Mutant microorganism having improved l-citrulline or l-arginine productivity, and method for producing l-citrulline or l-arginine using same

A mutant Corynebacterium strain with a weakened NCgl2653 gene enhances L-citrulline and L-arginine production by disrupting the ODHC activity, addressing productivity limitations and increasing yields significantly.

WO2025159353A1PCT designated stage Publication Date: 2025-07-31DAESANG CORP
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/021018
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-12-09
Filing Date
2024-12-24
Publication Date
2025-07-31

AI Technical Summary

Technical Problem

Existing methods for producing L-citrulline and L-arginine in microorganisms, such as Corynebacterium, do not effectively address the productivity limitations due to the activity of proteins involved in their biosynthesis, particularly the 2-oxoglutarate dehydrogenase complex (ODHC), leading to inefficiencies in production yields.

Method used

A mutant microorganism with a weakened or inactivated protein encoded by the NCgl2653 gene, which is a transmembrane protein involved in material transport, is developed to enhance L-citrulline and L-arginine production by disrupting the GlnH-GlnX-PknG-OdhI-OdhA signal transduction cascade, using a recombinant vector to delete or modify the NCgl2653 gene.

Benefits of technology

The mutant microorganism exhibits increased production of L-citrulline and L-arginine by up to 10 times compared to the parent strain, improving yield through reduced ODHC activity and enhanced carbon flow in the biosynthetic pathways.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTKR2024021018-APPB-IMG-000001
    Figure PCTKR2024021018-APPB-IMG-000001
  • Figure PCTKR2024021018-APPB-IMG-000002
    Figure PCTKR2024021018-APPB-IMG-000002
Patent Text Reader

Abstract

The present invention relates to: a mutant microorganism having improved L-citrulline or L-arginine productivity; and a method for producing L-citrulline or L-arginine using same. The mutant microorganism can improve the production yield of L-citrulline or L-arginine compared to the parent strain by weakening or inactivating the activity of a protein encoded by the NCgl2653 gene.
Need to check novelty before this filing date? Find Prior Art

Description

Mutant microorganism with improved L-citrulline or L-arginine production ability and method for producing L-citrulline or L-arginine using the same

[0001] The present invention relates to a mutant microorganism having improved L-citrulline or L-arginine production ability and a method for producing L-citrulline or L-arginine using the same.

[0002] Citrulline is a non-essential amino acid that plays a vital role in the body, including promoting ammonia metabolism, improving blood flow through vasodilation, lowering blood pressure, promoting neurotransmission, boosting immunity, and scavenging reactive oxygen species. In the kidneys, citrulline is metabolized into arginine, which then produces nitric oxide (NO). While not a component of proteins in the body, citrulline is an intermediate in the urea cycle. It is produced from arginine along with NO, a substance known to have vasodilating properties. Furthermore, it is regenerated into arginine through condensation with aspartic acid.

[0003] Arginine is a non-essential amino acid, but it is a semi-essential amino acid that must be supplied in growing children and under stressful conditions, trauma, cancer, and other special conditions. It is widely used as an ingredient in amino acid fortifiers, pharmaceuticals, and foods. For pharmaceutical purposes, it is used in liver function promoters, brain function promoters, male infertility treatments, and comprehensive amino acid preparations. For food, it is used as a fish cake additive, health drink additive, and salt substitute for hypertensive patients.

[0004] In the production of citrulline or arginine using microorganisms, L-citrulline or L-arginine can be produced from a wild-type strain obtained in a natural state or a mutant strain modified to enhance its citrulline or arginine production ability. Recently, in order to improve the production efficiency of L-citrulline or L-arginine, genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used in the production of L-amino acids and other useful substances, to develop various recombinant strains or mutants having excellent L-citrulline or L-arginine production ability and methods for producing L-citrulline or L-arginine using the same. In microorganisms, L-glutamate is synthesized from 2-oxoglutarate, an intermediate of the citric acid cycle, and using this as a starting material, L-citrulline and L-arginine are synthesized through N-acetylglutamate, N-acetylglutamyl-P, N-acetylglutamate 5-semialdehyde, N-acetylornithine, and L-ornithine. Since various proteins such as enzymes, transcription factors, and transport proteins are involved in the stepwise biosynthesis process of L-citrulline or L-arginine in microorganisms, the production of L-citrulline or L-arginine can be increased by inducing mutations in the genes encoding these proteins or in the promoters that control their expression.

[0005] Korean Patent Publication No. 10-2007-0053321 discloses a technology for effectively producing L-glutamate by inducing mutations in 2-oxoglutarate dehydrogenase (odhA) of the 2-oxoglutarate dehydrogenase complex (ODHC), which is involved in removing a carboxyl group from 2-oxoglutarate in the citric acid cycle to produce succinyl-CoA, thereby reducing the activity of 2-oxoglutarate dehydrogenase and maintaining the growth rate of the strain. Korean Patent Publication No. 10-2008-0052593 discloses a method for producing L-amino acids from a microorganism in which the activity of ODHC is reduced by a transporter protein, wherein the transporter protein is a 2-oxoglutarate dehydrogenase inhibitor, OdhI, which inhibits the activity of ODHC in its non-phosphorylated state, and the phosphorylation of OdhI is prevented by inactivating the serine / threonine-protein kinase PknG. Therefore, it was confirmed that deletion of PknG or OdhI can effectively produce glutamate by reducing the activity of ODHC. However, deletion of PknG has the problem that it is highly likely to change the intracellular phosphate pool and it is difficult to predict this, and these prior documents do not disclose the effect of the weakening of ODHC activity on the production of L-citrulline or L-arginine.

[0006] Therefore, much research is still needed to increase the productivity of L-citrulline or L-arginine by regulating the activity of several proteins directly or indirectly involved in L-citrulline or L-arginine production.

[0007] [Prior Art Literature]

[0008] [Patent Document]

[0009] Korean Patent No. 10-2007-0053321

[0010] Korean Patent No. 10-2008-0052593

[0011] The present invention aims to provide a mutant microorganism having improved L-citrulline or L-arginine production ability.

[0012] In addition, the present invention aims to provide a method for producing L-citrulline or L-arginine using the mutant microorganism.

[0013] One aspect of the present invention provides a mutant microorganism having an improved ability to produce L-citrulline or L-arginine and a weakened activity of a protein encoded by the NCgl2653 gene.

[0014] The “NCgl2653 gene” used in the present invention encodes a transmembrane protein that mainly serves as a conduit for material transport by penetrating the intracellular double lipid layer, and the protein encoded by the NCgl2653 gene is GlnX, which activates the GlnH-GlnX-PknG-OdhI-OdhA signal transduction cascade via L-glutamic acid or L-aspartic acid outside the cell (Lea Sundermeyer et al., Microbiology Spectrum. 2022 Dec 21;10(6):e0267722.).

[0015] According to one specific example of the present invention, the NCgl2653 gene and the protein encoded therefrom may be inherent in a strain of the genus Corynebacterium.

[0016] Specifically, the genus Corynebacterium includes Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, and Corynebacterium Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium Corynebacterium pollutisoli, Corynebacterium imitans,These may include, but are not limited to, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacaterium pseudopelargi, and Corynebacterium flavescens.

[0017] According to one specific example of the present invention, the NCgl2653 gene may include a base sequence of SEQ ID NO: 1, and a protein encoded by the NCgl2653 gene may be composed of an amino acid sequence of SEQ ID NO: 2.

[0018] As used herein, “weakening of activity” or “weakening of activity” means that the activity of a target polypeptide or protein is reduced or absent compared to its intrinsic activity, and may be used interchangeably with terms such as inactivation, deficiency, reduction, and deterioration. Specifically, weakening of activity may include, but is not limited to, cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide possessed by the original microorganism, i.e., the wild type or pre-modified microorganism, due to a nucleotide modification of the gene encoding the polypeptide; cases where the overall activity level (expression level) of the polypeptide is lower than that of the original microorganism due to inhibition of expression or translation of the target gene, etc., due to a modification of the regulatory region of the gene encoding the polypeptide; cases where the activity of the polypeptide is absent even if the gene encoding the polypeptide is expressed; and combinations thereof.

[0019] The above nucleotide modification refers to a difference from the original polynucleotide sequence due to deletion, substitution, addition, or a combination thereof of all or part of the polynucleotide sequence of a gene encoding a polypeptide. The above regulatory region modification refers to a difference from the original polynucleotide sequence due to deletion, substitution, addition, or a combination thereof of all or part of the polynucleotide sequence of an element constituting a regulatory region, such as a promoter or enhancer, and for example, it may be replaced with a weak promoter so that the expression of a gene is reduced or suppressed. Here, a substitution refers to a change in which a base, nucleotide, polynucleotide, or nucleic acid is replaced with another base, nucleotide, polynucleotide, or nucleic acid. An insertion refers to a change in which another base, nucleotide, polynucleotide, or nucleic acid is added. A deletion refers to a change in which a base, nucleotide, polynucleotide, or nucleic acid is removed.

[0020] According to one specific example of the present invention, the weakening of the activity of the protein encoded by the NCgl2653 gene may be due to a nucleotide modification of the NCgl2653 gene, a regulatory region modification, or a combination thereof.

[0021] For example, the weakening of the activity of the protein encoded by the NCgl2653 gene may be due to, but is not limited to, some, specifically one or more base deletions in the base sequence of the NCgl2653 gene.

[0022] The base sequence of the NCgl2653 gene according to the present invention or the amino acid sequence of the protein encoded by the NCgl2653 gene may be composed of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity compared to the base sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2, and may have an original function. Here, “homology” or “identity” means the rate of agreement (%) between two sequences when a reference base sequence or amino acid sequence and any other base sequence or amino acid sequence are aligned and analyzed so as to correspond as much as possible.

[0023] As used herein, “improved productivity” means increased productivity of L-citrulline or L-arginine compared to the target of mutation (parent strain). The parent strain refers to a wild type or mutant strain that is the target of mutation, and includes a target that is directly subject to mutation or transformed with a recombinant vector, etc. In the present invention, the parent strain may be a microorganism or strain of the genus Corynebacterium that does not have L-citrulline or L-arginine production ability or has L-citrulline or L-arginine production ability, or a wild type Corynebacterium or a Corynebacterium genus mutated from the wild type.

[0024] According to one specific example of the present invention, the mutant microorganism may be a strain of the genus Corynebacterium.

[0025] For example, the mutant microorganism may be, but is not limited to, Corynebacterium glutamicum.

[0026] The mutant microorganism according to the present invention can have improved L-citrulline or L-arginine production ability by weakening or inactivating the activity of the protein encoded by the NCgl2653 gene.

[0027] Specifically, the mutant microorganism having enhanced L-citrulline or L-arginine production ability exhibits increased L-citrulline or L-arginine production ability compared to the parent strain, and in particular, the L-citrulline or L-arginine production is increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or by 1.1-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, It may be increased by 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times or 10 times, but is not limited thereto. For example, the mutant microorganism in which the activity of the protein encoded by the NCgl2653 gene is weakened or inactivated may have an L-citrulline or L-arginine production increased by 5% or more, specifically 5 to 40% (preferably 7 to 30%) compared to the parent strain.

[0028] A composition comprising a mutant microorganism according to the present invention can be used as a composition for producing L-citrulline or L-arginine.

[0029]

[0030] A mutant microorganism according to one specific example of the present invention can be implemented through a recombinant vector that deletes all or part of a gene encoding a protein encoded by the NCgl2653 gene in the parent strain.

[0031] The term "vector" as used herein refers to any type of nucleic acid sequence carrier structure used as a means for delivering and expressing a target gene to a mutation target (host cell). Unless otherwise specified, the vector may mean one that allows the carried nucleic acid sequence to be inserted into the host cell genome and expressed and / or to be expressed independently. Such a vector includes essential regulatory elements operably linked to allow the gene insert to be expressed, and "operably linked" means that the target gene and its regulatory sequence are functionally linked to each other to enable gene expression, and "regulatory elements" include a promoter for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0032] The vector used in the present invention is not particularly limited as long as it is replicable in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include, but are not limited to, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.

[0033] The above vector can typically be constructed as a cloning vector or an expression vector. The expression vector can be any vector commonly used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and can be constructed using various methods known in the art.

[0034] The “recombinant vector” used in the present invention can be constructed using a prokaryotic or eukaryotic cell as a host, and can replicate independently of the genome of the host cell or can be integrated into the genome itself. The host cell can replicate the vector, and can include an origin of replication, which is a specific base sequence where replication is initiated. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it typically includes a strong promoter capable of driving transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. In the case of using a eukaryotic cell as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0035] The above recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, ampicillin, kanamycin, streptomycin, and chloramphenicol.

[0036] A transformant can be created by inserting the above recombinant vector into a host cell, and the transformant can be obtained by introducing the recombinant vector into an appropriate host cell. Any host cell known in the art that can stably and continuously clone or express the expression vector can be used as the host cell.

[0037] When transforming prokaryotic cells to produce recombinant microorganisms, various intestinal bacteria and strains such as E. coli such as E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, E. coliXL1-Blue, Corynebacterium genus, Bacillus genus such as Bacillus subtilis, Bacillus thuringiensis, Salmonella typhimurium, Serratia marcescens, and Pseudomonas genus may be used as host cells, but are not limited thereto.

[0038] When transforming eukaryotic cells to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines, can be used as host cells, but are not limited thereto.

[0039] “Transformation” as used in the present invention refers to a phenomenon in which a genetic change is artificially caused by introducing external DNA into a host cell, and “transformant” refers to a host cell into which external DNA is introduced and in which the expression of a target gene is stably maintained.

[0040] The above transformation can be performed by selecting an appropriate vector introduction technique depending on the host cell, so that the target gene or the recombinant vector containing it can be expressed within the host cell. For example, vector introduction can be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene can be included without limitation, whether it is integrated into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell.

[0041] The above transformant includes cells transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.

[0042] Genes inserted into the recombinant vector for transformation of the present invention can be substituted into a host cell such as a microorganism of the genus Corynebacterium through homologous recombination crossing over.

[0043] According to one specific example of the present invention, the host cell may be a microorganism of the genus Corynebacterium, and for example, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0044]

[0045] Another aspect of the present invention provides a method for producing L-citrulline or L-arginine, comprising the steps of culturing the mutant microorganism in a medium; and recovering L-citrulline or L-arginine from the mutant microorganism or the medium in which the mutant microorganism is cultured.

[0046] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.

[0047] According to one specific embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for strains of the genus Corynebacterium can be found in a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but are not limited thereto.

[0048] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.

[0049] According to one specific example of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during cultivation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C. The culture period may continue until a desired amount of useful substances is obtained, and may be, for example, 10 to 160 hours.

[0050] According to one specific example of the present invention, the step of recovering L-citrulline or L-arginine from the cultured transformant or the medium in which the transformant is cultured may collect or recover the L-citrulline or L-arginine produced from the medium using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but is not limited thereto.

[0051] According to one specific example of the present invention, the step of recovering the L-citrulline or L-arginine may include removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0052] According to one specific example of the present invention, the step of recovering L-citrulline or L-arginine may include a process of purifying L-citrulline or L-arginine.

[0053] The mutant microorganism according to the present invention can improve the production yield of L-citrulline or L-arginine compared to before mutation by weakening or inactivating the activity of the protein encoded by the NCgl2653 gene.

[0054] The present invention will be described in more detail below. However, this description is provided merely as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.

[0055]

[0056] Example 1. Construction of NCgl2653 deletion strain

[0057] A mutant strain was created by deleting the NCgl2653 gene encoding GlnX in Corynebacterium glutamicum.

[0058]

[0059] 1-1. Vector for NCgl2653 deficiency

[0060] The chromosomal DNA of Corynebacterium glutamicum ATCC13032 was used as a template, and amplification was performed by PCR using a combination of primers 1 and 2 and a combination of primers 3 and 4, respectively. The obtained PCR products were amplified by crossover PCR using a combination of primers 1 and 4, and then the PCR products were inserted into the HindIII and XbaI sites of the pK19mobSacB vector (Gene, 145: 69-73, 1994) using Gibson Assembly Master Mix (NEB, USA) and restriction enzymes HindIII and XbaI (NEB, USA). The constructed vector was named pK19ms-△NCgl2653.

[0061] Wizard Genomic DNA Purification Kit (Promega, USA) was used to isolate chromosomal DNA from Corynebacterium glutamicum ATCC13032.

[0062] PCR was performed using KOD-Plus-Neo High fidelity DNA Polymerase (Toyobo, Japan) in a reaction solution containing 200 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), 0.2 μM of oligonucleotides, and 20 ng of chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template, in the presence of 1 unit of KOD-Plus-Neo DNA polymerase mixture, for 30 cycles. PCR was performed under the following conditions: i) pre-denaturation step: 94°C for 2 minutes, ii) denaturation step: 94°C for 10 seconds, iii) annealing step: 56°C for 30 seconds, and iv) extension step: 68°C for 1 to 3 minutes (giving a polymerization time of 30 seconds per 1 kb).

[0063] The primers used here are shown in Table 1 below.

[0064] Primer name Primer sequence (5'→3') Sequence number Primer 1tgattacgccaagctcgcaccagtgtcgcataaacc3 Primer 2gcgtcgaaaagcgtgcatctctgaatgctccccatttcC4 Primer 3ggaaatggggagcattcagagatgcacgcttttcgacgc5 Primer 4ccggggatcctctagagccatcggtgacacaaatgg6

[0065]

[0066] 1-2. NCgl2653 defective Corynebacterium glutamicum mutant strain

[0067] The NCgl2653 gene was deleted by introducing the pK19ms-△NCgl2653 vector into Corynebacterium glutamicum CT19b3 (accession number KCCM13451P), an L-citrulline-producing strain.

[0068] The above Corynebacterium glutamicum CT19b3 was prepared by culturing in RG medium (Brain Heart Infusion 40 g / L, Beef extract 10 g / L and Sorbitol 30 g / L) at 30°C.

[0069] The constructed pK19ms-△NCgl2653 vector was introduced into competent Corynebacterium glutamicum CT19b3 cells by electroporation, and then plated on CIT active KM agar medium and cultured in a 30℃ incubator for 2 days to obtain colonies. Four colonies in which the first homologous recombination was induced were patched onto 2YT sucrose agar medium and CIT active KM agar medium and cultured in a 30℃ incubator for 1 day to obtain a single colony. Colonies that were confirmed to grow poorly on 2YT sucrose agar medium but grew well on CIT active KM agar medium were inoculated into 2YT liquid medium and cultured for 12 hours. The culture was spread on 2YT sucrose agar, and the antibiotic marker (kanamycin) was removed through a second round of homologous recombination. Selected colonies were subjected to PCR and sequence analysis to confirm that the NCgl2653 gene had been deleted as intended. The NCgl2653 gene deletion strain generated through the above process was named CT20i.

[0070] The CIT active KM agar medium used here contained 10.5 g / L Glucose, 10 g / L Beef extract, 10 g / L Yeast extract, 10 g / L Polypeptone, 2.5 g / L NaCl, 100 mg / L Arginine, 2% Agar, and 30 ug / mL Kanamycin. The 2YT sucrose agar medium contained 150 g / L 2YT agar and 16 g / L Tryptone, 10 g / L Yeast extract, 5 g / L NaCl, and 2% agar.

[0071]

[0072] Comparative Example 1. Production of PknG-deficient strain

[0073] The gene encoding PknG was deleted in Corynebacterium glutamicum CT19b3.

[0074] A PknG-deficient strain was constructed in the same manner as in Example 1, except that the primers in Table 2 below were used, and was named CT20i2.

[0075] Primer namePrimer sequence (5'→3')Sequence numberPrimer 1gaccatgattacgccaagctacgatcaccgacgaacgc7Primer 2aaatagccccaagtcaaaacagaatcttcattatccttcatcgttttctg8Primer 3cagaaaacgatgaaggataatgaagattctgttttgacttggggctattt9Primer 4ggtacccggggatcctctaggttgcgtcggagtttgacg10

[0076]

[0077] Experimental Example 1. Evaluation of ODHC enzyme activity

[0078] The intracellular ODHC activity of the NCgl2653 deletion strain produced in Example 1 was evaluated compared to the parent strain Corynebacterium glutamicum CT19b3.

[0079] Each strain was inoculated into RG medium (Brain Heart Infusion 40 g / L, Beef extract 10 g / L, and Sorbitol 30 g / L), and cells corresponding to 8 mg (dry cell weight, DCW) were harvested after culturing at 30°C for 24 hours. Afterwards, a crude extract was obtained using a cell disruptor (GeneReady Ultracool), and enzyme activity was measured using an ODHC enzyme assay kit (Elabscience), and the results are shown in Table 3 below.

[0080] Strain ODHC activity (U / L) Parent strain_CT19b38.79CT20i3.29

[0081] As shown in Table 3 above, in the NCgl2653-deficient strain CT20i of Example 1, the NCgl2653 gene encoding GlnX, an upstream protein of OdhI in the GlnH-GlnX-PknG-OdhI-OdhA signal transduction cascade, was deleted, resulting in an increase in the activated form of OdhI, which in turn suppressed the activity of ODHC, and it was confirmed that the ODHC activity was weakened by about 2.7 times compared to the parent strain.

[0082]

[0083] Experimental Example 2. Evaluation of L-citrulline production capacity

[0084] The L-citrulline production ability of the NCgl2653 defective strain produced in Example 1 was evaluated in comparison with the parent strain Corynebacterium glutamicum CT19b3 and the PknG defective strain of Comparative Example 1.

[0085] Each strain was inoculated onto a CIT active agar plate in a 2 x 2 cm square shape and activated at 30°C for 24 hours. Afterwards, ¾ of the activated strain was looped out and inoculated onto citrulline titer medium (Glucose 5%, MgSO4 1 g / L, YSP 4 g / L, KH2PO4 0.8 g / L, Na2HPO4 1.2 g / L, (NH4)2SO4 30 g / L, FeSO4 20 mg / L, MnSO4 20 mg / L, ZnSO4 10 mg / L, Arginine 100 mg / L, Biotin 100 g / L, and Thiamine 200 ug / L) and cultured with shaking at 32°C and 190 rpm for 30 hours. After the culture was completed, the culture medium was diluted 50-fold with distilled water, filtered through a 0.45 μm filter, and the amino acids were detected and quantified using a high-performance liquid chromatograph (HPLC) equipped with a column (Avantor® Apollo C18, HPLC Columns) and a UV detector (338 nm). The results are shown in Table 5 below.

[0086] Relative values ​​compared to parent strain gDCWL-glutamate L-ornithine L-citrulline Parent strain_CT19b3 1.001.001.001.00 CT20i2 (△pknG) 1.180.300.581.10 CT20i (△NCgl2653) 1.240.170.721.12

[0087] As shown in Table 5 above, CT20i and CT20i2 showed a decrease in L-glutamate and L-ornithine production and an increase in L-citrulline production as cell numbers increased compared to the parent strain. This is thought to be due to a compensatory increase in cell numbers and an enhanced carbon flow in the citrulline biosynthetic pathway due to the impedimentation of aspartate decomposition and fumarate removal in the citric acid cycle caused by PknG or NCgl2653 deficiency. In particular, L-glutamate and L-ornithine production in CT20i was significantly reduced compared to CT20i2. These results suggest that L-citrulline productivity increased by decreasing the activity of ODHC due to a deficiency in the NCgl2653 gene encoding GlnX.

[0088]

[0089] Example 2. Construction of NCgl2653 deletion strain

[0090] The pK19ms-△NCgl2653 vector produced in Example 1 was introduced into Corynebacterium glutamicum 14GR (accession number KCCM13219P), an L-arginine-producing strain, to delete the NCgl2653 gene encoding GlnX.

[0091] The above Corynebacterium glutamicum 14GR was prepared by culturing in RG medium (Brain Heart Infusion 40 g / L, Beef extract 10 g / L and Sorbitol 30 g / L) at 30°C.

[0092] The constructed pK19ms-△NCgl2653 vector was introduced into competent Corynebacterium glutamicum 14GR cells by electroporation, and then plated on ARG active KM agar medium and cultured in a 30℃ incubator for 2 days to obtain colonies. Four colonies in which the first homologous recombination was induced were patched onto 2YT sucrose agar medium and ARG active KM agar medium, and cultured in a 30℃ incubator for 1 day to obtain a single colony. Colonies that were confirmed to grow poorly on 2YT sucrose agar medium but grew well on ARG active KM agar medium were inoculated into 2YT liquid medium and cultured for 12 hours. The culture was spread on 2YT sucrose agar, and the antibiotic marker (kanamycin) was removed through a second round of homologous recombination. The selected colonies were finally confirmed to have deleted the NCgl2653 gene as intended through PCR and sequence analysis. The NCgl2653 gene deletion strain created through the above process was named ARX1.

[0093] The ARG active KM agar medium used here contained 10.2 g / L Glucose, 10 g / L Beef extract, 10 g / L Yeast extract, 10 g / L Polypeptone, 2.5 g / L NaCl, 3 g / L Urea, 2 g / L (NH4)2SO4, 100 ug / L Biotin, 2% Agar, and 30 ug / mL Kanamycin. The 2YT sucrose agar medium contained 150 g / L 2YT agar and 16 g / L Tryptone, 10 g / L Yeast extract, 5 g / L NaCl, and 2% agar.

[0094]

[0095] Experimental Example 3. Evaluation of L-arginine production capacity

[0096] The L-arginine production ability of the NCgl2653 defective strain produced in Example 2 was evaluated compared to the parent strain Corynebacterium glutamicum 14GR.

[0097] Each strain was inoculated into a 2 x 2 cm square shape on an ARG active plate and activated at 30°C for 24 hours. Afterwards, ¾ of the activated strain was taken with a loop and inoculated into arginine titer medium (Glucose 8%, MgSO4 1 g / L, YSP 4 g / L, KH2PO4 2 g / L, Urea 2 g / L, (NH4)2SO4 40 g / L, FeSO4 20 mg / L, MnSO4 20 mg / L, Biotin 100 ug / L, and Thiamine 100 ug / L), and then cultured with shaking at 32°C and 190 rpm for 30 hours. After the culture was completed, the culture medium was diluted 50-fold with distilled water, filtered through a 0.45 μm filter, and the amino acids were detected and quantified using a high-performance liquid chromatograph (HPLC) equipped with a column (Avantor® Apollo C18, HPLC Columns) and a UV detector (338 nm). The results are shown in Table 6 below.

[0098] Relative values ​​compared to parent strain gDCWL-glutamateL-ornithineL-citrullineL-arginineParent strain_14GR0.1170.650.680.7023.82ARX1 (△NCgl2653)0.0870.210.741.1324.86

[0099] As shown in Table 6 above, ARX1 showed a decrease in L-glutamate production and an increase in L-ornithine, L-citrulline, and L-arginine production as cell numbers decreased compared to the parent strain. This is thought to be due to the release of the bottleneck in the citric acid cycle caused by the NCgl2653 deletion, which led to a decrease in cell numbers and enhanced carbon flow in the arginine biosynthetic pathway. These results suggest that the deletion of the NCgl2653 gene encoding GlnX increases L-arginine productivity by reducing the activity of ODHC.

[0100]

[0101] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0102] [Accession number]

[0103] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0104] Accession number: KCCM13451P

[0105] Date of acceptance: 20240104

[0106]

[0107] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0108] Accession number: KCCM13219P

[0109] Date of acceptance: 20220629

[0110]

Claims

1. A mutant microorganism having enhanced L-citrulline or L-arginine production ability and weakened activity of a protein encoded by the NCgl2653 gene.

2. In claim 1, A mutant microorganism in which the protein encoded by the above NCgl2653 gene is composed of the amino acid sequence of sequence number 2.

3. In claim 1, A mutant microorganism in which the activity of the protein encoded by the NCgl2653 gene is weakened by a nucleotide modification, a regulatory region modification, or a combination thereof of the NCgl2653 gene.

4. In claim 1, The above mutant microorganism is a mutant microorganism that is a strain of the genus Corynebacterium.

5. A step of culturing the mutant microorganism of claim 1 in a medium; and A method for producing L-citrulline or L-arginine, comprising a step of recovering L-citrulline or L-arginine from the mutant microorganism or the medium in which the mutant microorganism is cultured.

Citation Information

Patent Citations

  • Method for evaluating the adequacy of design changes of developed military equipment

    KR1020220003428A

  • Ammonia treatment system

    KR1020230144366A

  • Nutrient solution remote control system for HEMP(Cannabis sativa) using wireless communication

    KR1020240058396A

  • Process for producing L-arginine, L-ornithine or L-citrulline

    US7741081B2