Method for constructing recombinant aspergillus oryzae strain
By knocking out the pacG gene in Aspergillus oryzae strain and using CRISPR technology to construct recombinant strains, the problem of protease in the host strain degradation of exogenous proteins was solved, the expression of lactoferrin was increased, the production cost was reduced, and the possibility of commercial production was realized.
Patent Information
- Application Number
- PCT/CN2025/074729
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-24
- Filing Date
- 2025-01-24
- Publication Date
- 2025-07-31
AI Technical Summary
During the heterologous protein expression process of the existing Aspergillus oryzae strains, the protease secreted by the host strain will degrade the exogenous protein, resulting in low expression of heterologous proteins, especially in the production of lactoferrin, which is difficult to achieve commercial production.
Knock out the Aspergillus oryzae pacG gene through CRISPR gene editing technology so that its expression does not appear or its expression level is reduced, thereby building a recombinant strain and increasing the expression of exogenous proteins such as lactoferrin.
The expression of lactoferrin on low-cost production medium has been significantly improved, laying the foundation for the commercial production of lactoferrin.
Smart Images

Figure CN2025074729_31072025_PF_FP_ABST
Abstract
Description
A method for constructing a recombinant Aspergillus oryzae strain
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] This application claims priority to Chinese patent application No. 202410104495.6 filed on January 24, 2024, the entire contents of which are incorporated herein by reference. Technical Field
[0003] The present invention relates to a method for constructing a recombinant Aspergillus oryzae strain, in particular to a method for constructing a recombinant Aspergillus oryzae strain by knocking out the pacG gene. The present invention also relates to the use of the recombinant Aspergillus oryzae strain in expressing exogenous proteins such as lactoferrin. Background Art
[0004] The filamentous fungus Aspergillus oryzae has been used in traditional Japanese food fermentation for over a thousand years and has been designated as a Generally Recognized as Safe (GRAS) strain by the U.S. Food and Drug Administration (FDA). Due to its robust extracellular protein secretion capacity, Aspergillus oryzae has been used as a host for recombinant protein production, including the production of amylase, chymosin, glucose oxidase, cellulase, lipase, pectinase, catalase, protease, phytase, xylanase, human lysozyme, and recombinant antibodies. It holds great potential for application in the industrial, food, feed, and pharmaceutical sectors. However, compared to endogenous proteins, the production efficiency of heterologous eukaryotic proteins is generally lower. To improve protein expression, numerous researchers have conducted extensive research, and a series of high-expression elements, such as strong promoters, signal peptides, and codon optimization techniques, have been reported to enhance protein expression in Aspergillus oryzae. Currently, a common problem encountered during heterologous protein expression is that proteases secreted by the host strain itself can degrade the exogenously produced heterologous protein, resulting in reduced yield. To reduce proteolytic activity, researchers have constructed various protease gene knockout strains, thereby increasing heterologous protein production. For example, in CN101292024, by completely or partially inactivating the endogenous alkaline protease alp of Aspergillus oryzae, the endogenous neutral protease npl, and the endogenous serine protease pepC of the subtilisin class, the degradation level of secreted exogenous protein antibody IgG by host proteases can be significantly reduced. For example, in order to improve the expression of heterologous proteins in Aspergillus oryzae, Jaewoo Yoon's team successively constructed two protease knockout strains (tppA and pepE), five protease knockout strains (tppA, pepE, nptB, dppIV, and dppV) and ten protease knockout strains (tppA, pepE, nptB, dppIV, dppV, alpA, pepA, AopepAa, AopepAd and cpI) of Aspergillus oryzae. Among them, the expression level of human lysozyme in the two protease knockout Aspergillus oryzae strains was 63% higher than that in the non-protease knockout control strain, the expression level of bovine lysozyme in the five protease knockout Aspergillus oryzae strains was 34% higher than that in the two protease knockout strains, the expression level of human lysozyme in the ten protease knockout Aspergillus oryzae strains was 35% higher than that in the five protease knockout strains, and the expression level of bovine lysozyme was 30% higher than that in the five protease knockout strains.(Yoon J, Maruyama J, Kitamoto K. Disruption of ten protease genes in the filamentous fungus Aspergillus oryzae highly improves production of heterologous proteins [J]. Applied microbiology and biotechnology, 2011, 89: 747-759.)
[0005] The Aspergillus oryzae pacG gene contains 591 amino acids (GeneBank ID: XP_001826638.1) and belongs to the Ndt80-like transcription factor family of the p53-like superfamily. Amino acids 80 to 333 encode the NDT80 DNA binding domain, which may be involved in sensing the nutrient environment and regulating downstream genes. Currently, the function of the pacG gene in Aspergillus oryzae is unclear, and there are no reports linking this gene to extracellular protein expression in Aspergillus oryzae.
[0006] Lactoferrin (LF), also known as lactotransferrin (LTF), is an iron-binding glycoprotein with a molecular weight of approximately 80 kDa. It is widely present in various secretions, such as breast milk, bovine milk, saliva, tears, and nasal secretions. Lactoferrin is found at its highest concentration in human colostrum (4.9 mg / ml) and in mature breast milk at 2.1 mg / ml. It is known as "the first line of defense for health." Lactoferrin regulates iron metabolism and enhances antibacterial and antiviral properties, regulates intestinal flora, and modulates immunity. Its applications are primarily in infant formula, dietary supplements, dairy products, beverages, oral care products, skin care products, and pet food, and it holds great promise. Currently, lactoferrin production primarily relies on extraction from cow's milk. Due to its low lactoferrin content, only 1 gram of lactoferrin can be extracted from 14 kg of milk, resulting in high production costs and a high price tag. It is known as "milk gold." In recent years, a small number of reports have been published on the expression of lactoferrin in microbial cells. For example, Ward et al. reported that the highest expression level of human lactoferrin in Aspergillus oryzae was only 0.025 g / L (Ward PP, Lo JY, Duke M, et al. Production of biologically active recombinant human lactoferrin in Aspergillus oryzae [J]. Bio / technology, 1992, 10(7): 784-789.). This very low expression level in low-cost production culture media is not conducive to scale-up fermentation and commercial production. To further increase the expression level of lactoferrin, it is necessary to develop new Aspergillus oryzae strains to increase the expression level of recombinant lactoferrin, reduce costs, and achieve commercial production. Summary of the Invention
[0007] In one aspect, the present invention provides a method for constructing a recombinant strain of Aspergillus oryzae, comprising knocking out its pacG gene so that the gene is not expressed or the expression level is reduced.
[0008] In some embodiments, the pacG gene comprises the nucleotide sequence shown in SEQ ID NO: 4 or has at least 90% sequence identity to the nucleotide sequence shown in SEQ ID NO: 4.
[0009] In some embodiments, the knockout is performed by CRISPR gene editing technology.
[0010] In some embodiments, the knockout comprises introducing a plasmid comprising a Cas9 encoding sequence and an sgRNA encoding sequence into the Aspergillus oryzae strain, wherein the sgRNA targets the pacG gene.
[0011] In some embodiments, the CRISPR gene editing technology uses one or more sgRNAs, the coding sequence of which includes at least one of the nucleotide sequences shown in SEQ ID NOs: 8-10.
[0012] On the other hand, the present invention provides a recombinant Aspergillus oryzae strain, wherein the pacG gene is knocked out, so that the gene is not expressed or the expression level is reduced.
[0013] In some embodiments, the pacG gene comprises the nucleotide sequence shown in SEQ ID NO: 4 or has at least 90% sequence identity to the nucleotide sequence shown in SEQ ID NO: 4.
[0014] In some embodiments, the recombinant Aspergillus oryzae strain comprises a polynucleotide encoding an exogenous protein.
[0015] In some embodiments, the exogenous protein is lactoferrin, preferably human lactoferrin.
[0016] In some embodiments, the amino acid sequence of the exogenous protein is as shown in SEQ ID NO: 1 or has at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 1.
[0017] In another aspect, the present invention provides a method for expressing foreign proteins, comprising using the above-mentioned recombinant Aspergillus oryzae strain as a host cell.
[0018] In some embodiments, the exogenous protein is expressed in a secretory manner.
[0019] In some embodiments, the exogenous protein is lactoferrin, preferably human lactoferrin.
[0020] In some embodiments, the amino acid sequence of the exogenous protein is as shown in SEQ ID NO: 1 or has at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 1.
[0021] In another aspect, provided herein is an sgRNA, the coding sequence of which includes at least one of the nucleotide sequences shown in SEQ ID NOs: 8-10.
[0022] In the present invention, the expression level of lactoferrin in a low-cost production culture medium is significantly increased by knocking out the pacG gene to transform the strain, laying the foundation for the industrialization of lactoferrin. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1: Schematic diagram of the human lactoferrin gene expression plasmid pNA2-huLF-pyrG.
[0024] Figure 2: Schematic diagram of the knockout plasmid pKO-pacG.
[0025] Figure 3: Schematic diagram of the CRISPR system for knocking out pacG in the Aspergillus oryzae genome.
[0026] Figure 4: DNA electrophoresis image of PCR identification of pacG gene knockout results.
[0027] Figure 5: Expression of human lactoferrin in the supernatant of shake flask fermentation of different strains. DETAILED DESCRIPTION
[0028] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.
[0029] The term "or" refers to a single element of the listed alternative elements unless the context clearly dictates otherwise.
[0030] The term "comprising" or "including" means including the stated elements, integers, or steps, but does not exclude any other elements, integers, or steps. When "comprising" or "including" is used, unless otherwise indicated, it also covers the situation where it consists of the stated elements, integers, or steps. For example, when it is mentioned that a combination or composition "comprising A and B", it is also intended to cover the combination or composition consisting of A and B.
[0031] When a specific value is mentioned, it is generally understood that a reference is made to any value within ±10% of the listed value, unless the context indicates otherwise. Those skilled in the art will appreciate that due to instrument accuracy, errors introduced during operation, and other factors, the values of test results, operation times, and the like may vary within a small range. For example, when cells are cultured for 24 hours, it should be understood that culturing cells for 24 hours ± 2.4 hours is also feasible.
[0032] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) gene editing technology is an RNA-guided technique that uses Cas9 nucleases to edit the DNA of target genes. The CRISPR gene editing system used in this technology consists of a Cas9 nuclease and a single-stranded guide RNA (sgRNA). A portion of the sgRNA sequence binds to the Cas9 nuclease, while another portion (the guide sequence, gRNA) is complementary to a portion of the target gene. The sgRNA's recognition allows the Cas9 nuclease to create a single-stranded or double-stranded cut at a specific site in the target gene. In some applications, CRISPR gene editing technology can be used to knock out genes in cells. In these cases, the only concern is disrupting the gene's normal coding function, such as causing a frameshift mutation or deletion of a gene segment, thereby preventing the production of a functional product (such as a protein). Typically, gene knockout can be achieved by introducing a Cas9 nuclease (such as Cas9) and sgRNA into cells and then screening for cells that do not express the product of the gene to be knocked out. Herein, "Cas9" is the key to the nuclease activity of the CRISPR / Cas9 system. It contains two domains with cleavage activity: the HNH domain and the RuvC domain. HNH and RuvC can cleave the two strands of DNA, respectively, to form double-strand breaks. The Cas9 protein can be the recombinant Cas9 protein SpCas9 derived from Streptococcus pyogenes. The Cas9 protein can also be a variant of the Cas9 protein, such as eSpCas9 (1.0), eSpCas9 (1.1), and SpCas9-HF1, Cas9 variants with significantly improved specificity, obtained through targeted engineering of the Cas9 protein.
[0033] When referring to sgRNA, the term "targeting" refers to the fact that a portion of the sgRNA sequence (the guide sequence, gRNA, approximately 20 bases) is complementary to a portion of the host cell genome (the target sequence), leading to gene editing in the presence of the Cas9 protein. This complementary portion of the sgRNA allows proteins like Cas9 to introduce nucleotide sequence changes at relatively specific locations in the genome, achieving gene knockout or knock-in effects.
[0034] When referring to sgRNA, its "coding sequence" refers to the corresponding DNA sequence located on a vector (such as a plasmid), which can be used to edit the target DNA after transcription. In sgRNA, in addition to the guide RNA (gRNA) that can bind to the target sequence, it also includes a skeleton part (scaffold) for binding to the Cas nuclease (such as Cas9). Usually, the vector used for sgRNA expression has constructed a promoter, scaffold sequence, and terminator sequence. It only needs to design and connect the guide sequence (gRNA) and introduce the vector into the host cell to produce the target sgRNA. In some embodiments, when CRISPR gene editing is performed, a vector (such as a plasmid) containing the coding sequence of the sgRNA and the coding sequence of the Cas nuclease is introduced into the host cell. In other embodiments, when CRISPR gene editing is performed, a vector (such as a plasmid) containing the coding sequence of the sgRNA and another vector (such as a plasmid) containing the coding sequence of the Cas nuclease is introduced into the host cell at the same time.
[0035] The "pacG gene" herein refers to the Ndt80-like transcription factor of the "p53-like" superfamily on the microbial genome, preferably the putative transcription factor pacG gene on the Aspergillus oryzae genome, which encodes 591 amino acids (GeneBank ID: XP_001826638.1), and amino acids 80 to 333 encode the NDT80 DNA binding domain, the nucleotide sequence of which is shown in SEQ ID NO: 4 or has at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 4, and the amino acid sequence encoded by this gene is shown in SEQ ID NO: 5 or has at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 5.
[0036] "Aspergillus oryzae recombinant strain" refers herein to an Aspergillus oryzae strain whose genome has been modified to be different from that of the wild-type genome. There are many ways to modify the genome, including genetic mutations caused by any means, such as insertion, deletion, substitution, breakage of single-stranded or double-stranded DNA, etc. of nucleotides or nucleotide fragments. In one example, genetic modification is achieved by gene editing technology, such as ZFN (zinc finger nuclease) technology, TALEN (transcription activator-like effector nuclease) technology, CRISPR technology, etc. For the purposes of the present invention, the genome modification can result in the knockout of the pacG gene.
[0037] "Knockout" or "gene knockout" herein refers to changing the nucleotide sequence of a gene in a host cell, regardless of whether the change is a nucleotide insertion, deletion, or replacement, as long as the gene being knocked out cannot produce a functional gene product (such as RNA or protein) in the cell. Ideally, gene knockout causes the cell or cell group to completely not form the gene product or functional gene product of the gene. Understandably, causing the amount of the gene product to be significantly reduced, or the activity of the gene product to be significantly reduced, can also be considered to have achieved "gene knockout." The result of "gene knockout" is that the gene is not expressed or the expression level is reduced (i.e., the expression product is reduced). In some embodiments, the result of gene knockout is a reduction in the expression level relative to the wild-type gene, for example, a reduction of 10%, a reduction of 20%, a reduction of 30%, a reduction of 40%, a reduction of 50%, a reduction of 60%, a reduction of 70%, a reduction of 80%, a reduction of 90%, a reduction of 95%, a reduction of 99%, or even a reduction of 100%.
[0038] In this article, the term "plasmid" generally refers to a DNA molecule outside the chromosome or nucleoid found in organisms such as bacteria, yeast, and fungi that has the ability to replicate autonomously, maintaining a constant copy number in daughter cells and expressing the genetic information it carries. Plasmids are used as gene carriers in genetic engineering research.
[0039] As used herein, the term "host cell" refers to a cell that can be or has been a recipient of an expression vector carrying an exogenous protein coding sequence. Host cells can be prokaryotic or eukaryotic. Exemplary eukaryotic cells include mammalian cells; fungal cells, such as molds; plant cells; and insect cells. Host cells include the progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or genomic DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation.
[0040] "Exogenous protein" herein refers to a protein that is not expressed by the host cell itself, or is expressed at a low level by the host cell, and whose expression in the host cell is increased after the gene encoding the protein is introduced. In some embodiments, the exogenous protein is a human protein that is not expressed by Aspergillus oryzae itself, such as human lactoferrin.
[0041] "Secretory expression" refers to the process by which a foreign protein, after being expressed in a host cell, is at least partially, and preferably mostly, secreted outside the host cell. For example, after culturing the host cells, the foreign protein can be isolated from the supernatant. A common method for achieving secretory expression of foreign proteins is to use a signal peptide. For example, a signal peptide coding sequence is added to the 5' end of the foreign protein coding sequence. After expression in the host cell, the signal peptide sequence forms a fusion protein with the foreign protein. The signal peptide guides the fusion protein to localize outside the host cell and is cleaved to produce the free foreign protein. Examples of signal peptides that can be used in Aspergillus oryzae include the amyB gene signal peptide.
[0042] "Sequence identity" (also called "sequence identity") refers to the amount of consistency between two amino acid or nucleotide sequences (such as a query sequence and a reference sequence), generally expressed as a percentage. Usually, before calculating the percentage of consistency between two amino acid or nucleotide sequences, the sequences are aligned and gaps (if any) are introduced. If the amino acid residues or bases in the two sequences are the same at a certain comparison position, the two sequences are considered to be consistent or matched at that position; if the amino acid residues or bases in the two sequences are different, they are considered to be inconsistent or mismatched at that position. In some algorithms, the number of matching positions is divided by the total number of positions in the comparison window to obtain sequence consistency. In other algorithms, the number of gaps and / or the length of the gaps are also taken into account. Commonly used sequence comparison algorithms or software include DANMAN, CLUSTALW, MAFFT, BLAST, MUSCLE, etc. For the purposes of the present invention, the publicly available alignment software BLAST (available from https: / / www.ncbi.nlm.nih.gov / ) can be used to obtain the best sequence alignment and calculate the sequence consistency between the two amino acid or nucleotide sequences by using the default settings.
[0043] The present inventors have found that knocking out the pacG gene of Aspergillus oryzae through gene editing facilitates the expression of foreign proteins therein. The present inventors also anticipate that knocking out the pacG gene in other fungi, particularly Aspergillus fungi, may also promote the expression of foreign proteins therein.
[0044] The present invention will be further described below in conjunction with specific embodiments:
[0045] Experimental materials and reagents
[0046] (1) Strains and vectors
[0047] Aspergillus oryzae NBRC4177: available from Institute for Fermentation, 17-25 Juso Hammachi2-Chome Yodogawa-Ku, Osaka, Japan. Plasmid pUC57 was purchased from GenScript Biotech Co., Ltd.
[0048] (2) Culture medium
[0049] TZ liquid culture medium: 0.8% beef extract powder, 0.2% yeast extract, 0.5% peptone, 0.2% NaCl, 3% sucrose, pH 5.8.
[0050] Enzyme hydrolysate: 0.25% cellulase, 0.25% snailase, 0.4% Yatalse, pH 5.8.
[0051] STC solution: 14.6% D-Sorbitol, 0.28% CaCl2, 0.3% Tris, pH 8.0.
[0052] CD medium: 2% glucose, 0.3% NaNO₃, 0.2% KCl, 0.1% KH₂PO₄, 0.002% FeSO₄, 0.0245% MgSO₄, 14.6% D-Sorbitol, pH 6.5. Aspergillus oryzae seed medium: 6% sucrose, 2% soybean meal, 1% corn steep liquor, 1% peptone.
[0053] Fermentation medium: 12% glucose, 2% soybean cake powder, 2% corn steep liquor powder, 1% KH2PO4, 0.25% MgSO4, 0.05% Tween 80.
[0054] Example 1 Construction of human lactoferrin expression plasmid
[0055] Human lactoferrin amino acid sequence P02788 is from the Uniprot database, and amino acid sequence is as shown in SEQ ID NO:1. Uniprot database shows that wherein 1-19 amino acids are human lactoferrin signal peptide sequences. When utilizing Aspergillus oryzae strain to express, it is necessary to replace it with Aspergillus oryzae amyB gene signal peptide. According to Aspergillus oryzae database, codon optimization is carried out to obtain human lactoferrin nucleotide sequence huLF, as shown in SEQ ID NO:2 (aspergillus oryzae amyB signal peptide nucleotide sequence in italics), and synthesized by GenScript company. Human lactoferrin nucleotide sequence huLF is connected between Aspergillus oryzae NA2 promoter and gla terminator to obtain huLF expression cassette. Selective marker pyrG expression cassette is synthesized by GenScript company, and the sequence of described pyrG expression cassette is as shown in SEQ ID NO:3 (underlined is pyrG gene promoter, bold is pyrG gene, italics is pyrG gene terminator). The linearized pUC57 vector, pyrG expression cassette, and huLF expression cassette were recombined using the Gibson Master Mix Kit to obtain the human lactoferrin gene expression plasmid pNA2-huLF-pyrG (as shown in Figure 1), and sequencing confirmed that the plasmid sequence was correct.
[0056] Example 2 Construction of human lactoferrin expression strain
[0057] The human lactoferrin gene expression plasmid pNA2-huLF-pyrG was introduced into the Aspergillus oryzaeΔpyrG strain using the protoplast transformation method. The strain is Aspergillus oryzae NBRC4177, a pyrG (orotidine-5'-phosphate decarboxylase) auxotrophic strain obtained by mutagenesis screening, so that pyrG can be used as a screening marker for transformation screening in the present invention.
[0058] The process of screening pyrG auxotrophic strains by mutagenesis is as follows:
[0059] The spore concentration in 5 mL was 2 × 10 7Fresh Aspergillus oryzae NBRC4177 spores were placed in a 5 cm diameter dish and subjected to UV mutagenesis under the following mutagenesis conditions: power 15 W, wavelength 254 nm, mutagenesis height 8 cm, mutagenesis time 3 min, magnetic stirrer speed 200 rpm. The induced spores were then plated on CD subculture medium containing 0.15% 5-FOA (5-fluoroorotic acid) and 0.24% uridine. After incubation at 30°C for 5 days, individual colonies resistant to 5-FOA were selected and transferred to CD subculture medium containing 0.15% 5-FOA (5-fluoroorotic acid) and 0.24% uridine. Single Aspergillus oryzae colonies grown on plates were spotted onto CD subculture medium and CD subculture medium containing 0.24% uridine, respectively. Strains that could not grow on the CD subculture medium but grew on the CD subculture medium containing 0.24% uridine were collected as uracil auxotrophic strains of Aspergillus oryzae. The obtained auxotrophic strains were sequenced and analyzed, and strains with inactivated orotidine-5'-phosphate decarboxylase were selected for subsequent transformation screening.
[0060] The specific steps for constructing a human lactoferrin expression strain are as follows:
[0061] (1) Preparation of protoplasts: Aspergillus oryzae mycelia were inoculated into a nutrient-rich TZ liquid medium. After culturing for 48 h, the mycelia were collected by filtration and washed with 0.8 M KCl. After the mycelia were filtered and dried, they were transferred to an enzymatic hydrolysis solution and enzymatically hydrolyzed at 30°C and 65 rpm for 2 h. The enzymatic hydrolysis solution containing the protoplasts was then centrifuged at 3000 rpm and 4°C for 10 min, and the supernatant was discarded. The protoplasts attached to the tube wall were washed once with 0.8 M STC solution, and finally the protoplasts were resuspended in an appropriate amount of 0.8 M STC solution.
[0062] (2) Protoplast transformation: 10 μL (concentration: 1000 ng / μL) of HindIII linearized human lactoferrin gene expression plasmid pNA2-huLF-pyrG was added to 100 μL of protoplast suspension, mixed and placed at room temperature for 25 min, then 900 μL of PEG solution was added, mixed and placed at room temperature for 25 min, and then mixed with CD culture medium without uridine that had been cooled to about 45°C and spread on a plate. After the plate solidified, it was placed in a 34°C incubator for 4-5 days. The transformants were picked and transferred to a new CD culture medium plate and placed in a 34°C incubator for another 4-5 days. The grown transformants were called positive transformants, and a human lactoferrin expression strain AO-huLF869 was selected for subsequent experiments.
[0063] Example 3 Construction of a putative transcription factor pacG gene knockout plasmid
[0064] Through bioinformatics analysis of the Aspergillus oryzae genome, we discovered the putative transcription factor pacG gene on the Aspergillus oryzae genome. Its nucleotide sequence is SEQ ID NO:4 (where lowercase letters are intron sequences) and its amino acid sequence is SEQ ID NO:5. The function of this gene is still unclear, but it may be related to the regulation of extracellular proteases and cell growth and development. The pacG gene was knocked out by CRISPR, so that the gene was not expressed or the expression level was reduced, and its effect on the expression of heterologous proteins was studied. The construction of the CRISPR knockout plasmid of the putative transcription factor pacG gene includes the following steps:
[0065] (1) Linearize the pUC57 plasmid using vector-F and vector-R primers;
[0066] vector-F(SEQ ID NO:15):AAGCTTGGCGTAATCATGGTCAT
[0067] vector-R (SEQ ID NO: 16):
[0068] (2) The selection marker gene itraconazole resistance gene itrA expression cassette was synthesized by GenScript. The sequence of the itrA expression cassette is shown in SEQ ID NO: 6 (the underlined portion indicates the Aspergillus oryzae tef promoter, the bold portion indicates the itrA gene, and the italic portion indicates the Aspergillus oryzae amyB terminator);
[0069] (3) Plasmid replicon AMA1 from Aspergillus oryzae, synthesized by GenScript, reference article Christina S., et al. "A CRISPR-Cas9system for genetic engineering of filamentous fungi." PloS one10.7(2015):e0133085;
[0070] (4) The cas9 gene from Streptococcus pyogenes was codon-optimized according to the Aspergillus oryzae database, and the SV40 nuclear localization signal was added to the 3' end of the cas9 gene. It was synthesized by GenScript and ligated between the Aspergillus oryzae enoA promoter and the niaD terminator. The sequence of the cas9 gene expression cassette is shown in SEQ ID NO: 7 (the Aspergillus oryzae enoA promoter is underlined, the cas9 gene is in bold, and the Aspergillus oryzae niaD terminator is in italics);
[0071] (5) The two ends of the sgRNA are connected to the 5'HH ribozyme sequence and the 3'HDV ribozyme sequence, respectively, and then connected between the Aspergillus oryzae enoA promoter and the pyrG terminator. It is transcribed by type II RNA polymerase and then released by ribozyme cleavage. The three selected sgRNAs target different positions of the pacG gene to ensure that the main coding region of the pacG gene is destroyed. The coding sequences of the guide sequences in the three sgRNAs are shown in SEQ ID NO: 8-10, the coding sequence in the sgRNA that binds to Cas9 is shown in SEQ ID NO: 11, and the 5'HH ribozyme sequence and the 3'HDV ribozyme sequence are shown in SEQ ID NO: 12-13. The construction method of sgRNA refers to the article Christina S., et al. "A CRISPR-Cas9system for genetic engineering of filamentous fungi." PloS one10.7(2015):e0133085.
[0072] (6) The sequence of the negative selection marker gene TK (herpes simplex virus thymidine kinase) expression cassette is shown in SEQ ID NO: 14 (underlined for the TK gene promoter, bold for the TK gene, and italicized for the TK gene terminator), which is used to remove free CRISPR plasmids under conditions containing fluorodeoxyuridine (FdU). The TK gene expression cassette is based on the article Gardiner, DM, Howlett, BJ Negative selection using thymidine kinase increases the efficiency of recovery of transformants with targeted genes in the filamentous fungus Leptosphaeria maculans. Curr Genet 45, 249–255 (2004).
[0073] The CRISPR knockout plasmid was constructed by sequentially recombining and ligating the above fragments using the Gibson Master Mix Kit (E2611, New England Biolabs) to obtain the pacG gene knockout plasmid pKO-pacG ( FIG. 2 ).
[0074] Example 4 Construction of a putative transcription factor pacG knockout strain
[0075] According to the method in Example 1, the pacG gene knockout plasmid pKO-pacG was transformed into the human lactoferrin expression strain AO-huLF869 obtained in Example 2 through protoplast transformation to knock out the pacG gene of the strain.
[0076] 10 μL (concentration: 1000 ng / μL) of the knockout plasmid pKO-pacG was mixed evenly with the prepared protoplasts and allowed to stand at room temperature for 25 minutes. Then, 900 μL of PEG solution was added, mixed and allowed to stand at room temperature for 25 minutes. Then, it was mixed with CD medium containing itraconazole resistance that had been cooled to about 45°C and plated. After the plate solidified, it was placed in a 34°C incubator and cultured for 4-5 days. The transformants were picked and transferred to new CD medium containing itraconazole resistance and placed in a 34°C incubator for another 4-5 days. The transformed cells were extracted by genome extraction and PCR amplification of the pacG gene, and sequencing was performed to verify that the transformants with the pacG gene knocked out were positive transformants (knockout schematic shown in Figure 3, PCR amplification results in Figure 4). The obtained positive transformants were then transferred to FdU plates for screening. The CRISPR plasmid in the cells was removed through counter-selection of the TK gene, and the pacG knockout strain was finally obtained. One of the strains, AO-pacG759, was selected.
[0077] Example 5 Comparison of human lactoferrin expression in strains with a hypothetical transcription factor pacG knockout
[0078] Mycelial plates of the human lactoferrin-expressing strain AO-huLF869 and the pacG knockout strain AO-pacG759 were inoculated into Aspergillus oryzae seed culture medium and cultured at 30°C and 200 rpm for 2 days. The same amount of seed culture was then transferred to fermentation medium and cultured at 30°C and 200 rpm for 5 days. After fermentation, the supernatant of the fermentation broth was centrifuged and analyzed by SDS-PAGE electrophoresis and HPLC. The HPLC results are shown in Figure 5.
[0079] The HPLC detection method refers to GB1903.17-2016 National Food Safety Standard - Food Nutrition Fortifier Lactoferrin Detection Method, and the detection standard is human lactoferrin (Sigma, SRP6519).
[0080] As shown in Figure 5, the expression level of human lactoferrin in the AO-huLF869 strain was low in shake flasks, with HPLC results showing a lactoferrin concentration of 0.02 mg / mL. However, the expression level of the pacG knockout strain, AO-pacG759, was significantly increased in shake flasks, with HPLC results showing a lactoferrin concentration of 0.23 mg / mL. This indicates that knockout of the pacG gene facilitates the expression of heterologous human lactoferrin in Aspergillus oryzae.
[0081] The amino acid and nucleotide sequences used in the present invention are as follows:
[0082] >SEQ ID NO:1 Human lactoferrin amino acid sequence P02788
[0083] >SEQ ID NO:2 Human lactoferrin nucleotide sequence huLF
[0084] >SEQ ID NO:3pyrG expression cassette
[0085] >SEQ ID NO:4 Aspergillus oryzae pacG gene nucleotide sequence
[0086] >SEQ ID NO:5 Aspergillus oryzae pacG gene amino acid sequence
[0087] >SEQ ID NO: 6itrA expression cassette
[0088] >SEQ ID NO:7cas9 gene expression cassette
[0089] >SEQ ID NO:8 Guide sequence in sgRNA1
[0090] >SEQ ID NO:9 guide sequence in sgRNA2
[0091] >SEQ ID NO: 10 Guide sequence in sgRNA3
[0092] >SEQ ID NO:11 Coding sequence of sgRNA that binds to Cas9
[0093] >SEQ ID NO:125'HH ribozyme sequence
[0094] >SEQ ID NO:133' HDV ribozyme sequence
[0095] >SEQ ID NO:14TK expression cassette
Claims
1. Method for constructing a recombinant Aspergillus oryzae strain, including knocking out its pacG gene to make the gene not expressed or the expression level reduced.
2. The method according to claim 1, wherein the pacG gene includes the nucleotide sequence shown in SEQ ID NO: 4 or has at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO:
4.
3. The method according to claim 1 or 2, wherein the knockout is carried out by CRISPR gene editing technology.
4. The method according to any one of claims 1-3, wherein the knockout includes introducing a plasmid containing the Cas9 coding sequence and the sgRNA coding sequence into the Aspergillus oryzae strain, and the sgRNA targets the pacG gene.
5. The method according to any one of claims 1-4, wherein the CRISPR gene editing technology uses one or more sgRNAs, and the coding sequence of the sgRNA includes at least one of the nucleotide sequences shown in SEQ ID NOs: 8-10.
6. A recombinant Aspergillus oryzae strain, in which the pacG gene is knocked out to make the gene not expressed or the expression level reduced.
7. The recombinant Aspergillus oryzae strain according to claim 6, wherein the pacG gene includes the nucleotide sequence shown in SEQ ID NO: 4 or has at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO:
4.
8. The recombinant Aspergillus oryzae strain according to claim 6 or 7, which includes a polynucleotide encoding a foreign protein.
9. The recombinant Aspergillus oryzae strain according to claim 8, wherein the foreign protein is lactoferrin, preferably human lactoferrin.
10. The recombinant Aspergillus oryzae strain according to claim 8 or 9, wherein the amino acid sequence of the foreign protein is as shown in SEQ ID NO: 1 or has at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO:
1.
11. A method for expressing a foreign protein, including using the recombinant Aspergillus oryzae strain according to any one of claims 6-10 as a host cell.
12. The method according to claim 11, wherein the foreign protein is secreted and expressed.
13. The method according to claim 12, wherein the foreign protein is lactoferrin, preferably human lactoferrin.
14. The method according to any one of claims 11-13, wherein the amino acid sequence of the foreign protein is as shown in SEQ ID NO: 1 or has at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO:
1.
15. sgRNA, the coding sequence of which includes at least one of the nucleotide sequences shown in SEQ ID NOs: 8-10.
Citation Information
Patent Citations
High-acid protease yield recombinant aspergillus niger expression strain and construction method and application thereof
CN107586789A
Expression of processed recombinant lactoferrin and lactoferrin polypeptide fragments from fusion product in aspergillus
CN1171815A
Transcriptional modulators and polynucleotides encoding same
CN117355608A
A funguns wherein areA, pepC and / or pepE genes have been inactivated
CN1204370A
Mutants of a filamentous fungal cell having increased productivity in the production of a polypeptide
WO2021148278A1