Allulose 3-epimerase variant with improved thermal stability and uses thereof

Abstract

The present disclosure relates to: an enzyme protein comprising a mutated amino acid sequence and having activity for converting fructose into allulose; a recombinant microorganism comprising a gene coding for the enzyme protein; a composition for producing allulose comprising same; and a method for producing allulose using same.

Description

Allulose 3-epimerization mutant enzyme with improved thermostability and use thereof

[0001] The present invention provides an allulose 3-epimerization mutant enzyme protein having improved thermal stability, a recombinant microorganism comprising the same and / or a composition for producing allulose, and / or a method for producing allulose using the same.

[0002] Glucose is an essential sugar, used as an energy source by the body when consumed. However, excessive glucose intake can lead to obesity and diabetes. To overcome this, allulose (D-allulose, D-psicose) has recently emerged as a sugar source.

[0003] Allulose is produced by the epimerization of fructose (D-fructose). Its structure makes it difficult to use as an energy source when consumed, resulting in low calories. Its ability to inhibit glucose absorption, thus preventing blood sugar spikes, makes it an effective sugar for diabetes. Furthermore, it inhibits the enzymes involved in fat accumulation, preventing fat accumulation and thus functioning as an effective sugar for obesity. Furthermore, allulose can be converted into a material that has anticancer properties, and there are reports of similar effects on its own. Therefore, it is expected to expand its use as a sugar with health benefits.

[0004] Additionally, it has 70% the sweetness of sugar, making it a sugar that maintains an appropriate level of sweetness when consumed. Therefore, it is widely used as a functional sugar and is widely used in low-calorie beverages.

[0005] Since the functionality of allulose was confirmed, research has continued on methods to convert fructose to allulose. Research is also being conducted on methods to produce allulose using glucose, which has a lower cost than fructose. Regarding the conversion of fructose to allulose, research is being conducted on allulose epimerases derived from Agrobacterium tumefaciense, Clostridium cellulolyticum, and Clostridium boleae; tagatose epimerases derived from Pseudomonas chichori and Rhodobacter sphaeroides; and enzymes derived from microorganisms such as Arthrobacter gloformis, Staphylococcus aureus, Mesorhizobium loti, and Methylonmonus sp. Recently, research has been conducted on the production of allulose through multienzymatic conversion using glucose or starch to reduce the cost of production.

[0006] Allulose production typically involves the epimerization of the hydroxyl moiety at the 3-carbon atom of fructose. The enzymatic reaction typically achieves a 70:30 ratio of fructose to substrate conversion. Therefore, the maximum conversion rate for allulose is typically around 30%.

[0007] However, numerous reports have confirmed that increasing the temperature of the conversion reaction increases the conversion rate of allulose. Therefore, by ensuring enzyme thermal stability and enhancing enzyme stability, it is possible to increase the conversion rate by increasing the temperature of the conversion reaction.

[0008] Accordingly, this study aimed to increase allulose productivity by studying mutations that increase enzyme thermostability and finding enzyme mutants with increased thermostability through increased activity and thermostability.

[0009] An object of the present invention is to provide an allulose 3-epimerase protein having improved thermostability and allulose conversion activity, a polynucleotide encoding the mutant enzyme protein, a recombinant vector comprising the polynucleotide, or a recombinant microorganism comprising the polynucleotide or the recombinant vector.

[0010] Another object of the present invention is to provide a composition for producing allulose, comprising at least one selected from the group consisting of the enzyme protein, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, and extracts thereof.

[0011] Another object of the present invention is to provide a method for producing allulose, comprising a step of reacting at least one selected from the group consisting of the enzyme protein, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, and an extract thereof with a substrate.

[0012] Another object of the present invention is to provide a use for producing allulose of a composition comprising at least one selected from the group consisting of the enzyme protein, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, and an extract thereof.

[0013] Another object of the present invention is to provide a use for producing a composition for producing allulose using the enzyme protein, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, or an extract thereof.

[0014] One example of the present invention provides an allulose 3-epimerase protein comprising an amino acid sequence having at least 80% sequence identity with the amino acid sequence of SEQ ID NO: 1, wherein an amino acid corresponding to some amino acids of the amino acid sequence of SEQ ID NO: 1 is substituted.

[0015] Specifically, the enzyme protein comprises an amino acid sequence having the N-terminus of SEQ ID NO: 1,

[0016] (1) The amino acids corresponding to the 23rd and 267th amino acids are substituted with isoleucine (I) and lysine (K), respectively;

[0017] (2) At least one amino acid selected from the group consisting of amino acids corresponding to the 67th, 68th, 77th, 106th, 132nd, 142nd, 170th, 174th, 192nd, 232nd, 278th and 285th amino acids,

[0018] It may be an allulose 3-epimerase protein substituted with one or more amino acids selected from the group consisting of Leucine (L), Asparagine (N), Alanine (A), Valine (V), Glutamine (Q), Glutamic Acid (E), Isoleucine (I), Threonine (T), Glycine (G), and Proline (P).

[0019] Another example of the present invention provides a polynucleotide encoding the enzyme protein,

[0020] Specifically, from the N-terminus of the amino acid sequence of SEQ ID NO: 1 in an amino acid sequence having at least 80% sequence identity with the amino acid sequence of SEQ ID NO: 1,

[0021] (1) The amino acids corresponding to the 23rd and 267th amino acids are substituted with isoleucine (I) and lysine (K), respectively;

[0022] (2) At least one amino acid selected from the group consisting of amino acids corresponding to the 67th, 68th, 77th, 106th, 132nd, 142nd, 170th, 174th, 192nd, 232nd, 278th and 285th amino acids,

[0023] A polynucleotide encoding an enzyme protein comprising an amino acid sequence substituted with at least one amino acid selected from the group consisting of Leucine (L), Asparagine (N), Alanine (A), Valine (V), Glutamine (Q), Glutamic Acid (E), Isoleucine (I), Threonine (T), Glycine (G), and Proline (P) is provided.

[0024] Another example of the present invention provides a recombinant vector comprising the polynucleotide.

[0025] Another example of the present invention provides a recombinant microorganism comprising a polynucleotide encoding the enzyme protein or a recombinant vector comprising the same.

[0026] The above microorganism may be at least one microorganism selected from the group consisting of, but is not limited to, a strain of the genus Escherichia coli, a strain of the genus Bacillus (e.g., Bacillus subtilis), a strain of the genus Corynebacterium (e.g., Corynebacterium glutamicum), a strain of the genus Saccharomyces (e.g., Saccharomyces cerevisiae), and a strain of the genus Pichia (e.g., Pichia pastoris).

[0027] Another example of the present invention provides a composition for producing allulose, comprising at least one selected from the group consisting of the enzyme protein, cells of a recombinant microorganism expressing the enzyme protein, a cell lysate of the microorganism, a culture of the microorganism, and extracts thereof.

[0028] Another example of the present invention provides a method for producing allulose, comprising a step of reacting at least one selected from the group consisting of the enzyme protein, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, and an extract thereof with a substrate.

[0029] The enzyme protein according to the present invention is an allulose 3-epimerase protein comprising an amino acid sequence having 80% or more sequence identity with the amino acid sequence of SEQ ID NO: 1, from the N-terminus of the amino acid sequence of SEQ ID NO: 1,

[0030] (1) The amino acids corresponding to the 23rd and 267th amino acids are substituted with isoleucine (I) and lysine (K), respectively;

[0031] (2) At least one amino acid selected from the group consisting of amino acids corresponding to the 67th, 68th, 77th, 106th, 132nd, 142nd, 170th, 174th, 192nd, 232nd, 278th and 285th amino acids,

[0032] Contains an amino acid sequence substituted with at least one amino acid selected from the group consisting of Leucine (L), Asparagine (N), Alanine (A), Valine (V), Glutamine (Q), Glutamic Acid (E), Isoleucine (I), Threonine (T), Glycine (G), and Proline (P),

[0033] Compared to an enzyme protein comprising an amino acid sequence in which the 23rd and 267th amino acids from the N-terminus in the amino acid sequence of sequence number 1 are substituted with isoleucine (I) and lysine (K), respectively, it has improved thermostability and allulose conversion activity.

[0034]

[0035] Hereinafter, the present invention will be described in more detail.

[0036]

[0037] Allulose 3-epimerase protein

[0038] One example of the present invention is an allulose 3-epimerase protein comprising an amino acid sequence having at least 80% sequence identity with the amino acid sequence of SEQ ID NO: 1, from the N-terminus of the amino acid sequence of SEQ ID NO: 1,

[0039] (1) The amino acids corresponding to the 23rd and 267th amino acids are substituted with isoleucine (I) and lysine (K), respectively;

[0040] (2) At least one amino acid selected from the group consisting of amino acids corresponding to the 67th, 68th, 77th, 106th, 132nd, 142nd, 170th, 174th, 192nd, 232nd, 278th and 285th amino acids,

[0041] An allulose 3-epimerase protein is provided, comprising an amino acid sequence substituted with at least one amino acid selected from the group consisting of Leucine (L), Asparagine (N), Alanine (A), Valine (V), Glutamine (Q), Glutamic Acid (E), Isoleucine (I), Threonine (T), Glycine (G), and Proline (P).

[0042] Specifically, the substituted amino acid sequence is from the N-terminus of the amino acid sequence of SEQ ID NO: 1,

[0043] (1) Substitution of the amino acid corresponding to the 23rd alanine with isoleucine and substitution of the amino acid corresponding to the 267th glutamic acid with lysine, and

[0044] (2) Substitution of the amino acid corresponding to the 67th serine (Serine; S) with threonine, substitution of the amino acid corresponding to the 68th glycine with proline, substitution of the amino acid corresponding to the 77th proline with isoleucine, substitution of the amino acid corresponding to the 106th isoleucine with leucine, substitution of the amino acid corresponding to the 132nd valine with leucine, substitution of the amino acid corresponding to the 142nd serine with asparagine, substitution of the amino acid corresponding to the 142nd serine with alanine, substitution of the amino acid corresponding to the 170th aspartame with glycine, substitution of the amino acid corresponding to the 174th leucine with valine, substitution of the amino acid corresponding to the 192nd alanine with threonine, substitution of the amino acid corresponding to the 192nd alanine with glutamine, substitution of the amino acid corresponding to the 232nd glycine with glutamic acid, substitution of the amino acid corresponding to the 278th aspartame with glutamine, 285 It may include, but is not limited to, one or more selected from the group consisting of a substitution of an amino acid corresponding to serine with glutamic acid and a substitution of an amino acid corresponding to serine at position 285 with asparagine.

[0045] Specifically, the substituted amino acid sequence is from the N-terminus of the amino acid sequence of SEQ ID NO: 1,

[0046] (1) Substitution of the amino acid corresponding to the 23rd alanine with isoleucine and substitution of the amino acid corresponding to the 267th glutamic acid with lysine, and

[0047] (2) It may include, but is not limited to, a substitution of the amino acid corresponding to the 106th isoleucine with leucine, a substitution of the amino acid corresponding to the 142nd serine with asparagine, a substitution of the amino acid corresponding to the 142nd serine with alanine, a substitution of the amino acid corresponding to the 174th leucine with valine, a substitution of the amino acid corresponding to the 278th aspartame with glutamine, a substitution of the amino acid corresponding to the 285th serine with glutamic acid, or a substitution of the amino acid corresponding to the 285th serine with asparagine.

[0048] Specifically, the substituted amino acid sequence is from the N-terminus of the amino acid sequence of SEQ ID NO: 1,

[0049] (1) Substitution of the amino acid corresponding to the 23rd alanine with isoleucine, substitution of the amino acid corresponding to the 267th glutamic acid with lysine, and substitution of the amino acid corresponding to the 278th aspartame with glutamine, or substitution of the amino acid corresponding to the 23rd alanine with isoleucine, substitution of the amino acid corresponding to the 267th glutamic acid with lysine, and substitution of the amino acid corresponding to the 285th serine with glutamic acid, and

[0050] (2) It may include, but is not limited to, a substitution of the amino acid corresponding to the 106th isoleucine with leucine, a substitution of the amino acid corresponding to the 132nd valine with leucine, a substitution of the amino acid corresponding to the 142nd serine with asparagine, a substitution of the amino acid corresponding to the 170th aspartame with glycine, a substitution of the amino acid corresponding to the 192nd alanine with threonine, a substitution of the amino acid corresponding to the 192nd alanine with glutamine, or a substitution of the amino acid corresponding to the 232nd glycine with glutamic acid.

[0051] Specifically, the substituted amino acid sequence is from the N-terminus of the amino acid sequence of SEQ ID NO: 1,

[0052] (1) Substitution of the amino acid corresponding to the 23rd alanine with isoleucine, substitution of the amino acid corresponding to the 106th isoleucine with leucine, substitution of the amino acid corresponding to the 267th glutamic acid with lysine, and substitution of the amino acid corresponding to the 285th serine with glutamic acid, and

[0053] (2) It may include, but is not limited to, a substitution of the amino acid corresponding to the 67th serine (Serine; S) with threonine, a substitution of the amino acid corresponding to the 68th glycine with proline, or a substitution of the amino acid corresponding to the 142nd serine with asparagine.

[0054] One example of the present invention provides an allulose 3-epimerase protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.9%, 99%, 99.3%, or 99.5% sequence identity or homology with the amino acid sequence of SEQ ID NO: 1, wherein the amino acids corresponding to the 23rd and 267th amino acids from the N-terminus of the amino acid sequence of SEQ ID NO: 1 are substituted with isoleucine (I) and lysine (K), respectively.

[0055] Specifically, the allulose 3-epimerase protein provided by the present invention is an allulose 3-epimerase protein comprising an amino acid sequence having a sequence identity or homology of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.9%, 99%, 99.3%, or 99.5% with the amino acid sequence of SEQ ID NO: 1, from the N-terminus of the amino acid sequence of SEQ ID NO: 1,

[0056] (1) The amino acids corresponding to the 23rd and 267th amino acids are substituted with isoleucine (I) and lysine (K), respectively;

[0057] (2) At least one amino acid selected from the group consisting of amino acids corresponding to the 67th, 68th, 77th, 106th, 132nd, 142nd, 170th, 174th, 192nd, 232nd, 278th and 285th amino acids,

[0058] substituted with one or more amino acids selected from the group consisting of Leucine (L), Asparagine (N), Alanine (A), Valine (V), Glutamine (Q), Glutamic Acid (E), Isoleucine (I), Threonine (T), Glycine (G), and Proline (P),

[0059] The above enzyme protein may be excluded if it is an enzyme protein having an amino acid sequence in which the 23rd amino acid in the amino acid sequence of sequence number 1 is substituted with isoleucine (I) and the 267th amino acid is substituted with lysine (K), i.e., an enzyme protein having two or fewer mutations.

[0060] An example of the present invention is an allulose 3-epimerase protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.9%, 99%, 99.3%, or 99.5% sequence identity or homology with the amino acid sequence of SEQ ID NO: 1, from the N-terminus of the amino acid sequence of SEQ ID NO: 1,

[0061] (1) The amino acids corresponding to the 23rd and 267th amino acids are substituted with isoleucine (I) and lysine (K), respectively;

[0062] (2) At least one amino acid selected from the group consisting of amino acids corresponding to the 67th, 68th, 77th, 106th, 132nd, 142nd, 170th, 174th, 192nd, 232nd, 278th and 285th amino acids,

[0063] Provided is an allulose 3-epimerase protein substituted with at least one amino acid selected from the group consisting of Leucine (L), Asparagine (N), Alanine (A), Valine (V), Glutamine (Q), Glutamic Acid (E), Isoleucine (I), Threonine (T), Glycine (G), and Proline (P).

[0064] The above enzyme protein may be excluded if it is an enzyme protein having an amino acid sequence in which the 23rd amino acid from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is substituted with isoleucine (I) and the 267th amino acid is substituted with lysine (K), i.e., an enzyme protein having two or fewer mutations.

[0065] Comparison of identity and homology can be performed by calculating the identity and homology between two or more sequences as a percentage (%) using a commercially available computer program.

[0066] It is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, or added is also included within the scope of the present application, as long as it has the identity or homology mentioned in the present invention and exhibits an activity corresponding to the enzyme protein. That is, even if the present application describes "a protein having or including an amino acid sequence described by a specific sequence number," it is obvious that a protein having (or including) an amino acid sequence in which some sequences are deleted, modified, substituted, or added can also be used in the present application, as long as it has the same or corresponding activity as a protein consisting of the amino acid sequence of the corresponding sequence number.

[0067] In the present invention, the "corresponding amino acid" refers to an amino acid residue at a corresponding position in an allulose 3-epimerase protein, or an amino acid residue that is similar, identical, or homologous to the amino acid residue at that position. Identifying the amino acid at the corresponding position may determine a specific amino acid of a sequence that references a specific sequence. In the present invention, the "corresponding position" generally refers to a similar or corresponding position in the amino acid sequence of a related protein or a reference sequence. For example, any amino acid sequence may be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence may be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, the position of the corresponding amino acid, or the position where a modification such as a substitution, insertion, or deletion occurs, may be identified by comparing it with a query sequence (also referred to as a "reference sequence") using a sequence alignment algorithm known in the art.

[0068]

[0069] Recombinant microorganism and composition for allulose production

[0070] Another example of the present invention provides a recombinant microorganism comprising a polynucleotide encoding the enzyme protein or a recombinant vector comprising the same.

[0071] The above microorganism may be at least one microorganism selected from the group consisting of, but is not limited to, a strain of the genus Escherichia coli, a strain of the genus Bacillus (e.g., Bacillus subtilis), a strain of the genus Corynebacterium (e.g., Corynebacterium glutamicum), a strain of the genus Saccharomyces (e.g., Saccharomyces cerevisiae), and a strain of the genus Pichia (e.g., Pichia pastoris).

[0072] Another example of the present invention provides a composition for producing allulose, comprising at least one selected from the group consisting of the enzyme protein, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, and an extract thereof.

[0073] The culture medium contains an enzyme produced from the recombinant microorganism, and may be a cell-free form containing the microorganism or not containing the microorganism. In addition, the lysate contains a lysate obtained by crushing cells of the recombinant microorganism or a supernatant obtained by centrifuging the lysate, and an enzyme produced from the recombinant microorganism.

[0074] In this specification, unless otherwise stated, the recombinant microorganism used for the production of allulose is used to mean at least one selected from the group consisting of a cell of the microorganism, a culture of the strain, and a lysate of the strain.

[0075] Since the enzyme protein of the present invention can be activated by metal ions, when producing allulose using the Escherichia genus strain, the conversion efficiency from fructose to allulose, i.e., the allulose production rate, can be increased by adding metal ions. Therefore, a composition for producing allulose, including at least one selected from the group consisting of the enzyme protein, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, and an extract thereof, or a composition for producing allulose using a microorganism producing the same, may further comprise a metal ion. In addition, the method for producing allulose using the enzyme protein may further comprise a step of adding a metal ion.

[0076] The metal ion may be at least one selected from the group consisting of manganese ions, magnesium ions, nickel ions, cobalt ions, etc., and in one example, the metal ion may be manganese ions, magnesium ions, nickel ions, cobalt ions, or a mixture thereof.

[0077] The amount of the metal ion added may be in the range of 0.5 mM to 5 mM, 0.5 mM to 4 mM, 0.5 mM to 3 mM, for example, 0.5 mM to 2 mM, taking into account the effect of increasing the yield of allulose production.

[0078]

[0079] Allulose conversion activity and thermal stability

[0080] In the enzymatic reaction of the enzyme protein of the present invention, the allulose conversion activity can be measured using cells of a microorganism (recombinant microorganism) expressing the enzyme, a culture medium in which the cells are cultured, and / or a supernatant obtained by centrifugation of the culture medium. Specifically, the measurement can be performed using cells obtained after reacting the cells with a substrate, a culture medium in which the cells are cultured, and / or a supernatant obtained by centrifugation of the culture medium. The substrate may be at least one selected from the group consisting of fructose, allulose, tagatose, xylose, sorbose, ribulose, and ketose, but is not limited thereto.

[0081] The bacterial cell used to confirm allulose conversion activity in the enzymatic reaction of the above enzyme protein may be a bacterial cell of an Escherichia genus strain (e.g., Escherichia Coli), but is not limited thereto.

[0082] In the substrate conversion reaction using the enzyme protein or the microbial cell producing the enzyme protein, the allulose conversion activity of the enzyme protein of the composition for producing allulose according to the present invention is 102% or more, 105% or more, 107% or more, 110% or more, 112% or more, 115% or more, 117% or more, 120% or more, 125% or more, 130% or more, 135% or more, 140% or more, 145% or more, 150% or more, 155% or more, 160% or more, 165% or more, 170% or more, based on 100% of the allulose conversion activity of the enzyme protein comprising an amino acid sequence in which the 23rd amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is substituted with isoleucine (I) and the 267th amino acid is substituted with lysine (K). 102% to 200%, 105% to 200%, 107% to 200%, 110% to 200%, 112% to 200%, 115% to 200%, 117% to 200%, 120% to 200%, 125% to 200%, 130% to 200%, 135% to 200%, 140% to 200%, 145% to 200%, 150% to 200%, 155% to 200%, 160% to 200%, 165% to 200%, 170% to 200%, for example, 105%, 110%, 115%, 120%, The activity may be, but is not limited to, 130%, 135%, 150%, or 170%. The enzyme activity evaluation using the microbial cells or enzyme proteins producing the enzyme may be performed by performing a substrate conversion reaction at 70°C for 30 minutes using the microbial cells expressing the enzyme protein, or by performing a substrate conversion reaction at 70°C for 30 minutes using a purified enzyme obtained by crushing the microbial cells producing the enzyme.

[0083] The thermal stability of the enzyme protein of the present invention (a microorganism expressing the enzyme protein) or the composition for producing allulose of the present invention can be confirmed by comparing the cell of the microorganism (recombinant microorganism) expressing the enzyme protein, the culture medium in which the cell is cultured, and / or the supernatant obtained by centrifuging the culture medium after the heat treatment reaction with the allulose conversion activity before the heat treatment of 100%, and measuring the half-life of the enzyme protein at the point where the activity becomes 50%, but is not limited thereto.

[0084] The bacterial cell used to confirm allulose conversion activity in the enzymatic reaction of the above enzyme protein may be a bacterial cell of an Escherichia genus strain (e.g., Escherichia Coli), but is not limited thereto.

[0085] The above heat stability confirmation may be accomplished by performing heat treatment at 80°C for 30 minutes, 1 hour, 90 minutes, 3 hours, 5 hours, or 7 hours using a purified enzyme obtained by crushing a microbial cell expressing the enzyme protein that produces the enzyme or a microbial cell that produces the enzyme.

[0086] The half-life (hr) of the enzyme protein of the present invention or the enzyme protein of the composition for producing allulose of the present invention is, under heat treatment conditions at 80°C, based on 100% of the half-life of the enzyme protein comprising the amino acid sequence of SEQ ID NO: 1, 600% or more, 800% or more, 1,000% or more, 1,200% or more, 1,400% or more, 1,600% or more, 1,800% or more, 2,000% or more, 2,200% or more, 2,400% or more, 2,600% or more, 2,800% or more, 3,000% or more, 3,200% or more, 3,400% or more, 3,600% or more, 3,800% or more, 4,000% or more, 600% to 5,000%, 800% to 5,000%, 1,000% to 5,000%, 1,200% to 5,000%, 1,400% to 5,000%, 1,600% to 5,000%, 1,800% to 5,000%, 2,000% to 5,000%, 2,200% to 5,000%, 2,400% to 5,000%, 2,600% to 5,000%, 2,800% to 5,000%, 3,000% to 5,000%, 3,200% to 5,000%, 3,400% to 5,000%, 3,600% to 5,000%, 3,800% to 5,000% or 4,000% to 5,000%, such as, but not limited to, about 621%, 675%, 756%, 810%, 972%, 1069.2%, 1080%, 1458%, 1836%, 1944%, 2430%, 2478.6%, 2937.6%, 3304.8%, 3855.6% or 4039.2%.

[0087] The half-life (hr) of the enzyme protein of the present invention or the enzyme protein of the composition for producing allulose of the present invention is, under heat treatment conditions at 80°C, 110% or more, 120% or more, 130% or more, 140% or more, 150% or more, 160% or more, 170% or more, 180% or more, 190% or more, 200% or more, 250% or more, 300% or more, 400% or more, 450% or more, 500% or more, 550% or more, 600% or more, 650% or more, 700% or more, based on 100% of the half-life of the enzyme protein comprising an amino acid sequence in which the 23rd amino acid is substituted with isoleucine (I) and the 267th amino acid is substituted with lysine (K) from the N-terminus of the amino acid sequence of SEQ ID NO: 1. 110% to 800%, 120% to 800%, 130% to 800%, 140% to 800%, 150% to 800%, 160% to 800%, 170% to 800%, 180% to 800%, 190% to 800%, 200% to 800%, 250% to 800%, 300% to 800%, 400% to 800%, 450% to 800%, 500% to 800%, 550% to 800%, 600% to 800%, 650% to 800%, 700% to 800%, for example, 115%, 125%, This may be, but is not limited to, 140%, 150%, 180%, 198%, 200%, 270%, 340%, 360%, 450%, 459%, 544%, 612%, 714% or 748%.

[0088]

[0089] Allulose production method

[0090] Another example of the present invention provides a method for producing allulose, comprising a step of reacting at least one selected from the group consisting of the enzyme protein, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, and an extract thereof with a substrate.

[0091] The above substrate may be at least one selected from the group consisting of fructose, allulose, tagacose, xylose, sorbose, ribulose, and ketose, but is not limited thereto.

[0092] The above reaction may include, but is not limited to, contacting a medium containing at least one selected from the group consisting of fructose, allulose, tagacose, xylose, sorbose, ribulose, and ketose with at least one selected from the group consisting of the enzyme protein, a recombinant microorganism expressing the enzyme protein, cells of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, and extracts thereof.

[0093]

[0094] Another object of the present invention is to provide a use for producing allulose of a composition comprising at least one selected from the group consisting of the enzyme protein, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, and an extract thereof.

[0095] Another object of the present invention is to provide a use for producing a composition for producing allulose using the enzyme protein, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, or an extract thereof.

[0096] The enzyme protein, recombinant microorganism, microbial cells, lysates, cultures, extracts, allulose production, etc. are as described above.

[0097] The present invention relates to an enzyme protein having allulose 3-epimerization activity in which a specific amino acid is mutated, a recombinant microorganism comprising the same, a composition for producing allulose, or a method for producing allulose using the same, which has a high conversion activity from fructose to allulose and excellent heat stability.

[0098] Figure 1 is a schematic diagram of a recombinant vector in which a D-allulose 3-epimerase gene according to an example of the present invention is cloned into the vector.

[0099] The present invention will be described in more detail with reference to the following examples, but the scope of the invention is not intended to be limited to the following examples.

[0100]

[0101] Example 1. Cloning of D-allulose 3-epimerase gene

[0102] Example 1-1. Preparation of enzyme genes

[0103] D-tagatose 3-epimerase, identified from Microbacterium foliorum (SY27B-MF; Accession No.: KCCM11774P), was expressed in Escherichia coli to confirm enzyme activity and synthesize its DNA sequence to identify mutants with improved thermostability. The amino acid sequence of the protein was synthesized with codons optimized for E. coli to ensure proper expression in E. coli.

[0104] The gene sequence obtained through codon optimization was synthesized by Integrated DNA Technologies (IDT, USA). The synthesized gene was named MDPE, and information on the codon-optimized gene is shown in Table 1 below. The amino acid sequence of the MDPE gene corresponds to SEQ ID NO: 1, and the base sequence corresponds to SEQ ID NO: 2.

[0105]

[0106]

[0107] Example 1-2. Production of vector containing enzyme genes

[0108] The polynucleotide of MDPE synthesized by codon optimization for expression in E. coli of Example 1-1 above was amplified by PCR (Polymerase Chain Reaction). Specifically, a gene amplification (Polymerase Chain Reaction, PCR) reaction solution with a final volume of 50 μl containing 50 ng of the synthesized MDPE gene, 10 pmol of forward primer (base sequence of SEQ ID NO: 3) for each amino acid residue, 10 pmol of reverse primer (base sequence of SEQ ID NO: 4), 1 μl of Phusion polymerase, 10 μl of reaction buffer (5X), and 1 μl of 10 mM dNTP was prepared and amplified by PCR, and the sequence information of the primers used is shown in Table 2 below.

[0109] Type Base Sequence (5' -> 3') Sequence Number MDPE_Cloning_For_PrimerCCATGATTACGCCAAGCTTATGAACATCGGTTGCCACG3 MDPE_Cloning_Rev_PrimerCGGTACCCGGGGATCCTAGCAGCCGGATCTCAGTGCAGACGGATAGAGTC4

[0110]

[0111] Specifically, using the above PCR reaction solution, a PCR reaction was performed in a GeneAmp PCR system 9700, including one cycle at 98°C (30 seconds), 18 cycles of [98°C (10 seconds), 55°C (30 seconds), 72°C (2 minutes 30 seconds)], and one cycle at 72°C (5 minutes), to secure a large amount of genes after gene amplification.

[0112] The pUC19 vector (NEB, New England Biolab) was cut using restriction enzymes HindIII and BamHI, and the amplified gene and pUC19 vector were ligated to the restriction enzyme sites using 2XHiFi DNA master mix (NEB) to construct a pUC19 / allulose 3-epimerase recombinant vector (pUC19_MDPE). A schematic diagram of the constructed recombinant vector is shown in Fig. 1. The constructed recombinant vector was transformed into E. coli DH10b competent cells (TRANS, Trans10) using a heat shock method to produce a recombinant microorganism (DH10b pUC19_MDPE).

[0113]

[0114] Example 2. Preparation of the first mutant enzyme

[0115] Based on the analysis of amino acid sequences between homologous genes and the analysis of the 3D structure model of the active site and metal binding site, the selected amino acids were substitutionally mutated into other amino acids using site-directed mutagenesis (SDM) and saturation mutagenesis methods.

[0116]

[0117] Example 2-1. Site-directed mutagenesis (SDM)

[0118] Among the epimerization enzymes, the sequences of which were confirmed were D-allulose 3-epimerases from Agrobacterium tumefaciense, Clostridium cellulolyticum, and Methylomonus sp. The sequences were analyzed to identify homologous regions, and the mutation locations according to the homologous regions were identified.

[0119] Specifically, as a result of comparing the homology of epimerization enzymes, it was confirmed that the amino acid at position 23 in the enzyme was Isoleucine (I) from D-allulose 3-epimers derived from Agrobacterium tumefaciense, Clostridium cellulolyticum, and Methylomonus sp, and was selected as the mutation site. The selected site was confirmed to maintain the structural activity of the enzyme using the Protein Data Bank database.

[0120] The substitution mutation of MDPE of Example 1 was produced by inducing mutations using site-directed mutagenesis (SDM) using Quikchange® (Stratagene) applied from previous studies. Stratagene's Quikchange® site-directed mutagenesis method uses a method in which the entire plasmid DNA is amplified through PCR and the template DNA is digested with the DpnI enzyme, rather than a method in which the gene corresponding to the enzyme part is amplified through PCR and subcloned into plasmid DNA. Quikchange® site-directed mutagenesis has the advantage of being able to induce mutations more quickly.

[0121] pUC19_MDPE of Example 1-2 was used as the template DNA for replication for the MDPE substitution mutation of Example 1. A final volume of 50 μl of a gene amplification (Polymerase Chain Reaction, PCR) reaction solution containing 10 ng of pUC19_MDPE, 10 pmol of forward primer (base sequence of SEQ ID NO: 5) for amino acid residue (I23), 10 pmol of reverse primer (base sequence of SEQ ID NO: 6), 1 μl of Phusion polymerase, 10 μl of reaction buffer (5X), and 1 μl of 10 mM dNTP was prepared, and amplification was performed by PCR, and the primer information used is shown in Table 3 below.

[0122] Type base sequence (5' -> 3') SEQ ID NO:MDPE_A23I_Cloning_For_Primergacggtatccgtctgtctattgaacagaccaaagcggc5MDPE_A23I_Cloning_Rev_Primergccgctttggtctgttca atagacagacggataccgtc6MDPE_Mut_For_Primergaccatgattacgccaagcttatg7MDPE_Mut_Rev_Primercggtacccggggatcctagcagccggatctcagtg8

[0123]

[0124] Specifically, using the above PCR reaction solution, a PCR reaction was performed in a GeneAmp PCR system 9700, including one cycle at 98°C (30 seconds), 18 cycles of [98°C (10 seconds), 55°C (30 seconds), 72°C (2 minutes 30 seconds)], and one cycle at 72°C (5 minutes), to secure a large amount of genes after gene amplification.

[0125] DpnI (10 Unit / μl, NEB), an enzyme that recognizes and degrades non-mutated template DNA, was added at 1 μl to a 50 μl reaction solution after PCR and treated at 37°C for 3 hours. After the treatment, the pUC19_MDPE_A23I (A23I mutation) gene that had undergone PCR treatment was transformed into E. coli DH10b using the MDPE_A23I_Cloning primer in a manner substantially identical to the method for producing the recombinant strain DH10b pUC19_MDPE of Example 1-2, thereby obtaining a DH10b pUC19_MDPE_A23I recombinant microorganism.

[0126] To confirm the enzyme mutations in the above-mentioned recombinant strain, the amino acid sequence alignment of the wild type enzyme and the NCBI website (BLAST) tool were used for comparison.

[0127]

[0128] Example 2-2. Mutagenesis through error-prone PCR

[0129] Error prone PCR was used to create mutants by inducing mutations during the gene amplification process. Specifically, to create mutants, pUC19_MDPE_A23I prepared in Example 2-1 was used as a template DNA, and 10 ng of the template DNA, 10 pmol of the forward primer (base sequence of SEQ ID NO: 9) for amino acid residues, 10 pmol of the reverse primer (base sequence of SEQ ID NO: 10), 1 μl of Taq polymerase (Clontech), 5 μl of reaction buffer (10X TITANIUM Taq Buffer), 1 μl of diversify dNTP Mix, 1 μl of dGTP (2 mM), and 4 μl of MnSO4 were added, and PCR grade water was added to prepare a gene amplification (Polymerase Chain Reaction, PCR) reaction solution with a final volume of 50 μl, and amplified by PCR, and the primer information used is shown in Table 3 above.

[0130] Specifically, using the above PCR reaction solution, the reaction was repeated 25 times, including 30 seconds at 94°C, 1 minute at 68°C, 30 seconds at 94°C, and 1 minute at 68°C, after which the reaction was repeated 25 times, after which the reaction was performed at 68°C for 1 minute, in a GeneAmp PCR system 9700.

[0131] The gene amplified through mutagenesis was subjected to electrophoresis to secure a band at a desired location, and the secured gene band was extracted. The PCR-processed gene was transformed into E. coli DH10b using a method substantially identical to the method for producing the recombinant microorganism DH10b pUC19_MDPE of Example 1-2, thereby securing a recombinant microorganism.

[0132]

[0133] Example 2-3. Mutant screening using HTS (High-Throughput-Screening)

[0134] The transformed recombinant microorganism of Example 2-2 was obtained by spreading on LB ampicilline solid medium composed of Bacto Tryptone (Difco) 10 g / L, Yeast Extract (Difco) 5 g / L, NaCl (Daejung Chemical) 10 g / L, Ampicilline (Sigma) 100 mg / L, and Bactor Agar 20 g / L. The obtained colonies were subjected to primary selection using HTS.

[0135] After the first selection, 300 uL of LB-ampiciline liquid medium (Bacto Tryptone (Difco) 10 g / L, Yeast Extract (Difco) 5 g / L, NaCl (Daejung Chemical) 10 g / L, Ampicilline (Sigma) 100 mg / L) was inoculated into a 96-well (Greiner) multi-colony culture medium and cultured with shaking at 37°C and 200 rpm for 16 to 18 hours.

[0136] The enzyme activity of the shake-cultured cells was confirmed using the fructose-dehydrogenase assay. 75 μL of the culture solution obtained through the shaking culture was transferred to a 96-well plate, and an equal amount of 100 mM allulose substrate (100 mM Mcilvaine buffer pH 6.0) was added, followed by cell reaction at 60°C for 30 minutes.

[0137] After transferring 10 μL of the reaction solution in which fructose was generated from allulose through the reaction to a new 96-well plate, reaction solution A (150 mM Mcilvain buffer pH 4.5), reaction solution B (0.1 M potassium ferricyanide, 0.1% Triton X-100), and reaction solution C (0.1 M potassium ferricyanide, 0.1% Triton X-100, 0.05% BSA) were mixed in a volume ratio of 70:10:10, and then 90 μL was added to the reaction solution converted to fructose.

[0138] After this, the reaction was stopped by adding 50 μL of reaction solution D (1.25 mM Iron(III) sulfate hydrate, 0.3% SDS, 8% phosphoric acid) after incubation for 30 minutes at 37°C. After stopping the reaction, the absorbance was measured at 660 nm, and the strain with high absorbance was selected by comparing it with the recombinant strain DH10b pUC19_MDPE of Example 1-2 in which no enzyme mutation occurred.

[0139]

[0140] Example 2-4. Identification of mutant amino acid residues in mutant proteins

[0141] In the recombinant microorganisms selected in Example 2-3 above, amino acid residue mutations of the enzyme were confirmed, and microorganisms with confirmed A23I and E267K mutations were selected.

[0142] Specifically, the plasmid of the recombinant microorganism obtained in Example 2-3 was purified using a plasmid prep kit (GENALL), and then the gene sequence of the subcloned epimerization enzyme portion of the plasmid was transcribed into an amino acid sequence of the gene sequence through a sequence analysis service (Macrogen), and then the mutation location was confirmed by comparing it with the amino acid sequence of the wild enzyme (SEQ ID NO: 1), and the primer information used therefor is shown in Table 4 below.

[0143] Type sequence (5' -> 3') Sequence number M13F_PrimerGCGGATAACAATTTCACACAGG9 M13R_PrimerGTAAAACGACGGCCAGT10

[0144]

[0145] According to the above method, a microorganism containing an enzyme in which A23I and E267K mutations were confirmed among the enzymes in the recombinant microorganism was selected, and the selected DH10b pUC19_MDPE_A23I / E267K (A23I and E267K mutations) was prepared.

[0146] The positions of the mutated amino acids through the above reaction were confirmed by generating the three-dimensional structure of the enzyme through a template search of the Protein Data Bank (PDB) using a protein three-dimensional structure homology model through SWIISS-MODEL (http: / www.expasy.org / swissmod / SWIIS-MODEL.html), and the shape of the three-dimensional structure was confirmed.

[0147]

[0148] Example 3. Preparation of secondary mutant enzyme

[0149] Example 3-1. Site-directed mutagenesis (SDM)

[0150] In order to induce additional mutations using the plasmid DH10b pUC19_MDPE_A23I / E267K prepared in Example 2-4 as template DNA, the SDM method of Example 2-1 was used.

[0151] Specifically, for DH10b pUC19_MDPE_A23I / E267K prepared in Example 2-4, the purified plasmid pUC19_MDPE_A23I / E267K was prepared using a plasmid prep kit (GENALL) in substantially the same manner as in Example 2-4. The above-prepared pUC19_MDPE_A23I / E267K was used as a template DNA, and a final volume of 50 μl of a gene amplification (Polymerase Chain Reaction, PCR) reaction solution containing 10 ng of template DNA, 10 pmol of forward primer (base sequence of SEQ ID NO: 11, 13, 15, 17, 19, 21, or 23) for each amino acid residue, 10 pmol of reverse primer (base sequence of SEQ ID NO: 12, 14, 16, 18, 20, 22, or 24), 1 μl of Phusion polymerase, 10 μl of reaction buffer (5X), and 4 μl of 10 mM dNTP was prepared, and PCR amplification was performed, and the primer information used is shown in Table 5 below.

[0152] Type base sequence (5' -> 3') SEQ ID NO:MDPE_I106L_FGTCGTCACTTCTGGCGGTGTTTTGTACTCTGCGATGCAGAAATAC11MDPE_I106L_RGTATTTCTGCATCGCAGAGTACAAAACACCGCAGAAGTGACGAC12MDPE_V132L_FCGTCGTACCATCGCGCGTCTGGCGGACCACGCGGCGG13MDPE_V132L_RCCGCCGC GTGGTCCGCCAGACGCGCGATGGTACGACG14MDPE_A192T_FCATCGAAGAATCTGACATGTTCACCCCGGTTCTGGACGCGGC15MDPE_A192T_RGCCGCGTCCAGAACCGGGGTGAACATGTCAGATTCTTCGATG16MDPE_G232E_FCAAAGCGCTGGGTCGTATCGAATACGACGGTCCGATC GTTTTC17MDPE_G232E_RGAAAACGATCGGACCGTCGTATTCGATACGACCCAGCGCTTTG18MDPE_D170G_FGCGTACCTGGCGGAAGTTGGCCGTCCGAACCTGGGTATC19MDPE_D170G_RGATACCCAGGTTTCGGACGGCCAACTTCCGCCAGGTACGC20MDPE_L174V_FGGAAGTTGAC CGTCCGAACGTGGGTATCCACCTGGACACC21MDPE_L174V_RGGTGTCCAGGTGGATACCCACGTTCGGACGGTCAACTTCC22MDPE_D278Q_FCGAACGCGTACATCCGTCAGAAACTGGTTGCGGTTGACTC23MDPE_D278Q_RGAGTCAACCGCAACCAGTTTCTGACGGATGTACGCGTTCG24

[0153] (In Table 5 above, the underlined part indicates the base sequence part corresponding to the amino acid to be replaced.)

[0154] Specifically, using the above PCR reaction solution, Takara PCR Thermal Cycler Dice TMA PCR reaction was performed including one cycle at 98℃ (30 seconds), 25 cycles of [98℃ (10 seconds), 55℃ (30 seconds), 72℃ (2 minutes 30 seconds)], and one cycle at 72℃ (5 minutes) to secure a large amount of genes after gene amplification.

[0155] DpnI (10 Unit / μl, NEB), an enzyme that recognizes and degrades non-mutated template DNA, was added at 0.5 μl to 10 μl of a 50 μl reaction solution after PCR completion and treated at 37°C for 3 hours. After the treatment, each was transformed into E. coli DH10b using substantially the same method as the method for producing a recombinant strain of Example 1-2, thereby securing a recombinant strain.

[0156] To confirm the enzyme mutation in the above-mentioned manufactured recombinant strain, the plasmid was extracted and the gene sequence of the MDPE enzyme was sequenced and compared using the NCBI website (BLAST) tool and the amino acid sequence alignment of the wild type enzyme.

[0157]

[0158] Example 3-2. Saturation mutagenesis

[0159] Saturation mutagenesis is an experimental method that is similar to site-directed mutagenesis (SDM) in that it changes the amino acid at a designated position to several unspecified amino acids rather than to a designated amino acid by different primer designs.

[0160] Specifically, a recombinant strain was obtained by inducing mutations in substantially the same manner as in Example 3-1, except that the forward primer (base sequence of SEQ ID NO: 25 or 27) and reverse primer (base sequence of SEQ ID NO: 26 or 28) in Table 6 below were used.

[0161] Primers used in saturation mutagenesis were created by inserting codons of unspecified amino acids, such as NNN, as underlined in Table 6 below.

[0162] Type base sequence (5' -> 3') SEQ ID NO:MDPE_S142_Fcgcggcggaacgtggtatcrmngtttctctggaagttgttaacc25MDPE_S142_Rggttaacaacttccagagaaacnkygataccacgttcc gccgcg26MDPE_S285_Fcaaactggttgcggttgacranatccgtctgcacccccgg27MDPE_S285_Rccgggggtgcagacggatntygtcaaccgcaaccagtttg28

[0163]

[0164] Example 3-3. Confirmation of mutant amino acid residues

[0165] Amino acid residue mutations in the recombinant microorganism obtained in Example 3-1 and the recombinant microorganism obtained through saturation mutagenesis in Example 3-2 were confirmed.

[0166] Specifically, the plasmids of the recombinant microorganisms of Examples 3-1 and 3-2 were purified and secured using a plasmid prep kit (GENALL), and then the gene sequence of the subcloned epimerase portion of the plasmid was transcribed into the amino acid sequence of the gene sequence through a sequence analysis service (Macrogen), and then the mutation positions were confirmed by comparing them with the amino acid sequence of the wild species using the primers in Table 4 above.

[0167] The positions of the amino acids that were mutated through the above reaction were confirmed by generating the three-dimensional structure of the enzyme through a template search of the Protein Data Bank (PDB) using a protein three-dimensional structure homology model using SWIISS-MODEL (http: / www.expasy.org / swissmod / SWIIS-MODEL.html), and the shape of the three-dimensional structure was confirmed.

[0168] Accordingly, DH10b pUC19_MDPE_IK_I106L, DH10b pUC19_MDPE_IK_S142N, DH10b pUC19_MDPE_IK_S142A, DH10b pUC19_MDPE_IK_L174V, DH10b pUC19_MDPE_IK_D278Q (DH10b pUC19_MDPE_IKQ), DH10b pUC19_MDPE_IK_S285E (DH10b pUC19_MDPE_IKE) or DH10b were selected as microorganisms containing enzymes in which I106L, S142N, S142A, L174V, D278Q, S285E or S285N mutations were confirmed in addition to A23I and E267K mutations. pUC19_MDPE_IK_S285N microorganism was obtained.

[0169]

[0170] Example 4. Evaluation of the thermal stability of a strain producing a secondary mutant enzyme.

[0171] DH10b pUC19_MDPE_IK_I106L, DH10b pUC19_MDPE_IK_S142N, DH10b pUC19_MDPE_IK_S142A, DH10b pUC19_MDPE_IK_L174V, DH10b pUC19_MDPE_IK_D278Q (DH10b pUC19_MDPE_IKQ), DH10b pUC19_MDPE_IK_S285E (DH10b pUC19_MDPE_IKE) or DH10b selected as a microorganism containing an enzyme in which I106L, S142N, S142A, L174V, D278Q, S285E or S285N mutations were confirmed in addition to A23I and E267K mutations in Example 3-3 above. The thermal stability of pUC19_MDPE_IK_S285N was confirmed against microorganisms.

[0172] The thermostability was confirmed using the DH10b pUC19_MDPE_A23I / E267K (DH10b pUC19_MDPE_IK) microorganism containing the enzyme in which the A23I and E267K mutations of Example 2-4 were confirmed as a control.

[0173] Specifically, the recombinant microorganisms were cultured by spreading on LB ampicilline solid medium composed of 10 g / L Bacto Tryptone (Difco), 5 g / L Yeast Extract (Difco), 10 g / L NaCl (Daejung Chemical), 100 mg / L Ampicilline (Sigma), and 20 g / L Bactor Agar. One colony was taken from the solid culture result, inoculated into 3 ml of LB ampicilline liquid medium (composition of 10 g / L Bacto Tryptone (Difco), 5 g / L Yeast Extract (Difco), 10 g / L NaCl (Daejung Chemical), and 100 mg / L Ampicilline (Sigma), and then cultured with shaking at 37°C and 250 rpm for 16 to 18 hours. After the above bacterial culture was performed, the microbial cells were harvested when the OD600nm reached 2 to 3.

[0174] The recovered cells were diluted with 50 mM PIPES buffer solution (pH 6.0) containing 1 mM manganese ion to a cell concentration of 1 mg (dcw) / mL, and heat-treated at 80°C for 30 minutes, 1 hour, 90 minutes, 3 hours, 5 hours, or 7 hours. Then, fructose substrate was added to a final concentration of 400 g / L, and a conversion reaction from fructose to allulose was performed at 70°C for 30 minutes.

[0175] After the conversion reaction, the supernatant was recovered by centrifugation (13,000 rpm, 10 min), and high-performance liquid chromatography (HPLC) analysis was performed. The HPLC analysis was performed using a RID (Refractive Index Detector, Agilent 1280 RID) of HPLC (Agilent, USA) equipped with a Cosmosil Sugar D column. The mobile phase solvent used was 80% (v / v) acetonitrile, and the temperature and flow rate were 35°C and 1.0 mL / min, respectively. Based on the conversion activity measured over time through the HPLC analysis, the activity half-life was converted to confirm the level of thermal stability of the mutant based on 100% activity before the heat treatment reaction, and the point at which the mutant activity became 50% was measured as the half-life, and the results are shown in Table 7 below.

[0176] The values ​​listed in Table 7 below are the half-life values ​​of each microorganism calculated as a percentage (%) based on the half-life time at 80℃ of the DH10b pUC19_MDPE_IK microorganism as 100%.

[0177] Strain thermal stability comparison value (%) DH10b pUC19_MDPE_IK100DH10b pUC19_MDPE_IK_I106L150DH10b pUC19_MDPE_IK_S142N115DH10b pUC19_MDPE_IK_S142A125DH10b pUC19_MDPE_IK_L174V140DH10b pUC19_MDPE_IK_D278Q (IKQ)180DH10b pUC19_MDPE_IK_S285E (IKE)340DH10b pUC19_MDPE_IK_S285N200

[0178]

[0179] As a result of measuring the above half-life, it was confirmed that the half-life of a microorganism with additional mutations increased compared to a microorganism with double mutations of A23I and E267K, confirming that the thermostability increased. In particular, it was confirmed that the thermostability of a microorganism with additional mutations of D278Q, S285E, or S285N increased significantly.

[0180]

[0181] Example 5. Preparation and thermal stability evaluation of the 3rd mutant enzyme (1)

[0182] Example 5-1. Production and screening of additional mutants of D-allulose 3-epimerase in DH10b pUC19_MDPE_IKQ microorganism.

[0183] In Example 4, MDPE_IKQ, which was selected for its excellent enzyme thermostability, was used as a template DNA to undergo mutagenesis via site-directed mutagenesis (SDM). This process involves additional mutations to the primary mutation, MDPE_IK_D278Q, allowing for the confirmation of the double mutation effect.

[0184] Specifically, for DH10b pUC19_MDPE_IKQ prepared in Example 4 above, a purified plasmid pUC19_MDPE_IK_D278Q was prepared using a plasmid prep kit (GENALL) in substantially the same manner as in Example 2-4 above.

[0185] Using the above-prepared plasmid pUC19_MDPE_IK_D278Q as a template, and using the forward primer of SEQ ID NO: 13, 15, or 17 of Table 5, the reverse primer of SEQ ID NO: 14, 16, or 18, and the primer set of Table 8 below, enzyme mutations were additionally induced in substantially the same manner as the site-directed mutagenesis (SDM) process of Example 3-1, and the mutation positions were confirmed in substantially the same manner as in Example 3-3 to secure microorganisms in which additional mutations occurred.

[0186] Type base sequence (5' -> 3') Sequence number MDPE_P77I_FCCGACGTTACCTCTTCTGACATTGCGGTTGTTGCGGCGGG29 MDPE_P77I_RCCCGCCGCAACAACCGCAATGTCAGAAGAGGTAACGTCGG30

[0187] (In Table 8 above, the underlined part indicates the base sequence part corresponding to the amino acid to be replaced.)

[0188]

[0189] Example 5-2. Evaluation of the thermal stability of microorganisms producing tertiary mutant enzymes.

[0190] The half-life of DH10b pUC19_MDPE_IKQ of Example 4 and the microorganisms DH10b pUC19_MDPE_IKQ_P77I, DH10b pUC19_MDPE_IKQ_V132L, DH10b pUC19_MDPE_IKQ_A192T and DH10b pUC19_MDPE_IKQ_G232E, which were confirmed to have P77I, V132L, A192T or G232E mutations in Example 5-1, was confirmed using substantially the same method as in Example 4, and the results are shown in Table 9 below.

[0191] The values ​​listed in Table 9 below are the half-life values ​​of each microorganism calculated as a percentage (%) based on the half-life time at 80℃ of the DH10b pUC19_MDPE_IKQ microorganism as 100%.

[0192] Strain thermal stability comparison value (%)DH10b pUC19_MDPE_IKQ100DH10b pUC19_MDPE_IKQ_P77I110DH10b pUC19_MDPE_IKQ_V132L200DH10b pUC19_MDPE_IKQ_A192T250DH10b pUC19_MDPE_IKQ_G232E150

[0193]

[0194] As a result of measuring the half-life, it was confirmed that the half-life of the microorganism with additional mutations increased compared to the microorganism with only A23I, E267K, and D278Q mutations, confirming that the thermal stability increased.

[0195]

[0196] Example 6. Preparation and thermal stability evaluation of the 3rd mutant enzyme (2)

[0197] Example 6-1. Production and screening of additional mutants of D-allulose 3-epimerase in DH10b pUC19_MDPE_IKE microorganisms.

[0198] In Example 4, MDPE_IKE, selected for its excellent enzyme thermostability, was used as template DNA to undergo mutagenesis via site-directed mutagenesis (SDM). This process involves additional mutations to the primary mutation, MDPE_IK_S285E, allowing for the confirmation of the double mutation effect.

[0199] Specifically, for DH10b pUC19_MDPE_IKE prepared in Example 4 above, a purified plasmid pUC19_MDPE_IK_S285E was prepared using a plasmid prep kit (GENALL) in substantially the same manner as in Example 2-4 above.

[0200] Using the above-prepared plasmid pUC19_MDPE_IK_S285E as a template, and using the forward primer of SEQ ID NO: 11 or 19 of Table 5 and the reverse primer of SEQ ID NO: 12 or 20, enzyme mutations were additionally induced in a method substantially identical to the site-directed mutagenesis (SDM) process of Example 3-1, or using the forward primer of SEQ ID NO: 25 of Table 6 and the reverse primer of SEQ ID NO: 26 in a method substantially identical to the saturation mutagenesis process of Example 3-2, and the mutation positions were confirmed in a method substantially identical to Example 3-3 to secure microorganisms in which additional mutations occurred.

[0201] Additionally, using the primers of sequence numbers 11 and 12 of Table 5, DNA in which an I106L mutation was additionally generated as a template, the forward primer (base sequence of sequence number 31 or 33) and the reverse primer (base sequence of sequence number 32 or 34) of Table 10 were used to additionally induce enzyme mutations in substantially the same manner as the site-directed mutagenesis (SDM) process of Example 3-1, or the forward primer of sequence number 25 and the reverse primer of sequence number 26 of Table 6 were used in substantially the same manner as the saturation mutagenesis process of Example 3-2, and the mutation location was confirmed in substantially the same manner as in Example 3-3 to secure microorganisms in which additional mutations occurred.

[0202] Type Base Sequence (5' -> 3') Sequence Number MDPE_S67T_FGTTTCTGCGTCTCTGGGTCTGACCGGTGCGACCGACGTTACC31 MDPE_S67T_RGGTAACGTCGGTCGCACCGGTCAGACCCAGAGACGCAGAAAC32 MDPE_G68P_FTCTGCGTCTCTGGGTCTGTCTCCGGCGACCGACGTTACCTCTTC33 MDPE_G68P_RGAAGAGGTAACGTCGGTCGCCGGAGACAGACCCAGAGACGCAGA34

[0203] (In Table 10 above, the underlined part indicates the base sequence part corresponding to the amino acid to be replaced.)

[0204]

[0205] Example 6-2. Evaluation of the thermal stability of additional mutagenic microorganisms

[0206] The half-life was confirmed in substantially the same manner as in Example 4 for the microorganisms DH10b pUC19_MDPE_IKE_I106L, DH10b pUC19_MDPE_IKE_S142N, DH10b pUC19_MDPE_IKE_D170G, DH10b pUC19_MDPE_IKE_I106L / S67T, DH10b pUC19_MDPE_IKE_I106L / G68P and DH10b pUC19_MDPE_IKE_I106L / S142N, which were confirmed to have mutations of I106L, S142N, D170G, I106L / S67T, I106L / G68P or I106L / S142N in DH10b pUC19_MDPE_IKE of Example 4 and Example 5-1. The results are shown in Table 11 below.

[0207] The values ​​listed in Table 11 below are the half-life values ​​of each microorganism calculated as a percentage (%) based on the half-life time at 75℃ of the DH10b pUC19_MDPE_IKE microorganism as 100%.

[0208] Strain thermal stability comparison value (%) DH10b pUC19_MDPE_IKE100DH10b pUC19_MDPE_IKE_I106L160DH10b pUC19_MDPE_IKE_S142N160DH10b pUC19_MDPE_IKE_D170G135DH10b pUC19_MDPE_IKE_I106L / S67T180DH10b pUC19_MDPE_IKE_I106L / G68P220DH10b pUC19_MDPE_IKE_I106L / S142N210

[0209]

[0210] As a result of measuring the half-life, it was confirmed that the half-life of the microorganism with additional mutations increased compared to the microorganism with only A23I, E267K, and S285E mutations, confirming that the thermostability increased. In particular, it was confirmed that the half-life of the microorganism with additional mutations of I106L and S68P increased significantly, confirming that the thermostability significantly increased.

[0211] In summary of the above thermal stability results, it was confirmed that DH10b pUC19_MDPE_IKE_I106L / G68P, a microorganism with S285E, I106L, and S68P mutations in addition to A23I and E267K mutations, has a half-life that is more than 700% higher than the thermal stability of the DH10b pUC19_MDPE_IK microorganism of Example 2-4, and thus has very high thermal stability.

[0212]

[0213] Example 7. Activity evaluation of mutant enzymes with increased thermostability

[0214] From the above Examples 4 to 6, additional mutations were induced in the enzyme to identify a mutant enzyme with improved thermostability, and in order to compare the enzyme activity with that of a microorganism in which only A23I and E267K mutations occurred, DH10b pUC19_MDPE_IK of the above Examples 2-4 and DH10b pUC19_MDPE_IKQ, DH10b pUC19_MDPE_IKQ_V132L, DH10b pUC19_MDPE_IKQ_A192T and DH10b pUC19_MDPE_IKQ_G232E of the above Example 5 and DH10b pUC19_MDPE_IKE, DH10b pUC19_MDPE_IKE_I106L, DH10b pUC19_MDPE_IKE_D170G, DH10b Microbial cells were recovered in substantially the same manner as in Example 4 for pUC19_MDPE_IKE_I106L / S67T, DH10b pUC19_MDPE_IKE_I106L / G68P, and DH10b pUC19_MDPE_IKE_I106L / S142N.

[0215] The cell conversion reaction was performed by using a 50 mM PIPES buffer solution (pH 6.0) containing 400 g / L fructose as a reaction substrate and 1 mM manganese ion as a reaction solution for the recovered cells, and reacting at 70°C for 30 minutes at a cell concentration of 1 mg (dcw) / mL.

[0216] After the above conversion reaction, centrifugation and HPLC analysis were performed in substantially the same manner as in Example 4, and the HPLC analysis results are shown in Table 12 below.

[0217] The values ​​listed in Table 12 below are the relative activity values ​​of each microorganism calculated as a percentage (%) based on 100% substrate conversion activity of the DH10b pUC19_MDPE_IK microorganism.

[0218] Strain relative activity (%) DH10b pUC19_MDPE_IK100DH10b pUC19_MDPE_IKQ110DH10b pUC19_MDPE_IKQ_V132L110DH10b pUC19_MDPE_IKQ_A192T105DH10b pUC19_MDPE_IKQ_G232E115DH10b pUC19_MDPE_IKE110DH10b pUC19_MDPE_IKE_I106L130DH10b pUC19_MDPE_IKE_D170G135DH10b pUC19_MDPE_IKE_I106L / S67T120DH10b pUC19_MDPE_IKE_I106L / G68P170

[0219]

[0220] As a result of evaluating enzyme activity by measuring the substrate conversion activity of the organism, it was confirmed that the activity of microorganisms with additional mutations increased compared to microorganisms with A23I and E267K double mutations, and in particular, the activity of microorganism DH10b pUC19_MDPE_IKE_I106L / G68P with additional mutations of I106L and S68P was confirmed to increase by more than 170% compared to the activity of DH10b pUC19_MDPE_IK microorganism.

Claims

1. An allulose 3-epimerase protein comprising an amino acid sequence having at least 80% sequence identity with the amino acid sequence of sequence number 1, from the N-terminus of the amino acid sequence of sequence number 1, (1) The amino acids corresponding to the 23rd and 267th amino acids are substituted with isoleucine (I) and lysine (K), respectively. (2) At least one amino acid selected from the group consisting of amino acids corresponding to the 67th, 68th, 77th, 106th, 132nd, 142nd, 170th, 174th, 192nd, 232nd, 278th and 285th amino acids, substituted with at least one amino acid selected from the group consisting of Leucine (L), Asparagine (N), Alanine (A), Valine (V), Glutamine (Q), Glutamic Acid (E), Isoleucine (I), Threonine (T), Glycine (G), and Proline (P), An allulose 3-epimerase protein, wherein the enzyme protein comprises an amino acid sequence in which the 23rd amino acid from the N-terminus in the amino acid sequence of sequence number 1 is substituted with isoleucine (I) and the 267th amino acid is substituted with lysine (K), excluding the enzyme protein.

2. In paragraph 1, from the N-terminus of the amino acid sequence of sequence number 1, (1) Substitution of the amino acid corresponding to the 23rd alanine with isoleucine and substitution of the amino acid corresponding to the 267th glutamic acid with lysine, and (2) Substitution of the amino acid corresponding to the 67th serine (Serine; S) with threonine, substitution of the amino acid corresponding to the 68th glycine with proline, substitution of the amino acid corresponding to the 77th proline with isoleucine, substitution of the amino acid corresponding to the 106th isoleucine with leucine, substitution of the amino acid corresponding to the 132nd valine with leucine, substitution of the amino acid corresponding to the 142nd serine with asparagine, substitution of the amino acid corresponding to the 142nd serine with alanine, substitution of the amino acid corresponding to the 170th aspartame with glycine, substitution of the amino acid corresponding to the 174th leucine with valine, substitution of the amino acid corresponding to the 192nd alanine with threonine, substitution of the amino acid corresponding to the 232nd glycine with glutamic acid, substitution of the amino acid corresponding to the 278th aspartame with glutamine, substitution of the amino acid corresponding to the 285th serine with glutamic acid and substitution of the 285th An allulose 3-epimerase protein comprising at least one selected from the group consisting of substitutions of an amino acid corresponding to serine with asparagine.

3. In the first paragraph, the enzyme protein comprises an amino acid sequence in which the 23rd amino acid from the N-terminus of the amino acid sequence of sequence number 1 is substituted with isoleucine (I) and the 267th amino acid is substituted with lysine (K), and has a conversion activity of 102% to 200% based on the allulose conversion activity of 100% of the enzyme.

4. A polynucleotide encoding an enzyme protein according to any one of claims 1 to 3.

5. A recombinant vector comprising a polynucleotide according to Article 4.

6. A recombinant microorganism comprising a polynucleotide encoding an enzyme protein according to any one of claims 1 to 3 or a recombinant vector comprising the same.

7. A recombinant microorganism in claim 6, wherein the microorganism is at least one microorganism selected from the group consisting of an Escherichia coli strain, a Bacillus strain, a Corynebacterium strain, a Saccharomyces strain, and a Pichia strain.

8. A composition for producing allulose, comprising at least one selected from the group consisting of an enzyme protein according to any one of claims 1 to 3, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, and extracts thereof.

9. In the 8th paragraph, a composition for producing allulose, wherein the half-life of the enzyme protein is 600% to 5,000% based on 100% of the half-life of the enzyme protein comprising the amino acid sequence of sequence number 1 under heat treatment conditions of 80°C.

10. In the 8th paragraph, the half-life of the enzyme protein is 110% to 800% based on 100% of the half-life of the enzyme protein comprising an amino acid sequence in which the 23rd amino acid from the N-terminus of the amino acid sequence of sequence number 1 is substituted with isoleucine (I) and the 267th amino acid is substituted with lysine (K), under heat treatment conditions at 80°C.

11. A composition for producing allulose, wherein the composition in claim 8 further comprises at least one selected from the group consisting of manganese ions, magnesium ions, nickel ions, and cobalt ions.

12. A method for producing allulose, comprising a step of reacting at least one selected from the group consisting of an enzyme protein according to any one of claims 1 to 3, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, and extracts thereof, with a substrate.

Images