Compositions and methods for organ and cell targeted delivery
Lipid nanoparticle compositions with covalent lipids enable targeted delivery of therapeutic agents to bone marrow and immune system organs, addressing the challenges of HSC delivery and reducing risks associated with viral vectors, thereby facilitating effective genome editing and treatment of genetic disorders.
Patent Information
- Application Number
- PCT/US2025/012598
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-22
- Filing Date
- 2025-01-22
- Publication Date
- 2025-07-31
AI Technical Summary
Current methods for delivering genetic medicine to hematopoietic stem cells (HSCs) are challenging due to the quiescent nature of HSCs and the sensitivity of the stem cell niche, with viral vectors posing risks of leukemogenesis and off-target cytotoxicity, necessitating the development of safe and effective synthetic delivery systems for genome editing in bone marrow.
Lipid nanoparticle compositions comprising covalent lipids and cationic lipids facilitate targeted delivery of therapeutic agents, such as nucleic acids, to specific organs like bone marrow by forming covalent bonds, enabling selective localization and efficient delivery to hematopoietic stem cells and other cells within the bone marrow.
The compositions achieve selective and efficient delivery of therapeutic agents to bone marrow and immune system organs, allowing for effective genome editing and treatment of genetic disorders, while minimizing risks associated with viral vectors.
Smart Images

Figure IMGF000005_0001 
Figure IMGF000006_0001 
Figure IMGF000006_0002
Abstract
Description
DESCRIPTIONCOMPOSITIONS AND METHODS FOR ORGAN AND CELL TARGETEDDELIVERY
[0001] This application claims the benefit of priority to United States Provisional Application No. 63 / 623,583 filed on January 22, 2024, the entire contents of which are incorporated herein.REFERENCE TO A SEQUENCE LISTING
[0002] This application contains a Sequence Listing XML, which has been submitted electronically and is hereby incorporated by reference in its entirety. Said XML Sequence Listing, created on January 22, 2025, is named UTFDP4285WO.xml and is 47,531 bytes in size.STATEMENT OF FEDERALLY SPONSORED RESEARCH
[0003] This invention was made with government support under Grant No. EB025192 and Grant No. CA269787 awarded by the National Institutes of Health. The government has certain rights in the invention.BACKGROUND OF THE INVENTION1. Field of the Invention
[0004] The present invention relates generally to the field of molecular biology. More particularly, it concerns tissue specific delivery of nucleic acids in lipid nanoparticles.2. Description of Related Art
[0005] Hematopoietic stem cells (HSCs) differentiate into many types of immune cells and erythrocytes erythrocytes (Laurenti & Gottgens, 2018). Thus, genetic disorders in HSCs account for numerous hematopoietic diseases including sickle cell anemia, β-thalassemia, cancer, and primary immune deficiencies (Bauer et al., 2006; Blaese et al., 1995; Boztug et al., 2010; Cowan et al., 2020; Gaspar et al., 2004; Kanter et al., 2022; Kohn & Kohn, 2021 ; Kondo. et al., 2003; Locatelli et al., 2022; Malech et al., 1997; Morgan et al., 2017). Although there have been reports of drug and nucleic acid delivery to bone marrow (BM), (Sago et al., 2018; Shi et al., 2023; Sou et al., 2011; Sou et al., 2005; Xue et al., 2022) direct in vivo gene editordelivery to genetically disordered HSCs remains challenging due to the quiescent nature of HSCs, the regulation of HSC niche (Boulais & Frenette, 2015; Ikonomi et al., 2020; Li, 2011; Man et al., 2021; Nakamura-Ishizu et al., 2014), and the sensitivity of the diseased and malignant stem cell niches to therapeutic intervention (Eppert et al., 2011; Lapidot et al., 1994; Mandal et al., 2018; Pei & Jordan, 2012). Recently, adenovirus vector systems demonstrated in vivo transduction of HSCs, which involved mobilization of HSCs from BM into periphery blood followed by intravenous injection of the adenovirus vectors (Li et al., 2020; Li et al., 2021a; Li et al., 2021b; Li et al., 2022; Psatha et al., 2021). While viral vectors have been safe and efficacious in rodents, the potential risks of leukemogenesis arising from random insertion, off-target cytotoxicity, and dose-limiting toxicides in humans could hinder further advancement (Muruve et al., 1999; Sweeney & De Ravin, 2023; Worgall et al., 1997; Lek et al., 2023). These concerns suggest a need to develop safe and effective synthetic delivery systems for genome editing in the BM.
[0006] Lipid nanoparticles (LNPs) are the most clinically advanced nucleic acid delivery platform as witnessed through its clinical use in intravenously administered siRNA LNP delivery to the liver and in intramuscular administered mRNA LNP COVID-19 vaccines, demonstrating advantages of low immunogenicity and enabling re-dosing feasibility over viral vectors (Hou et al., 2021). This technology recently experienced further progress in the ability to enable liver and non-liver (extrahepatic) delivery for mRNA and genome editor delivery (Cheng et al., 2020; Dilliard et al., 2021; Dilliard & Siegwart, 2023; Farbiak et al., 2021; Liu et al., 2021a; Liu et al., 2021b; Wang et al., 2023; Wei et al., 2020; Zhang et al., 2020). For example, the development of Selective ORgan Targeting (SORT) LNPs, in which the addition of a defined amount of ionizable lipids, positively charged lipids, or negatively charged lipids to the base 4-lipid LNP formulation, leads to exclusive mRNA delivery to liver, lung, and spleen, respectively (Cheng et al., 2020; Liu et al., 2021; Wei et al., 2020). This is mediated by an endogenous targeting mechanism in which inclusion of specific SORT lipids leads to distinct surface adsorption of serum proteins onto SORT LNPs which enable tunable delivery tropism (Dilliard et al., 2021; Dilliard & Siegwart, 2023). However, there remains an unmet need for the development of compositions and methods to deliver genetic medicine to other therapeutically relevant extrahepatic tissues.SUMMARY OF THE INVENTION
[0007] In some aspects, the present disclosure provides lipid compositions which facilitate organ specific delivery of the lipid composition, including lipid compositions further comprising a therapeutic agent. In some embodiments, the present disclosure may provide for specific delivery of lipid compositions to organs or tissue which are not targetable in a therapeutically useful manner according to presently known methods. In some embodiments, the present disclosure provides compositions for improved delivery of lipid compositions, including lipid compositions comprising a therapeutic agent, to target organs or tissue, such as a blood cell or a bone marrow. The presently disclosed compositions may be useful for delivery a nucleic acid component to a specific organ.
[0008] In some embodiments, the present disclosure provides a nanoparticle that contains a covalent lipid. In some embodiments, the covalent lipid is a covalent lipid shown in FIG. 4. In other embodiments, the covalent lipid is selected from Table 5. In further embodiments, the nanoparticle comprises a covalent lipid and a cationic lipid. In additional embodiments, the nanoparticle comprises a covalent lipid, a cationic lipid, and one or more additional lipids. Additionally, the nanoparticle comprises a therapeutic agent, such a nucleic acid or a single stranded or double stranded oligonucleotide. In certain aspects, the nanoparticle that contains a covalent lipid localizes to a patient’s bone marrow when administered to the patient.
[0009] In some aspects, the present disclosure provides compositions comprising:(A) a lipid nanoparticle comprising:(i) a covalent lipid; wherein the covalent lipid is an amino reactive group, a carboxylic acid reactive group, a thiol reactive group, a crosslinker comprising two or more amino reactive groups, carboxylic acid reactive groups, or thiol reactive groups, a covalent lipid of the formula:or a crosslinker of the formula:(ii) a cationic lipid;(iii) one or more additional lipids; and(B) a therapeutic agent encapsulated in the lipid nanoparticle.
[0010] In some embodiments, the covalent lipid is an amino reactive group. In some embodiments, the amino reactive group comprises an isocyanate group, an isothiocyanate group, an anhydride group, or an aldehyde group. In some embodiments, the amino reactive group comprises an isocyanate group. In some embodiments, the amino reactive group is further defined as:RiNCO wherein:Ri is alkyl(c≤24), substituted alkyl(c≤24), alkenyl(c≤24), or substituted alkenyl(c≤24).
[0011] In some embodiments, Ri is alkyl(c≤24) or substituted alkyk ^ i). In some embodiments, Ri is alkyl(C6-24).
[0012] In some embodiments, the covalent lipid is substituted phenyl. In some embodiments, the substituted phenyl has the formula:wherein:R300 is substituted alkyl(c≤24), alkyl(c≤24), hydroxy, or C(O)OH; and n is 1, 2, 3, 4, or 5.
[0013] In other embodiments, the amino reactive group comprises an isothiocyanate group. In some embodiments, the amino reactive group is further defined as:R2NCS wherein:R2 is alkyl(c≤24), substituted alkyl(C≤24), alkenyl(C≤24), or substituted alkenyl(c≤24).
[0014] In some embodiments, R2 is alkyl(c≤24) or substituted alkyl(c≤24). In some embodiments, R2 is alkyl(C6-24).
[0015] In other embodiments, the amino reactive group comprises an aldehyde group.In some embodiments, the amino reactive group is further defined as:R3C(O)H or R20R3C(O)H wherein:R3is alkyl(c≤24), substituted alkyl(c≤24), alkenyl(c≤24), or substituted alkenyl(c≤24), and R20 is C(O)H or an amino group.
[0016] In some embodiments, R3is alkyl(c≤24) or substituted alkyl(c≤24). In some embodiments, R3is alkyl(C6-24).
[0017] In other embodiments, the amino reactive group is an anhydride group. In some embodiments, the anhydride group is further defined as:wherein:R4 is alkyl(c≤24), substituted alkyl(c≤24), alkenyl(c≤24), or substituted alkenyl(c≤24); orwherein:R5and R5' are each independently alkyl(c≤24), substituted alkylc y,, alkenyl(c≤24), or substituted alkenyl(c≤24).
[0018] In some embodiments, R4 is alkyl(c≤24) or substituted alkyl(c≤24). In some embodiments, R4 is alkyl(C6 -24). In some embodiments, R5 is alkyl(c≤24) or substituted alkyl(c≤24). In some embodiments, R5 is alkyl(C6 -24). In some embodiments, R5' is alkyl(c≤24) or substituted alkyl(c≤24). In some embodiments, R5' is alkyl(c6-24).
[0019] In other embodiments, the covalent lipid is a covalent lipid of the formula:
[0020] In some embodiments, the covalent lipid is further defined as:wherein:R6is alkyl(c≤24), substituted alkyl(c≤24), alkenyl(c≤24), substituted alkenyl(c≤24), cycloalkyl(c≤24), substituted cycloalkyl(c≤24), cycloalkenyl(c≤24), substituted cycloalkenyl(c≤24), aryl(c≤24), substituted aryl(c≤24), aralkyl(c≤24), or substituted aralkyl(c≤24); andR7is hydrogen or -S(O)3-.
[0021] In some embodiments, the covalent lipid is a covalent lipid of the formula:wherein:Re is alkyl(c≤24), substituted alkyl(c≤24), alkenyl(c≤24), substituted alkenyl(c≤24), or (-CH2- O-CH2-)n, wherein: n is 1, 2, 3, or 4.
[0022] In some embodiments, Re is alkyl(c≤24) or substituted alkyl(c≤24). In some embodiments, Re is alkyl(C6-24). In other embodiments, the covalent lipid is a thiol reactive group. In some embodiments, the thiol reactive group comprises an a,P-unsaturated carbonyl. In some embodiments, the thiol reactive group is further defined by the formula:wherein:R8is alkyl(c≤24), substituted alkyl(c≤24), alkenyl(c≤24), or substituted alkenyl(c≤24); andXi is O or NRa, wherein Rais hydrogen, alkyl(c≤8), or substituted alkyf(c≤8).
[0023] In some embodiments, the thiol reactive group is further defined as:wherein:R8is alkyl(c≤24), substituted alkyl(c≤24), alkenyl(c≤24), or substituted alkenyfc 24>.
[0024] In some embodiments, the thiol reactive group is further defined as:wherein:
[0025] In some embodiments, R5is alkyl(c≤24) or substituted alky l(( 24j. In some embodiments, R5is alkyl(C6-24). In other embodiments, the thiol reactive group is maleimide or a disulfide. In other embodiments, the thiol reactive group is further defined as:wherein:R9 and R9' are each independently alkyl(c≤24), substituted alkyl(c≤24), alkenyl(c≤24), or substituted alkenyl (c≤24>; andRio is a maleimide or disulfide containing group.
[0026] In some embodiments, R9 is alkenyl;c≤24) or substituted alkenyl(c≤24). In some embodiments, R9 is alkenyl(c6-24). In some embodiments, R9' is alkenyl(c≤24) or substituted alkenyl(C≤24). In some embodiments, R9' is alkenyl(c6-24). In some embodiments, Rio is a maleimide containing group. In some embodiments, the maleimide containing group further comprises one or more methylene units. In some embodiments, the maleimide containing group further comprises a benzenediyl linker. In some embodiments, Rio is a disulfide containing group. In some embodiments, the disulfide containing group further comprises one or more methylene units. In some embodiments, the disulfide containing group further comprises a heteroaryl(c≤12) or substituted heteroaryl(c≤12).
[0027] In other embodiments, the covalent lipid is a carboxylic acid reactive group. In some embodiments, the carboxylic acid reactive group comprises a hydrazine or a carbodiimide group. In some embodiments, the carboxylic acid reactive group comprises a hydrazine.
[0028] In some embodiments, the carboxylic acid reactive group further defined by the formula:wherein:R11is alkyl(c≤24), substituted alkyl(c≤24), alkenyl(c≤24), substituted alkenyl(c≤24), aryl(c≤12), substituted aryl(c≤12), aralkyl<c≤18), or substituted aralkyl(c≤18>; andX2 is C(O), S(O)2, or a covalent bond.
[0029] In some embodiments, R11is alkyl(c≤24) or substituted alkyl(c≤24). In some embodiments, R11is aryl(c≤12) or substituted aryl(c≤12). In some embodiments, R11is aralkyl(c≤18) or substituted aralkyl(c≤18). In some embodiments, X2 is a covalent bond. In some embodiments, X2 is a C(O). In some embodiments, X2 is a S(O)2.
[0030] In other embodiments, the carboxylic acid reactive group further defined by the formula:wherein:R12 and R11' are each independently selected from alkyl(c≤24), substituted alkyl(c≤24), cycloalkyl(c≤12), or substituted cycloalky l(c≤i 2).
[0031] In some embodiments, R11is alkykc≤24) or substituted alkyl(c≤24). In some embodiments, R11is cycloalkyl(c≤n) or substituted cycloalky l(c≤i 2). In some embodiments, R11' is alkyl(c≤24) or substituted alkyl(c≤24). In some embodiments, R11' is cycloalkyfc n, or substituted cycloal ky I ,c n>-
[0032] In other embodiments, the covalent lipid is a crosslinker. In some embodiments, the crosslinker comprises two or more reactive heads selected from an amino reactive group, a carboxylic acid reactive group, or a thiol reactive group. In some embodiments, the reactive head is an amino reactive group and a thiol reactive group. In some embodiments, the reactive head is a thiol reactive group and a carboxylic acid reactive group. In some embodiments, the reactive head is two carboxylic acid reactive groups. In some embodiments, the reactive head is two amino reactive groups. In some embodiments, the reactive head is an amino reactive group of the formula:
[0033] In some embodiments, the reactive head is an amino reactive group of the formula:
[0034] In some embodiments, the reactive head is an amino reactive group of the formula:
[0035] In some embodiments, the reactive head is an amino reactive group of the formula:
[0036] In some embodiments, the reactive head is a thiol reactive group comprising an iodo group. In some embodiments, the reactive head is a thiol reactive group comprising a maleimide group. In some embodiments, the reactive head is a thiol reactive group comprising a disulfide. In some embodiments, the disulfide is a group of the formula:wherein:R13 is aryl(c≤12), substituted aryl(c≤12), heteroaryl<c≤12), or substituted heteroaryl(c≤12).
[0037] In some embodiments, RB is heteroaryl<c≤12) or substituted heteroaryl(c≤12). In some embodiments, the reactive head is a carboxylic acid reactive group of the formula:wherein:X2 is C(O), S(O)2, or a covalent bond.
[0038] In some embodiments, the crosslinker comprises a linker. In some embodiments, the linker is a hydrophobic component. In some embodiments, the hydrophobic component is one or more alkanediyl(c≤12) or substituted alkanediyl jc≤12) groups. In someembodiments, the hydrophobic component comprises one, two or three alkanediyhc i?) or substituted alkanediyl(c≤12) groups. In some embodiments, the hydrophobic component comprises one alkanediyl(c≤12) or substituted alkanediyl(c≤12) group. In some embodiments, the hydrophobic component is one or more arenediy 1(C212) or substituted arenediykc ni groups. In some embodiments, the hydrophobic component comprises one arenediybc i2j or substituted arenediyl(C≤i2) groups. In some embodiments, the hydrophobic component is one or more cycloalkanediyl(c≤12) or substituted cycloalkanediyl(c≤12) groups. In some embodiments, the hydrophobic component comprises one cycloalkanediyl(c±i2) or substituted cycloalkanediyl(c≤12) group. In some embodiments, the hydrophobic component comprises one or more joining groups. In some embodiments, the joining group is O, NRa, wherein Rais hydrogen, alkyl<C≤8), or substituted alkyl(C≤8), S, C(O), C(O)O, C(O)NRb, wherein Rb is hydrogen, alkyl<C≤8), or substituted alkyl(C≤8), S-S, or S(O)X, wherein x is 0, 1, or 2.
[0039] In some embodiments, the cationic lipid is an ionizable cationic lipid. In some embodiments, the cationic lipid is a dendron or dendrimer. In some embodiments, the cationic lipid is a compound of the formula:Core-Repeating Unit-Terminating Group (D-I) wherein the core is linked to the repeating unit by removing one or more hydrogen atoms from the core and replacing the atom with the repeating unit and wherein: the core has the formula:wherein:Xi is amino or alkylamino(C2i2), dialkylamino(C2i2), heterocycloalkyl(C2i2), heteroaryl(c≤12), or a substituted version thereof;Ri is amino, hydroxy, or mercapto, or alkylamino(c≤12), dialkylamino(c≤12), or a substituted version of either of these groups; and a is 1, 2, 3, 4, 5, or 6; or the core has the formula:wherein:X2is N(R5)y;R5is hydrogen, alkyl(c≤18), or substituted alkyl(c≤18); and y is 0, 1, or 2, provided that the sum of y and z is 3;R2 is amino, hydroxy, or mercapto, or alkylamino(c≤12), dialkylamino(c≤12), or a substituted version of either of these groups; b is 1, 2, 3, 4, 5, or 6; and z is 1, 2, 3; provided that the sum of z and y is 3; or the core has the formula:wherein:X3 is -N R6-, wherein R6is hydrogen, alkyl(C≤8), or substituted alkyl(C≤8), -O-, or alkylaminodiyl(C≤8), alkoxydiyl(C≤8), arenediyl(C≤8), heteroarenediyl (C≤8), heterocycloalkanediyl(C≤8), or a substituted version of any of these groups;R3 and R4 are each independently amino, hydroxy, or mercapto, or alkylamino(c≤12), dialkylaminO(c≤12), or a substituted version of either of these groups; or a groupwherein: e and f are each independently 1, 2, or 3; provided that the sum of e and f is 3;Rc, Rd, and Rf are each independently hydrogen, alkyl(c≤6), or substituted alkyl(c≤6); c and d are each independently 1, 2, 3, 4, 5, or 6; or the core is alkylamine (C≤8 ), dialkylamine(c≤36), heterocycloalkane(c≤12), or a substituted version of any of these groups; wherein the repeating unit comprises a degradable diacyl and a linker; the degradable diacyl group has the formula:wherein:Ai and A2 are each independently -O- , -S-, or -NRa-, wherein:Rais hydrogen, alkyfc ei. or substituted alkyl(c≤6);Y3 is alkanediyl(c≤12), alkenediyl(c≤12), arenediyl(c≤12), or a substituted version of any of these groups; or a group of the formula:wherein:X3 and X4 are alkanediyl(c≤12), alkenediyl(c≤12), arenediyfc i 21, or a substituted version of any of these groups;Y5 is a covalent bond, alkanediyl(c≤12i, alkenediyfc oi, arenediyl(c≤12), or a substituted version of any of these groups; andR9 is alkyl(C≤8> or substituted alkyl(C≤8>; the linker group has the formula:wherein:Yi is alkanediyl(c≤12), alkenediyl(c≤12), arenediyl(c≤12), or a substituted version of any of these groups; and wherein when the repeating unit comprises a linker group, then the linker group comprises an independent degradable diacyl group attached to both the nitrogen and the sulfur atoms of the linker group if n is greater than 1, wherein the first group in the repeating unit is a degradable diacyl group, wherein for each linker group, the next repeating unit comprises two degradable diacyl groups attached to the nitrogen atom of the linker group; and wherein n is the number of linker groups present in the repeating unit; and the terminating group has the formula:wherein:Y4 is alkanediyl(c≤24), alkanediyl(c≤24), or a substituted version thereof;Rio is hydrogen, amino, carboxy, hydroxy, oraryl(c≤12), alkylamino(c≤12), dialkylamino(c≤12), N-heterocycloalkyl(c≤12), -C(O)N(Ri i)-alkanediyl(c≤6)-heterocycloalkyl(c≤12), -C(O)-alkylamino(c≤12), -C(O)-dialkylamino(c≤12), -C(O)- N-heterocycloalkyl(C2i2), wherein:R11is hydrogen, alkyl(C≤6), or substituted alkyl(c≤6); wherein the final degradable diacyl in the chain is attached to a terminating group; n is 0, 1, 2, 3. 4, 5, or 6; or a pharmaceutically acceptable salt thereof.
[0040] In some embodiments, in Formula (D-I), the core is further defined by the formula:wherein:X2is N(R5)y;R5is hydrogen or alkyl(C≤8), or substituted alkyl(c≤18); and y is 0, 1, or 2, provided that the sum of y and z is 3;R2is amino, hydroxy, or mercapto, or alkylamino(c≤12), dialkylamino(c≤12), or a substituted version of either of these groups; b is 1, 2, 3, 4, 5, or 6; and z is 1, 2, 3; provided that the sum of z and y is 3.
[0041] In some embodiments, in Formula (D-I), the core is further defined as:wherein:X3 is -NR5-, wherein R6is hydrogen, alkyl(C≤8), or substituted alkyl<C≤8), -O-, or alkylaminodiyl(C≤8), alkoxydiyl(C≤8), arenediyl(C≤8), heteroarenediyl(C≤8), heterocycloalkanediyl(C≤8), or a substituted version of any of these groups;R3 and R4 are each independently amino, hydroxy, or mercapto, or alkylamino(c≤12), dialkylamino(c≤12), or a substituted version of either of these groups; or a groupwherein: e and f are each independently 1. 2, or 3; provided that the sum of e and f is 3;Rc, Rd, and Rf are each independently hydrogen, alkyl(c≤6), or substituted alkyl(c≤6); c and d are each independently 1, 2, 3, 4, 5, or 6.
[0042] In some embodiments, in Formula (D-I), the core is further defined as:
[0044] In some embodiments, in Formula (D-I), the core is further defined as:
[0045] In some embodiments, Ai and A2 are O. In some embodiments, Y3 is alkanediyl(c≤12) or substituted alkanediyl(c≤12). In some embodiments, Yi is alkanediyl(c≤12) or substituted alkanediyl(c≤12).
[0046] In some embodiments, the terminating group is further defined as:wherein:Y4 is alkanediyl(c≤18) or alkenediyl(c≤18); andRio is hydrogen.
[0047] In some embodiments, the terminating group is further defined as:wherein:Y4 is alkanediyl(c≤18); andRio is hydrogen.
[0048] In some embodiments, the dendrimer or dendron is further defined as:R' is alkyl(c≤18), alkenyl(c≤18), or a substituted version thereof.
[0049] In some embodiments, the dendrimer or dendron is further defined as:wherein:R' is alkyl(c≤18), alkenyl(c≤18), or a substituted version thereof.
[0050] In some embodiments, the dendrimer or dendron is further defined as:wherein:R' is alkyl(C6-i8).
[0051] In some embodiments, the ionizable cationic lipid is a dendrimer or dendron of a generation (g) having a structural formula:or a pharmaceutically acceptable salt thereof, wherein:(a) the core comprises a structural formula (Xcore):wherein:Q is independently at each occurrence a covalent bond, -O-, -S-, -NR2-, or -CR3aR3b-;R2is independently at each occurrence Rlgor -L2-NRleRlf;R3aand R3bare each independently at each occurrence hydrogen or an optionally substituted (e.g., Ci-Ce, such as C1-C3) alkyl;Rla, Rlb, Rlc, Rld, Rle, Rlf, and Rlg(if present) are each independently at each occurrence a point of connection to a branch, hydrogen, or an optionally substituted (e.g., Ci- C12) alkyl;L°, L1, and L2are each independently at each occurrence selected from a covalent bond, (e.g., C1-C12, such as Ci-Ce or C1-C3) alkylene, (e.g., C1-C12, such as Ci-Cs or Ci-Ce) heteroalkylene (e.g., Ci-Cs alkyleneoxide, such as oligo(ethyleneoxide)), [(e.g., Ci-Ce) alkylene]-[(e.g., C4-C6) heterocycloalkyl]-[(e.g., Ci-Ce) alkylene], [(e.g., Ci-Ce) alkylene]- ( arylene)- [(e.g., Ci-Ce) alkylene] (e.g., [(e.g., Ci-Ce) alkylene]-phenylene-[(e.g., Ci-Ce) alkylene]), (e.g., C4-C6) heterocycloalkyl, and arylene (e.g., phenylene); or, alternatively, part of L1form a (e.g., C4-G) heterocycloalkyl (e.g., containing one or two nitrogen atoms and, optionally, an additional heteroatom selected from oxygen and sulfur) with one of Rlcand Rld; and x1is 0, 1, 2, 3, 4, 5, or 6; and(b) each branch of the plurality (N) of branches independently comprises a structural formula (XB ranc h):wherein:* indicates a point of attachment of the branch to the core; g is 1, 2, 3, or 4;Z = 2(g4);G=0, whenwhen g / 1;(C) each diacyl group independently comprises a structural formula iherein:* indicates a point of attachment of the diacyl group at the proximal end thereof;** indicates a point of attachment of the diacyl group at the distal end thereof;Y3is independently at each occurrence an optionally substituted (e.g., C1-C12); alkylene, an optionally substituted (e.g., C1-C12) alkenylene, or an optionally substituted (e.g., C1-C12) arenylene; A1and A2are each independently at each occurrence -O-, -S-, or -NR4-, wherein:R4is hydrogen or optionally substituted (e.g., Ci-Ce) alkyl; m1and m2are each independently at each occurrence 1, 2, or 3; andR3C, R3d, R3e, and R3fare each independently at each occurrence hydrogen or an optionally substituted (e.g., Ci-Cs) alkyl; and(d) each linker group independently comprises a structural formula wherein:** indicates a point of attachment of the linker to a proximal diacyl group;*** indicates a point of attachment of the linker to a distal diacyl group; andYi is independently at each occurrence an optionally substituted (e.g., C1-C12) alkylene, an optionally substituted (e.g., C1-C12) alkenylene, or an optionally substituted (e.g., C1-C12) arenylene; and(e) each terminating group is independently selected from optionally substituted (e.g., Ci- Ci8, such as C4-C18) alkylthiol, and optionally substituted (e.g., Ci-Cis, such as C4- Cis) alkenylthiol.
[0052] In some embodiments, x1is 0, 1, 2, or 3. In some embodiments, Rla, Rlh, Rlc, Rld, Rle, Rlf, and Rlg(if present) are each independently at each occurrence a point of connection to a branch (e.g., as indicated by *), hydrogen, or C1-C12 alkyl (e.g., Ci-Cs alkyl, such as Ci-Ce alkyl or C1-C3 alkyl), wherein the alkyl moiety is optionally substituted with one or more substituents each independently selected from -OH, C4-C8 (e.g., C4-C6) heterocycloalkyl (e.g., piperidinyl (e.g.,), 1V-(CI-C3alkyl) -piperidinyl (e.g.,, p p y .g., ), JV-(CI-C3alkyl)-piperadizinyl morpholinyl (e.g.,), / V-pyrrolidinyl (e.g.,), pyrrolidinyl (e.g(C1-C3 alkyl)-pyrrolidinyl (e.g., aryl, and C3-C5 heteroaryl (e.g., imidazolyl (e.g.,), or pyrisome embodiments, Rla, Rlb, Rlc,Rld, Rle, Rlf, and Rlg(if present) are each independently at each occurrence a point of connection to a branch (e.g., as indicated by *), hydrogen, or C1-C12 alkyl (e.g., Ci-Cs alkyl, such as Ci-Ce alkyl or C1-C3 alkyl), wherein the alkyl moiety is optionally substituted with one substituent -OH. In some embodiments, R3aand R3bare each independently at each occurrence hydrogen. In some embodiments, the plurality (N) of branches comprises at least 3 (e.g., at least 4, or at least 5) branches. In some embodiments, g=l; G=0; and Z=l. In some embodiments, each branch of the plurality of branches comprises a structural formula* -(-diacyl group ^-(terminating groupIn some embodiments, g=2; G=l; and Z=2. In some embodiments, each branch of the plurality of branches comprises a structural formula
[0054] In some embodiments, the core comprises a structural formula:
[0055] In some embodiments, the core comprises a structural formula selected from the, and pharmaceutically acceptable salts thereof, wherein * indicates a point of attachment of the core to a branch of the plurality of branches.
[0056] In some embodiments, the core has the structure, wherein * indicates a point of attachment of the core to a branch of the plurality of branches or H, wherein at least 2 (e.g., at least 3, or at least 4) branches are attached to the core.
[0057] In some embodiments, the core has the structure, wherein * indicates a point of attachment of the core to a branch of the plurality of branches or H, wherein at least 4 (e.g., at least 5, or at least 6) branches are attached to the core.
[0058] In some embodiments, A1is -O- or -NH-. In some embodiments, A2is -O- or - NH-. In some embodiments, Y3is C1-C12 (e.g., Ci-Ce, such as C1-C3) alkylene. In some embodiments, the diacyl group independently at each occurrence comprises a structuralsuch as), optionally wherein R3c, R3d, R3e, and R3fare each independently at each occurrence hydrogen or C1-C3 alkyl.
[0059] In some embodiments, each terminating group is independently Ci-Cis (e.g., Cr-Cis) alkenylthiol or Ci-Cis (e.g., C4-C18) alkylthiol. In some embodiments, each terminating group is independently Ci-Cis (e.g., C4-C18) alkenylthiol or Ci-Cis (e.g., C4-C18) alkylthiol.
[0060] In some embodiments, the composition comprises from about 1% w / w to about 40% w / w of the covalent lipid relative to the total lipid composition. In some embodiments, the composition comprises from about 5% w / w to about 30% w / w of the covalent lipid relative to the total lipid composition. In some embodiments, the composition comprises from about 15% w / w to about 25% w / w of the covalent lipid relative to the total lipid composition. In some embodiments, the composition comprises from about 1% w / w to about 40% w / w of the cationic lipid relative to the total lipid composition. In some embodiments, the composition comprises from about 5% w / w to about 30% w / w of the cationic lipid relative to the total lipid composition. In some embodiments, the composition comprises from about 15% w / w to about 25% w / w of the cationic lipid relative to the total lipid composition.
[0061] In some embodiments, the composition comprises two or more helper lipids. In some embodiments, the helper lipids include one or more sterol or sterol derivative. In some embodiments, the sterol or sterol derivative is cholesterol.
[0062] In some embodiments, the helper lipids include one or more phospholipids. In some embodiments, the phospholipid comprises one or two long chain alkyl or alkenyl groups, a glycerol or a sphingosine, one or two phosphate groups, and a small organic molecule, wherein the small organic molecule is an amino acid, a sugar, a neurotransmitter, a vitamin, a hormone, a peptide, or an amino substituted alkoxy group. In some embodiments, the phospholipid is l,2-distearoyl-5n-glycero-3-phosphocholine (DSPC) or 1 ,2-dioleoyl-.vn- glycero-3 -phosphoethanolamine (DOPE). In some embodiments, the phospholipid is DOPE.
[0063] In some embodiments, the helper lipids further comprises a polymer-conjugated (e.g., PEGylated) lipid. In some embodiments, the polymer-conjugated lipid comprises a polyethylene glycol (PEG) component from about 1000 to about 10,000 daltons. In some embodiments, the polymer-conjugated lipid is a PEGylated diacylglycerol. In some embodiments, the polymer-conjugated lipid is further defined by the formula:wherein:R12 and Ri - are each independently alkyl(c≤24), alkenyl(c≤24), or a substituted version of either of these groups;Reis hydrogen, alkyl(C≤8), or substituted alkyl(C≤8); and x is 1-250.
[0064] In some embodiments, the polymer-conjugated lipid is a PEGylated dimyristoyl-sn-glycerol or a compound of the formula:wherein: m is 5-250; and nz and ns are each independently 2-25.
[0065] In some embodiments, the composition comprises a polyethylene glycol functionalized sugar, amino acid, peptide, protein, or antibody.
[0066] In some embodiments, the composition comprises a molar ratio from about 5 to about 50 of the phospholipid relative to the total lipid composition. In some embodiments, the molar ratio is from about 10 to about 45 of the phospholipid relative to the total lipid composition. In some embodiments, the molar ratio is from about 20 to about 40 of the phospholipid relative to the total lipid composition. In some embodiments, the composition comprises a molar ratio from about 10 to about 60 of the sterol relative to the total lipid composition. In some embodiments, the molar ratio is from about 15 to about 50 of the sterol relative to the total lipid composition. In some embodiments, the molar ratio is from about 25 to about 50 of the sterol relative to the total lipid composition. In some embodiments, the composition comprises a molar ratio from about 0.25 to about 12.5 of the polymer-conjugated lipid relative to the total lipid composition. In some embodiments, the molar ratio is from about 0.5 to about 10 of the polymer-conjugated lipid relative to the total lipid composition. In some embodiments, the molar ratio is from about 1 to about 6 of the polymer-conjugated lipid relative to the total lipid composition.
[0067] In some embodiments, the therapeutic agent is one or more small molecule therapeutic agent. In some embodiments, the therapeutic agent is one or more protein or peptide. In some embodiments, the therapeutic agent is one or more nucleic acid. In someembodiments, the nucleic acid is selected from a short (small) interfering RNA (siRNA), a microRNA (miRNA), a messenger RNA (mRNA), a cluster regularly interspaced short palindromic repeats (CRISPR) RNA (crRNA), a trans-activating crRNA (tracrRNA), a single guide RNA (sgRNA), a transfer RNA (tRNA), a plasmid DNA (pDNA), a double stranded DNA (dsDNA), a single stranded DNA (ssDNA), a single stranded RNA (ssRNA), a double stranded RNA (dsRNA), a locked nucleic acid (LNA), a peptide nucleic acid (PNA), a miRNA mimic, and a anti-miRN A. In some embodiments, the therapeutic agent comprises two or more nucleic acids. In some embodiments, the two or more nucleic acids are selected from:(1) a polynucleotide comprising a sequence encoding a polynucleotide-guided nuclease;(2) a guide polynucleotide (e.g., configured to complex with at least a portion of a target gene or transcript, or a polynucleotide comprising a sequence that encodes the guide polynucleotide); and(3) a donor polynucleotide (e.g., configured to repair a modified target gene or transcript).
[0068] In some embodiments, the composition comprises a weight ratio of lipid components to nucleic acid of from about 100:1 to about 1: 1. In some embodiments, the composition comprises a weight ratio of lipid components to nucleic acid of from about 50: 1 to about 5:1. In some embodiments, the composition comprises a combination of nucleic acids that may be used as a CRISPR system.
[0069] In some embodiments, the composition is formulated with a pharmaceutically acceptable carrier. In some embodiments, the composition is formulated for administration: orally, intraadiposally, intraarterially, intraarticularly, intracranially, intradermally, intralesionally, intramuscularly, intranasally, intraocularly, intrapericardially, intraperitoneally, intrapleurally, intraprostatically, intrarectally, intrathecally, intratracheally, intratumorally, intraumbilically, intravaginally, intravenously, intravesicularly, intravitreally, liposomally, locally, mucosally, parenterally, rectally, subconjunctivally, subcutaneously, sublingually, topically, transbuccally, transdermally, vaginally, in cremes, in lipid compositions, via a catheter, via a lavage, via continuous infusion, via infusion, via inhalation, via injection, via local delivery, or via localized perfusion. In some embodiments, the composition is formulated for aerosol, intravenous, intraperitoneal, subcutaneous, topical, or oral administration. In some embodiments, the composition is formulated for injection such asfor intraperitoneal injection or intravenous injection. In some embodiments, the composition is formulated for inhalation. In some embodiments, the composition when administered preferentially localizes in the bone marrow, an immune system organ, or a blood cell. In some embodiments, the composition localizes in the bone marrow. In some embodiments, the bone marrow comprises hematopoietic stem cells. In some embodiments, the bone marrow comprises one or more progenitor cells. In some embodiments, the bone marrow comprises one or more endothelial cell. In some embodiments, the bone marrow comprises one or more stromal cell. In some embodiments, the bone marrow comprises one or more mesenchymal stem cell. In some embodiments, the composition localizes in a blood cell. In some embodiments, the blood cell is a B lymphocyte cell. In other embodiments, the blood cell is a T lymphocyte cell. In other embodiments, the blood cell is a macrophage. In other embodiments, the blood cell is a monocyte. In other embodiments, the blood cell is a neutrophil. In other embodiments, the blood cell is an eosinophil. In other embodiments, the blood cell is a basophil. In other embodiments, the blood cell is an erythrocyte. In other embodiments, the blood cell is a mast cell. In other embodiments, the blood cell is a large granular lymphocyte. In other embodiments, the blood cell is a small lymphocyte. In other embodiments, the blood cell is a megakaryocyte. In other embodiments, the blood cell is a thrombocyte.
[0070] In some embodiments, the composition localizes to an immune system organ. In some embodiments, the immune system organ is one or more lymph nodes or lymph vessels. In some embodiments, the immune system organ is a thymus. In some embodiments, the immune system organ is the spleen. In some embodiments, the composition localizes into at least 5% of the bone marrow, immune system organ, or blood cells. In some embodiments, the composition localizes into at least 10% of the bone marrow, immune system organ, or blood cells. In some embodiments, the composition localizes into at least 20% of the bone marrow, immune system organ, or blood cells.
[0071] In still yet another aspect, the present disclosure provides methods of treating a patient with a disease or disorder comprising administering to the patient in need thereof a therapeutically effective amount of a composition described herein.
[0072] In some embodiments, the disease or disorder is a disease of the blood. In other embodiments, the disease or disorder is a disease of the bone marrow. In other embodiments, the disease or disorder is a disease of the bone. In other embodiments, the disease or disorderis a disease of the immune system organs. In other embodiments, the disease or disorder is a cancer of the blood or bone marrow.
[0073] In still yet another aspect, the present disclosure provides methods of delivering a therapeutic agent to a blood cell or a bone marrow cell comprising using a composition described herein. In some embodiments, the bone marrow cell is hematopoietic stem cells. In other embodiments, the bone marrow cell is one or more progenitor cells. In some embodiments, the blood cell is a B lymphocyte cell. In other embodiments, the blood cell is a T lymphocyte cell. In other embodiments, the blood cell is a macrophage. In other embodiments, the blood cell is a monocyte. In other embodiments, the blood cell is a neutrophil. In other embodiments, the blood cell is an eosinophil. In other embodiments, the blood cell is a basophil. In other embodiments, the blood cell is an erythrocyte. In other embodiments, the blood cell is a mast cell. In other embodiments, the blood cell is a large granular lymphocyte. In other embodiments, the blood cell is a small lymphocyte. In other embodiments, the blood cell is a megakaryocyte. In other embodiments, the blood cell is a thrombocyte.
[0074] In yet another aspect, the present disclosure provides methods of editing the genome of a blood cell or a bone marrow cell comprising using a composition described herein, wherein the composition comprises a therapeutic agent suitable to edit the genome.
[0075] In some embodiments, the bone marrow cell is hematopoietic stem cells. In other embodiments, the bone marrow cell is one or more progenitor cells. In some embodiments, the blood cell is a B lymphocyte cell. In other embodiments, the blood cell is a T lymphocyte cell. In other embodiments, the blood cell is a macrophage. In other embodiments, the blood cell is a monocyte. In other embodiments, the blood cell is a neutrophil. In other embodiments, the blood cell is an eosinophil. In other embodiments, the blood cell is a basophil. In other embodiments, the blood cell is an erythrocyte. In other embodiments, the blood cell is a mast cell. In other embodiments, the blood cell is a large granular lymphocyte. In other embodiments, the blood cell is a small lymphocyte. In other embodiments, the blood cell is a megakaryocyte. In other embodiments, the blood cell is a thrombocyte.
[0076] In another aspect, the present disclosure provides methods of treating a disease affecting one or more blood cells or bone marrow cells comprising delivering a blood cell or abone marrow cell comprising using a composition described herein, wherein the composition comprises a therapeutic agent suitable to treat the disease.
[0077] In some embodiments, the bone marrow cell is hematopoietic stem cells. In other embodiments, the bone marrow cell is one or more progenitor cells. In some embodiments, the blood cell is a B lymphocyte cell. In other embodiments, the blood cell is a T lymphocyte cell. In other embodiments, the blood cell is a macrophage. In other embodiments, the blood cell is a monocyte. In other embodiments, the blood cell is a neutrophil. In other embodiments, the blood cell is an eosinophil. In other embodiments, the blood cell is a basophil. In other embodiments, the blood cell is an erythrocyte. In other embodiments, the blood cell is a mast cell. In other embodiments, the blood cell is a large granular lymphocyte. In other embodiments, the blood cell is a small lymphocyte. In other embodiments, the blood cell is a megakaryocyte. In other embodiments, the blood cell is a thrombocyte.
[0078] As used herein, “essentially free,” in terms of a specified component, is used herein to mean that none of the specified component has been purposefully formulated into a composition and / or is present only as a contaminant or in trace amounts. The total amount of the specified component resulting from any unintended contamination of a composition is preferably below 0.01%. Most preferred is a composition in which no amount of the specified component can be detected with standard analytical methods.
[0079] As used herein in the specification and claims, “a” or “an” may mean one or more. As used herein in the specification and claims, when used in conjunction with the word “comprising”, the words “a” or “an” may mean one or more than one. As used herein, in the specification and claim, “another” or “a further” may mean at least a second or more.
[0080] As used herein in the specification and claims, the term “about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.
[0081] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating certain embodiments of the invention, are given by way of illustration only, since various changes and modifications withinthe spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF THE DRAWINGS
[0082] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0083] FIG. 1 shows the molecular structures of tested biologically active molecules in search for novel in vivo mRNA delivery tropism. Red: 16 sugar and lipidized sugar molecules. Orange: 6 vitamin molecules. Green: 7 lipidized amino acid molecules. Cyan: 5 hormone molecules. Blue: 5 neurotransmitter molecules. Purple: 1 lipidized nucleotide and 1 N-hydroxy succinimide ester lipid.
[0084] FIG. 2 shows the bioluminescence image of dissected femurs collected from mouse injected with 20% stearic acid NHS ester-mDLNP, 20% stearic acid-mDLNP, and 20% 5-Octylthieno[3,4-c]pyrrole-4,6-dione-mDLNP formulations, the molecular structures of tested molecules, and average luminescence intensity of dissected femurs. N=3, femurs were collected 6 hours after injection.
[0085] FIG. 3A-3D: FIG. 3A shows a schematic representation of LNP preparation, including covalent lipid species (covalent lipids and crosslinkers). FIG. 3B is an illustration showing that the addition of a covalent lipid or crosslinker to the base 4-lipid LNP formulation leads to BM mRNA delivery and genome editing in the great breadth of unique BM cell types. FIGS. 3C and 3D show bioluminescence images of dissected femurs, summary of average bioluminescence signal intensity on dissected femurs, and represented (FIG. 3C) covalent lipids and (FIG. 3D) crosslinker molecular structures. Femurs were harvested from mice 6 hours after the injection of BM homing LNPs.
[0086] FIG. 4 shows the molecular structures of tested covalent lipids (green, orange and purple) and crosslinkers (green-orange, orange-purple, purple, and green). Covalent lipid: molecules in 1) green box are reactive to amines; 2) orange box are reactive to thiols; 3) purple box are reactive to carboxylic acids. Crosslinkers: molecules in 1) green-orange box are reactive to amines and thiols; 2) orange-purple box are reactive to thiols and carboxylic acids; 3) purple box are reactive to carboxylic acids; 4) green box are reactive to amines.
[0087] FIGS. 5A-5E illustrate that tdTomato (tdTom) expression in BM cells was activated by Cre mRNA BM homing LNP delivery. FIG. 5 A is a schematic illustration showing how delivery of Cre mRNA activates tdTom expression in tdTom transgenic mice via Cre- mediated genetic deletion of the stop cassette. FIG. 5B shows bone marrow tdTom fluorescence detected / quantified 72 hours after IV injection of LNPs loaded with Cre mRNA. FIG. 5C shows in vivo evaluation of 23 BM homing formulations in tdTom reporter mice showing the fluorescence images of dissected femur bones. FIG. 5D shows confocal microscope imaging on BM slices that confirm tdTom activation in BM. Scale bar: 100 pm. FIG. 5E shows flow cytometry data used to quantify Cre mRNA delivery efficacy in various BM cell types.
[0088] FIG. 6: presents the FACS gating strategy for analysis of tdTom+ cells in hematopoietic stem and progenitor cells (HSPCs). Live-Dead aqua was used to distinguish live cells. Lineage cocktail assay was used to distinguish Lin- cell populations. CD117 and Sca-1 were used to distinguish L-S-K+and L S+K+populations. CD34 and CD135 were used to distinguish LT-HSC, LMPP and MPP in L‘S+K+cells. CD34 and CD 16 / 32 were used to distinguish MEP, CMP and GMP in L-S-K+cells.
[0089] FIG. 7 presents the FACS gating strategy for analysis of tdTom+ cells in B cells. Live-Dead aqua was used to distinguish live cells. B220 and CD3, Ly-6G, CD 11b, and TER- 119 were used to distinguish B cells.
[0090] FIG. 8 presents the FACS gating strategy for analysis of tdTom+ cells in T cells. Live-Dead aqua was used to distinguish live cells. CD3 was used to distinguish T cells. CD4 and CD8 were used to distinguish CD4+ and CD8+ T cells, respectively.
[0091] FIG. 9 presents the FACS gating strategy for analysis of tdTom+ cells in macrophage, monocytes and neutrophils. Live-Dead aqua was used to distinguish live cells. CD 11b and Ly-6G were used to distinguish neutrophils and macrophage / monocytes. F4 / 80 was used to distinguish macrophage and monocytes.
[0092] FIGS. 10A-10D show factors that do and do not contribute to BM delivery tropism. FIG. 10A and FIG. 10B: Size and ξ-potential of selected BM homing LNPs determined by dynamic light scattering (DLS). FIG. 10C: The protein composition of LNP surface adsorbed protein corona determined by unbiased mass spectrometry proteomics. FIG. 10D: Comparison of luminescence signal intensity of selected BM homing LNPs injected into wild type (wt) C57BL / 6 mice and ApoE knockout (ApoE- / -) mice (n=3).
[0093] FIGS. 11A-11B: FIG. 11 A: tdTom+% of each BM cell type after 1 or 2 LNP injections encapsulating Cre mRNA (0.6 mg / kg). Injection interval is 1 week for the 2 injections group and BM was harvested 3 days after the last injection. FIG. 11B: n=3 for selected formulations delivering Cre mRNA into tdTomato mice. tdTom+% was determined by flow cytometry
[0094] FIGS. 12A-12G shows in vivo CRISPR / Cas mediated genome editing of β- globin disorder relevant genes in HBBS / S Townes mice. FIG. 12A: The extended β-globin locus, showing the target BCL11A binding motif in the promoters of the genes encoding y- globin. BCL11 A binding motif is represented by a red line and sgG34 is represented by a green line (SEQ ID NOs: 21 & 22). FIG. 12B: HBBS / S Townes mice received two weekly IV injections of BM homing LNPs encapsulating Cas9 mRNA and sgG34 or ABE8e_NRCH mRNA and sgHBB (n=3, total RNA dose per injection was 3 mg / kg). BM samples were harvested and analyzed 7 days after the final injection. FIG. 12C: Insertions and deletions (Indels) detected in CD 117+ cells isolated from the bone marrow of HBBS / S Townes mice. FIG. 12D: Representative NGS reads of an LNP (encapsulating Cas9 mRNA and sgG34) treated sample (SEQ ID NOs: 23-30). FIG. 12E: The edited region of HBB with the target A at protospacer position 7 shown in orange and bystander edit in blue (silent). sgHBB is represented by a purple line (SEQ ID NOs: 31 & 32). FIG. 12F: A-G conversion detected in CD117+ cells isolated from the bone marrow of HBBS / S Townes mice. FIG. 12G: Representative NGS reads of an LNP (encapsulating ABE8e_NRCH mRNA and sgHBB) treated sample (SEQ ID NOs: 33-39).
[0095] FIGS. 13-13G provide evidence that tdTom expression in MLL-AF9 driven AML model was activated by BM homing LNP mediated editing. (FIG. 13A) The MLL-AF9- IRES-YFP gene was installed into the genome of Lin" cells extracted from fetal liver of tdTom reporter mice and the cells were incubated with LNPs containing Cre mRNA in a 24 well plate for 24 hours. (FIG. 13B) Delivery of Cre mRNA activates tdTom expression in tdTom transgenic mice via Cre-mediated genetic deletion of the stop cassette. (FIG. 13C) Summary of the percentage of tdTom+ cells measured from confocal microscope images of edited MLL- AF9-IRES-YFP Lin" cells (n=3). (FIG. 13D) Representative confocal microscope images of control and LNP treated cells. Scale bar: 100 pm. (FIG. 13E) DNA agarose gel of PCR amplicon performed from the genomic DNA extracted from control and LNP treated cells with primers flanking the Ail4 locus (n=3). (FIG. 13F) C57BL / 6 recipient mice were lethallyirradiated and received intravenous transplantation of MLL-AF9 transfected Lin’ cells. Three weeks after the transplantation, bone marrow and spleen were extracted from the primary transplant recipient animal and the isolated cells were transplanted to secondary transplant recipient to establish the model for LNP study. Three weeks after the secondary transplantation, Cre mRNA BM homing LNPs were IV injected. Leukemic cells were harvested and analyzed72 hours after LNP injection. (FIG. 13G) Percentage of tdTom+ cells in bone marrow isolated leukemic cells, leukemic stem cells residing in BM (BM LSC), and spleen isolated leukemic cells (n=3).
[0096] FIG. 14 shows the SDS-PAGE of the plasma proteins adsorbed to the surface of mDLNP and 9 BM homing LNPs.
[0097] FIG. 15 presents the FACS gating strategy for analysis of tdTom+ cells in leukemic cells. Live-Dead aqua was used to distinguish live cells. Leukemic cells are YFP+. CD l ib and CD 117 were used to distinguish leukemic stem cells.
[0098] FIG. 16 presents the percentage of LNPs in dissected femurs and tibias.
[0099] FIG. 17 shows the bioluminescence signal intensity of the LNPs in dissected femurs and tibias.DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0101] The present disclosure provides compositions and methods for delivery of lipid nanoparticle compositions to organs or tissue in a selective manner. In some embodiments, the lipid nanoparticle compositions comprise a therapeutic molecule, such as a nucleic acid including both DNA and RNA. The lipid nanoparticle compositions may, as nonlimiting examples, comprise mRNA, Cas9 mRNA / single guide RNA (sgRNA), or adenine base editor (ABE) mRNA / sgRNA. The present disclosure provides compositions and methods for targeted delivery of lipid nanoparticle compositions to healthy, malignant, or diseased organs or tissue.
[0102] The presently disclosed compositions comprise a therapeutic agent encapsulated in a lipid nanoparticle. The lipid nanoparticles of the present disclosure comprise a covalent bond- forming lipid, which facilitates directed delivery of said therapeutic agent. In some embodiments, the therapeutic agent is delivered to a blood cell or a bone marrow cell. The presently disclosed compositions may be, for example, useful for the treatment of a disease or disorder in a patient in need thereof, useful in delivering therapeutic agents to a blood or bone marrow cell, or useful for editing a genome of a blood cell or a bone marrow cell. In some embodiments, the presently disclosed compositions facilitate delivery of therapeutic agents to one or more specific organs or cells in vivo. Details of these aspects and more are provided below and in the sections that follow.A. DEFINITIONS
[0103] Reference is made herein to particular features (including method steps) It is to be understood that the disclosure in this specification includes all possible combinations of such particular features. For example, where a particular feature is disclosed in the context of a particular aspect or embodiment, or a particular claim, that feature can also be used, to the extent possible, in combination with and / or in the context of other particular aspects and embodiments.
[0104] Where reference is made herein to a method comprising two or more defined steps, the defined steps can be carried out in any order or simultaneously (except where the context excludes that possibility), and the method can include one or more other steps which are carried out before any of the defined steps, between two of the defined steps, or after all the defined steps (except where the context excludes that possibility).
[0105] The practice of the technology will employ, unless indicated specifically to the contrary, conventional methods of chemistry, biochemistry, organic chemistry, molecular biology, microbiology, recombinant DNA techniques, genetics, immunology, and cell biology that are within the skill of the art, many of which are described below for the purpose of illustration. Such techniques are explained fully in the literature. It is to be understood that this disclosure is not limited to the particular methodology, protocols, and reagents described, as these may vary, depending upon the context in which they are used by those of skill in the art.
[0106] All publications and patents mentioned herein are hereby incorporated by reference in their entirety as if each individual publication or patent was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, controls. However, mention of any reference, article, publication, patent, patent publication, and patent application cited herein is not, and should not be taken as an acknowledgment, or any form of suggestion, that they constitute valid prior art or form part of the common general knowledge in any country in the world.
[0107] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. Specifically, features described in one section may be combined with features in any other section of the description.
[0108] While illustrative embodiments are described and depicted, it will be appreciated that various changes can be made to these illustrative embodiments without departing from the spirit and scope of the invention.
[0109] Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Various scientific dictionaries that include the terms included herein are well known and available to those in the art. Although any methods and materials similar or equivalent to those described herein find use in the practice or testing of the disclosure, some preferred methods and materials are described. Accordingly, the terms defined immediately below are more fully described by reference to the specification as a whole.
[0110] When used in the context of a chemical group: “hydrogen” means -H; “hydroxy” means -OH; “oxo” means =0; “carbonyl” means -C(=O)-; “carboxy” means -C(=O)OH (also written as -COOH or -CO2H); “halo” means independently_F, -Cl. -Br or-I; “amino” means -NH2; “hydroxyamino” means -NHOH; “nitro” means -NO2; imino means =NH; “cyano” means -CN; “isocyanate” means -N=C=O; “isothiocyanate” means -N=C=O: “azido” means -N3; in a monovalent context “phosphate” means -OP(O)(OH)2 or a deprotonated form thereof; in a divalent context “phosphate” means -OP(O)(OH)O- or a deprotonated form thereof; “mercapto” means -SH; and “thio” means =S; “sulfony l” means -S(O)2_; “hydroxysulfonyl” means ~S(O)2OH; “sulfonamide” means -S(O)2NH2i and “sulfinyl” means -S(O)-.
[0111] In the context of chemical formulas, the symbolmeans a single bond,“=” means a double bond, and “=” means triple bond. The symbolrepresents an optional bond, which if present is either single or double. The symbolrepresents a single bond or a double bond. Thus, for example, the formulaincludesAnd it is understood that no one such ring atom forms part of more than one double bond. Furthermore, it is noted that the covalent bond symbol when connecting one or two stereogenic atoms, does not indicate any preferred stereochemistry. Instead, it covers all stereoisomers as well as mixtures thereof. The symbol,when drawn perpendicularly across a bond (e.g. ,for methyl) indicates a point of attachment of the group. It is noted that the point of attachment is typically only identified in this manner for larger groups in order to assist the reader in unambiguously identifying a point of attachment. The symbolmeans a single bond where the group attached to the thick end of the wedge is “out of the page.” The symbol ” means a single bond where the group attached to the thick end of the wedge is “into the page”. The symbolmeans a single bond where the geometry around a double bond (e.g., either E or Z) is undefined. Both options, as well as combinations thereof are therefore intended. Any undefined valency on an atom of a structure shown in this application implicitly represents a hydrogen atom bonded to that atom. A bold dot on a carbon atom indicates that the hydrogen attached to that carbon is oriented out of the plane of the paper.
[0112] When a group “R” is depicted as a “floating group” on a ring system, for example, in the formula:then R may replace any hydrogen atom attached to any of the ring atoms, including a depicted, implied, or expressly defined hydrogen, so long as a stable structure is formed. When a group “R” is depicted as a “floating group” on a fused ring system, as for example in the formula:then R may replace any hydrogen attached to any of the ring atoms of either of the fused rings unless specified otherwise. Replaceable hydrogens include depicted hydrogens (e.g., the hydrogen attached to the nitrogen in the formula above), implied hydrogens (e.g., a hydrogen of the formula above that is not shown but understood to be present), expressly defined hydrogens, and optional hydrogens whose presence depends on the identity of a ring atom (e.g., a hydrogen attached to group X, when X equals -CH-), so long as a stable structure is formed. In the example depicted, R may reside on either the 5-membered or the 6-membered ring of the fused ring system. In the formula above, the subscript letter “y” immediately following the group “R” enclosed in parentheses, represents a numeric variable. Unless specified otherwise, this variable can be 0, 1, 2, or any integer greater than 2, only limited by the maximum number of replaceable hydrogen atoms of the ring or ring system.
[0113] For the chemical groups and compound classes, the number of carbon atoms in the group or class is as indicated as follows: “Cn” defines the exact number (n) of carbon atoms in the group / class. “C<n” defines the maximum number (n) of carbon atoms that can be in the group / class, with the minimum number as small as possible for the group / class in question, e.g., it is understood that the minimum number of carbon atoms in the group “alkenyl(C≤8)” or the class “alkene(C≤8)” is two. Compare with “alkoxy (c≤io)”, which designates alkoxy groups having from 1 to 10 carbon atoms. “Cn-n'” defines both the minimum (n) and maximum number (n') of carbon atoms in the group. Thus, “alkyl(C2-io)” designates those alkyl groups having from 2 to 10 carbon atoms. These carbon number indicators may precede or follow the chemical groups or class it modifies and it may or may not be enclosed in parenthesis, without signifying any change in meaning. Thus, the terms “C5 olefin”, “C5- olefin”, “olefin(c5)”, and “olefines” are all synonymous.
[0114] The term “saturated” when used to modify a compound or chemical group means the compound or chemical group has no carbon-carbon double and no carbon-carbon triple bonds, except as noted below. When the term is used to modify an atom, it means that the atom is not part of any double or triple bond. In the case of substituted versions of saturated groups, one or more carbon oxygen double bond or a carbon nitrogen double bond may be present. And when such a bond is present, then carbon-carbon double bonds that may occur as part of keto-enol tautomerism or imine / enamine tautomerism are not precluded. When the term “saturated” is used to modify a solution of a substance, it means that no more of that substance can dissolve in that solution.
[0115] The term “aliphatic” when used without the “substituted” modifier signifies that the compound or chemical group so modified is an acyclic or cyclic, but non-aromatic hydrocarbon compound or group. In aliphatic compounds / groups, the carbon atoms can be joined together in straight chains, branched chains, or non-aromatic rings (alicyclic). Aliphatic compounds / groups can be saturated, that is joined by single carbon-carbon bonds (alkanes / alkyl), or unsaturated, with one or more carbon-carbon double bonds (alkenes / alkenyl) or with one or more carbon-carbon triple bonds (alkynes / alkynyl).
[0116] The term “aromatic” when used to modify a compound or a chemical group atom means the compound or chemical group contains a planar unsaturated ring of atoms that is stabilized by an interaction of the bonds forming the ring.
[0117] The term “alkyl” when used without the “substituted” modifier refers to a monovalent saturated aliphatic group with a carbon atom as the point of attachment, a linear or branched acyclic structure, and no atoms other than carbon and hydrogen. The groups -CH3 (Me), -CH2CH3 (Et), -CH2CH2CH3 (n-Pr or propyl), -CH(CH3)2 (i-Pr, 'Pr or isopropyl), -CH2CH2CH2CH3 (n-Bu), -CH(CH3)CH2CH3 (sec-butyl), -CH2CH(CH3)2 (isobutyl), - C(CH3)3 (tert-butyl, t-butyl, t-Bu orzBu), and -CTEQCHsh (neo-pentyl) are non-limiting examples of alkyl groups. The term “alkanediyl” when used without the “substituted” modifier refers to a divalent saturated aliphatic group, with one or two saturated carbon atom(s) as the point(s) of attachment, a linear or branched acyclic structure, no carbon-carbon double or triple bonds, and no atoms other than carbon and hydrogen. The groups -CH2- (methylene), -CH2CH2-, -CH2C(CH3)2CH2-, and -CH2CH2CH2- are non-limiting examples of alkanediyl groups. An “alkane” refers to the class of compounds having the formula H-R, wherein R is alkyl as this term is defined above. When any of these terms is used with the “substituted”modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2. The following groups are non-limiting examples of substituted alkyl groups: -CH2OH, -CH2C1, -CF3, -CH2CN, -CH2C(O)OH, -CH2C(O)OCH3, -CH2C(O)NH2, -CH2C(O)CH3, -CH2OCH3, -CH2OC(O)CH3, -CH2NH2, -CH2N(CH3)2, and -CH2CH2CI. The term “haloalkyl” is a subset of substituted alkyl, in which the hydrogen atom replacement is limited to halo (i.e. -F, -Cl, -Br, or -I) such that no other atoms aside from carbon, hydrogen and halogen are present. The group, -CH2C1 is a nonlimiting example of a haloalkyl. The term “fluoroalkyl” is a subset of substituted alkyl, in which the hydrogen atom replacement is limited to fluoro such that no other atoms aside from carbon, hydrogen and fluorine are present. The groups -CH2F, -CF3, and -CH2CF3 are nonlimiting examples of fluoroalkyl groups.
[0118] The term “cycloalkyl” when used without the “substituted” modifier refers to a monovalent saturated aliphatic group with a carbon atom as the point of attachment, said carbon atom forming part of one or more non-aromatic ring structures, no carbon-carbon double or triple bonds, and no atoms other than carbon and hydrogen. Non-limiting examples include: -CH(CH2)2 (cyclopropyl), cyclobutyl, cyclopentyl, or cyclohexyl (Cy). The term “cycloalkanediyl” when used without the “substituted” modifier refers to a divalent saturated aliphatic group with two carbon atoms as points of attachment, no carbon-carbon double or triple bonds, and no atoms other than carbon and hydrogen. The groupjs a non_ limiting example of cycloalkanediyl group. A “cycloalkane” refers to the class of compounds having the formula H-R, wherein R is cycloalkyl as this term is defined above. When any of these terms is used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2.
[0119] The term “alkenyl” when used without the “substituted” modifier refers to an monovalent unsaturated aliphatic group with a carbon atom as the point of attachment, a linear or branched, acyclic structure, at least one nonaromatic carbon-carbon double bond, no carbon-carbon triple bonds, and no atoms other than carbon and hydrogen. Non-limiting examples include: -CH=CH2(vinyl), -CH=CHCH3, -CH=CHCH2CH3, -CH2CH=CH2(allyl), -CH2CH=CHCHS, and -CH=CHCH=CH2. The term “alkenediyl” when used without the “substituted” modifier refers to a divalent unsaturated aliphatic group, with two carbon atoms as points of attachment, a linear or branched, a linear or branched acyclic structure, at least one nonaromatic carbon-carbon double bond, no carbon-carbon triple bonds, and no atoms other than carbon and hydrogen. The groups -CH=CH-, -CH=C(CH3)CH2-, -CH=CHCH2-, and -CH2CH=CHCH2- are non-limiting examples of alkenediyl groups. It is noted that while the alkenediyl group is aliphatic, once connected at both ends, this group is not precluded from forming part of an aromatic structure. The terms “alkene” and “olefin” are synonymous and refer to the class of compounds having the formula H-R, wherein R is alkenyl as this term is defined above. Similarly the terms “terminal alkene” and “a-olefin” are synonymous and refer to an alkene having just one carbon-carbon double bond, wherein that bond is part of a vinyl group at an end of the molecule. When any of these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -0C(0)CH3, -NHC(O)CH3, -S(O)2OH. or -S(O)2NH2. The groups -CH=CHF, -CH=CHC1 and -CH=CHBr are non-limiting examples of substituted alkenyl groups.
[0120] The term “alkynyl” when used without the “substituted” modifier refers to a monovalent unsaturated aliphatic group with a carbon atom as the point of attachment, a linear or branched acyclic structure, at least one carbon-carbon triple bond, and no atoms other than carbon and hydrogen. As used herein, the term alkynyl does not preclude the presence of one or more non-aromatic carbon-carbon double bonds. The groups -C=CH, -C=CCH3, and -CH2C=CCH3 are non-limiting examples of alkynyl groups. An “alkyne” refers to the class of compounds having the formula H-R, wherein R is alkynyl. When any of these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2.
[0121] The term “aryl” when used without the “substituted” modifier refers to a monovalent unsaturated aromatic group with an aromatic carbon atom as the point of attachment, said carbon atom forming part of a one or more six-membered aromatic ring structure, wherein the ring atoms are all carbon, and wherein the group consists of no atomsother than carbon and hydrogen. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl or aralkyl groups (carbon number limitation permitting) attached to the first aromatic ring or any additional aromatic ring present. Non-limiting examples of aryl groups include phenyl (Ph), methylphenyl, (dimethyl)phenyl, -C6H4CH2CH3 (ethylphenyl), naphthyl, and a monovalent group derived from biphenyl. The term “arenediyl” when used without the “substituted” modifier refers to a divalent aromatic group with two aromatic carbon atoms as points of attachment, said carbon atoms forming part of one or more six-membered aromatic ring structure(s) wherein the ring atoms are all carbon, and wherein the monovalent group consists of no atoms other than carbon and hydrogen. As used herein, the term does not preclude the presence of one or more alkyl, aryl or aralkyl groups (carbon number limitation permitting) attached to the first aromatic ring or any additional aromatic ring present. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via one or more of the following: a covalent bond, alkanediyl, or alkenediyl groups (carbon number limitation permitting). Non-limiting examples of arenediyl groups include:An “arene” refers to the class of compounds having the formula H-R, wherein R is aryl as that term is defined above. Benzene and toluene are non-limiting examples of arenes. When any of these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2.
[0122] The term “aralkyl” when used without the “substituted” modifier refers to the monovalent group -alkanediyl-aryl, in which the terms alkanediyl and aryl are each used in a manner consistent with the definitions provided above. Non-limiting examples are: phenylmethyl (benzyl, Bn) and 2-phenyl-ethyl. When the term aralkyl is used with the “substituted” modifier one or more hydrogen atom from the alkanediyl and / or the aryl group has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2,-C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2. Nonlimiting examples of substituted aralkyls are: (3-chlorophenyl)-methyl, and 2-chloro-2-phenyl- eth-l-yl.
[0123] The term “heteroaryl” when used without the “substituted” modifier refers to a monovalent aromatic group with an aromatic carbon atom or nitrogen atom as the point of attachment, said carbon atom or nitrogen atom forming part of one or more aromatic ring structures wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the heteroaryl group consists of no atoms other than carbon, hydrogen, aromatic nitrogen, aromatic oxygen and aromatic sulfur. Heteroaryl rings may contain 1, 2, 3, or 4 ring atoms selected from are nitrogen, oxygen, and sulfur. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl, aryl, and / or aralkyl groups (carbon number limitation permitting) attached to the aromatic ring or aromatic ring system. Non-limiting examples of heteroaryl groups include furanyl, imidazolyl, indolyl, indazolyl (Im), isoxazolyl, methylpyridinyl, oxazolyl, phenylpyridinyl, pyridinyl (pyridyl), pyrrolyl, pyrimidinyl, pyrazinyl, quinolyl, quinazolyl, quinoxalinyl, triazinyl, tetrazolyl, thiazolyl, thienyl, and triazolyl. The term ‘W-heteroaryl” refers to a heteroaryl group with a nitrogen atom as the point of attachment. The term “heteroarenediyl” when used without the “substituted” modifier refers to an divalent aromatic group, with two aromatic carbon atoms, two aromatic nitrogen atoms, or one aromatic carbon atom and one aromatic nitrogen atom as the two points of attachment, said atoms forming part of one or more aromatic ring structure(s) wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the divalent group consists of no atoms other than carbon, hydrogen, aromatic nitrogen, aromatic oxygen and aromatic sulfur. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via one or more of the following: a covalent bond, alkanediyl, or alkenediyl groups (carbon number limitation permitting). As used herein, the term does not preclude the presence of one or more alkyl, aryl, and / or aralkyl groups (carbon number limitation permitting) attached to the aromatic ring or aromatic ring system. Nonlimiting examples of heteroarenediyl groups include:A “heteroarene” refers to the class of compounds having the formula H-R, wherein R is heteroaryl. Pyridine and quinoline are non-limiting examples of heteroarenes. When theseterms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2-
[0124] The term “heterocycloalkyl” when used without the “substituted” modifier refers to a monovalent non-aromatic group with a carbon atom or nitrogen atom as the point of attachment, said carbon atom or nitrogen atom forming part of one or more non-aromatic ring structures wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the heterocycloalkyl group consists of no atoms other than carbon, hydrogen, nitrogen, oxygen and sulfur. Heterocycloalkyl rings may contain 1, 2, 3, or 4 ring atoms selected from nitrogen, oxygen, or sulfur. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl groups (carbon number limitation permitting) attached to the ring or ring system. Also, the term does not preclude the presence of one or more double bonds in the ring or ring system, provided that the resulting group remains non-aromatic. Non-limiting examples of heterocycloalkyl groups include aziridinyl, azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, tetrahydrofuranyl, tetrahydrothiofuranyl, tetrahydropyranyl, pyranyl, oxiranyl, and oxetanyl. The term “jV-heterocycloalkyl” refers to a heterocycloalkyl group with a nitrogen atom as the point of attachment. A-pyrrolidinyl is an example of such a group. The term “heterocycloalkanediyl” when used without the “substituted” modifier refers to an divalent cyclic group, with two carbon atoms, two nitrogen atoms, or one carbon atom and one nitrogen atom as the two points of attachment, said atoms forming part of one or more ring structure(s) wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the divalent group consists of no atoms other than carbon, hydrogen, nitrogen, oxygen and sulfur. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via one or more of the following: a covalent bond, alkanediyl, or alkenediyl groups (carbon number limitation permitting). As used herein, the term does not preclude the presence of one or more alkyl groups (carbon number limitation permitting) attached to the ring or ring system. Also, the term does not preclude the presence of one or more double bonds in the ring or ring system, provided that the resulting group remains non-aromatic. Non-limiting examples of heterocycloalkanediyl groups include:When these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2.
[0125] The term “acyl” when used without the “substituted” modifier refers to the group -C(O)R, in which R is a hydrogen, alkyl, cycloalkyl, alkenyl, aryl, aralkyl or heteroaryl, as those terms are defined above. The groups, -CHO, -C(O)CH3 (acetyl, Ac), -C(O)CH2CH3, -C(O)CH2CH2CH3, -C(O)CH(CH3)2, -C(O)CH(CH2)2, -C(O)C6H5, -C(O)C6H4CH3, -C(O)CH2CeH5, -C(O)(imidazolyl) are non-limiting examples of acyl groups. A “thioacyl” is defined in an analogous manner, except that the oxygen atom of the group -C(O)R has been replaced with a sulfur atom, -C(S)R. The term “aldehyde” corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with a -CHO group. When any of these terms are used with the “substituted” modifier one or more hydrogen atom (including a hydrogen atom directly attached to the carbon atom of the carbonyl or thiocarbonyl group, if any) has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH or -S(O)2NH2. The groups, -C(O)CH2CF3, -CO2H (carboxyl), -CO2CH3 (methylcarboxyl), -CO2CH2CH3, -C(O)NH2 (carbamoyl), and -CON(CH3)2, are non-limiting examples of substituted acyl groups.
[0126] The term “alkoxy” when used without the “substituted” modifier refers to the group -OR, in which R is an alkyl, as that term is defined above. Non-limiting examples include: -OCH3 (methoxy), -OCH2CH3 (ethoxy), -OCH2CH2CH3, -OCH(CH3)2(isopropoxy), -OC(CH3)3 (tert-butoxy), -OCH(CH2)2, -O-cyclopentyl, and -O-cyclohexyl. The terms “cycloalkoxy”, “alkenyloxy”, “alkynyloxy”, “aryloxy”, “aralkoxy”, “heteroaryloxy”, “heterocycloalkoxy”, and “acyloxy”, when used without the “substituted” modifier, refers to groups, defined as -OR, in which R is cycloalkyl, alkenyl, alkynyl, aryl, aralkyl, heteroaryl, heterocycloalkyl, and acyl, respectively. The term “alkoxydiyl” refers to the divalent group -O-alkanediyl-, -O-alkanediyl-O-, or -alkanediyl-O-alkanediyl-. The term “alkylthio” and “acylthio” when used without the “substituted” modifier refers to the group -SR, in which R is an alkyl and acyl, respectively. The term “alcohol” corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with a hydroxy group. The term “ether” corresponds to an alkane, as defined above, wherein at leastone of the hydrogen atoms has been replaced with an alkoxy group. When any of these terms is used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2.
[0127] The term “alkylamino” when used without the “substituted” modifier refers to the group -NHR, in which R is an alkyl, as that term is defined above. Non-limiting examples include: -NHCH3 and -NHCH2CH3. The term “dialkylamino” when used without the “substituted” modifier refers to the group -NRR', in which R and R' can be the same or different alkyl groups, or R and R' can be taken together to represent an alkanediyl. Nonlimiting examples of dialkylamino groups include: -NiCHsh and -N(CH3)(CH2CH3). The terms “cycloalkylamino”, “alkenylamino”, “alkynylamino”, “arylamino”, “aralkylamino”, “heteroarylamino”, “heterocycloalkylamino”, “alkoxyamino”, and “alkylsulfonylamino” when used without the “substituted” modifier, refers to groups, defined as -NHR, in which R is cycloalkyl, alkenyl, alkynyl, aryl, aralkyl, heteroaryl, heterocycloalkyl, alkoxy, and alkylsulfonyl, respectively. A non-limiting example of an arylamino group is -NHCeHs. The term “alkylaminodiyl” refers to the divalent group -NH-alkanediyl-, -NH-alkanediyl-NH-, or -alkanediyl-NH-alkanediyl-. The term “amido” (acylamino), when used without the “substituted” modifier, refers to the group -NHR, in which R is acyl, as that term is defined above. A non-limiting example of an amido group is -NHC(O)CH3. The term “alkylimino” when used without the “substituted” modifier refers to the divalent group =NR, in which R is an alkyl, as that term is defined above. When any of these terms is used with the “substituted” modifier one or more hydrogen atom attached to a carbon atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2. The groups -NHC(O)OCH3 and -NHC(O)NHCH3 are non-limiting examples of substituted amido groups.
[0128] The use of the word “a” or “an,” when used in conjunction with the term “comprising” in the claims and / or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”
[0129] Throughout this application, the term “about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.
[0130] As used in this application, the term “average molecular weight” refers to the relationship between the number of moles of each polymer species and the molar mass of that species. In particular, each polymer molecule may have different levels of polymerization and thus a different molar mass. The average molecular weight can be used to represent the molecular weight of a plurality of polymer molecules. Average molecular weight is typically synonymous with average molar mass. In particular, there are three major types of average molecular weight: number average molar mass, weight (mass) average molar mass, and Z- average molar mass. In the context of this application, unless otherwise specified, the average molecular weight represents either the number average molar mass or weight average molar mass of the formula. In some embodiments, the average molecular weight is the number average molar mass. In some embodiments, the average molecular weight may be used to describe a PEG component present in a lipid.
[0131] The terms “comprise,” “have” and “include” are open-ended linking verbs. Any forms or tenses of one or more of these verbs, such as “comprises,” “comprising,” “has,” “having,” “includes” and “including,” are also open-ended. For example, any method that “comprises,” “has” or “includes” one or more steps is not limited to possessing only those one or more steps and also covers other unlisted steps.
[0132] The terms “polypeptide”, “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues, wherein the polymer may be conjugated to a moiety that does not consist of amino acids, such as a glycan or other post-translational modification, or a non-natural chemical moeity. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non- naturally occurring amino acid polymers. A “fusion protein” refers to a chimeric protein encoding two or more separate protein sequences that are recombinantly expressed as a single polymer molecule.
[0133] The term “recombinant polypeptide” refers to a polypeptide that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwiseseparated segments of sequence. In several embodiments, a recombinant polypeptide is encoded by a heterologous (for example, recombinant) nucleic acid that has been introduced into a host cell, such as a bacterial or eukaryotic cell.
[0134] The term “expression” includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion. In some aspects, expression can be detected using conventional techniques for detecting protein (e.g., ELISA, Western blotting, flow cytometry, immunofluorescence, immunohistochemistry, etc.).
[0135] A “cell” as used herein, refers to a membrane-bound biological unit capable of carrying out metabolic or other function sufficient to preserve or replicate its genomic DNA. A cell can be identified by well-known methods in the art including, for example, presence of an intact membrane, staining by a particular dye, ability to produce progeny or, in the case of a gamete, ability to combine with a second gamete to produce a viable offspring. Cells may include prokaryotic and eukaroytic cells. Prokaryotic cells include but are not limited to bacteria. Eukaryotic cells include but are not limited to yeast cells and cells derived from plants and animals, for example mammalian, insect (e.g., spodoptera) and human cells. Cells may be useful when they are naturally nonadherent or have been treated not to adhere to surfaces, for example by trypsinization.
[0136] As may be used herein, the terms “nucleic acid,” “nucleic acid molecule,” “nucleic acid oligomer,” “oligonucleotide,” “nucleic acid sequence,” “nucleic acid fragment” and “polynucleotide” are used interchangeably and are intended to include, but are not limited to, a polymeric form of nucleotides covalently linked together that may have various lengths, either deoxyribonucleotides or ribonucleotides, or analogs, derivatives or modifications thereof. Different polynucleotides may have different three-dimensional structures, and may perform various functions, known or unknown. Non-limiting examples of polynucleotides include a gene, a gene fragment, an exon, an intron, intergenic DNA (including, without limitation, heterochromatic DNA), messenger RNA (mRNA), transfer RNA, ribosomal RNA, a ribozyme, cDNA, a recombinant polynucleotide, a branched polynucleotide, a plasmid, a vector, isolated DNA of a sequence, isolated RNA of a sequence, a nucleic acid probe, and a primer. Polynucleotides useful in the methods of the disclosure may comprise natural nucleic acid sequences and variants thereof, artificial nucleic acid sequences, or a combination of such sequences.
[0137] The term “identical” or percent “identity,” in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence. Methods of alignment of sequences for comparison are well known in the art. Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is present in both sequences. The percent sequence identity is determined by dividing the number of matches in the alignment by the length of the reference sequence, followed by multiplying the resulting value by 100. For example, a peptide sequence that has 1166 matches when aligned with a test sequence having 1554 amino acids is 75.0 percent identical to the test sequence (1166-M554 * 100=75.0). As the terms are used herein, gaps in the alignment do not decrease the percent sequence identity. Unless otherwise specificed, optimal alignment of sequences for comparison is conducted by the global alignment algorithm of Needleman and Wunsch, Mol. Biol. 48:443 (1970) as implemented by EMBOSS Needle (on the World Wide Web at ebi.ac.uk / Tools / psa / emboss_needle / ) (Madeira et al. Nucleic Acids Res. 5O(W1):W276- W279 (2022)). In embodiments, other alignment methods may be used, including without limitation those described in Devereux, et al, Nucleic Acids Res. 12:387-95 (1984) ; Atschul et al. J. Mo. Biol. 215:403-10 (1990) (BLAST); Carrillo and Lipman Siam J. Appl. Math. 48(5) (1988); Computational Molecular Biology (Lesk, AM, ed., 1989); Biocomputing Informatics and Genome Projects, (Smith. DW. ed.. 1993); Computer Analysis of Sequence Data, Part I. (Griffin and Griffin, eds., 1994); Sequence Analysis in Molecular Biology (von Heinje, 2012); Sequence Analysis Primer (Gribskov and Devereux, J., eds. 1993). In embodiments, sequence identity is calclated using the implementation of the Needleman-Wunsch algorithm provided by the National Library of Medicine (on the World Wide Web at blast.ncbi.nlm.nih.gov / Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=GlobalAln)
[0138] For example, sequence identity can be determined by standard methods that are commonly used to compare the similarity of two polypeptide or two polynucleotide sequences. Using a computer program such as EMBOSS Needle or BLAST, two polypeptide or two polynucleotide sequences are aligned for optimal matching of their respective residues (either along the full length of one or both sequences, or along a pre-determined portion of one or both sequences). The programs provide a default opening penalty and a default gap penalty, and a scoring matrix such as PAM 250 (a standard scoring matrix; see Dayhoff et al., in Atlasof Protein Sequence and Structure, vol. 5, supp. 3 (1978)) that can be used in conjunction with the computer program.
[0139] As used herein, the term “messenger RNA (mRNA)” refers to a polynucleotide that encodes at least one polypeptide. mRNA as used herein encompasses both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, mRNA can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc. An mRNA sequence is presented in the 5' to 3' direction unless otherwise indicated
[0140] As used herein, the term “shRNA” or “shor hairpin RNA” refer to a short sequence of RNA which makes a tight hairpin turn and can be used to silence gene expression.
[0141] As used herein, the term “microRNA” refers noncoding RNA consisting of about 22 ribonucleotides which regulates gene expression in the post transcriptional stage by silencing messenger RNA by base-pairing with omplementary sequence in its targeted mRNA.
[0142] As used herein, the term “gene-editing system” refers to a DNA or RNA editing system that comprises one or more guide RNA elements and one or more RNA-guided endonuclease elements. The guide RNA element comprises a target RNA comprising a nucleotide sequence substantially complementary to a nucleotide sequence at the one or more target genomic regions or a nucleic acid comprising a nucleotide sequence(s) encoding the target RNA. The RNA-guided endonuclease element comprises an endonuclease that is guided or brought to a target genomic region(s) by a guide RNA element or a nucleic acid comprising a nucleotide sequence(s) encoding such endonuclease.
[0143] The term “effective,” as that term is used in the specification and / or claims, means adequate to accomplish a desired, expected, or intended result. “Effective amount,” “Therapeutically effective amount” or “pharmaceutically effective amount” when used in the context of treating a patient or subject with a compound means that amount of the compound which, when administered to a subject or patient for treating a disease, is sufficient to effect such treatment for the disease.
[0144] More particularly, as used herein, the term "therapeutically effective amount" means an amount of an agent to be delivered (e.g., nucleic acid, drug, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and / or condition, to treat, improve signs and symptoms of, diagnose, prevent, and / or delay the onset of the infection, disease, disorder, and / or condition.
[0145] For example, for the given parameter, a therapeutically effective amount will show an increase or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100%. Therapeutic efficacy can also be expressed as “-fold” increase or decrease. For example, a therapeutically effective amount can have at least a 1.2-fold, 1.5- fold, 2-fold, 5-fold, or more effect over a control.
[0146] As used herein, the term “IC50” refers to an inhibitory dose which is 50% of the maximum response obtained. This quantitative measure indicates how much of a particular drug or other substance (inhibitor) is needed to inhibit a given biological, biochemical or chemical process (or component of a process, i.e. an enzyme, cell, cell receptor or microorganism) by half.
[0147] As used herein, the term “patient” or “subject” refers to a living mammalian organism, such as a human, monkey, cow, sheep, goat, dog, cat, mouse, rat, guinea pig, or transgenic species thereof. In certain embodiments, the patient or subject is a primate. Nonlimiting examples of human subjects are adults, juveniles, infants and fetuses.
[0148] “Treatment” or “treating” includes (1) inhibiting a disease in a subject or patient experiencing or displaying the pathology or symptomatology of the disease (e.g., arresting further development of the pathology and / or symptomatology), (2) ameliorating a disease in a subject or patient that is experiencing or displaying the pathology or symptomatology of the disease (e.g., reversing the pathology and / or symptomatology), and / or (3) effecting any measurable decrease in a disease in a subject or patient that is experiencing or displaying the pathology or symptomatology of the disease.
[0149] “Prevention” or “preventing” includes: (1) inhibiting the onset of a disease in a subject or patient which may be at risk and / or predisposed to the disease but does not yet experience or display any or all of the pathology or symptomatology of the disease, and / or (2) slowing the onset of the pathology or symptomatology of a disease in a subject or patient whichmay be at risk and / or predisposed to the disease but does not yet experience or display any or all of the pathology or symptomatology of the disease. The prevention may be complete (no detectable symptoms) or partial, such that fewer symptoms are observed than would likely occur absent treatment.
[0150] As used herein, the term “delivering” means causing, through chemical or biophysical properties of a composition (e.g., an LNP composition), a therapeutic agent (e.g., a nucleic acid) to pass from a site of administration to a subject to a target organ, target tissue, or target cell.. As used herein, the term “selectively delivering” refers delivery to a target organ, tissue, or cell at a greater rate or in a great amount than to a reference, non-target organ, tissue, or cell, or that a greater fraction of total amount administered to a subject is delivered to a target organ, tissue, or cell by the composition than by a reference composition. For example, selective delivery may mean that at least 25% (e.g., at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%) of the total amount administered is delivered to the target organ, tissue, or cell. In embodiments, “selective delivery” is determined by comparing the fraction of an LNP composition or therapeutic agent that is delivery to a target organ or cell (e.g., bone marrow) by an LNP composition comprises a selected lipid (e.g. a covalent bond-forming lipid) compared to a reference LNP composition in which the selected lipid is replace by a control lipid.
[0151] An “isomer” of a first compound is a separate compound in which each molecule contains the same constituent atoms as the first compound, but where the configuration of those atoms in three dimensions differs.
[0152] As generally used herein “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues, organs, and / or bodily fluids of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio.
[0153] “Pharmaceutically acceptable salts” means salts of compounds of the present invention which are pharmaceutically acceptable, as defined above, and which possess the desired pharmacological activity. Such salts include acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or with organic acids such as 1,2-ethanedisulfonic acid,2 -hydroxyethanesulfonic acid, 2-naphthalenesulfonic acid, 3 -phenylpropionic acid, 4,4’-methylenebis(3-hydroxy-2-ene-l-carboxylic acid), 4-methylbicyclo[2.2.2]oct-2-ene- 1 -carboxylic acid, acetic acid, aliphatic mono- and dicarboxylic acids, aliphatic sulfuric acids, aromatic sulfuric acids, benzenesulfonic acid, benzoic acid, camphorsulfonic acid, carbonic acid, cinnamic acid, citric acid, cyclopentanepropionic acid, ethanesulfonic acid, fumaric acid, glucoheptonic acid, gluconic acid, glutamic acid, glycolic acid, heptanoic acid, hexanoic acid, hydroxynaphthoic acid, lactic acid, laurylsulfuric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, muconic acid, o-(4-hydroxybenzoyl)benzoic acid, oxalic acid, p-chlorobenzenesul Ionic acid, phenyl-substituted alkanoic acids, propionic acid, p-toluenesulfonic acid, pyruvic acid, salicylic acid, stearic acid, succinic acid, tartaric acid, tertiarybutylacetic acid, trimethylacetic acid, and the like. Pharmaceutically acceptable salts also include base addition salts which may be formed when acidic protons present are capable of reacting with inorganic or organic bases. Acceptable inorganic bases include sodium hydroxide, sodium carbonate, potassium hydroxide, aluminum hydroxide and calcium hydroxide. Acceptable organic bases include ethanolamine, diethanolamine, triethanolamine, tromethamine, A-methylglucamine and the like. It should be recognized that the particular anion or cation forming a part of any salt of this invention is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (P. H. Stahl & C. G. Wermuth eds., Verlag Helvetica Chimica Acta, 2002).
[0154] The term “pharmaceutically acceptable carrier,” as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting a chemical agent.
[0155] A “repeat unit” is the simplest structural entity of certain materials, for example, frameworks and / or polymers, whether organic, inorganic or metal-organic. In the case of a polymer chain, repeat units are linked together successively along the chain, like the beads of a necklace. For example, in polyethylene, -[-CH2CH2-]n-, the repeat unit is -CH2CH2-. The subscript “n” denotes the degree of polymerization, that is, the number of repeat units linked together. When the value for “n” is left undefined or where “n” is absent, it simply designates repetition of the formula within the brackets as well as the polymeric natureof the material. The concept of a repeat unit applies equally to where the connectivity between the repeat units extends three dimensionally, such as in metal organic frameworks, modified polymers, thermosetting polymers, etc. Within the context of the dendrimer, the repeating unit may also be described as the branching unit, interior layers, or generations. Similarly, the terminating group may also be described as the surface group.
[0156] A “stereoisomer” or “optical isomer” is an isomer of a given compound in which the same atoms are bonded to the same other atoms, but where the configuration of those atoms in three dimensions differs. “Enantiomers” are stereoisomers of a given compound that are mirror images of each other, like left and right hands. “Diastereomers” are stereoisomers of a given compound that are not enantiomers. Chiral molecules contain a chiral center, also referred to as a stereocenter or stereogenic center, which is any point, though not necessarily an atom, in a molecule bearing groups such that an interchanging of any two groups leads to a stereoisomer. In organic compounds, the chiral center is typically a carbon, phosphorus or sulfur atom, though it is also possible for other atoms to be stereocenters in organic and inorganic compounds. A molecule can have multiple stereocenters, giving it many stereoisomers. In compounds whose stereoisomerism is due to tetrahedral stereogenic centers (e.g., tetrahedral carbon), the total number of hypothetically possible stereoisomers will not exceed 2n, where n is the number of tetrahedral stereocenters. Molecules with symmetry frequently have fewer than the maximum possible number of stereoisomers. A 50:50 mixture of enantiomers is referred to as a racemic mixture. Alternatively, a mixture of enantiomers can be enantiomerically enriched so that one enantiomer is present in an amount greater than 50%. Typically, enantiomers and / or diastereomers can be resolved or separated using techniques known in the art. It is contemplated that that for any stereocenter or axis of chirality for which stereochemistry has not been defined, that stereocenter or axis of chirality can he present in its R form, .S' form, or as a mixture of the R and .S' forms, including racemic and non-racemic mixtures. As used herein, the phrase “substantially free from other stereoisomers” means that the composition contains < 15%, more preferably < 10%, even more preferably < 5%, or most preferably < 1% of another stereoisomer(s).
[0157] The above definitions supersede any conflicting definition in any reference that is incorporated by reference herein. The fact that certain terms are defined, however, should not be considered as indicative that any term that is undefined is indefinite. Rather, allterms used are believed to describe the invention in terms such that one of ordinary skill can appreciate the scope and practice the present invention.B. COVALENT LIPIDS
[0158] The compositions disclosed herein comprise lipid nanoparticles that comprise at least one lipid that possesses a functional group that is able to form a covalent bond. The term “covalent lipid” as used herein refers to a lipid that possesses a functional group that is able to form a covalent bond. In some embodiments, the covalent lipids of the presently disclosed lipid nanoparticles and compositions thereof form covalent bonds under physiological conditions. Identification, selection and incorporation of the covalent lipids of the presently disclosed nanoparticles facilitates delivery of the present compositions to a target organ or cell. The covalent lipids of the present disclosure may have the advantage that they may be more efficacious than, be less toxic than, be longer acting than, be more potent than, produce fewer side effects than, be more easily absorbed than, and / or have a better pharmacokinetic profile (e.g., higher oral bioavailability and / or lower clearance) than, and / or have other useful pharmacological, physical, or chemical properties over, compounds known in the prior art, whether for use in the indications stated herein or otherwise.
[0159] Covalent lipids may be characterized by the type of functional group with which the functional group of the covalent lipid reacts. In some embodiments, the functional group of the covalent lipid of the presently disclosed compositions is a group that reacts with amino groups, alkylamino groups, or dialkylamino compounds or functional groups. In some embodiments, the covalent lipids of the presently disclosed compositions comprise any functional group that reacts with an amino, an alkylamino, or a dialkylamino compound or functional group under physiological conditions. A functional group that reacts with an amino, an alkylamino, or a dialkylamino functional group, as used herein, is considered an “amino reactive group.” The present disclosure therefore includes compositions comprising lipid nanoparticles comprising amino reactive groups. Non-limiting examples of amino reactive groups that may be present in covalent lipids of the presently disclosed compositions are hydroxysuccinyl esters, isocyanates, isothiocyanates, anhydrides, or aldehydes. In some embodiments, the lipid nanoparticles of the presently disclosed compositions comprise a covalent lipid having an isocyanate group. In some embodiments, the lipid nanoparticles of the presently disclosed compositions comprise a covalent lipid having an isothiocyanate group. In some embodiments, the lipid nanoparticles of the presently disclosed compositions comprise acovalent lipid having an anhydride group. In some embodiments, the lipid nanoparticles of the presently disclosed compositions comprise a covalent lipid having an aldehyde group.
[0160] In some embodiments, the covalent lipid comprises an amino reactive group of the formula
[0161] In some embodiments, the functional group of the covalent lipids of the presently disclosed compositions is a group that reacts with thiol functional groups. In some embodiments, the covalent lipids of the presently disclosed compositions comprise any functional group that reacts with a thiol functional group under physiological conditions. Nonlimiting examples of functional groups that react with thiol groups include a,|B-unsaturated carbonyl groups, a group that contains an iodo group, maleimides, and disulfides.
[0162] In some embodiments, the functional group of the covalent lipid of the presently disclosed compositions is a group that reacts with carboxylic acid functional groups. In some embodiments, the covalent lipids of the presently disclosed compositions comprise any functional group that reacts with a carboxylic acid group under physiological conditions. Non-limiting examples of functional groups that react with carboxylic acid groups include hydrazines and carbodiimides.
[0163] In some embodiments, the covalent lipids of the presently disclosed lipid nanoparticles and compositions thereof comprise multiple functional groups. In some embodiments, the covalent lipids of the present disclosure have two or more reactive functional groups. For example, covalent lipids according to the present disclosure have 2, 3, 4, 5, 6, 7, 8, 9, or 10 functional groups that react with a functional group. The multiple functional groups of the covalent lipids described herein may react with the same or with different types functional groups. More particularly, the multiple functional groups of the covalent lipids may independently react, for example, with amino groups, thiol groups, or carboxylic acids. The covalent lipids disclosed herein may comprise any number and any combination of functional groups that independently react with amino groups, thiol groups, or carboxylic acids. In some embodiments, the covalent lipids disclosed herein comprise 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino reactive groups. In some embodiments, the covalent lipids disclosed herein comprise 2, 3, 4, 5,6, 7, 8, 9, or 10 functional groups that react with thiol groups. In some embodiments, the covalent lipids disclosed herein comprise 2, 3, 4, 5, 6, 7, 8, 9, or 10 functional groups that react with carboxylic acid groups. The covalent lipids of the present disclosure may comprise any combination of the above features. In some embodiments, the covalent lipids of the presently disclosed lipid nanoparticles and compositions thereof comprise 2, 3, or 4 amino reactive groups. In some embodiments, the covalent lipids of the presently disclosed lipid nanoparticles and compositions thereof comprise two amino reactive groups. In some embodiments, the covalent lipids of the presently disclosed lipid nanoparticles and compositions thereof comprise 2, 3, or 4 functional groups that react with thiol groups. In some embodiments, the covalent lipids of the presently disclosed lipid nanoparticles and compositions thereof comprise two functional groups that react with thiol groups. In some embodiments, the covalent lipids of the presently disclosed lipid nanoparticles and compositions thereof comprise 2, 3, or 4 functional groups that react with carboxylic acid groups. In some embodiments, the covalent lipids of the presently disclosed lipid nanoparticles and compositions thereof comprise two functional groups that react with carboxylic acid groups. In some embodiments, the covalent lipids of the present disclosure comprise an amino reactive group and a functional group that reacts with a thiol group. In some embodiments, the covalent lipids of the present disclosure comprise an amino reactive group and a functional group that reacts with a carboxylic acid group. In some embodiments, the covalent lipids of the present disclosure comprise a functional group that reacts with a thiol group and a functional group that reacts with a carboxylic acid group.C. CATIONIC IONIZABLE LIPIDS
[0164] Disclosed herein are compositions comprising nanoparticles formed in part from a cationic ionizable lipid. The cationic ionizable lipids of the presently disclosed compositions may be ionizable lipids. In some embodiments, cationic lipids contain one or more groups which is protonated at physiological pH but may deprotonated and has no charge at a pH above 8, 9, 10, 11, or 12. The ionizable group may, for example, contain one or more protonatable amines which are able to form a cationic group at physiological pH. The ionizable lipid compound may also further comprise one or more lipid components such as two or more fatty acids with C6-C24 alkyl or alkenyl carbon groups. These lipid groups may be attached through an ester linkage or may be further added through a Michael addition to a sulfur atom. In some embodiments, these compounds may be a dendrimer, a dendron, a polymer, or a combination thereof. As used herein, the term “ionizable lipid” has its ordinary meaning in the art and may refer to a lipid comprising one or more charged moieties. In some embodiments,an ionizable lipid may be positively charged or negatively charged. For instance, an ionizable lipid may be positively charged at lower pHs, in which case it could be referred to as “cationic lipid.” In certain embodiments, an ionizable lipid molecule may comprise an amine group, and can be referred to as an ionizable amino lipids. As used herein, a “charged moiety” is a chemical moiety that carries a formal electronic charge, e.g., monovalent (+1, or -1), divalent (+2, or - 2), trivalent (+3, or -3), etc. The charged moiety may be anionic (i.e., negatively charged) or cationic (z.e. , positively charged). Examples of positively-charged moieties include amine groups (e.g., primary, secondary, and / or tertiary amines), ammonium groups, pyridinium group, guanidine groups, and imidazolium groups. In a particular embodiment, the charged moieties comprise amine groups. Examples of negatively- charged groups or precursors thereof, include carboxylate groups, sulfonate groups, sulfate groups, phosphonate groups, phosphate groups, hydroxyl groups, and the like. The charge of the charged moiety may vary, in some cases, with the environmental conditions, for example, changes in pH may alter the charge of the moiety, and / or cause the moiety to become charged or uncharged. In general, the charge density of the molecule may be selected as desired.
[0165] It should be understood that the terms “charged” or “charged moiety” does not refer to a “partial negative charge” or “partial positive charge” on a molecule. The terms “partial negative charge” and “partial positive charge” are given its ordinary meaning in the art. A “partial negative charge” may result when a functional group comprises a bond that becomes polarized such that electron density is pulled toward one atom of the bond, creating a partial negative charge on the atom. Those of ordinary skill in the art will, in general, recognize bonds that can become polarized in this way.
[0166] A lipid nanoparticle composition may include one or more ionizable (e.g., ionizable amino) lipids (e.g., lipids that may have a positive or partial positive charge at physiological pH). Ionizable lipids may be selected from the non-limiting group consisting of 3-(didodecylamino)-Nl,Nl,4-tridodecyl-l-piperazineethanamine (KL10), Nl-[2-(didodecylamino)ethyl] Nl ,N4,N4-tridodecyl- l ,4- piperazinediethanamine (KL22), 14,25- ditridecy 1-15,18,21 ,24-tetraaza-octatriacontane (KL25) , 1 ,2-dilinoleyloxy-N,N- dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin- MC3-DMA), 2,2-dilinoleyl-4-(2 dimethylaminoethyl)-[l,3]-dioxolane (DLin-KC2-DMA), l,2-dioleyloxy-N,Ndimethylaminopropane (DODMA), 2-({ 8 [(3(3)-cholest-5-en-3-yloxy]octylIoxy)N,N dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-l-amine(Octyl-CLinDMA), (2R)-2-({8-[(3(3)-cholest-5-en-3-yloxy]octylIoxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-l-amine (Octyl-CLinDMA (2R)), and (2S) 2- ({8-[(3(3)-chol e st-5-en-3 -yloxy] octyl } oxy)-N,N-dimethyl-3 -[(9Z,12Z)-octadeca-9,12-di en-1 -yloxy ]propan-l-amine (Octyl-CLinDMA (2S)), 4-hydroxybutyl ) azanediyl)bis (hexane- 6,l-diyl)bis(2-hexyldecanoate (ALC-0315), or heptadecan-9-yl 8-((2-hydroxyethyl) (6-oxo-6- (undecyloxy) hexyl) amino) octanoate (SM-102). In addition to these, an ionizable lipid may also be a lipid including a cyclic amine group.
[0167] Ionizable lipids can also be the compounds disclosed in International Publication No. WO 2017 / 075531 Al, hereby incorporated by reference in its entirety. Ionizable lipids can also be the compounds disclosed in International Publication No. WO 2015 / 199952 Al, hereby incorporated by reference in its entirety. In one embodiment, the ionizable lipid may be selected from, but not limited to, an ionizable lipid described in International Publication Nos. W02012040184, W02011153120, WO2011149733, W02011090965, W02011043913, W02011022460, WO2012061259, WO2012054365, WO2012044638, W02010080724, W0201021865, W02008103276, WO2013086373 and WO2013086354, US Patent Nos. 7,893,302, 7,404,969, 8,283,333, and 8,466,122 and US Patent Publication No. US20100036115, US20120202871, US20130064894, US20130129785, US20130150625, US20130178541 and US20130225836; the contents of each of which are herein incorporated by reference in their entirety.
[0168] As a non-limiting example, a ionizable lipid may be selected from (20Z,23Z)-N,N-dimethylnonacosa-20,23-dien-10-amine,(17Z,20Z)-N,Ndimemylhexacosa- 17,20-dien-9-amine,(lZ,19Z)-N5N-dimethylpentacosa-16,19-dien-8-amine,(13Z,16Z)-N,N- dimethyldocosa- 13, 16-dien-5-amine, (12Z,15Z)-N,N dimethylhenicosa-12,15-dien-4-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-6-amine, (15Z,18Z)-N,N-dimethyltetracosa- 15,18-dien-7-amine, (18Z,21Z)-N,Ndimethylheptacosa-18,21-dien-10-amine, (15Z,18Z)- N,N-dimethyltetracosa-l 5,18-dien-5-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-4- amine, (19Z,22Z)-N,Ndimeihyloctacosa-19,22-dien-9-amine, (18Z,21Z)-N,N- dimethylheptacosa-18,21-dien-8-amine, (17Z,20Z)-N,N-dimethylhexacosa-17,20-dien-7- amine, (16Z,19Z)-N,Ndimethylpentacosa-16,19-dien-6-amine, (22Z,25Z)-N,N- dimethylhentriaconta-22,25-dien-10-amine, (21Z ,24Z)-N,N-dimethyltriaconsa-21,24-dien-9- amine, (18Z)-N,Ndimetylheptacos-18-en-10-amine, (17Z)-N,N-dimethylhexacos-17-en-9-amine, (19Z,22Z)-N,N-dimethyloctacosa-19,22-dien-7-amine, N,N-dimethylheptacosan-10- amine, (20Z,23Z)-N-ethyl-N-methylnonacosa-20,23-dien-10-amine, 1-[(11Z,14Z)-1- nonylicosa-1 l,14-dien-l-yl]pyrrolidine, (20Z)-N,N-dimethylheptacos-20-en-10-amine, (15Z)- N,N-dimethyleptacos-15-en-10-amine, (14Z)-N,N-dimethylnonacos-14-en-10-amine, (17Z)- N,N-dimethylnonacos-17-en-10-amine, (24Z)-N,N-dimethyltritriacont-24-en-10-amine, (20Z)-N,N-dimethylnonacos-20-en- 10-amine, (22Z)-N,Ndimethylhentriacont-22-en- 10- amine, (16Z)-N,N-dimethylpentacos-16-en-8-amine, (12Z,15Z)-N,N-dimethyl-2- nonylhenicosa- 12, 15-dien- 1 -amine, ( 13 Z, 16Z)-N,Ndimethy 1 -3-nonyldocosa- 13,16-dien-l- amine, N,N-dimethyl- 1 - [( 1 S ,2R)-2-oetyleyclopropyl]eptadecan- 8-amine, 1 - [( 1 S ,2R)-2- hexylcyclopropy l]-N,Ndimethylnonadecan- 10-amine, N,N-dimethy 1- 1-[( lS,2R)-2- oetylcyclopropyl]nonadecan- 10-amine, N,N-dimethyl-21-[(lS,2R)-2- octylcyclopropyl]heni cosan- 10-amine, N,N-dimethy 1 - 1 - [( 1 S,2S)-2- { [( 1 R,2R)-2- penty Icy clopropyl] methyl } cyclopropyl] nonadecan- 10-amine, N,N-dimethyl- 1 - [( lS,2R)-2- octylcyclopropyl]hexadecan-8-amine, N,N-dimethyl-[(lR,2S)-2 undecy!cyclopropyl]tetradecan-5 -amine, N,N -dimethy 1 -3 - { 7- [( 1 S,2R)-2- octylcyclopropyl]heptylldodecan-l-amine, l-[(lR,2S)-2-heptylcyclopropyl]-N,Ndimethyloctadecan-9-amine, 1 - [( 1 S ,2R)-2-decylcyclopropy 1 ] -N,N-dimethylpentadecan-6-amine, N,N-dimethy 1 - 1 - [( 1 S ,2R)-2-octylcyclopropyl]pentadecan- 8-amine, R-N,Ndimethy 1 - 1 - [(9Z, 12Z)-octadeca-9, 12-dien-l-yloxy ] -3 -(octyloxy)propan-2-amine, S -N,Ndimethy 1 - 1 - [(9Z, 12Z)-octadeca-9, 12-dien-l-yloxy ] -3 -(octyloxy )propan-2-amine, l-{2- [(9Z,12Z)-octadeca-9,12-dien-l-yloxy]-l-[(octyloxy)methyl]ethyllpyrrolidine, (2S)-N,Ndimethy 1 - 1 - [(9Z, 12Z)-octadeca-9, 12-dien-l-yloxy ] -3 - [(5Z)-oct-5 -en-l-loxy ]propan-2- amine, 1 - { 2- [(9Z, 12Z)-octadeca-9, 12-dien-l-yloxy] - 1 - [(octyloxy)methyl]ethyllazetidine,(2S)-l-(hexyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-2-amine, (2S)-l-(heptyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-lyloxy]propan-2-amine, N,N-dimethy 1 - 1 -(nonyloxy)-3- [(9Z, 12Z)-octadeca-9, 12-dien- 1 -yloxy]propan-2-amine, N,N- dimethyl-l-[(9Z)-octadec-9-en-l-yloxy]-3-(octyl oxy)prop an-2-amine; (2 S)-N,N-dimethyl- l-[(6Z,9Z,12Z)-octadeca-6,9,12-trien-l-yloxy]-3-(octyloxy)propan-2-amine, (2S)-1-[(HZ,14Z)-icosa-l l, 14-dien-l-yloxy]-N,Ndimethyl-3-(pentyloxy)propan-2-amine, (2S)-1- (hexyloxy)-3-[(l lZ,14Z)-icosa-ll,14-dien-l-yloxy]-N,N-dimethylpropan-2-amine, 1- [(l lZ,14Z)-icosa-ll,14-dien-l-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, 1- [(13Z,16Z)-docosa-13,16-dien-l-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, (2S)-1- r(13Z,16Z)-docosa-13,16-dien-l-yloxy]-3-(hexyl oxy)-N,N-dimethylpropan-2-amine, (2S)-1- [(13Z)-docos- 13-en-l-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, 1 -[(13Z)-docos- 13-en-l-yloxy]-N,Ndimethyl-3-(octyl oxy )propan-2- amine, l-[(9Z)-hexadec-9-en-l-yloxy]-N,N- dimethyl-3-(octyloxy)propan-2-amine, (2R)-N,N-dimethyl-H(l-metoyloctyl)oxy]-3- [(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-2-amine, (2R)-l-[(3,7-dimethyloctyl)oxy]- N,Ndimethy 1-3- [(9Z, 12Z)-octadeca-9, 12-dien-l-yloxy]propan-2-amine, N,N-dimethy 1- 1 -(octyloxy)-3-({8-[(l S,2 S)-2-[(lR,2R)-2- pentylcyclopropyl]methylIcyclopropyl]octylIoxy)propan-2-amine, N,N-dimethyl-l-[8-(2- oclylcyclopropyl)octyl]oxy }-3-(octyloxy)propan-2-amine and (11E,2OZ,23Z)- N,Ndimethylnonacosa-l l,20,2-trien-10-amine or a pharmaceutically acceptable salt or stereoisomer thereof.
[0169] In some embodiments of the lipid composition of the present application, the ionizable lipids refer to lipid and lipid-like molecules with nitrogen atoms that can acquire charge (pKa). These molecules with amino groups typically have between 2 and 6 hydrophobic chains, often alkyl or alkenyl such as C6-C24 alkyl or alkenyl groups, but may have at least 1 or more that 6 tails. In some embodiments, these -ionizable lipids are dendrimers, which are a polymer exhibiting regular dendritic branching, formed by the sequential or generational addition of branched layers to or from a core and are characterized by a core, at least one interior branched layer, and a surface branched layer. (See Petar R. Dvornic and Donald A. Tomalia in Chem. in Britain, 641-645, August 1994.) In other embodiments, the term “dendrimer” as used herein is intended to include, but is not limited to, a molecular architecture with an interior core, interior layers (or “generations”) of repeating units regularly attached to this initiator core, and an exterior surface of terminal groups attached to the outermost generation. A “dendron” is a species of dendrimer having branches emanating from a focal point which is or can be joined to a core, either directly or through a linking moiety to form a larger dendrimer. In some embodiments, the dendrimer structures have radiating repeating groups from a central core which doubles with each repeating unit for each branch. In some embodiments, the dendrimers described herein may be described as a small molecule, mediumsized molecules, lipids, or lipid-like material. These terms may be used to describe compounds described herein which have a dendron like appearance (e.g. molecules which radiate from a single focal point).
[0170] While dendrimers are polymers, dendrimers may be preferable to traditional polymers because they have a controllable structure, a single molecular weight, numerous and controllable surface functionalities, and traditionally adopt a globular conformation afterreaching a specific generation. Dendrimers can be prepared by sequentially reactions of each repeating unit to produce monodisperse, tree-like and / or generational structure polymeric structures. Individual dendrimers consist of a central core molecule, with a dendritic wedge attached to one or more functional sites on that central core. The dendrimeric surface layer can have a variety of functional groups disposed thereon including anionic, cationic, hydrophilic, or lipophilic groups, according to the assembly monomers used during the preparation.
[0171] Modifying the functional groups and / or the chemical properties of the core, repeating units, and the surface or terminating groups, their physical properties can be modulated. Some properties which can be varied include, but are not limited to, solubility, toxicity, immunogenicity and bioattachment capability. Dendrimers are often described by their generation or number of repeating units in the branches. A dendrimer consisting of only the core molecule is referred to as Generation 0, while each consecutive repeating unit along all branches is Generation 1, Generation 2, and so on until the terminating or surface group. In some embodiments, half generations are possible resulting from only the first condensation reaction with the amine and not the second condensation reaction with the thiol.
[0172] Preparation of dendrimers requires a level of synthetic control achieved through series of stepwise reactions comprising building the dendrimer by each consecutive group. Dendrimer synthesis can be of the convergent or divergent type. During divergent dendrimer synthesis, the molecule is assembled from the core to the periphery in a stepwise process involving attaching one generation to the previous and then changing functional groups for the next stage of reaction. Functional group transformation is necessary to prevent uncontrolled polymerization. Such polymerization would lead to a highly branched molecule that is not monodisperse and is otherwise known as a hyperbranched polymer. Due to steric effects, continuing to react dendrimer repeat units leads to a sphere shaped or globular molecule, until steric overcrowding prevents complete reaction at a specific generation and destroys the molecule's monodispersity. Thus, in some embodiments, the dendrimers of Gl- G10 generation are specifically contemplated. In some embodiments, the dendrimers comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeating units, or any range derivable therein. In some embodiments, the dendrimers used herein are GO, Gl, G2, or G3. However, the number of possible generations (such as 11, 12, 13, 14, 15, 20, or 25) may be increased by reducing the spacing units in the branching polymer.
[0173] Additionally, dendrimers have two major chemical environments: the environment created by the specific surface groups on the termination generation and the interior of the dendritic structure which due to the higher order structure can be shielded from the bulk media and the surface groups. Because of these different chemical environments, dendrimers have found numerous different potential uses including in therapeutic applications.
[0174] In some embodiments of the lipid composition of the present application, the dendrimers are assembled using the differential reactivity of the acrylate and methacrylate groups with amines and thiols. The dendrimers may include secondary or tertiary amines and thioethers formed by the reaction of an acrylate group with a primary or secondary amine and a methacrylate with a mercapto group. Additionally, the repeating units of the dendrimers may contain groups which are degradable under physiological conditions. In some embodiments, these repeating units may contain one or more germinal diethers, esters, amides, or disulfides groups. In some embodiments, the core molecule is a monoamine which allows dendritic polymerization in only one direction. In other embodiments, the core molecule is a poly amine with multiple different dendritic branches which each may comprise one or more repeating units. The dendrimer may be formed by removing one or more hydrogen atoms from this core. In some embodiments, these hydrogen atoms are on a heteroatom such as a nitrogen atom. In some embodiments, the terminating group is a lipophilic groups such as a long chain alkyl or alkenyl group. In other embodiments, the terminating group is a long chain haloalkyl or haloalkenyl group. In other embodiments, the terminating group is an aliphatic or aromatic group containing an ionizable group such as an amine (-NH2) or a carboxylic acid (-CO2H). In still other embodiments, the terminating group is an aliphatic or aromatic group containing one or more hydrogen bond donors such as a hydroxide group, an amide group, or an ester.
[0175] The ionizable lipids of the present application may contain one or more asymmetrically-substituted carbon or nitrogen atoms, and may be isolated in optically active or racemic form. Thus, all chiral, diastereomeric, racemic form, epimeric form, and all geometric isomeric forms of a chemical formula are intended, unless the specific stereochemistry or isomeric form is specifically indicated. Ionizable lipids may occur as racemates and racemic mixtures, single enantiomers, diastereomeric mixtures and individual diastereomers. In some embodiments, a single diastereomer is obtained. The chiral centers of the ionizable lipids of the present application can have the S or the R configuration. Furthermore, it is contemplated that one or more of the ionizable lipids may be present asconstitutional isomers. In some embodiments, the compounds have the same formula but different connectivity to the nitrogen atoms of the core. Without wishing to be bound by any theory, it is believed that such ionizable lipids exist because the starting monomers react first with the primary amines and then statistically with any secondary amines present. Thus, the constitutional isomers may present the fully reacted primary amines and then a mixture of reacted secondary amines.
[0176] Chemical formulas used to represent ionizable lipids of the present application will typically only show one of possibly several different tautomers. For example, many types of ketone groups are known to exist in equilibrium with corresponding enol groups. Similarly, many types of imine groups exist in equilibrium with enamine groups. Regardless of which tautomer is depicted for a given formula, and regardless of which one is most prevalent, all tautomers of a given chemical formula are intended.
[0177] The ionizable lipids of the present disclosure may also have the advantage that they may be more efficacious than, be less toxic than, be longer acting than, be more potent than, produce fewer side effects than, be more easily absorbed than, and / or have a better pharmacokinetic profile (e.g., higher oral bioavailability and / or lower clearance) than, and / or have other useful pharmacological, physical, or chemical properties over, compounds known in the prior art, whether for use in the indications stated herein or otherwise.
[0178] In addition, atoms making up the ionizable lipids of the present application are intended to include all isotopic forms of such atoms. Isotopes, as used herein, include those atoms having the same atomic number but different mass numbers. By way of general example and without limitation, isotopes of hydrogen include tritium and deuterium, and isotopes of carbon include13C and14C.
[0179] It should be recognized that the particular anion or cation forming a part of any salt form of a ionizable lipids provided herein is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (2002), which is incorporated herein by reference.
[0180] In some embodiments of the lipid composition of the present application, the ionizable lipid is a dendrimer or dendron. In some embodiments, the ionizable lipid comprises an ammonium group which is positively charged at physiological pH and containsat least two hydrophobic groups. In some embodiments, the ammonium group is positively charged at a pH from about 6 to about 8. In some embodiments, the ionizable lipid is a dendrimer or dendron. In some embodiments, the ionizable lipid comprises at least two C6-C24 alkyl or alkenyl groups.I. Dendrimers of Formula (I)
[0181] In some embodiments of the lipid composition, the ionizable lipid comprises at least two C8-C24 alkyl groups. In some embodiments, the ionizable lipid is a dendrimer further defined by the formula:Core- (Repeating Unit)n-Terminating Group (D-I) wherein one or more hydrogen atoms of the core are replaced with a repeating unit and wherein: the core has the formula:wherein:Xi is amino or C1-C12 alkylamino, C1-C12 dialkylamino, C3-C12 heterocycloalkyl, C5-C12 heteroaryl, or a substituted version thereof;Ri is amino, hydroxy, mercapto, C1-C12 alkylamino, or Ci-C 12 dialkylamino, or a substituted version of either of these groups; and a is 1. 2, 3, 4. 5, or 6; or the core has the formula: wherein:X2 is N(R5)y;R5is hydrogen, Ci-Cis alkyl, or substituted Ci-Cis alky l; and y is 0. 1, or 2. provided that the sum of y and z is 3;R2 is amino, hydroxy, mercapto, C1-C12 alkylamino, or Ci-C 12 dialkylamino, or a substituted version of either of these groups; b is 1, 2, 3, 4, 5, or 6; and z is 1, 2, or 3; provided that the sum of z and y is 3; orthe core has the formula:wherein:X3 is -NR.6-, wherein Re is hydrogen, Ci-Cs alkyl, or Ci-Cs substituted alkyl, -O-, or Ci-Cs alkylaminodiyl, Ci-Cs alkoxydiyl, Ce-Cs arenediyl, Cs-Cs heteroarenediyl, CrCs heterocycloalkanediyl, or a substituted version of any of these groups;R3 and R4 are each independently amino, hydroxy, mercapto, C1-C12 alkylamino, or C1-C12 dialkylamino, or a substituted version of either of these groups; or a group of the formula: -N(Rf)f(CH2CH2N(Rc))eRd,wherein: e and f are each independently 1, 2, or 3; provided that the sum of e and f is 3;Rc, Rd, and Rf are each independently hydrogen, Ci-Ce alkyl, or substituted Ci-Ce alkyl; c and d are each independently 1, 2, 3, 4, 5, or 6; or the core is Ci-Cis alkylamine, C1-C36 dialkylamine, C3-C12 heterocycloalkane, or a substituted version of any of these groups; wherein the repeating unit comprises a degradable diacyl or a degradable diacyl and a linker; the degradable diacyl group has the formula:wherein:A; and A2 are each independently -O- , -S-, or -NRa-, wherein:Rais hydrogen, Ci-Ce alkyl, or substituted Ci-Ce alkvl;Y3 is C1-C12 alkanediyl, C1-C12 alkenediyl, C6-C12 arenediyl, or a substituted version of any of these groups; or a group of the formula:wherein:X3 and X4 are C1-C12 alkanediyl, C2-C12 alkenediyl, C6-C12 arenediyl, or a substituted version of any of these groups;Y5 is a covalent bond, Ci-C 12 alkanediyl, C1-C12 alkenediyl, C(>- C12 arenediyl, or a substituted version of any of these groups; andR9 is Ci-Cs alkyl or substituted Ci-Cs alkyl; the linker group has the formula:(D-VI) wherein:Yi is C1-C12 alkanediyl, C1-C12 alkenediyl, C6-C12 arenediyl, or a substituted version of any of these groups; and* wherein eachindependently denotes a point of attachment to another repeating unit or a terminating group; and the terminating group has the formula:wherein:Y4 is alkanediyl or an Ci-Cis alkanediyl wherein one or more of the hydrogen atoms on the Ci-Cis alkanediyl has been replaced with -OH, -F, -Cl, -Br, -I, -SH, -OCH3, -OCH2CH3, -SCH3, or -OC(O)CH3;Rio is hydrogen, carboxy, hydroxy,Ce-Cn aryl, C1-C12 alkylamino, C1-C12 dialkylamino, C3-C12A- heterocycloalkyl, -C(O)N(R11)- Ci-Ce alkanediyl- C3-C12 heterocycloalkyl, -C(O)- C1-C12 alkylamino, -C(O)- C1-C12 dialkylamino, or -C(O)- Ci-CiT 'V-heterocycloalkyl, wherein: Ri 1 is hydrogen, Ci-Ce alkyl, or substituted Ci-Ce alkyl; wherein the final degradable diacyl in the chain is attached to a terminating group; n is 0, 1, 2, 3, 4, 5, or 6; or a pharmaceutically acceptable salt thereof.
[0182] In some embodiments, the terminating group is further defined by the formula:wherein:Y4is Ci-C is alkanediyl; and Rio is hydrogen. In some embodiments, Ai and A2 are each independently -O- or-NRa-.
[0183] In some embodiments of the dendrimer of formula (D-I), the terminating group is a structure selected from the structures in Table 1.Table 1. Example terminating group / peripheries structures
[0184] In some embodiments of the dendrimer of formula (D-I), the core is further defined by the formula:wherein:X2 is N(R5)y;R5 is hydrogen or Ci-Cs alkyl, or substituted Ci-Cis alky l; and y is 0, 1, or 2, provided that the sum of y and z is 3;R2 is amino, hydroxy, or mercapto, or C1-C12 alkylamino, Ci-C 12 dialkylamino, or a substituted version of either of these groups; b is 1, 2, 3, 4, 5, or 6; and z is 1, 2, 3; provided that the sum of z and y is 3.
[0185] In some embodiments of the dendrimer of formula (D-I), the core is further defined by the formula:wherein:X3 is -NR6-, wherein Re is hydrogen, Ci-Cs alkyl, or substituted Ci-Cs alkyl, -O-, or Ci-Cs alkylaminodiyl, Ci-Cs alkoxydiyl, Ci-Cs arenediyl, Ci-Cs heteroarenediyl, Ci-Csheterocycloalkanediyl, or a substituted version of any of these groups;R3 and R4 are each independently amino, hydroxy, or mercapto, or C1-C12 alkylamino, dialkylamino, or a substituted version of either of these groups; or a group ofwherein: e and f are each independently 1, 2, or 3; provided that the sum of e and f is 3;Rc, Rd, and Rf are each independently hydrogen, Ci-Ce alkyl, or substituted Ci-Ce alkyl; c and d are each independently 1, 2, 3, 4, 5, or 6.
[0186] In some embodiments of the dendrimer of formula (I), the terminating group is represented by the formula:wherein:Y4 is alkanediyl(c≤18); andRio is hydrogen.
[0187] In some embodiments of the dendrimer of formula (D-I), a core of the structure of formula (D-IV) is:, or a pharmaceutically acceptable salt thereof.
[0188] In some embodiments of the dendrimer of formula (D-I), the core comprises a structural formula set forth in Table 2 and pharmaceutically acceptable salts thereof, wherein * indicates a point of attachment of the core to a repeating unit (i.e., where a hydrogen of the core is relaced with a repeating unit).Table 2. Example core structures
[0189] In some embodiments of the dendrimer of formula (D-I), the degradable diacyl is further defined as:
[0190] In some embodiments of the dendrimer of formula (D-I), the linker is further defined aswherein Yi is C1-C8 alkanediyl or substituted Cl -Cl 2 alkanediyl.
[0191] In some embodiments, in the core of formula (D-IV), Re is H. In some embodiments, in the core of formula (D-IV), Re is C1-C8 alkyl. In some embodiments, in the core of formula (D-IV), R6 is substituted alkyl (e.g., alkyl substituted with -NH2, alkyl substituted with -NHCH3, or alkyl substituted with -NHCH2CH3).
[0192] In some embodiments one or two hydrogen atoms of the core are replaced with a repeating unit. In some embodiments three or four hydrogen atoms of the core is replaced with a repeating unit. In some embodiments five hydrogen atoms of the core is replaced with a repeating unit. In some embodiments six hydrogen atoms of the core is replaced with a repeating unit.
[0193] In some embodiments of the dendrimer of formula (D-I), the dendrimer is selected from the group consisting of:and pharmaceutically acceptable salts thereof. IL Dendrimers of Formula (X)
[0194] In some embodiments of the lipid composition, the ionizable lipid is a dendrimer of the formula. In some embodiments, the ionizable lipid is a dendrimer of the formula
[0195] In some embodiments of the lipid composition, the ionizable lipid is a dendrimer of a generation (g) having a structural formula:or a pharmaceutically acceptable salt thereof, wherein:(a) the core comprises a structural formula (Xcore): (Xcore)wherein:Q is independently at each occurrence a covalent bond, -O-, -S-, -NR2-, or -CR3aR3b-; R2is independently at each occurrence Rlgor -L2-NRleRlf;R3aand R3bare each independently at each occurrence hydrogen or an optionally substituted (e.g., Ci-Ce, such as C1-C3) alkyl;Rla, Rlb, Rlc, Rld, Rle, Rlf, and Rlg(if present) are each independently at each occurrence a point of connection to a branch, hydrogen, or an optionally substituted (e.g., C1-C12) alkyl;L°, L1, and L2are each independently at each occurrence selected from a covalent bond, alkylene, heteroalkylene, [alkylene] -[heterocycloalkyl] -[alkylene], [alkylene]- (arylene)- [alkylene], heterocycloalkyl, and arylene; or, alternatively, part of L1form a (e.g. , Cr-Ce) heterocycloalkyl (e.g., containing one or two nitrogen atoms and, optionally, an additional heteroatom selected from oxygen and sulfur) with one of Rlcand Rld; and x1is 0, 1, 2, 3, 4, 5, or 6; and(b) each branch of the plurality (N) of branches independently comprises a structural formula (XB ranc h):(XBranch)wherein:* indicates a point of attachment of the branch to the core; g is 1. 2, 3, or 4;Z = 2(g’n;G=0, whenwhen g#l ;(c) each diacyl group independently comprises a structural formula* indicates a point of attachment of the diacyl group at the proximal end thereof;** indicates a point of attachment of the diacyl group at the distal end thereof;Y3is independently at each occurrence an optionally substituted (e.g. , C1-C12); alkylene, an optionally substituted (e.g., C1-C12) alkenylene, or an optionally substituted (e.g., C1-C12) arenylene:A1and A2are each independently at each occurrence -O-, -S-, or - NR4-, wherein:R4is hydrogen or optionally substituted (e.g., Ci-Ce) alkyl; m1and m2are each independently at each occurrence 1, 2, or 3; and R3C, R3d, R3e, and R3fare each independently at each occurrence hydrogen or an optionally substituted (e.g., Ci-Cs) alkyd; and (d) each linker group independently comprises a structural formulawherein:** indicates a point of attachment of the linker to a proximal diacyl group;*** indicates a point of attachment of the linker to a distal diacyl group; andYi is independently at each occurrence an optionally substituted (e.g. , C1-C12) alkylene, an optionally substituted (e.g., C1-C12) alkenylene, or an optionally substituted (e.g., C1-C12) arenylene; and(e) each terminating group is independently selected from optionally substituted (e.g., Ci-Cis, such as C4-C18) alkylthiol, and optionally substituted (e.g., Ci- Cis, such as C4-C18) alkenylthiol.
[0196] In some embodiments of Xcore, Q is independently at each occurrence a covalent bond, -O-, -S-, -NR2-, or -CR3aR3b. In some embodiments of Xcore Q is independently at each occurrence a covalent bond. In some embodiments of Xcore Q is independently at each occurrence an -O-. In some embodiments of XcoreQ is independently at each occurrence a -S- . In some embodiments of XcoreQ is independently at each occurrence a -NR2and R2is independently at each occurrence Rlgor -L2-NRleRlf. In some embodiments of Xcore Q is independently at each occurrence a -CR3aR3bR3a, and R3aand R3bare each independently at each occurrence hydrogen or an optionally substituted alkyl (e.g., C1-C6, such as C1-C3).
[0197] In some embodiments of Xcore, Rla, Rlb, Rlc, Rld, RIe, Rlf, and Rlg(if present) are each independently at each occurrence a point of connection to a branch, hydrogen, or an optionally substituted alkyl. In some embodiments of Xcore, Rla, Rlb, Rlc, Rld, Rle, Rlf, and Rlg(if present) are each independently at each occurrence a point of connection to a branch, hydrogen. In some embodiments of Xcore, Rla, Rlb, Rlc, Rld, Rle, Rlf, and Rlg(if present) are each independently at each occurrence a point of connection to a branch an optionally substituted alkyl (e.g. , C1-C12).
[0198] In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence selected from a covalent bond, alkylene, heteroalkylene, [alkylene] - [heterocycloalkyl]-[alkylene], [alkylene]-(arylene)-[alkylene], helerocycloalkyl. and arylene; or, alternatively, part of L1form a heterocycloalkyl (e.g., C4-C6 and containing one or two nitrogen atoms and, optionally, an additional heteroatom selected from oxygen and sulfur) with one of Rlcand Rld. In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be a covalent bond. In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be a hydrogen. In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be an alkylene (e.g., C1-C12, such as Ci- CG or C1-C3). In some embodiments of Xcorc, L°, L1, and L2are each independently at each occurrence can be a heteroalkylene (e.g., C1-C12, such as Ci-Cs or Ci-Ce). In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be a heteroalkylene (e.g., Cb-Cs alkyleneoxide, such as oligo(ethyleneoxide)). In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be a[alkylene] -[heterocycloalkyl] -[alkylene] [(e.g., Ci-Ce) alkylene] -[(e.g. , C4-C6) heterocycloalkyl]-[(<?.g., Ci-Ce) alkylene]. In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be a [alkylene]-(arylene)-[alkylene] [(e.g., Ci-Ce) alkylene]-(arylene)-[(e.g., Ci-Ce) alkylene]. In some embodiments of XcOTc, L°, L1, and L2are each independently at each occurrence can be a [alkylene] -(arylene)- [alkylene] (e.g. , |(<?. g. , Ci- Ce) alky lene]-phenylene- [(e.g. , Ci-Ce) alkylene]). In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be a heterocycloalkyl (e.g., C4- Ceheterocycloalkyl). In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be an arylene (e.g. , phenylene). In some embodiments of Xcore, part of L1form a heterocycloalkyl with one of Rlcand Rld. In some embodiments of Xcore, part of L1form a heterocycloalkyl (e.g., C4-C.6 heterocycloalkyl) with one of Rlcand Rldand the heterocycloalkyl can contain one or two nitrogen atoms and, optionally, an additional heteroatom selected from oxygen and sulfur.
[0199] In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence selected from a covalent bond, Ci-Ce alkylene (e.g. , C1-C3 alkylene), C2-C12 (e.g.,C2-Cs) alkyleneoxide (e.g., oligo(ethyleneoxide), such as -(CH2CH20)i4-(CH2CH2)-), [(C1-C4) alkylene]- [(C4-C6) heterocycloalkyl]- [(C1-C4) alkylene] (e.g.,), and [(C1-C4) alkylene]-phenylene-[(Ci-C4) alkylene] (e.g. ,In some embodiments ofXcore, L°, L1, and L2are each independently at each occurrence selected from Ci-Ce alkylene(e.g. , C1-C3 alkylene), -(C1-C3 alkylene-O)i-4-(Ci-C3 alkylene), -(C1-C3 alkylene)-phenylene- (C1-C3 alkylene)-, and -(C1-C3 alkylene)-piperazinyl-(Ci-C3 alkylene)-. In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence Ci-Ce alkylene (e.g., C1-C3 alkylene). In some embodiments, L°, L1, and L2are each independently at each occurrence C2- C12 (e.g., C2-C8) alkyleneoxide (e.g. , -(C1-C3 alkylene-O)i-4-(Ci-C3 alkylene)). In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence selected from[(C1-C4) alkylene] -[(C4-C6) heterocycloalkyl]-[(Ci-C4) alkylene] (e.g., -(C1-C3 alkylene)- phenylene-(Ci-C3 alkylene)-) and [(C1-C4) alkylene] -[(C4-C6) heterocycloalkyl]- [(C1-C4) alkylene] (e.g. , -(C1-C3 alkylene)-piperazinyl-(Ci-C3 alkylene)-).
[0200] In some embodiments of Xcore, x1is 0, 1, 2, 3, 4, 5, or 6. In some embodiments of Xcore, x1is 0. In some embodiments of Xcore, x1is 1. In some embodiments of Xcore, x1is 2. In some embodiments of Xcore. x1is 0, 3. In some embodiments of Xcorex1is 4. In some embodiments of Xcore x1is 5. In some embodiments of Xcore. x1is 6.
[0201] In some embodiments of Xcore, the core comprises a structural formula:.g., ). In some embodiments of Xcore, the core comprises a structural formula:. In some embodiments of Xcore, theRlarf3rf3-RlCR1 bR1g Rid core comprises a structural formula:some embodiments of Xcore, the core comprises a structural formula:Insome embodiments of Xcorc, the core comprises a structural formula:.Insome embodiments of Xcore. the core comprises a structural formula:). In some embodiments of Xcorethe core comprises a structural formula:, suchsome embodiments of Xcore, the core comprises a structural formula:wherein Q’ is -NR2- or -CR3aR3b-; q1and q2are each independently 1 or 2. In some embodiments of Xcore, the core comprises awherein ring A is an optionally substituted aryl or an optionally substituted (e.g., C3-C12, such as C3-C5) heteroaryl. In some embodiments of Xcore, the core comprises has a structural formula
[0202] In some embodiments of Xcore, the core comprises a structural formula set forth in Table 2 and pharmaceutically acceptable salts thereof, wherein * indicates a point of attachment of the core to a branch of the plurality of branches.
[0203] In some embodiments, the plurality (N) of branches comprises at least 3 branches, at least 4 branches, at least 5 branches. In some embodiments, the plurality (N) of branches comprises at least 3 branches. In some embodiments, the plurality (N) of branches comprises at least 4 branches. In some embodiments, the plurality (N) of branches comprises at least 5 branches.
[0204] In some embodiments of XBranch, g is 1, 2, 3, or 4. In some embodiments of XBranch, g is 1. In some embodiments of XBranch, g is 2. In some embodiments of XBranch, g is 3. In some embodiments of XBranch, g is 4.
[0205] In some embodiments of XBranch, Z = 2lg l)and when g=l, G=0. In some embodiments of XBranch, Z = 2(g-1)and G =21, when g / 1.
[0206] In some embodiments of XBranch, g=l, G=0, Z=l, and each branch of the plurality of branches comprises a structural formula each branch of the plurality of branches comprises a structural formula
[0207] In some embodiments of XBranch, g=2, G=l, Z=2, and each branch of the plurality of branches comprises a structural formula
[0208] In some embodiments of XBranch, g=3, G=3, Z=4, and each branch of the plurality of branches comprises a structural formula
[0209] In some embodiments of XBranch, g=4, G=7, Z=8, and each branch of the plurality of branches comprises a structural formula
[0210] In some embodiments, the dendrimers described herein with a generation(g) = 1 has the structure:
[0211] In some embodiments, the dendrimers described herein with a generation(g) = 1 has the structure:
[0212] An example formulation of the dendrimers described herein for generations1-4 is shown in Table 3. The number of diacyl groups, linker groups, and terminating groups can be calculated based on g.Table 3. Formulation of Dendrimer Groups Based on Generation (g)
[0213] In some embodiments, the diacyl group independently comprises a structural formula, * indicates a point of attachment of the diacyl group at the proximal end thereof, and ** indicates a point of attachment of the diacyl group at the distal end thereof.
[0214] In some embodiments of the diacyl group of XBranch, Y3is independently at each occurrence an optionally substituted; alkylene, an optionally substituted alkenylene, or an optionally substituted arenylene. In some embodiments of the diacyl group of XBranch, Y3is independently at each occurrence an optionally substituted alkylene (e.g., C1-C12). In some embodiments of the diacyl group of XBranch, Y3is independently at each occurrence an optionally substituted alkenylene (e.g., C1-C12). In some embodiments of the diacyl group ofXBranch, Y3is independently at each occurrence an optionally substituted arenylene (e.g., Ci- C12).
[0215] In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -O-, -S-, or -NR4-. In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -O-. In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -S-. In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -NR4- and R4is hydrogen or optionally substituted alkyl (e.g., Ci-Ce). In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 1, 2, or 3. In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 1. In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 2. In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 3. In some embodiments of the diacyl group of XBranch, R3c, R3d, R3e, and R3fare each independently at each occurrence hydrogen or an optionally substituted alkyl. In some embodiments of the diacyl group of XBranch, R3c, R3d, R3e, and R3fare each independently at each occurrence hydrogen. In some embodiments of the diacyl group of XBranch, R3c, R3d, R3e, and R3fare each independently at each occurrence an optionally substituted (e.g., Ci-Cs) alkyl.
[0216] In some embodiments of the diacyl group, A1is -O- or -NH-. In some embodiments of the diacyl group, A1is -O-. In some embodiments of the diacyl group, A2is - O- or -NH-. In some embodiments of the diacyl group, A2is -O-. In some embodiments of the diacyl group, Y3is C1-C12 (e.g., Ci-Ce, such as C1-C3) alkylene.
[0217] In some embodiments of the diacyl group, the diacyl group independentlyO O at each occurrence comprises a structural formula(e.g.,R3e, and R3fare each independently at each occurrence hydrogen or C1-C3 alkyl.
[0218] In some embodiments, linker group independently comprises a structural formula , ** indicates a point of attachment of the linker to a proximal diacyl group, and *** indicates a point of attachment of the linker to a distal diacyl group.
[0219] In some embodiments of the linker group of XBranch if present, Yi is independently at each occurrence an optionally substituted alkylene, an optionally substituted alkenylene, or an optionally substituted arenylene. In some embodiments of the linker group of XBranch if present, Y i is independently at each occurrence an optionally substituted alkylene (e.g. , C1-C12). In some embodiments of the linker group of XBranch if present, Yi is independently at each occurrence an optionally substituted alkenylene (e.g., C1-C12). In some embodiments of the linker group of XBranch if present, Y 1 is independently at each occurrence an optionally substituted arenylene (e.g. , C1-C12).
[0220] In some embodiments of the terminating group of XBranch, each terminating group is independently selected from optionally substituted alkylthiol and optionally substituted alkenylthiol. In some embodiments of the terminating group of XBranch, each terminating group is an optionally substituted alkylthiol (e.g., Ci-Cis, such as C4-C18). In some embodiments of the terminating group of XBranch, each terminating group is optionally substituted alkenylthiol (e.g., C1-C18, such as C4-C18).
[0221] In some embodiments of the terminating group of XBranch, each terminating group is independently Ci-Cis alkenylthiol or Ci-Cis alkylthiol, and the alkyl or alkenyl moiety is optionally substituted with one or more substituents each independently selected from halogen, C6-C12 aryl, C1-C12 alkylamino, C4-C6 iV-heterocycloalkyl , -OH, -C(O)OH, -C(O)N(CI-C3alkyl)-(Ci-C6alkylene)-(Ci-Ci2alkylamino), -C(O)N(CI-C3alkyl)-(Ci-C6alkylene)-(C4-Ce -V-heterocycloalkyl), -C(O)-(Ci-Ci2 alkylamino), and -C(O)-(C4-C6 N- heterocycloalkyl), and the C4-C6 / V-heterocycloalkyl moiety of any of the preceding substituents is optionally substituted with C1-C3 alkyl or C1-C3 hydroxyalkyl.
[0222] In some embodiments of the terminating group of XBranch, each terminating group is independently Ci-Cis (e.g., C4-C18) alkenylthiol or Ci-Cis (e.g., C4-C18) alkylthiol, wherein the alkyl or alkenyl moiety is optionally substituted with one or more substituents each independently selected from halogen, C6-C12 aryl (e.g., phenyl), C1-C12 (e.g., Ci-Cs) alkylamino (e.g., Ci-Ce mono-alkylamino (such as -NHCH2CH2CH2CH3) or Ci-Cs di-alkylamino (such asC4-C6 / / -heterocycloalkyl (e.g. ,A'-pyrrolidinyl ()), -OH, -C(O)OH,-C(O)N(CI-C3alkyl)-(Ci-C6alkylene)-(Ci-C 12 alkylamino (e.g., mono- or di-alkylamino)) 0alkylamino)), and -C(O)-(C4-Ce 7V-heterocycloalkyl) (wherein theC4-C6 A^-heterocycloalkyl moiety of any of the preceding substituents is optionally substituted with C1-C3 alkyl or C1-C3 hydroxy alkyl. In some embodiments of the terminating group of XBranch, each terminating group is independently Ci-Cis (e.g., C4-C18) alkylthiol, wherein the alkyl moiety is optionally substituted with one substituent -OH. In some embodiments of the terminating group of XBranch, each terminating group is independently Ci-Cis (e.g., C4-C18) alkylthiol, wherein the alkyl moiety is optionally substituted with one substituent selected from C1-C12 (e.g. , Ci-Cs) alkylamino (e.g., Ci-Ce mono- alkylamino (such as -NHCH2CH2CH2CH3) or Ci-Cs di-alkylamino (suchheterocycloalkyl (e.g., A^-pyrrolidinyl ( ^ ), jV-piperidinyl (“^ ), A-azepanyl ("Vk)). In some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18 (e.g. , C4-C18) alkenylthiol or Ci-Cis (e.g. , C4-C18) alkylthiol. In some embodiments of the terminating group of XBranch, each terminating group is independently Ci- Ci8 (e.g., C4-C18) alkylthiol.B. In some embodiments of Xcore, the core comprises a structural formula selected fromacceptable salts thereof, wherein * indicates a point of attachment of the core to a branch of the plurality of branches.
[0223] In some embodiments of the terminating group of XBranch, each terminating group is independently a structure selected from the structures in Table 1. In some embodiments, the dendrimers described herein can compnse a terminating group or pharmaceutically acceptable salt, or thereof selected in Table 1.
[0224] In some embodiments, the dendrimer of Formula (X) is selected from those set forth in Table 4 and pharmaceutically acceptable salts thereof.Table 5. Additional Covalent LipidsIII. Other Ionizable Lipids
[0225] In some embodiments of the lipid composition, the ionizable lipid comprises a structural formula (D-T):wherein: a is 1 and b is 2, 3, or 4; or, alternatively, b is 1 and a is 2, 3, or 4; m is 1 and n is 1; or, alternatively, m is 2 and n is 0; or, alternatively, m is 2 and n is 1; andR1, R2, R3, R4, R5, and R6are each independently selected from the group consisting of H, -CH2CH(OH)R7, -CH(R7)CH2OH, -CH2CH2C(=O)OR7, - CH2CH2C(=O)NHR7, and -CH2R7, wherein R7is independently selected from C3-C18 alkyl, C3-C18 alkenyl having one C=C double bond, a protecting group for an amino group, -C(=NH)NH2, a poly(ethylene glycol) chain, and a receptor ligand: provided that at least two moieties among R1to R6are independently selected from - CH2CH(OH)R7, -CH(R7)CH2OH, -CH2CH2C(=O)OR7, -CH2CH2C(=O)NHR7, or -CH2R7, wherein R7is independently selected from C3-C18 alkyl or C3-C18 alkenyl having one C=C double bond; and wherein one or more of the nitrogen atoms indicated in formula (D-P ) may be protonated to provide a ionizable lipid.
[0226] In some embodiments of the ionizable lipid of formula (D-P), a is 1. In some embodiments of the ionizable lipid of formula (D-I’), b is 2. In some embodiments of the ionizable lipid of formula (D-I’), m is 1. In some embodiments of the ionizable lipid of formula (D-I’), n is 1. In some embodiments of the ionizable lipid of formula (D-I’), R1, R2, R3, R4, R5, and R6are each independently H or -CH2CH(OH)R7. In some embodiments of the ionizableOH lipid of formula (D-I’), R1, R2, R3, R4, R5, and R6are each independently H or. In some embodiments of the ionizable lipid of formula (D-I’), R1, R2, R3, R4, Rs, and R6are eachOH independently H or. In some embodiments of the ionizable lipid of formula (D-I’), R7is C3-C18 alkyl (e.g., C6-C12 alkyl).
[0227] In some embodiments, the ionizable lipid of formula (D-I’) is 13,16,20- tris(2-hydroxydodecyl)-13,16,20,23-tetraazapentatricontane-l l,25-diol:
[0228] In some embodiments, the ionizable lipid of formula (D-T) is (11R, 257?)- 13,16,20-tris((7?)-2-hydroxydodecyl)-13,16,20,23-tetraazapentatricontane-l l,25-diol:
[0229] Additional ionizable lipids that can be used in the compositions and methods of the present application include those ionizable lipids as described in International Patent Publication W02010144740, W02013149140, WO2016118725, WO2016118724, WO2013063468, WO2016205691, WO2015184256, W02016004202, WO2015199952,W02017004143, WO2017075531, WO2017117528, WO2017049245, WO2017173054 and W02015095340,
[0230] Additionally, dendrimers have two major chemical environments: the environment created by the specific surface groups on the termination generation and the interior of the dendritic structure which due to the higher order structure can be shielded from the bulk media and the surface groups. Because of these different chemical environments, dendrimers have found numerous different potential uses including in therapeutic applications.
[0231] In some aspects, the dendrimers that may be used in the present compositions are assembled using the differential reactivity of the acrylate and methacrylate groups with amines and thiols. The dendrimers may include secondary or tertiary amines and thioethers formed by the reaction of an acrylate group with a primary or secondary amine and a methacrylate with a mercapto group. Additionally, the repeating units of the dendrimers may contain groups which are degradable under physiological conditions. In some embodiments, these repeating units may contain one or more germinal diethers, esters, amides, or disulfides groups. In some embodiments, the core molecule is a monoamine which allows dendritic polymerization in only one direction. In other embodiments, the core molecule is a polyamine with multiple different dendritic branches which each may comprise one or more repeating units. The dendrimer may be formed by removing one or more hydrogen atoms from this core. In some embodiments, these hydrogen atoms are on a heteroatom such as a nitrogen atom. In some embodiments, the terminating group is a lipophilic groups such as a long chain alkyl or alkenyl group. In other embodiments, the terminating group is a long chain haloalkyl or haloalkenyl group. In other embodiments, the terminating group is an aliphatic or aromatic group containing an ionizable group such as an amine (-NH2) or a carboxylic acid (-CO2H). In still other embodiments, the terminating group is an aliphatic or aromatic group containing one or more hydrogen bond donors such as a hydroxide group, an amide group, or an ester.
[0232] The cationic ionizable lipids of the present disclosure may contain one or more asymmetrically-substituted carbon or nitrogen atoms, and may be isolated in optically active or racemic form. Thus, all chiral, diastereomeric, racemic form, epimeric form, and all geometric isomeric forms of a chemical formula are intended, unless the specific stereochemistry or isomeric form is specifically indicated. Cationic ionizable lipids may occur as racemates and racemic mixtures, single enantiomers, diastereomeric mixtures and individual diastereomers. In some embodiments, a single diastereomer is obtained. The chiral centers of the cationic ionizable lipids of the present disclosure can have the S or the R configuration. Furthermore, it is contemplated that one or more of the cationic ionizable lipids may be presentas constitutional isomers. In some embodiments, the compounds have the same formula but different connectivity to the nitrogen atoms of the core. Without wishing to be bound by any theory, it is believed that such cationic ionizable lipids exist because the starting monomers react first with the primary amines and then statistically with any secondary amines present. Thus, the constitutional isomers may present the fully reacted primary amines and then a mixture of reacted secondary amines.
[0233] Chemical formulas used to represent cationic ionizable lipids of the present disclosure will typically only show one of possibly several different tautomers. For example, many types of ketone groups are known to exist in equilibrium with corresponding enol groups. Similarly, many types of imine groups exist in equilibrium with enamine groups. Regardless of which tautomer is depicted for a given formula, and regardless of which one is most prevalent, all tautomers of a given chemical formula are intended.
[0234] The cationic ionizable lipids of the present disclosure may also have the advantage that they may be more efficacious than, be less toxic than, be longer acting than, be more potent than, produce fewer side effects than, be more easily absorbed than, and / or have a better pharmacokinetic profile (e.g., higher oral bioavailability and / or lower clearance) than, and / or have other useful pharmacological, physical, or chemical properties over, compounds known in the prior art, whether for use in the indications stated herein or otherwise.
[0235] In addition, atoms making up the cationic ionizable lipids of the present disclosure are intended to include all isotopic forms of such atoms. Isotopes, as used herein, include those atoms having the same atomic number but different mass numbers. By way of general example and without limitation, isotopes of hydrogen include tritium and deuterium, and isotopes of carbon include13C and14C.
[0236] It should be recognized that the particular anion or cation forming a part of any salt form of a cationic ionizable lipids provided herein is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (2002), which is incorporated herein by reference.
[0237] In some embodiments, the ionizable cationic lipid is present in an amount from about from about 20 to about 23. In some embodiments, the molar percentage is from about 20, 20.5, 21, 21.5, 22, 22.5, to about 23 or any range derivable therein. In otherembodiments, the molar percentage is from about 7.5 to about 20. In some embodiments, the molar percentage is from about 7.5, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, to about 20 or any range derivable therein.D. ADDITIONAL LIPIDS IN THE LIPID NANOPARTICLES
[0238] In some aspects of the present disclosure, the disclosed compositions comprise one or more additional lipids. In some embodiments, the cationic ionizable lipids are mixed with 1, 2, 3, 4, or 5 different types of lipids. It is contemplated that the cationic ionizable lipids can be mixed with multiple different lipids of a single type. In some embodiments, the cationic ionizable lipids compositions comprise at least a steroid or a steroid derivative, a PEG lipid, and a phospholipid.
[0239] In some embodiments, the lipid nanoparticles are preferentially delivered to a target organ. In some embodiments, the target organ is selected from the lungs, the heart, the brain, the spleen, the bones, the skeletal muscles, the stomach, the small intestine, the large intestine, the kidneys, the bladder, the breast, the testes, the ovaries, the uterus, the spleen, the thymus, the brainstem, the cerebellum, the spinal cord, the eye, the ear, the tongue, or the skin. Alternatively, the composition may be preferentially delivered to a target organ system such as the nervous system, the cardiovascular system, or the respiratory system or a part of one of these organ system. As used herein, the term “preferentially delivered” is used to refer to a composition which is delivered to the target organ or organ system in at least 25% of the amount administered. This term is used to refer to a composition in which at least 25%, 50%, or at least 75% of the amount administered.1. Steroids and Steroid Derivatives
[0240] In some aspects of the present disclosure, the cationic ionizable lipids are mixed with one or more steroid or a steroid derivative to create a composition. In some embodiments, the steroid or steroid derivative comprises any steroid or steroid derivative. As used herein, in some embodiments, the term “steroid” is a class of compounds with a four ring 17 carbon cyclic structure which can further comprises one or more substitutions including alkyl groups, alkoxy groups, hydroxy groups, oxo groups, acyl groups, or a double bond between two or more carbon atoms. In one aspect, the ring structure of a steroid comprises three fused cyclohexyl rings and a fused cyclopentyl ring as shown in the formula below:In some embodiments, the compositions comprise a steroid derivative comprises the ring structure above with one or more non-alkyl substitutions. In some embodiments, the steroid or steroid derivative is a sterol wherein the formula is further defined as:
[0241] In some embodiments of the present disclosure, the steroid or steroid derivative is a cholestane or cholestane derivative. In a cholestane, the ring structure is further defined by the formula:As described above, a cholestane derivative includes one or more non-alkyl substitution of the above ring system. In some embodiments, the cholestane or cholestane derivative is a cholestene or cholestene derivative or a sterol or a sterol derivative. In other embodiments, the cholestane or cholestane derivative is both a cholestere and a sterol or a derivative thereof.
[0242] In some embodiments, the compositions may further comprise a molar percentage of the sterol relative or steroid derivative to the total lipid composition from about 5 to about 75. In some embodiments, the molar percentage is from about 10 to about 60, or any range derivable therein. In other embodiments, the molar percentage of the sterol relative or steroid derivative to the total lipid composition is from about 15 to about 50. In some embodiments, the molar percentage is about 25 to about 50 or any range derivable therein. In some embodiments, the molar percentage of sterol relative or sterol derivative to the total lipid composition is about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, or about 50.2. PEG or PEGylated lipid
[0243] In some aspects of the present disclosure, the nanoparticles disclosed herein comprise one or more PEGylated lipids (or PEG lipid). In some embodiments, the present disclosure comprises using any lipid to which a PEG group has been attached. In some embodiments, the PEG lipid is a diglyceride which also comprises a PEG chain attached to the glycerol group. In other embodiments, the PEG lipid is a compound which contains one or more C6-C24 long chain alkyl or alkenyl group or a C6-C24 fatty acid group attached to a linker group with a PEG chain. Some non-limiting examples of a PEG lipid includes a PEG modified phosphatidylethanolamine and phosphatidic acid, a PEG ceramide conjugated, PEG modified dialkylamines and PEG modified l,2-diacyloxypropan-3-amines, PEG modified diacylglycerols and dialkylglycerols. In some embodiments, PEG modified diastearoylphosphatidylethanolamine or PEG modified dimyristoyl-.sn-glycerol. In some embodiments, the PEG modification is measured by the molecular weight of PEG component of the lipid. In some embodiments, the PEG modification has a molecular weight from about 100 to about 15,000. In some embodiments, the molecular weight is from about 200 to about 500, from about 400 to about 5,000, from about 500 to about 3,000, or from about 1,200 to about 3,000. The molecular weight of the PEG modification is from about 100, 200, 400, 500, 600, 800, 1,000, 1,250, 1,500, 1,750, 2,000, 2,250, 2,500, 2,750, 3,000, 3,500, 4,000, 4,500, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 12,500, to about 15,000. Some non-limiting examples of lipids that may be used in the present invention are taught by U.S. Patent 5,820,873, WO 2010 / 141069, or U.S. Patent 8,450,298, which is incorporated herein by reference.
[0244] In another aspect, the PEG lipid has the formula:wherein: R12 and R13 are each independently alkyl(c≤24), alkenyl(c≤24), or a substituted version of either of these groups; Re is hydrogen, alkyl(C≤8), or substituted alkyl<C≤8); and x is 1-250. In some embodiments, Reis alkyl(C≤8) such as methyl. R12 and R13 are each independently alkyl(c≤4-20). In some embodiments, x is 5-250. In one embodiment, x is 5-125 or x is 100-250. In some embodiments, the PEG lipid is l,2-dimyristoyl-.v / i-glycerol, methoxypolyethylene glycol.
[0245] In another aspect, the PEG lipid has the formula:wherein: m is an integer between 1 and 100 and m and ns are each independently selected from an integer between 1 and 29. In some embodiments, ni is 5, 10, 15, 20, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100, or any range derivable therein. In some embodiments, m is from about 30 to about 50. In some embodiments, ns is from 5 to 23. In some embodiments, ns is 11 to about 17. In some embodiments, ns is from 5 to 23. In some embodiments, ns is 11 to about 17.
[0246] In some embodiments, the compositions may further comprise a molar percentage of the PEG lipid to the total lipid composition from about 0.1 to about 20. In some embodiments, the molar percentage is from about 0.25 to about 12.5, or any range derivable therein. In other embodiments, the molar percentage of the PEG lipid to the total lipid composition is from about 0.5 to about 10. In some embodiments, the molar percentage is about 1 to about 6 or any range derivable therein. In some embodiments, the molar percentage of the PEG lipid to the total lipid composition is about 1, about 2, about 3, about 4, about 5, about 6, or any range derivable therein.3. Phospholipid
[0247] In some embodiments of the present disclosure, the nanoparticles disclosed herein comprise one or more phospholipids to create a composition. In some embodiments, any lipid which also comprises a phosphate group. In some embodiments, the phospholipid is a structure which contains one or two long chain C6-C24 alkyl or alkenyl groups, a glycerol or a sphingosine, one or two phosphate groups, and, optionally, a small organic molecule. In some embodiments, the small organic molecule is an amino acid, a sugar, or an amino substituted alkoxy group, such as choline or ethanolamine. In some embodiments, the phospholipid is a phosphatidylcholine. In some embodiments, the phospholipid is distearoylphosphatidylcholine or dioleoylphosphatidylethanolamine.
[0248] In some embodiments, the nanoparticles disclosed herein may comprise a molar percentage of the phospholipid to the total lipid composition from about 1.0 to about 70. In some embodiments, the molar percentage is about 10, about 20, about 30, about 40, about 50, about 60, or about 70, or any range derivable therein. In some embodiments, the molar percentage is from about 10 to about 60, or any range derivable therein. In other embodiments, the molar percentage is from about 10 to about 45 or about 20 to about 40, or any range derivable therein. In some embodiments, the molar percentage of the phospholipid to the total lipid composition is about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, or about 40, or any range derivable therein.E. NUCLEIC ACIDS AND NUCLEIC ACID BASED THERAPEUTIC AGENTSNucleic acids
[0249] As mentioned elsewhere in the application, the presently disclosed compositions comprise a therapeutic agent. In some embodiments, the therapeutic agent is a nucleic acid. The presently disclosed compositions may comprise a therapeutically effective amount of nucleic acid. In some embodiments, the lipid composition comprises one or more nucleic acids. In some embodiments, the weight ratio of the lipid composition to the nucleic acid is from about 100:1 to about 1:5. In some embodiments, the weight ratio of lipid composition to nucleic acid is from about 5:1, 2.5: 1, 1: 1, 1:5, 1:10, 1:15, 1:20, 1:25, 1:30, 1 :35, 1:40, 1:45, 1:50, 1:60, 1:70, 1:80, 1:90, or 1: 100, or any range derivable therein. In some embodiments, the weight ratio is from about 50:1 to about 5:1, or any range derivable therein. In some embodiments, the weight ratio of lipid composition to nucleic acid is about 50: 1 , about 45: 1, about 40: 1, about 35: l, about 30: 1, about 25:1, about 20:1, about 15:1, about 10:1, about 5 : 1 , or any range derivable therein. In addition, it should be clear that the present disclosure is not limited to the specific nucleic acids disclosed herein. The present invention is not limited in scope to any particular source, sequence, or type of nucleic acid, however, as one of ordinary skill in the art could readily identify related homologs in various other sources of the nucleic acid including nucleic acids from non-human species (e.g., mouse, rat, rabbit, dog, monkey, gibbon, chimp, ape, baboon, cow, pig, horse, sheep, cat and other species). It is contemplated that the nucleic acid used in the present disclosure can comprises a sequence based upon a naturally-occurring sequence. Allowing for the degeneracy of the genetic code, sequences that have at least about 50%, usually at least about 60%, more usually about 70%, most usuallyabout 80%, preferably at least about 90% and most preferably about 95% of nucleotides that are identical to the nucleotide sequence of the naturally-occurring sequence. In another embodiment, the nucleic acid is a complementary sequence to a naturally occurring sequence, or complementary to 75%, 80%, 85%, 90%, 95% and 100%. Longer polynucleotides encoding 250, 500, 1000, 1212, 1500, 2000, 2500, 3000 or longer are contemplated herein.
[0250] The nucleic acid used herein may be derived from genomic DNA, i.e.. cloned directly from the genome of a particular organism. In preferred embodiments, however, the nucleic acid would comprise complementary DNA (cDNA). Also contemplated is a cDNA plus a natural intron or an intron derived from another gene; such engineered molecules are sometime referred to as "mini-genes." At a minimum, these and other nucleic acids of the present invention may be used as molecular weight standards in, for example, gel electrophoresis.
[0251] The term "cDNA" is intended to refer to DNA prepared using messenger RNA (mRNA) as template. The advantage of using a cDNA, as opposed to genomic DNA or DNA polymerized from a genomic, non- or partially-processed RNA template, is that the cDNA primarily contains coding sequences of the corresponding protein. There may be times when the full or partial genomic sequence is preferred, such as where the non-coding regions are required for optimal expression or where non-coding regions such as introns are to be targeted in an antisense strategy.
[0252] In some embodiments, the nucleic acid comprises one or more antisense segments which inhibits expression of a gene or gene product. Antisense methodology takes advantage of the fact that nucleic acids tend to pair with "complementary" sequences. By complementary, it is meant that polynucleotides are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules. That is, the larger purines will base pair with the smaller pyrimidines to form combinations of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. Inclusion of less common bases such as inosine, 5- methylcytosine, 6-methyladenine, hypoxanthine and others in hybridizing sequences does not interfere with pairing.
[0253] Targeting double-stranded (ds) DNA with polynucleotides leads to triplehelix formation; targeting RNA will lead to double-helix formation. Antisense polynucleotides,when introduced into a target cell, specifically bind to their target polynucleotide and interfere with transcription, RNA processing, transport, translation and / or stability. Antisense RNA constructs, or DNA encoding such antisense RNA's, may be employed to inhibit gene transcription or translation or both within a host cell, either in vitro or in vivo, such as within a host animal, including a human subject.
[0254] Antisense constructs may be designed to bind to the promoter and other control regions, exons, introns or even exon-intron boundaries of a gene. It is contemplated that the most effective antisense constructs will include regions complementary to intron / exon splice junctions. Thus, it is proposed that a preferred embodiment includes an antisense construct with complementarity to regions within 50-200 bases of an intron-exon splice junction. It has been observed that some exon sequences can be included in the construct without seriously affecting the target selectivity thereof. The amount of exonic material included will vary depending on the particular exon and intron sequences used. One can readily test whether too much exon DNA is included simply by testing the constructs in vitro to determine whether normal cellular function is affected or whether the expression of related genes having complementary sequences is affected.
[0255] As stated above, "complementary" or "antisense" means polynucleotide sequences that are substantially complementary over their entire length and have very few base mismatches. For example, sequences of fifteen bases in length may be termed complementary when they have complementary nucleotides at thirteen or fourteen positions. Naturally, sequences which are completely complementary will be sequences which are entirely complementary throughout their entire length and have no base mismatches. Other sequences with lower degrees of homology also are contemplated. For example, an antisense construct which has limited regions of high homology, but also contains a non-homologous region (e.g., ribozyme; see below) could be designed. These molecules, though having less than 50% homology, would bind to target sequences under appropriate conditions.4. Modified Nucleobases
[0256] In some embodiments, the nucleic acids of the present disclosure comprise one or more modified nucleosides comprising a modified sugar moiety. Such compounds comprising one or more sugar-modified nucleosides may have desirable properties, such as enhanced nuclease stability or increased binding affinity with a target nucleic acid relative toan oligonucleotide comprising only nucleosides comprising naturally occurring sugar moieties. In some embodiments, modified sugar moieties are substituted sugar moieties. In some embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of substituted sugar moieties.
[0257] In some embodiments, modified sugar moieties are substituted sugar moieties comprising one or more non-bridging sugar substituent, including but not limited to substituents at the 2' and / or 5' positions. Examples of sugar substituents suitable for the 2'- position, include, but are not limited to: 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'- O(CH2)2OCH3("MOE"). In certain embodiments, sugar substituents at the 2' position is selected from allyl, amino, azido, thio, O-allyl, O-Ci-Cw alkyl, O— Ci-Cio substituted alkyl; OCF3, O(CH2)2SCH3, O(CH2)2-O-N(Rm)(R11), and O-CH2-C(=O)-N(Rm)(Rn), where each Rm and R11is, independently, H or substituted or unsubstituted Ci-Cio alkyl. Examples of sugar substituents at the 5'-position, include, but are not limited to: 5'-methyl (R or S); 5'-vinyl, and 5'-methoxy. In some embodiments, substituted sugars comprise more than one nonbridging sugar substituent, for example, T-F-5'-methyl sugar moieties (see, e.g., PCT International Application WO 2008 / 101157, for additional 5',2'-bis substituted sugar moieties and nucleosides).
[0258] Nucleosides comprising 2'-substituted sugar moieties are referred to as 2'- substituted nucleosides. In some embodiments, a 2'-substituted nucleoside comprises a 2'- substituent group selected from halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O, S, or N(Rm)-alkyl; O, S. or N(Rm)-alkenyl; O, S or N(Rm)-alkynyl; O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2-O-N(Rm)(Rn) or O-CH2- C(=O)— N(Rm)(Rn), where each Rmand Rnis, independently, H, an amino protecting group or substituted or unsubstituted Ci-Cio alkyl. These 2' -substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and alkynyl.
[0259] In some embodiments, a 2'-substituted nucleoside comprises a 2'-substituent group selected from F, NH2, N3, OCF3, O-CH3, O(CH2)3NH2, CH2— CH=CH2, O-CH2— CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O-(CH2)2-O-N(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (O— CH2— C(=O)— N(Rm)(Rn) whereeach Rm and Rnis, independently, H, an amino protecting group or substituted or unsubstituted C1-C10 alkyl.
[0260] In some embodiments, a 2'-substituted nucleoside comprises a sugar moiety comprising a 2'-substituent group selected from F, OCF3, O— CH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2-O-N(CH3)2, -O(CH2)2O(CH2)2N(CH3)2, and O-CH2-C(=O)- N(H)CH3.
[0261] In some embodiments, a 2'-substituted nucleoside comprises a sugar moiety comprising a 2'-substituent group selected from F, O-CH3, and OCH2CH2OCH3.
[0262] Certain modified sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In some such embodiments, the bicyclic sugar moiety comprises a bridge between the 4’ and the 2' furanose ring atoms. Examples of such 4' to 2’ sugar substituents, include, but are not limited to: — [C(Ra)(Rb)]n-, -- [C(Ra)(Rb)]n-O-, -C(RaRb)-N(R)-O- or, -C(RaRb)-O-N(R)-; 4'-CH2-2’, 4'-(CH2)2-2', 4'- (CH2)-O-2' (LNA); 4'-(CH2)— S-2'; 4'-(CH2)2-O-2' (ENA); 4'-CH(CH3) -O-2' (cEt) and 4'- CH(CH2OCH3)-O-2', and analogs thereof (see, e.g., U.S. Patent 7,399,845); 4'-C(CH3)(CH3)- -O-2' and analogs thereof, (see, e.g.. WO 2009 / 006478); 4'-CH2-N(OCH3)-2’ and analogs thereof (see, e.g., W02008 / 150729); 4'-CH2-O-N(CH3)-2' (see, e.g., US2004 / 017 E570, published Sep. 2, 2004); 4'-CH2— O— N(R)-2', and 4'-CH2-N(R)-O-2'-, wherein each R is, independently, H, a protecting group, or C1-C12 alkyl; 4'-CH2— N(R)— O-2', wherein R is H, Ci- C12 alkyl, or a protecting group (see. U.S. Patent. 7,427.672); 4'-CH2-C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al. , J. Org. Chem., 2009, 74, 118-134); and 4'-CH2-C(=CH2)-2' and analogs thereof (see, PCT International Application WO 2008 / 154401).
[0263] In some embodiments, such 4' to 2’ bridges independently comprise from 1 to 4 linked groups independently selected from — [C(Ra)(Rb)]n-, -C(Ra)=C(Rb)-, -C(Ra)=N- -, -C(=NRa)-, -C(=O)-, -C(=S)— , -O-, -Si(Ra)2-, -S(=O)X-, and -N(Ra)-; wherein: x is 0. 1, or 2; n is 1, 2, 3, or 4; each Raand Rbis, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclicradical, substituted C5-C7 alicyclic radical, halogen, OJi, NJ1J2, SJi, N3, COOJi, acyl (C(=O)--H), substituted acyl, CN, sulfonyl (S(=O)2-Ji), or sulfoxyl (S(=O)-Ji); and each Ji and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2- C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5- C20 aryl, substituted C5-C20 aryl, acyl (C(=O)— H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.
[0264] Nucleosides comprising bicyclic sugar moieties are referred to as bicyclic nucleosides or BNAs. Bicyclic nucleosides include, but are not limited to, (A) a-L- Methyleneoxy (4'-CH2-O-2') BNA, (B) P-D-Methyleneoxy (4'-CH2-O-2') BNA (also referred to as locked nucleic acid or LNA), (C) Ethyleneoxy (4'-(CH2)2-O-2') BNA, (D) Aminooxy (4'- CH2-O-N(R)-2’) BNA, (E) Oxyamino (4’-CH2-N(R)-O-2') BNA, (F) Methyl(methyleneoxy) (4'-CH(CH3)— 0-2’) BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4'-CH2-S-2') BNA, (H) methylene- amino (4'-CH2-N(R)-2’) BNA, (I) methyl carbocyclic (4'-CH2-CH(CH3)-2') BNA, (J) propylene carbocyclic (4'-(CH2)3-2') BNA, and (K) Methoxy(ethyleneoxy) (4’-CH(CH2OMe)-O-2') BNA (also referred to as constrained MOE or cMOE).
[0265] Additional bicyclic sugar moieties are known in the art, for example: Singh et al., Chem. Commun., 1998, 4, 455-456: Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al. , J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 5561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Patents 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191, 6,670,461, and 7,399,845; WO 2004 / 106356, WO 1994 / 14226, WO 2005 / 021570, and WO 2007 / 134181; U.S. Patent Publication Nos. US 2004 / 0171570, US 2007 / 0287831, and US 2008 / 0039618; U.S. Serial Nos. 12 / 129,154, 60 / 989,574, 61 / 026,995, 61 / 026,998, 61 / 056,564, 61 / 086,231, 61 / 097,787, and 61 / 099,844; and PCT International Applications Nos. PCT / US2008 / 064591, PCT / US2008 / 066154, and PCT / US2008 / 068922.
[0266] In some embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. Forexample, a nucleoside comprising a 4'-2' methylene-oxy bridge, may be in the .alpha.-L configuration or in the .beta.-D configuration. Previously, a-L-methyleneoxy (4'-CH2-O-2') bicyclic nucleosides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).
[0267] In some embodiments, substituted sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5'-substituted and 4'-2' bridged sugars; PCT International Application WO 2007 / 134181, wherein LNA is substituted with, for example, a 5'-methyl or a 5'-vinyl group).
[0268] In some embodiments, modified sugar moieties are sugar surrogates. In some such embodiments, the oxygen atom of the naturally occurring sugar is substituted, e.g., with a sulfer, carbon or nitrogen atom. In some such embodiments, such modified sugar moiety also comprises bridging and / or non-bridging substituents as described above. For example, certain sugar surrogates comprise a 4'-sulfur atom and a substitution at the 2’-position (see, e.g. , published U.S. Patent Application US 2005 / 0130923) and / or the 5' position. By way of additional example, carbocyclic bicyclic nucleosides having a 4'-2' bridge have been described (see, e.g., Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740).
[0269] In some embodiments, sugar surrogates comprise rings having other than 5- atoms. For example, in some embodiments, a sugar surrogate comprises a six-membered tetrahydropyran. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, C J. Bioorg. & Med. Chem. (2002) 10:841-854), and fluoro HNA (F-HNA).
[0270] In some embodiments, the modified THP nucleosides of Formula VII are provided wherein qi, q2, qi, q4, qs, qe and q? are each H. In certain embodiments, at least one of qi, q2, qa, q4, qs, qe and q? is other than H. In some embodiments, at least one of qi, q2, qs, q4, qs, qe and q? is methyl. In some embodiments, THP nucleosides of Formula VII are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is fluoro and R2 is H, Ri is methoxy and R2 is H, and Ri is methoxy ethoxy and R2 is H.
[0271] Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds(see, e.g. , review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841- 854).
[0272] Combinations of modifications are also provided without limitation, such as 2'-F-5'-methyl substituted nucleosides (see PCT International Application WO 2008 / 101157 for other disclosed 5’,2’-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2'-position (see U.S. Patent Publication US 2005 / 0130923) or alternatively 5'-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007 / 134181 wherein a 4’-CH2-O-2' bicyclic nucleoside is further substituted at the 5' position with a 5’-methyl or a 5’-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., IGOTI).
[0273] In some embodiments, the present invention provides oligonucleotides comprising modified nucleosides. Those modified nucleotides may include modified sugars, modified nucleobases, and / or modified linkages. The specific modifications are selected such that the resulting oligonucleotides possess desirable characteristics. In some embodiments, oligonucleotides comprise one or more RNA-like nucleosides. In some embodiments, oligonucleotides comprise one or more DNA-like nucleotides.
[0274] In some embodiments, nucleosides of the present invention comprise one or more unmodified nucleobases. In certain embodiments, nucleosides of the present invention comprise one or more modified nucleobases.
[0275] In some embodiments, modified nucleobases are selected from: universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil; 5-propynylcytosine; 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7- deazaguanine and 7-deazaadenine, 3 -deazaguanine and 3 -deazaadenine, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine([5,4-b][l,4]benzoxazin-2(3H)-one), phenothiazine cytidine (lH-pyrimido[5,4- b][l,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g., 9- (2-aminoethoxy)-H-pyrimido[5,4-13][l,4]benzoxazin-2(3H)-one), carbazole cytidine (2H- pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3- d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7- deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Patent 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; those disclosed by Englisch et al., 1991; and those disclosed by Sanghvi, Y. S., 1993.
[0276] Representative United States Patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, U.S. Patents 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502.177; 5.525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,645,985; 5,681,941; 5,750,692; 5,763,588; 5,830,653 and 6,005,096, each of which is herein incorporated by reference in its entirety.
[0277] In some embodiments, the present invention provides oligonucleotides comprising linked nucleosides. In such embodiments, nucleosides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing intern ucleoside linkages include, but are not limited to, phosphodiesters (P=O), phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates (P=S). Representative non-phosphorus containing intemucleoside linking groups include, but are not limited to, methylenemethylimino (— CFE— NCCEE)— O— CH2— ), thiodiester (-O— C(O)— S— ), thionocarbamate (— O-C(O)(NH)— S-); siloxane (-O-Si(H)2-O-); and N,N'- dimethylhydrazine (— CH2-N(CH3)— N(CFh)— ). Modified linkages, compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In some embodiments, intemucleoside linkages having a chiral atom can beprepared as a racemic mixture, or as separate enantiomers. Representative chiral linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.
[0278] The oligonucleotides described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), a or P such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the antisense compounds provided herein are all such possible isomers, as well as their racemic and optically pure forms.
[0279] Neutral internucleoside linkages include without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2— C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), and thioformacetal (3'-S— CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvt and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2component parts.
[0280] Additional modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide. For example, one additional modification of the ligand conjugated oligonucleotides of the present invention involves chemically linking to the oligonucleotide one or more additional non-ligand moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al. , 1989), cholic acid (Manoharan et al., 1994), a thioether, e.g., hexyl-5 -tritylthiol (Manoharan et al., 1992; Manoharan et al., 1993), a thiocholesterol (Oberhauser et al., 1992), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., 1991; Kabanov et al., 1990; Svinarchuk et al., 1993), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., 1995; Shea et al., 1990), a polyamine or a polyethylene glycol chain (Manoharan et al., 1995), or adamantane aceticacid (Manoharan et al., 1995), a palmityl moiety (Mishra et al. , 1995), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., 1996).
[0281] Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Patents 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552.538; 5.578,717, 5.580,731; 5,580,731;5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718;5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263;4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963;5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262.536; 5,272,250; 5,292,873; 5,317,098;5,371,241, 5,391,723; 5,416,203. 5,451.463; 5,510.475; 5.512,667; 5.514,785; 5,565,552;5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is herein incorporated by reference.5. Proteins
[0282] In some embodiments, the compositions may further comprise one or more proteins. Some proteins may include enzymes such as nuclease enzymes. The compositions described herein may comprise one or more CRISPR associated proteins (e.g. CRISPR enzyme) including a Cas protein. Non-limiting examples of Cas proteins include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof. These enzymes are known; for example, the amino acid sequence of .S'. pyogenes Cas9 protein may be found in the SwissProt database under accession number Q99ZW2.
[0283] The protein in the compositions described herein may be Cas9 (e.g., from .S'. pyogenes or S. pneumonia). The CRISPR enzyme can direct cleavage of one or both strands at the location of a target sequence, such as within the target sequence and / or within the complement of the target sequence. The CRISPR enzyme may be mutated with respect to a corresponding wild-type enzyme such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence. For example, an aspartate-to-alanine substitution (D10A) in the RuvC I catalytic domain of Cas9 from .S'. pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand). In some embodiments, a Cas9 nickase may be used in combination with guidesequence(s), e.g., two guide sequences, which target respectively sense and antisense strands of the DNA target. This combination allows both strands to be nicked and used to induce NHEJ or HDR.F. PHARMACEUTICAL FORMULATIONS AND ROUTES OF ADMINISTRATION
[0284] In another aspect, for administration to a patient in need of such treatment, pharmaceutical formulations (also referred to as a pharmaceutical preparations, pharmaceutical compositions, pharmaceutical products, medicinal products, medicines, medications, or medicaments) comprise a therapeutically effective amount of a compound disclosed herein formulated with one or more excipients and / or drug carriers appropriate to the indicated route of administration. In some embodiments, the compounds disclosed herein are formulated in a manner amenable for the treatment of human and / or veterinary patients. In some embodiments, formulation comprises admixing or combining one or more of the compounds disclosed herein with one or more of the following excipients: lactose, sucrose, starch powder, cellulose esters of alkanoic acids, cellulose alkyl esters, talc, stearic acid, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulfuric acids, gelatin, acacia, sodium alginate, polyvinylpyrrolidone, and / or poly vinyl alcohol. In some embodiments, e.g., for oral administration, the pharmaceutical formulation may be tableted or encapsulated. In some embodiments, the compounds may be dissolved or slurried in water, polyethylene glycol, propylene glycol, ethanol, corn oil, cottonseed oil, peanut oil, sesame oil, benzyl alcohol, sodium chloride, and / or various buffers. In some embodiments, the pharmaceutical formulations may be subjected to pharmaceutical operations, such as sterilization, and / or may contain drug carriers and / or excipients such as preservatives, stabilizers, wetting agents, emulsifiers, encapsulating agents such as lipids, dendrimers, polymers, proteins such as albumin, nucleic acids, and buffers.
[0285] Pharmaceutical formulations may be administered by a variety of methods, e.g., orally or by injection (e.g. subcutaneous, intravenous, and intraperitoneal). Depending on the route of administration, the compounds disclosed herein may be coated in a material to protect the compound from the action of acids and other natural conditions which may inactivate the compound. To administer the active compound by other than parenteral administration, it may be necessary to coat the compound with, or co-administer the compound with, a material to prevent its inactivation. In some embodiments, the active compound may be administered to a patient in an appropriate carrier, for example, liposomes, or a diluent.Pharmaceutically acceptable diluents include saline and aqueous buffer solutions. Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes.
[0286] The compounds disclosed herein may also be administered parenterally, intraperitoneally, intraspinally, or intracerebrally. Dispersions can be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.
[0287] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (such as, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.
[0288] The compounds disclosed herein can be administered orally, for example, with an inert diluent or an assimilable edible carrier. The compounds and other ingredients may also be enclosed in a hard or soft-shell gelatin capsule, compressed into tablets, or incorporated directly into the patient’ s diet. For oral therapeutic administration, the compounds disclosed herein may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. The percentage of the therapeutic compound in the compositions and preparations may, of course, be varied. The amount of the therapeutic compound in such pharmaceutical formulations is such that a suitable dosage will be obtained.
[0289] The therapeutic compound may also be administered topically to the skin, eye, ear, or mucosal membranes. Administration of the therapeutic compound topically may include formulations of the compounds as a topical solution, lotion, cream, ointment, gel, foam, transdermal patch, or tincture. When the therapeutic compound is formulated for topical administration, the compound may be combined with one or more agents that increase the permeability of the compound through the tissue to which it is administered. In other embodiments, it is contemplated that the topical administration is administered to the eye. Such administration may be applied to the surface of the cornea, conjunctiva, or sclera. Without wishing to be bound by any theory, it is believed that administration to the surface of the eye allows the therapeutic compound to reach the posterior portion of the eye. Ophthalmic topical administration can be formulated as a solution, suspension, ointment, gel, or emulsion. Finally, topical administration may also include administration to the mucosa membranes such as the inside of the mouth. Such administration can be directly to a particular location within the mucosal membrane such as a tooth, a sore, or an ulcer. Alternatively, if local delivery to the lungs is desired the therapeutic compound may be administered by inhalation in a dry-powder or aerosol formulation.
[0290] In some embodiments, it may be advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the patients to be treated; each unit containing a predetermined quantity of therapeutic compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. In some embodiments, the specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the therapeutic compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such a therapeutic compound for the treatment of a selected condition in a patient. In some embodiments, active compounds are administered at a therapeutically effective dosage sufficient to treat a condition associated with a condition in a patient. For example, the efficacy of a compound can be evaluated in an animal model system that may be predictive of efficacy in treating the disease in a human or another animal.
[0291] In some embodiments, the effective dose range for the therapeutic compound can be extrapolated from effective doses determined in animal studies for a variety of different animals. In some embodiments, the human equivalent dose (HED) in mg / kg canbe calculated in accordance with the following formula (see, e.g., Reagan-Shaw el al., FASEB J., 22(3):659-661, 2008, which is incorporated herein by reference):HED (mg / kg) = Animal dose (mg / kg) x (Animal Km / Human Km)Use of the Kmfactors in conversion results in HED values based on body surface area (BSA) rather than only on body mass. Kmvalues for humans and various animals are well known. For example, the Kmfor an average 60 kg human (with a BSA of 1.6 m2) is 37, whereas a 20 kg child (BSA 0.8 m2) would have a Kmof 25. Kmfor some relevant animal models are also well known, including: mice Kmof 3 (given a weight of 0.02 kg and BSA of 0.007); hamster Kmof 5 (given a weight of 0.08 kg and BSA of 0.02); rat Kmof 6 (given a weight of 0.15 kg and BSA of 0.025) and monkey Kmof 12 (given a weight of 3 kg and BSA of 0.24).
[0292] Precise amounts of the therapeutic composition depend on the judgment of the practitioner and are specific to each individual. Nonetheless, a calculated HED dose provides a general guide. Other factors affecting the dose include the physical and clinical state of the patient, the route of administration, the intended goal of treatment and the potency, stability and toxicity of the particular therapeutic formulation.
[0293] The actual dosage amount of a compound of the present disclosure or composition comprising a compound of the present disclosure administered to a patient may be determined by physical and physiological factors such as type of animal treated, age, sex, body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. These factors may be determined by a skilled artisan. The practitioner responsible for administration will typically determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual patient. The dosage may be adjusted by the individual physician in the event of any complication.
[0294] In some embodiments, the therapeutically effective amount typically will vary from about 0.001 mg / kg to about 1000 mg / kg, from about 0.01 mg / kg to about 750 mg / kg, from about 100 mg / kg to about 500 mg / kg, from about 1 mg / kg to about 250 mg / kg, from about 10 mg / kg to about 150 mg / kg in one or more dose administrations daily, for one or several days (depending of course of the mode of administration and the factors discussed above). Other suitable dose ranges include 1 mg to 10,000 mg per day, 100 mg to 10,000 mg per day, 500 mg to 10,000 mg per day, and 500 mg to 1,000 mg per day. In some embodiments, the amount is less than 10,000 mg per day with a range of 750 mg to 9,000 mg per day.
[0295] In some embodiments, the amount of the active compound in the pharmaceutical formulation is from about 2 to about 75 weight percent. In some of these embodiments, the amount if from about 25 to about 60 weight percent.
[0296] Single or multiple doses of the agents are contemplated. Desired time intervals for delivery of multiple doses can be determined by one of ordinary skill in the art employing no more than routine experimentation. As an example, patients may be administered two doses daily at approximately 12-hour intervals. In some embodiments, the agent is administered once a day.
[0297] The agent(s) may be administered on a routine schedule. As used herein a routine schedule refers to a predetermined designated period of time. The routine schedule may encompass periods of time which are identical, or which differ in length, as long as the schedule is predetermined. For instance, the routine schedule may involve administration twice a day, every day, every two days, every three days, every four days, every five days, every six days, a weekly basis, a monthly basis or any set number of days or weeks there-between. Alternatively, the predetermined routine schedule may involve administration on a twice daily basis for the first week, followed by a daily basis for several months, etc. In other embodiments, the invention provides that the agent(s) may be taken orally and that the timing of which is or is not dependent upon food intake. Thus, for example, the agent can be taken every morning and / or every evening, regardless of when the patient has eaten or will eat.F. KITS
[0298] The present disclosure also provides kits. Any of the components disclosed herein may be combined in the form of a kit. In some embodiments, the kits comprise a composition as described above or in the claims.
[0299] The kits will generally include at least one vial, test tube, flask, bottle, syringe or other container, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit, the kit also will generally contain a second, third or other additional containers into which the additional components may be separately placed. However, various combinations of components may be comprised in a container. In some embodiments, all of the lipid nanoparticle components are combined in a single container. In other embodiments, some or all of the lipid nanoparticle components are provided in separate containers.
[0300] The kits of the present invention also will typically include packaging for containing the various containers in close confinement for commercial sale. Such packaging may include cardboard or injection or blow molded plastic packaging into which the desired containers are retained. A kit may also include instructions for employing the kit components. Instructions may include variations that can be implemented.G. EXAMPLES
[0301] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.Example 1 - Development of Bone Marrow (BM) Homing LNPs
[0302] To form LNPs that target hematopoietic stem cells (HSCs), 41 molecules that have the potential to form covalent bonds with amino acid residues were incorporated into lipid nanoparticle compositions. The 41 molecules included 16 carbohydrates, 6 vitamins, 7 amino acids, 5 hormones, 5 neurotransmitters, 1 nucleotide, and 1 covalent lipid (stearic acid N-hydroxysuccinimide ester, SA-NHS) (FIG. 1). A degradable dendrimer ionizable (pKa<7) cationic lipid 5A2-SC8 formulation named mDLNP, originally optimized for delivery of mRNA to the liver, was used as the base 4-component formulation, which consists of 5A2-SC8 (Zhou et al., 2016) (ionizable lipid), l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and l,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG- PEG-2000) at a molar ratio of 15: 15:30:3.
[0303] The molar percentage of test molecules versus total lipids was fixed at 20% during the study mirroring prior approaches to generate organ targeting LNPs (Cheng et al., 2020), and mRNA encoding firefly luciferase (Luc) was encapsulated to examine the delivery tropism of produced protein. Surprisingly, LNPs with SA-NHS incorporation demonstrated BM tropism while all other molecules led to liver, spleen, or mixed tropism. Reasoning that SA-NHS contains a labile NHS group which may undergo hydrolysis in aqueous solution,stearic acid, the hydrolysis product of SA-NHS, was incorporated into LNPs and the in vivo delivery fate was examined. Incorporation of stearic acid into LNPs did not lead to BM luciferase mRNA delivery (FIG. 2), indicating, without being bound by theory, that the reactive lipid itself and not a potential hydrolysis product caused the BM tropism. The incorporation of an unreactive molecule (5-octylthieno[3,4-c]pyrrole-4, 6-dione) with similar head group to NHS ester into LNPs also did not yield BM delivery (FIG. 2). These two negative control results confirmed that SA-NHS, the covalent lipid species, exhibited BM delivery tropism.
[0304] The molecular diversity of covalent lipid species was expanded to identify additional molecules with higher BM transfection efficacy (FIG. 3A). To understand if BM tropism is specific to amine-reactive NHS ester head group or is applicable to multiple reactivity profiles, a collection of lipids with different reactive functional groups was selected for evaluation in vivo (FIG. 4). These lipids can be divided into 4 categories: reactive solely to amine; reactive solely to carboxylic acid; reactive solely to thiol; crosslinking reagent. Within each category, the molecules consisted of different head group structures and / or hydrophobic domains to ensure chemical diversity in the study.
[0305] In the amine-reactive group, a high hit rate (defined as higher than IxlO6photons s’1cm'2sr1luminescence) of 83.3% was observed from NHS ester lipids possessing various structures of hydrophobic domains (FIG. 3C). Anhydride lipids, on the other hand, demonstrated polarized performances as palmitic anhydride showed the highest Luc delivery efficacy while trimellic anhydride was the lowest (FIG. 3C). Subtle change in the head group led in some cases to a dramatic decrease in BM transfection; for example, A3 vs A10, where isothiocyanate displayed high efficacy while isocyanate almost lost all activity (FIG. 2, FIG. 3C). In the thiol-reactive group, neither acrylate nor acrylamide containing lipids displayed BM transfection activity (FIG. 3C). This is likely due, without being bound by theory, to the hydrophobicity of the molecules in that the thiol-reactive C=C double bond is buried in the internal LNP and not exposed on the surface. T3 and T4 are maleimido- and 2-pyridyldithio- containing lipids and surprisingly, T4 displayed much higher activity than T3 although these two lipids possess nearly identical hydrophobic domains (FIG. 2, FIG. 3C). In the carboxylic- reactive group, molecules containing carbodiimide structure, a canonical moiety for activating carboxylic acid for crosslinking with amine, displayed a high hit rate with different hydrophobic domains varying activity to some extent (FIG. 2, FIG. 3C). Hydrazide andhydrazine containing lipids were also included in the screen and displayed low hit rate, probably due, again without being bound by theory, to the low activity to carboxylic acid in the absence of catalyst (FIG. 3C).
[0306] The crosslinker category may be further divided into 4 groups based on reactivity: amine to thiol crosslinker (AT), thiol to carboxylic crosslinker (TC), carboxylic to carboxylic crosslinker (CC), and amine to amine crosslinker (AA) (FIG. 4). The AT group displayed a high hit rate, especially those with NHS moieties on one end (FIG. 3D). TC and CC groups only contained 1 molecule, but both demonstrated high activity. Crosslinkers AA1, AA3, AA4, AA7, AA9, and AA11 all possessed linear hydrophobic domain and NHS ester groups on both ends (FIG. 4). Crosslinker AA11 displayed the highest Luc delivery efficacy among crosslinkers and surprisingly, crosslinker AA3, with variation only on sulfo-NHS ester over NHS ester, showed only one tenth of efficacy (FIG. 3D). This can be attributed, without being bound by theory, to the increased hydrophilicity of AA3, which resulted in poor presentation on the hydrophobic LNP surface. Crosslinkers AA1, AA4, AA7, and AA9 possessed very similar structure as crosslinker AA11 and only differed in the length and composition of the linkers. However, these crosslinkers had lower activities, with crosslinker AA1 losing all activity. Crosslinker AA6 possessed 3 NHS ester groups, however, it did not show as high activity as crosslinker AA11, probably, without being bound by theory, due to its irregular shape and poor presentation on the LNP surface (FIG. 4, FIG. 3D). Crosslinker AA10 possessed 2 aldehyde groups and, consistent with highly active single aldehyde containing lipid A12, demonstrated high activity. Overall, NHS ester and 2-pyridyldithio containing lipids yielded polarized delivery efficacy, whereas hydrazide and aldehyde containing crosslinkers yielded more efficacious Luc activity.Example 2 - Lipid nanoparticles enable mRNA delivery to HSCs with high efficacy
[0307] To determine which BM cell types are transfected by the presently disclosed LNP compositions, genetically engineered tdTomato (tdTom) reporter mice containing a LoxP flanked stopper cassette to prevent the expression of tdTom fluorescent protein were utilized (Madisen et al., 2010). Cre recombinase can delete the stop cassette and activate tdTom expression, thus allowing detection of gene edited cells (FIG. 5A). Cre mRNA were encapsulated with BM homing LNPs, administered IV into tdTom mice, and harvested femur bone 72 hours after the injection (FIG. 5A). Fluorescence signals of tested formulationsappeared all over the bone and were much higher than that of PBS or mDLNP treated animals (FIG. 5B). tdTom+ cells were easily distinguished using confocal imaging of BM tissue sections (FIG. 5C).
[0308] Delivery into specific cell types was quantified using flow cytometry with cells isolated from BM 72 hours post Cre mRNA LNP IV administration to tdTom mice (FIG. 6-FIG. 9). All tested formulations enabled Cre mRNA delivery to HSCs, progenitor cells, B cells, T cells, macrophages, monocytes, and neutrophils after a single injection at low dose (0.6 mg / kg) (FIG. 5D). Specifically, AA11 mediated the highest delivery efficacy in HSCs, leading to tdTom+ cells in 44.8% Lin Sca-l+CD117+(LSK) population, 40.2% long-term HSC (LT- HSC), 17-66% in different progenitor cells, 7.19% B cell, 17.0% T cell, 32.1% macrophage, 7.55% monocyte, and 22.9% neutrophil. The high transfection efficacy in LT-HSC suggests, without being bound by theory, that BM homing LNPs may be suitable for correcting inherited hematopoietic diseases. Moreover, the transfection efficacy was further enhanced by administering higher dose or multiple doses (FIG. 9).Example 3 - Mechanism of BM tropism
[0309] To investigate the mechanism of action, the physical properties of BM homing LNPs, including size, surface charge, and mRNA encapsulation efficiency were characterized. All formulations tested with the inclusion of molecules in FIG. 3 displayed 120- 170 nm in size, near neutral surface charge, and >80% encapsulation efficiency with few outliers (FIG. 10A, FIG. 10B, Table 4). These data were comparable to that of mDLNP, Liver targeting LNPs, Spleen targeting LNPs, and Lung targeting LNPs (Cheng et al., 2020; Dilliard et al., 2021). Since covalent lipids and crosslinkers have the capability of forming strong interactions or even covalent bonds with certain serum proteins, the composition of the protein coronas formed on the surface of BM homing LNPs may differ from that of mDLNP, which, without being bound by theory, may lead to BM delivery tropism.Table 4: Summary of LNP size, ^-potential, and mRNA encapsulation efficiency.
[0310] Nine BM homing LNPs with high BM transfection efficacy containing chemically diverse covalent lipid species were selected for further study. The selected LNPs were incubated with mouse plasma. Bound proteins were extracted and analyzed by SDS- PAGE. Unlike Spleen and Lung targeting LNPs that display drastically different gel patterns, most BM homing LNPs exhibited similar protein corona composition to that of mDLNP (FIG. 11). Unbiased mass spectrometry proteomics were employed to identify and quantify which serum proteins bind most avidly to the BM homing formulations. ApoE was found to be the top enriched serum protein in 7 out of 9 BM homing formulations (FIG. 10C, Table 6-Table 18).
[0311] To further study the impact of ApoE, 3 BM homing LNPs encapsulating luciferase mRNA IV were administered to ApoE knockout (ApoE7) mice and found that the luminescence signals were significantly lower than those in wild type mice (FIG. 10D). Given that ApoE mediates liver delivery in multiple reports (Dilliard et al., 2021; Dilliard & Siegwart, 2023; Akinc et al., 2010; Kim et al., 2021), this finding suggests, without being bound bytheory, the existence of a previously unknown role of ApoE in mediating LNPs delivery into BM.Table 6. Average abundance and physiological function of the proteins that are most enriched in the protein corona of A12-BM-homing formulation (n = 3).Table 7. Average abundance and physiological function of the proteins that are most enriched in the protein corona of A8-BM-homing formulation (n = 3).Table 8. Average abundance and physiological function of the proteins that are most enriched in the protein corona of C9-BM-homing formulation (n = 3).Table 9. Average abundance and physiological function of the proteins that are most enriched in the protein corona of AAlO-BM-homing formulation (n = 3).Table 10. Average abundance and physiological function of the proteins that arc most enriched in the protein corona of All-BM-homing formulation (n = 3).Table 11. Average abundance and physiological function of the proteins that are most enriched in the protein corona of C5-BM-homing formulation (n = 3).Table 12. Average abundance and physiological function of the proteins that are most enriched in the protein corona of CC-BM-homing formulation (n = 3).Table 13. Average abundance and physiological function of the proteins that are most enriched in the protein corona of A13-BM-homing formulation (n = 3).Table 14. Average abundance and physiological function of the proteins that are most enriched in the protein corona of AAll-BM-homing formulation (n = 3).Table 15. Average abundance and physiological function of the proteins that are most enriched in the protein corona of mDLNP formu ation (n = 3).Table 16. The protospacer sequences of sgRNAs used in this study. All sgRNAs have 3X 2'-O-methyl phosphorothioate (MS) modification on both 5’ and 3’ ends.Table 17. Forward and reverse primers of PCR products.Table 18. Forward and reverse primers of PCR products used for NGS.Example 4 - BM homing LNPs mediated HSC genome editing in a 0-globin disorder mouse model
[0312] To investigate if BM homing LNPs achieve genome editing to disrupt or correct disease relevant alleles in diseased animals, a study using a Townes UIBBS / S) mouse model, in which endogenous adult a- and P-like globin genes are replaced by human globin genes with the sickle cell mutation, resulting in sickle cell disease (SCD) phenotypes was performed (Wu et al., 2006). A CRISPR / Cas9 gene editing system was used to disrupt the BCL11 A transcriptional repressor binding motif in the HBG1 / HBG2 gene promoter (Metais et al., 2019), which has the potential to induce fetal hemoglobin (HbF) and reduce the morbidity and mortality of P-globin disorders (FIG. 12A). Homozygous sickle Townes (HBBS / S) mice received two weekly IV injections of BM homing LNPs containing 20 mol% palmitic hydrazide (C6) encapsulating Cas9 mRNA and sgRNA (sgG34) (FIG. 12B). Next-generation sequencing (NGS) demonstrated that insertion and / or deletion mutations (indels) were present in 5.2% of alleles in hematopoietic stem and progenitor cells (HSPCs) 7 days after the final LNP administration (FIG. 12C, FIG. 12D).
[0313] Although promising in preclinical and early clinical studies, treating P- globin disorders with nuclease genome editing strategies is not without risk, as nucleases have been shown to induce DNA damage responses, cause loss of chromosome arms, and lead to variability in HbF induction outcomes (Enache etal., 2020; Haapaniemi et al., 2018; Leibowitz et al., 2021; Mayuranathan et al., 2023; Zuccaro et al., 2020). Indeed, base editing approaches to induce HbF production were recently shown to be more potent and more uniform than nuclease approaches, since nucleases generate uncontrolled mixtures of indels that can each cause different biological consequences when characterized as individual clones. Therefore, precision genome editing strategies such as base editing and prime editing (Anzalone et al., 2019) may possess advantages over nuclease delivery. ABE8e_NRCH (Miller et al., 2020;Richter et al., 2020), an adenine base editor designed to convert sickle cell disease allele to a non-pathogenic, Makassar allele (FIG. 12E) was used. Similar to the CRISPR / Cas study, HBBS / Smice received two weekly IV injections of BM homing LNPs containing 20 mol% palmitic hydrazide (C6) encapsulating ABE8e_NRCH mRNA and sgRNA (sgHBB). NGS demonstrated that 2.43% of sickle cell alleles were converted to the Makassar allele along with 2.25% silent editing at the A9 position in HSPCs 7 days after the final LNP administration (FIG. 12F, FIG. 12G).These results of adenine base editing of the sickle cell allele and Cas9 disruption of a BCL11A binding motif regulating the HBG1 / HBG2 genes represent the first non- viral demonstrations of in vivo genome editing of [3-glob i n disorder relevant genes in the bone marrow.Example 5 - BM homing LNPs enabled mRNA delivery and genome editing in an aggressive leukemia model
[0314] Previous results have established the capability of BM homing LNPs in transfecting healthy and diseased HSCs for in vivo genome editing on disease relevant genes. However, the ability of BM homing LNPs to enable mRNA delivery to malignant cell types remained unknown. A mixed lineage leukemia (MLL)-fusion driven acute myeloid leukemia (AML) model was used to evaluate transfection efficacy of BM homing LNPs to leukemic cells. The t(9;l 1) (p22;q23) reciprocal translocation results in the expression of MLL-AF9 fusion gene and myelo-monoblastic AML, which is typically associated with extramedullary tumor infiltration, resistance to chemotherapy, frequent relapses, and poor survival (Stavropoulou et al., 2018; Marschalek, 2015; Stavropoulou et al., 2016).
[0315] An MLL-AF9-IRES-YFP-encoding plasmid (Kang et al., 2015; Wu et al., 2021; Zheng et al., 2012) was used for lentiviral infection of Lin’ cells isolated from tdTom reporter mice (FIG. 13A). To confirm the success of oncogene insertion, the integrity of loxP- tdTom reporter cassette and the capability of LNPs in transfecting this newly created malignant cell type, the cells were first incubated with LNPs encapsulating Cre mRNA and determined the activation of tdTom expression 24 hours later using confocal microscopy. 28% of cells showed strong tdTom expression upon low LNP dose treatment (100 ng mRNA per well) and the number increased to 63% upon higher dose treatment (200 ng mRNA per well) (FIG. 13C, FIG. 13D). The Cre-mediated recombination was also confirmed by polymerase chain reaction (PCR), as only treated samples showed the expected product size of 185 base pairs in editedDNA, while the control sample yielded only one band of 1056 base pairs on an agarose gel (FIG. 13E).
[0316] Next, the ability of the presently disclosed compositions to transfect a leukemic model in vivo was assessed. To mimic the clinical aggressiveness of MLL-AF9 driven AML, all model mice were generated from secondary transplantation (FIG. 13F), in which mice barely survive more than 60 days upon transplantation and the median lifespan of model mice is more than a month shorter than those generated from primary transplantation (Itskovich et al., 2020). Cre mRNA encapsulating BM homing LNPs were IV injected. BM and spleen were harvested 72 hours post injection for flow cytometry analysis (FIG. 13F). A single, low dose (0.6 mg / kg) injection of tested BM homing LNPs led to tdTom expression activation in 13-18% BM leukemic stem cells (FIG. 13G), the cell type that is believed to account for drug resistance and leukemia relapse (Barreto et al., 2022), and in 2-4% BM or spleen residing leukemic cells, demonstrating the potential application of the presently disclosed invention to treat aggressive leukemia through non-invasive, less toxic LNP strategy.Example 6 - Discussion
[0317] The above sections describe a series of BM homing LNPs that enable mRNA, CRISPR / Cas9, and base editor delivery to a breadth of at least 14 cell types in BM, especially HSCs, in healthy reporter mice, mouse models expressing sickle cell disease phenotypes, and an aggressive acute myeloid leukemia model. Unexpectedly, covalent lipid species enable BM delivery tropism when incorporated into base 4-lipid LNP formulations as described in the claims below. The delivery efficacy can be related to the structure and activity of both the head group and hydrophobic domains. Initial results suggest, without being bound by theory, that bone marrow enrichment is closely related to ApoE in the serum, as evidenced by the significant decrease in delivery efficacy in ApoE‘ / _mice. The details of how covalent lipids and crosslinkers interact with serum proteins, especially ApoE, as well as how these interactions lead to bone marrow tropism other than liver delivery (liver delivering LNPs also heavily rely on ApoE to achieve liver tropism) still remain to be explored. It is possible, without being bound by theory, that differences in the conformation of surface-bound ApoE exist between BM homing LNPs compared to mDLNP, which enable interactions with relevant ApoE receptors expressed by the bone marrow, leading to bone marrow tropism. Indeed, other work has shown, again without being bound by theory, that structure and conformation ofcorona proteins can affect which receptors nanoparticles interact with and their pathway of cellular uptake (Fleischer & Payne, 2014; Myerson et al., 2022; Zhang et al., 2020).
[0318] The therapeutic potential of BM homing LNPs to achieve genome editing in a P-globin disorder model and an aggressive AML model was also demonstrated. The results presented above on the HBBS / STownes model represent the first in situ non-viral strategy for in vivo gene therapy of P-globin disorder diseases. It is worth noting that there is a lack of therapeutic studies of P-globin disorders and MLL-AF9 driven AML by in vivo administration of genetic medicine, and due to the severity of the sickle cell disease phenotype (severe anemia and splenomegaly) and the aggressiveness of the MLL-AF9 driven AML model (mice barely survive for more than 60 days after transplantation), proof-of-concept genome editing was demonstrated.Example 8 - Average bioluminescence signal intensity of additional LNPs on femurs and tibias
[0319] By following the procedure previously mentioned in Example 1, additional LNPs that target hematopoietic stem cells (HSCs) were prepared by incorporating additional covalent lipids (Table 5) into lipid nanoparticle compositions. A degradable dendrimer ionizable (pKa<7) cationic lipid 4A3-SC7 was substituted for 5A2-SC8 in the formulation named mDLNP, originally optimized for delivery of mRNA to the liver. This base 4- component formulation consists of 4A3-SC7 (ionizable lipid), l,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), cholesterol, l,2-dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (DMG-PEG-2000) and covalent lipid at a molar ratio of 15:15:30:3:20.
[0320] Average bioluminescence signal intensity and percentage of additional LNPs on dissected femurs and tibias are shown in FIG. 16 and FIG. 17.Example 7 - Methods i. Nanoparticle formation
[0321] RNA-loaded LNP formulations were formed using the ethanol dilution method. mDLNP formulation was prepared as previously described. Unless otherwise stated, all lipids with specified molar ratios were dissolved in ethanol and RNA was dissolved in 10 mM citrate buffer (pH 4.0). The two solutions were rapidly mixed at an aqueous to ethanol ratio of 3 / 1 by volume (3 / 1, aq. / ethanol. vol. / vol.), then incubated for 10 min at room temperature. For all ex vivo assays, characterization of physiochemical properties and in vivo Luc mRNA delivery studies, lipid to total RNA weight ratio is fixed at 40 / 1. For all in vivo Cre mRNA delivery studies, the lipid to total RNA weight ratio was fixed at 20 / 1. For all Cas9 mRNA / sgG34 and ABE8e_NRCH mRNA / sgHBB delivery studies, the lipid to total RNA weight ratio was fixed at 10 / 1. To prepare mDLNP, a mixture of 23.8 mol % 5A2-SC8, 23.8 mol % DOPE, 47.6 mol % cholesterol, and 4.8 mol % DMG-PEG2K was dissolved in ethanol, then mixed with mRNA, and diluted in 10 mM, pH 4.0 citrate buffer at a volume ratio of 3:1 (mRNA:lipids). To prepare BM homing LNPs, a mixture of 19 mol % 5A2-SC8, 19 mol % DOPE, 38 mol % cholesterol, 4 mol % DMG-PEG2K, and 20 mol% covalent lipid species (covalent lipid or crosslinker) was dissolved in ethanol, then mixed with mRNA, and diluted in 10 mM, pH 4.0 citrate buffer at a volume ratio of 3: 1 (mRNA: lipids). After 10 min of mixing the mRNA and lipid solutions, the LNP formulations were diluted with lx phosphate buffered saline (PBS) to 0.5 ng / pL mRNA for in vitro assays and characterization of physicochemical properties. For in vivo experiments, the formulations were dialyzed (Pur-A-Lyzer Midi Dialysis Kits, MWCO 3.5 kDa, Sigma-Aldrich) against lx PBS for 2 h. Afterward, LNPs were diluted with PBS to a final volume of 250 pL / mouse for IV injections. ii. Characterization of mRNA encapsulating nanoparticles
[0322] Size distribution, polydispersity index, and zeta-potential were measured using DLS (Malvern MicroV model; He-Ne laser, / . = 632 nm). The encapsulation efficiency of mRNA in each LNP was quantified by measuring the mRNA binding following the Quant- iT RiboGreen assay protocols.Hi. mRNA synthesis
[0323] Firefly luciferase, Cre recombinase, Cas9, and ABE8e_NRCH mRNAs were produced using in vitro transcription (IVT). Briefly, the coding fragments of each protein were prepared using a PCR program (Table 6). Then, these fragments were cloned into pCS2+MT vectors with optimized 5'(3')-untranslated regions and poly A sequences. IVT reactions were performed following standard protocols but with Nl-methylpseudouridine-5'- triphosphate replacing the typical uridine triphosphate. Finally, the mRNA was capped (Cap- 11 using the ScriptCap system (CellScript). The coding sequences for these proteins are detailed in a section that follows. iv. In vivo Luc mRNA delivery’
[0324] C57BL / 6 mice with weights of 18-20 g were IV injected with various Luc mRNA formulations: n = 3 per group. 6 hours post injection, mice were injected with D- Luciferin (150 mg / kg, intraperitoneal). Femur bone was dissected and imaged and luminescence intensity was quantified using Living Image Software (PerkinElmer). v. Gene editing (Cre mRNA) in the tdTomato reporter mice
[0325] Cre mRNA formulations were prepared as described above and IV injections were performed (0.6 mg / kg Cre mRNA). After 2 d, mice (n = 3 per group for selected formulations) were euthanized and femurs were dissected and imaged using an IVIS Lumina system (Perkin Elmer). vi. Cell isolation and staining for flow cytometry
[0326] Cre mRNA formulations were prepared as described above and IV inj ections were performed (0.6 mg / kg Cre mRNA). After 2 d, mice (n = 3 per group for selected formulations) were euthanized and femurs were dissected and imaged using an IVIS Lumina system (Perkin Elmer).
[0327] To isolate bone marrow cells for analysis of tdTom+ cells and genomic DNA extraction, femur and tibia bones were collected and bone marrow cells were isolated via centrifugation (1000 g, 2 minutes, 4 °C). Peripheral blood was collected in EDTA-coated tubes to prevent clotting. Spleen was collected in cold PBS. Isolated cells passed through 100 pm cell strainer (BD-Biosciences, 352360) to obtain single cell suspension and were treated withlx red blood cell (RBC) lysis buffer (BioLegend, 420301) for 5 minutes (bone marrow and spleen samples) or 10 minutes (peripheral blood samples) on ice. RBC lysis buffer was neutralized by adding twice the volume of cell staining buffer (BioLegend, 420201). IxlO6cells were stained with fluorescent labelled anti-mouse antibodies at 1 :100 dilution for 20-30 minutes on ice. Live Dead Aqua (ThermoFisher, L34957) was used to distinguish live cells for all samples. BM-HSPC panel was stained with FITC lineage cocktail (BioLegend, 133301), PerCP-Cy5.5 Sca-1 antibody (ThermoFisher, 45-5981-80), Alexa Fluro 700 CD117 antibody (ThermoFisher, 56-1172-80), PE / Cy7 CD34 antibody (BioLegend, 128617), APC CD135 antibody (BioLegend, 135309), and Brilliant Violet 711 CD16 / 32 antibody (BioLegend, 101337). BM-B cell panel was stained with FITC CD3 antibody (BioLegend, 100203), FITC Ly-6G antibody (BioLegend, 108405), FITC CDl lb antibody (BioLegend, 101205), FITC TER-119 antibody (BioLegend, 116205), APC B220 antibody (BioLegend, 103211), and PerCP CD19 antibody (BioLegend, 115531). BM-T cell panel was stained with FITC CD3 antibody, Alexa Fluor 700 CD8a antibody (ThermoFisher, 56-0081-80), and PerCP CD4 antibody (BioLegend, 100431). BM-macrophage, monocyte and neutrophil panel was stained with APC Ly-6G antibody (BioLegend, 127613), FITC CDllb antibody, and Alexa Fluor 594 F4 / 80 antibody (BioLegend, 123140). Leukemic cell panel was stained with APC-Cy7 CDllb antibody (BioLegend, 101225) and Alexa Fluor 700 CD117 antibody. Cells were washed twice with cell staining buffer to remove excess antibodies and resuspended in 500 pL cell staining buffer. The cells were kept on ice until analyzed by LSRFortessa flow cytometer (BD Biosciences).
[0328] For genomic DNA extraction, isolated BM cells were treated with RBC lysis buffer for 5 minutes on ice, then incubated with Biotin CD117 antibody (BioLegend, 135129) at 1 :100 dilution for 20-30 minutes on ice. Cells were washed twice with PBS and incubated on an EasySep magnetic stand (StemCell technology, 18000) for 5 minutes. Free cell suspension was removed and attached cells were washed with PBS for three times. Whole BM cells and CD117+ cells were re-suspended in 50 pL of lx passive lysis buffer (Promega) together with 2 pL of proteinase K (Thermofisher). Afterwards, a lysis PCR program (65 °C for 15 min, 95 °C for 10 min) was run to obtain cell lysates. The targeted genomic loci were then amplified using the following PCR amplification program (95 °C for 3 min; (95 °C for 30 s; 61 °C for 20 s; 72 °C for 30 s) for 30 cycles; 72 °C for 2 min and then keep at 4 °C). Cell lysates were used as DNA templates.vii. Isolation of plasma proteins adsorbed on LNPs
[0329] LNPs were prepared according to the previously described method and were diluted to a final lipid concentration of 1 g / L with lx PBS. Mouse plasma was added to each LNP solution at a 1 : 1 volume ratio and incubated for 15 min at 37 °C. A 0.7-M sucrose solution was prepared by dissolving solid sucrose in MilliQ water. The LNP / plasma mixture was loaded onto a 0.7-M sucrose cushion of equal volume to the mixture and centrifuged at 15,300 g and 4 °C for 1 h. The supernatant was removed, and the pellet was washed with 1 x PBS. Next, the pellet was centrifuged at 15,300 g and 4 °C for 5 min, and the supernatant was removed. Washing was performed twice more for a total of three washes. Following the final wash, the pellet was resuspended in 2 weight % SDS. Excess lipids were removed from each sample by following the protocol provided with the ReadyPrep 2-D Cleanup (Bio-Rad). The resulting pellet from the cleanup step was resuspended in 2x Laemmli buffer. viii. SDS-PAGE characterization of plasma proteins
[0330] Plasma proteins isolated from the surface of LNPs were loaded onto a 4- 20% Mini-PROTEAN TGX Precast Protein Gel at a volume of 10 pL and separated at 200 V. Proteins were visualized by staining the gel for 1 h with SimplyBlue Safe Stain. The gel was destained using deionized (DI) water overnight and imaged with a Licor Scanner the following day. ix. Preparation of plasma protein samples for mass spectrometry
[0331] Plasma proteins isolated from the surface of LNPs were loaded onto a 4- 20% Mini-PROTEAN TGX Precast Protein Gel at a volume of 10 pL and run into the gel 1 cm at 90 V. The gel was stained with SimplyBlue Safe Stain for 1 h to fix and visualize the proteins. After destaining for 1 h, the protein bands were excised using a sterile razor blade and sliced into l-mm3 cubes. The cubes were added to a 1.5-mL tube that had been rinsed with 1 : 1 MilliQ water: Ethanol and stored at 4 °C until being submitted to the University7of Texas Southwestern Proteomics Core for mass spectrometry analysis. Samples were submitted to the UT Southwestern Proteomics core for analysis using a Thermo QExactive HF mass spectrometer to identify protein corona constituents.X. ApoE knockout mice experiments
[0332] LNPs were prepared according to the previously described method. B6.129P2-ApoetmlUnc / J mice weighing 18 to 20 g were IV injected with BM homing LNPs at a dosage of 0.1 mg / kg Luc mRNA (n - 3). As a comparison, C57BL / 6 mice weighing 18 to 20 g were IV injected with BM homing LNPs at a dosage of 0.1 mg / kg Luc mRNA (n = 3). After 6 h, mice were injected with D-Luciferin (150 mg / kg, intraperitoneal) and imaged by an IVIS Lumina system (PerkinElmer). Femur bone was dissected and imaged and luminescence intensity was quantified using Living Image Software (PerkinElmer). xi. Creation of MLL-AF9 driven leukemia model
[0333] MLL-AF9-expressing retroviruses were produced in 293T cells using an MSCV-MLL-AF9-IRES-YFP-encoding plasmid as previously described (Kang et al., 2015; Wu et al., 2021; Zheng et al., 2012) and used for infection with Lin- fetal liver cells isolated from tdTom reporter mice after two rounds of spinoculation in the presence of 4 pg / mL polybrene. The cells were then IV injected into lethally irradiated C57BL6 mice and peripheral blood of injected mice were collected 3 weeks post transplantation to check the YFP+ cell population and confirm the establishment of the leukemia model. Bone marrow and spleen cells from the primary transplant recipients were further injected into lethally irradiated C57BL6 mice for the secondary transplantation. All model mice used in this application were generated from secondary transplantation. xii. In vitro gene editing (Cre mRNA) on the leukemia cells
[0334] Upon infection by MLL-AF9-expressing retroviruses, cells were seeded in a 24-well plate with a concentration of IxlO6cells / mL. 4 hours after seeding, LNPs (100 or 200 ng mRNA per well) were added and incubated for 24 hours. Cells were then collected by centrifugation and mounted on a cover slip for confocal microscope imaging or lysed for genomic DNA extraction for PCR. xiii. Gene editing ( Cre mRNA) in the MLL-AF9 driven leukemia model
[0335] Once AML establishment was confirmed on transplant recipients, Cre mRNA formulations were prepared as described above and IV injections were performed(0.6 mg / kg Cre mRNA). After 72 hours, mice (n = 3 per group) were euthanized. Femur and tibia bones and spleen were collected for flow cytometry analysis. xiv. Gene editing (Cas9 mRNA / sgG34 and ABE8e_NRCH mRNA / sgHBB) in the HBBS / Smice
[0336] HBBS / Sfemale mice were IV injected with BM homing formulations for codelivery of Cas9 mRNA and modified sgG34 or ABE8e_NRCH mRNA and modified sgHBB (Table 2) at a total dose of 3 mg / kg (2 / 1, mRNA / sgRNA, wt / wt) (n = 3 per group). All mice received 2 weekly injections. 7 days after the last injection, femur and tibia bones were collected and the genomic DNA were collected following the procedure described above.,xi’. Display items
[0337] The images of mice and syringes (Figs. IB, 2A, 4B, D, E, G and 5A, F) were created with BioRender.com. xvi. Materials
[0338] 5A2-SC8 was synthesized and purified according to published protocols.Cholesterol, D-(+)-glucose, D-(+)-galactose, D-(+)-mannose, L-(-)-fucose, xylose, D- glucoronic acid, V-acetyl-D-glucosamine, .V-acetyl-D-galactosamine, V-acetyl-D- mannosamine, Folic acid, Retinol, Biotin, Ascorbic acid, Ergocalciferol, (i)-a-Tocopherol, Dopamine hydrochloride, (-)-Norepinephrine, Acetylcholine chloride, Lauryl methacrylate, stearic acid V-succinimic ester, 5-Octylthieno[3,4-c]pyrrole-4, 6-dione, Dodecyl isocyanate, Octyl isothiocyanate, (4,4,4-Trifluorobutyl)hydrazine hydrochloride, Trimellitic anhydride, Palmitic anhydride, Dodecyl aldehyde, (2,5-Dimethylphenethyl)hydrazine hydrochloride, CMC (7V-Cyclohexyl-V'-(2-morpholinoethyl)carbodiimide methyl-p-toluenesulfonate), N,N’- Diisopropylcarbodiimide, EDC (l-Ethyl-3-(3-dimethylaminopropyl)carbodiimide), DCC (V,M-Dicyclohexylcarbodiimide), l-(3-Isothiocyanatobenzyl)-4-[2-(3,4-dihydro-2H-l- benzopyran-6-yl)-5-oxazolyl]pyridinium bromide, 3-Mercaplopropanyl-V- hydroxysuccinimide ester, DHSO (3,3'-Sulfinyldi(propanehydrazide)), SMPT (4- succinimidyloxycarbonyl-alpha-methyl-alpha(2-pyridyldithio)toluene), PDPH (3-(2- pyridyldithiojpropionyl hydrazide), DFDNB (l,5-Difluoro-2,4-dinitrobenzene), Glutaraldehyde dioxime, Succinimidyl 4-formylbenzoate, Terephthaldehyde were purchased from Sigma Aldrich. N- acetylneuraminic acid, Arachidonic Acid, Docosahexaenoic Acid,Melatonin, Hydrocortisone, Estradiol, Tryptamine, 3-Iodothyronamine (hydrochloride), MEGA-10, n-Dodecyl-P-D-maltoside, a-C16 Galactosylceramide (dl 8: 1 / 16:0), Sulfatides (bovine) (sodium salt), A-Oleoyl-L-Serine, V-(a-Linolenoyl) Tyrosine, A-Palmiloyl-L- Aspartate, A-Palmitoyl Glycine, N-Oleoyl Alanine, V-Oleoyl Glutamine, A-Oleoyl-L- phenylalanine, Acridinium NHS ester, DMABA NHS ester, Sulfosuccinimidyl Myristate (sodium salt), FMOC- Succinimide, 5-Norbornene-2-acetic acid succinimidyl ester, DSS (Disuccinimidyl Suberate), SMCC (Succin imidyl-4-( A-maleimidomelhyl (cyclohexane- 1 - carboxylate) were purchased from Cayman Chemical. DOPE, 18:1 CDP DG ( 1 ,2-dioleoyl-.vn- glycero-3-(cytidine diphosphate) (ammonium salt)), 18:1 PDP PE ( 1 .2-dioleoyl-.s7?-glycero-3- phosphoethanolamine-ZV-[3-(2-pyridyldithio)propionate] (sodium salt)), 18: 1 PE MCC (1,2- dioleoyl-.sn-glycero-3-phosplioethanolamine-V-|4-(p-maleimidomeihyl)cyclohexane- carboxamide] (sodium salt)), TMG-A13 (Tandem malonate glucoside-A13), VEG-3 (Vitamin- based Glycoside-3) were purchased from Avanti Polar Lipids. Hexadecylsuccinic Anhydride, 4-Methylbenzohydrazide, and Benzenesulfonyl Hydrazide were purchased from TCI. N- Dodecylacrylamide, Palmitic acid hydrazide were purchased from Fisher Scientific. TSAT (tris-(succinimidyl)aminotriacetate), and SIAB (succinimidyl (4-iodoacetyl)aminobenzoate) were purchased from Thermo Fisher. SIA (Succinimidyl iodoacetate), BS3 (bis(sulfosuccinimidyl)suberate), DSG (Di(N-succinimidyl) glutarate), DSP (dithiobis(succinimidyl propionate)), DSSeb (Disuccinimidyl sebacate), EGS (Ethylene glycolbis(succinimidylsuccinate)), SPDP (A'-Succinimidyl 3-[2-pyridyldithio]-propionate), LC-SPDP (Succinimidyl 6-(3-[2-pyridyldithio]-propionamido)hexanoate) were purchased from Proteochem. l-[3-(Dimethylamino)propyl]-3-ethylcarbodiimide methiodide was purchased from Santa Cruz Biotechnology. DMG-PEG 2000 was purchased from NOF America Corporation. Pur-A-Lyzer Midi Dialysis Kits (WMCO. 3.5 kDa) were purchased from Sigma Aldrich. D-Luciferin was purchased from Gold Biotechnology. 4’,6-diamidino-2- phenylindole dihydrochloride (DAPI) was purchased from Thermo Fisher. Sucrose was purchased from Sigma Aldrich.The ReadyPrep 2-D Cleanup Kit, 12% Mini-PROTEAN TGX Precast Protein Gels, 2x Laemmli Buffer, and lOx Tris / Glycine / SDS were purchased from BioRad. Innovative Research C57BL / 6 Mouse Plasma K2EDTA was purchased from Fisher Scientific. Firefly luciferase (Luc), Cre recombinase (Cre), Cas9 and ABE8e_NRCH mRNA were synthesized by in vitro transcription (IVT). Modified sgG34 and sgHBB were purchased from BioSprings. xvii. Animal experiments
[0339] All animal experiments were approved by the Institution Animal Care and Use Committees of The University of Texas Southwestern Medical Center and were consistent with local, state and federal regulations as applicable, C57BL / 6 mice were obtained from the UTSW Mouse Breeding Core Facility. ^6.Cg-Gt(ROSA)26Sortn'14{CAG'tdToma,o)Hvl} mice (also known as Ail4 or Ail4(RCL-tdT) mice) were obtained from The Jackson Laboratory (007914) and bred to maintain homozygous expression of the Cre reporter allele. B6;129-were obtained from The Jackson Laboratory (013071). B6. 129P2- / l / >oc"'' / ,"'7J mice were acquired from the Jackson Laboratory (002052). xviii. Statistical analysis
[0340] Data for all bar charts were plotted via mean ± standard error of the mean (s.e.m.). Statistical analyses were performed using Prism 9 (GraphPad Software). A two-tailed unpaired t-test was used to determine the significance of the indicated comparisons. (*P < 0.05; **P<0.01 ; ***P < 0.001 ; ****P<0.0001). xix. Coding sequences for Luc, Cre, Cas9, and ABE8e_NRCH mRNAs
[0341] Data for all bar charts were plotted via mean + standard error of the mean (s.e.m.). Statistical analyses were performed using Prism 9 (GraphPad Software). A two-tailed unpaired t-test was used to determine the significance of the indicated comparisons. (*P < 0.05; **P<0.01; ***P < 0.001; ****P<0.0001).Firefly luciferase
[0342] ATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCT ATCCGCTGGAAGATGGAACCGCTGGAGAGCAACTGCATAAGGCTATGAAGAGAT ACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGGACAT CACTTACGCTGAGTACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGA TATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAAT TCTTTATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAA CGACATTTATAATGAACGTGAATTGCTCAACAGTATGGGCATTTCGCAGCCTACC GTGGTGTTCGTTTCCAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAG CTCCCAATCATCCAAAAAATTATTATCATGGATTCTAAAACGGATTACCAGGGAT TTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTGCCAGAGTCCTTCGATAGGGACAAGACAATTGCACTGATCATGAACTCCTCTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCATAGAACTGCCTGCGTGAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAATCAAATCATTCCGGATACTGCGATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGAATGTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGAAGAAGAGCTGTTTCTGAGGAGCCTTCAGGATTACAAGATTCAAAGTGCGCTGCTGGTGCCAACCCTATTCTCCTTCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTTACACGAAATTGCTTCTGGTGGCGCTCCCCTCTCTAAGGAAGTCGGGGAAGCGGTTGCCAAGAGGTTCCATCTGCCAGGTATCAGGCAAGGATATGGGCTCACTGAGACTACATCAGCTATTCTGATTACACCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAAGCGAAGGTTGTGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAAAGAGGCGAACTGTGTGTGAGAGGTCCTATGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACCAACGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGACGAAGACGAACACTTCTTCATCGTTGACCGCCTGAAGTCTCTGATTAAGTACAAAGGCTATCAGGTGGCTCCCGCTGAATTGGAATCCATCTTGCTCCAACACCCCAACATCTTCGACGCAGGTGTCGCAGGTCTTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGACGATGACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGCGAAAAAGTTGCGCGGAGGAGTTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGCCGTGTAA (SEQ ID NO: 17)NLS-Cre
[0343] ATGCCCAAGAAGAAGAGGAAGGTGGCCAATTTACTGACCGTACACCAAAATTTGCCTGCATTACCGGTCGATGCAACGAGTGATGAGGTTCGCAAGAACCTGATGGACATGTTCAGGGATCGCCAGGCGTTTTCTGAGCATACCTGGAAAATGCTTCTGTCCGTTTGCCGGTCGTGGGCGGCATGGTGCAAGTTGAATAACCGGAAATGGTTTCCCGCAGAACCTGAAGATGTTCGCGATTATCTTCTATATCTTCAGGCGCGCGGTCTGGCAGTAAAAACTATCCAGCAACATTTGGGCCAGCTAAACATGCTTCATCGTCGGTCCGGGCTGCCACGACCAAGTGACAGCAATGCTGTTTCACTGGTTATGCGGCGTATCCGAAAAGAAAACGTTGATGCCGGTGAACGTGCAAAACAGGCTCTAGCGTTCGAACGCACTGATTTCGACCAGGTTCGTTCACTCATGGAAAATAGCGATCGCTGCCAGGATATACGTAATCTGGCATTTCTGGGGATTGCTTATAACACCCTGTTACGTATAGCCGAAATTGCCAGGATCAGGGTTAAAGATATCTCACGTACTGACGGTGGGAGAATGTTAATCCATATTGGCAGAACGAAAACGCTGGTTAGCACCGCAGGTGTAGAGAAGGCACTTAGCCTGGGGGTAACTAAACTGGTCGAGCGATGGATTTCCGTCTCTGGTGTAGCTGATGATCCGAATAACTACCTGTTTTGCCGGGTCAGAAAAAATGGTGTTGCCGCGCCATCTGCCACCAGCCAGCTATCAACTCGCGCCCTGGAAGGGATTTTTGAAGCAACTCATCGATTGATTTACGGCGCTAAGGATGACTCTGGTCAGAGATACCTGGCCTGGTCTGGACACAGTGCCCGTGTCGGAGCCGCGCGAGATATGGCCCGCGCTGGAGTTTCAATACCGGAGATCATGCAAGCTGGTGGCTGGACCAATGTAAATATTGTCATGAACTATATCCGTAACCTGGATAGTGAAACAGGGGCAATGGTGCGCCTGCTGGAAGATGGCGATTAA (SEQ ID NO: 18)NLS-Cas9-SV40 NLS-Nucleoplasmin NLS
[0344] ATGCGCGCCGCTCCGGCAGCTAAGAAAAAGAAACTGGATGGCAGCGTCGACATGGATAAGAAATACTCAATAGGCTTAGATATCGGCACAAATAGCGTCGGATGGGCGGTGATCACTGATGAATATAAGGTTCCGTCTAAAAAGTTCAAGGTTCTGGGAAATACAGACCGCCACAGTATCAAAAAAAATCTTATAGGGGCTCTTTTATTTGACAGTGGAGAGACAGCGGAAGCGACTCGTCTCAAACGGACAGCTCGTAGAAGGTATACACGTCGGAAGAATCGTATTTGTTATCTACAGGAGATTTTTTCAAATGAGATGGCGAAAGTAGATGATAGTTTCTTTCATCGACTTGAAGAGTCTTTTTTGGTGGAAGAAGACAAGAAGCATGAACGTCATCCTATTTTTGGAAATATAGTAGATGAAGTTGCTTATCATGAGAAATATCCAACTATCTATCATCTGCGAAAAAAATTGGTAGATTCTACTGATAAAGCGGATTTGCGCTTAATCTATTTGGCCTTAGCGCATATGATTAAGTTTCGTGGTCATTTTTTGATTGAGGGAGATTTAAATCCTGATAATAGTGATGTGGACAAACTATTTATCCAGTTGGTACAAACCTACAATCAATTATTTGAAGAAAACCCTATTAACGCAAGTGGAGTAGATGCTAAAGCGATTCTTTCTGCACGATTGAGTAAATCAAGACGATTAGAAAATCTCATTGCTCAGCTCCCCGGTGAGAAGAAAAATGGCTTATTTGGGAATCTCATTGCTTTGTCATTGGGTTTGACCCCTAATTTTAAATCAAATTTTGATTTGGCAGAAGATGCTAAATTACAGCTTTCAAAAGATACTTACGATGATGATTTAGATAATTTATTGGCGCAAATTGGAGATCAATATGCTGATTTGTTTTTGGCAGCTAAGAATTTATCAGATGCTATTTTACTTTCAGATATCCTAAGAGTAAATACTGAAATAACTAAGGCTCCCCTATCAGCTTCAATGATTAAACGCTACGATGAACATCATCAAGACTTGACTCTTTTAAAAGCTTTAGTTCGACAACAACTTCCAGAAAAGTATAAAGAAATCTTTTTTGATCAATCAAAAAACGGATATGCAGGTTATATTGATGGGGGAGCTAGCCAAGAAGAATTTTATAAATTTATCAAACCAATTTTAGAAAAAATGGATGGTACTGAGGAATTATTGGTGAAACTAAATCGTGAAGATTTGCTGCGCAAGCAACGGACCTTTGACAACGGCTCTATTCCCCATCAAATTCACTTGGGTGAGCTGCATGCTATTTTGAGAAGACAAGAAGACTTTTATCCATTTTTAAAAGACAATCGTGAGAAGATTGAAAAAATCTTGACTTTTCGAATTCCTTATTATGTTGGTCCATTGGCGCGTGGCAATAGTCGTTTTGCATGGATGACTCGGAAGTCTGAAGAAACAATTACCCCATGGAATTTTGAAGAAGTTGTCGATAAAGGTGCTTCAGCTCAATCATTTATTGAACGCATGACAAACTTTGATAAAAATCTTCCAAATGAAAAAGTACTACCAAAACATAGTTTGCTTTATGAGTATTTTACGGTTTATAACGAATTGACAAAGGTCAAATATGTTACTGAAGGAATGCGAAAACCAGCATTTCTTTCAGGTGAACAGAAGAAAGCCATTGTTGATTTACTCTTCAAAACAAATCGAAAAGTAACCGTTAAGCAATTAAAAGAAGATTATTTCAAAAAAATAGAATGTTTTGATAGTGTTGAAATTTCAGGAGTTGAAGATAGATTTAATGCTTCATTAGGTACCTACCATGATTTGCTAAAAATTATTAAAGATAAAGATTTTTTGGATAATGAAGAAAATGAAGATATCTTAGAGGATATTGTTTTAACATTGACCTTATTTGAAGATAGGGAGATGATTGAGGAAAGACTTAAAACATATGCTCACCTCTTTGATGATAAGGTGATGAAACAGCTTAAACGTCGCCGTTATACTGGTTGGGGACGTTTGTCTCGAAAATTGATTAATGGTATTAGGGATAAGCAATCTGGCAAAACAATATTAGATTTTTTGAAATCAGATGGTTTTGCCAATCGCAATTTTATGCAGCTGATCCATGATGATAGTTTGACATTTAAAGAAGACATTCAAAAAGCACAAGTGTCTGGACAAGGCGATAGTTTACATGAACATATTGCAAATTTAGCTGGTAGCCCTGCTATTAAAAAAGGTATTTTACAGACTGTAAAAGTTGTTGATGAATTGGTCAAAGTAATGGGGCGGCATAAGCCAGAAAATATCGTTATTGAAATGGCACGTGAAAATCAGACAACTCAAAAGGGCCAGAAAAATTCGCGAGAGCGTATGAAACGAATCGAAGAAGGTATCAAAGAATTAGGAAGTCAGATTCTTAAAGAGCATCCTGTTGAAAATACTCAATTGCAAAATGAAAAGCTCTATCTCTATTATCTCCAAAATGGAAGAGACATGTATGTGGACCAAGAATTAGATATTAATCGTTTAAGTGATTATGATGTCGATCACATTGTTCCACAAAGTTTCCTTAAAGACGATTCAATAGACAATAAGGTCTTAACGCGTTCTGATAAAAATCGTGGTAAATCGGATAACGTTCCAAGTGAAGAAGTAGTCAAAAAGATGAAAAACTATTGGAGACAACTTCTAAACGCCAAGTTAATCACTCAACGTAAGTTTGATAATTTAACGAAAGCTGAACGTGGAGGTTTGAGTGAACTTGATAAAGCTGGTTTTATCAAACGCCAATTGGTTGAAACTCGCCAAATCACTAAGCATGTGGCACAAATTTTGGATAGTCGCATGAATACTAAATACGATGAAAATGATAAACTTATTCGAGAGGTTAAAGTGATTACCTTAAAATCTAAATTAGTTTCTGACTTCCGAAAAGATTTCCAATTCTATAAAGTACGTGAGATTAACAATTACCATCATGCCCATGATGCGTATCTAAATGCCGTCGTTGGAACTGCTTTGATTAAGAAATATCCAAAACTTGAATCGGAGTTTGTCTATGGTGATTATAAAGTTTATGATGTTCGTAAAATGATTGCTAAGTCTGAGCAAGAAATAGGCAAAGCAACCGCAAAATATTTCTTTTACTCTAATATCATGAACTTCTTCAAAACAGAAATTACACTTGCAAATGGAGAGATTCGCAAACGCCCTCTAATCGAAACTAATGGGGAAACTGGAGAAATTGTCTGGGATAAAGGGCGAGATTTTGCCACAGTGCGCAAAGTATTGTCCATGCCCCAAGTCAATATTGTCAAGAAAACAGAAGTACAGACAGGCGGATTCTCCAAGGAGTCAATTTTACCAAAAAGAAATTCGGACAAGCTTATTGCTCGTAAAAAAGACTGGGATCCAAAAAAATATGGTGGTTTTGATAGTCCAACGGTAGCTTATTCAGTCCTAGTGGTTGCTAAGGTGGAAAAAGGGAAATCGAAGAAGTTAAAATCCGTTAAAGAGTTACTAGGGATCACAATTATGGAAAGAAGTTCCTTTGAAAAAAATCCGATTGACTTTTTAGAAGCTAAAGGATATAAGGAAGTTAAAAAAGACTTAATCATTAAACTACCTAAATATAGTCTTTTTGAGTTAGAAAACGGTCGTAAACGGATGCTGGCTAGTGCCGGAGAATTACAAAAAGGAAATGAGCTGGCTCTGCCAAGCAAATATGTGAATTTTTTATATTTAGCTAGTCATTATGAAAAGTTGAAGGGTAGTCCAGAAGATAACGAACAAAAACAATTGTTTGTGGAGCAGCATAAGCATTATTTAGATGAGATTATTGAGCAAATCAGTGAATTTTCTAAGCGTGTTATTTTAGCAGATGCCAATTTAGATAAAGTTCTTAGTGCATATAACAAACATAGAGACAAACCAATACGTGAACAAGCAGAAAATATTATTCATTTATTTACGTTGACGAATCTTGGAGCTCCCGCTGCTTTTAAATATTTTGATACAACAATTGATCGTAAACGATATACGTCTACAAAAGAAGTTTTAGATGCCACTCTTATCCATCAATCCATCACTGGTCTTTATGAAACACGCATTGATTTGAGTCAGCTAGGAGGTGACACCGGTGGTGGTCCCGGGGGTGGTGCGGCCGCAGGCAGCGGAAGCCCTAAGAAAAAACGAAAAGTTGGCAGCGGAAGCAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGTGA (SEQ ID NO: 19)SV40 NLS-ABE8e_NRCH-SV40 NLS
[0345] ATGGCCCCAAAGAAGAAGCGGAAAGTCTCTGAGGTGGAGTTTTCCCACGAGTACTGGATGAGACATGCCCTGACCCTGGCCAAGAGGGCACGGGATGAGAGGGAGGTGCCTGTGGGAGCCGTGCTGGTGCTGAACAATAGAGTGATCGGCGAGGGCTGGAACAGAGCCATCGGCCTGCACGACCCAACAGCCCATGCCGAAATTATGGCCCTGAGACAGGGCGGCCTGGTCATGCAGAACTACAGACTGATTGACGCCACCCTGTACGTGACATTCGAGCCTTGCGTGATGTGCGCCGGCGCCATGATCCACTCTAGGATCGGCCGCGTGGTGTTTGGCGTGAGGAACTCAAAAAGAGGCGCCGCAGGCTCCCTGATGAACGTGCTGAACTACCCCGGCATGAATCACCGCGTCGAAATTACCGAGGGAATCCTGGCAGATGAATGTGCCGCCCTGCTGTGCGATTTCTATCGGATGCCTAGACAGGTGTTCAATGCTCAGAAGAAGGCCCAGAGCTCCATCAACTCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACACCTGGCACAAGCGAGAGCGCAACACCTGAAAGCAGCGGGGGCAGCAGCGGGGGGTCAGACAAGAAGTACAGCATCGGCCTGACCATCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACAGCCGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCGGATCTGCTATCTGCAAGAGATCTTCAGCAACGAGATGGCCAAGGTGGACGACAGCTTCTTCCACAGACTGGAAGAGTCCTTCCTGGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCATCTTCGGCAACATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGAAACTGGTGGACAGCACCGACAAGGCCGACCTGCGGCTGATCTATCTGGCCCTGGCCCACATGATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGACAACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTGTTCGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATCCTGTCTGCCAGACTGAGCAAGAGCAGACGGCTGGAAAATCTGATCGCCCAGCTGCCCGGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCCTGAGCCTGGGCCTGACCCCCAACTTCAAGAGCAACTTCGACCTGGCCGAGGATGCCAAACTGCAGCTGAGCAAGGACACCTACGACGACGACCTGGACAACCTGCTGGCCCAGATCGGCGACCAGTACGCCGACCTGTTTCTGGCCGCCAAGAACCTGTCCGACGCCATCCTGCTGAGCGACATCCTGAGAGTGAACACCGAGATCACCAAGGCCCCCCTGAGCGCCTCTATGGTGAAGAGATACGACGAGCACCACCAGGACCTGACCCTGCTGAAAGCTCTCGTGCGGCAGCAGCTGCCTGAGAAGTACAAAGAGATTTTCTTCGACCAGAGCAAGAACGGCTACGCCGGCTACATTGACGGCGGAGCCAGCCAGGAAGAGTTCTACAAGTTCATCAAGCCCATCCTGGAAAAGATGGACGGCACCGAGGAACTGCTCGTGAAGCTGAACAGAGAGGACCTGCTGCGGAAGCAGCGGACCTTCGACAACGGCATTATCCCCCACCAGATCCACCTGGGAGAGCTGCACGCCATTCTGCGGCGGCAGGGCGATTTTTACCCATTCCTGAAGGACAACCGGGAAAAGATCGAGAAGATCCTGACCTTCCGCATCCCCTACTACGTGGGCCCTCTGGCCAGGGGAAACAGCAGATTCGCCTGGATGACCAGAAAGAGCGAGGAAACCATCACCCCCTGGAACTTCGAGGAAGTGGTGGACAAGGGCGCTTCCGCCCAGAGCTTCATCGAGCGGATGACCAACTTCGATAAGAACCTGCCCAACGAGAAGGTGCTGCCCAAGCACAGCCTGCTGTACGAGTACTTCACCGTGTATAACGAGCTGACCAAAGTGAAATACGTGACCGAGGGAATGAGAAAGCCCGCCTTCCTGAGCGGCGAGCAGAAAAAGGCCATCGTGGACCTGCTGTTCAAGACCAACCGGAAAGTGACCGTGAAGCAGCTGAAAGAGGACTACTTCAAGAAAATCGAGTGCTTCGACTCCGTGGAAATCTCCGGCGTGGAAGATCGGTTCAACGCCTCCCTGGGCACATACCACGATCTGCTGAAAATTATCAAGGACAAGGACTTCCTGGACAATGAGGAAAACGAGGACATTCTGGAAGATATCGTGCTGACCCTGACACTGTTTGAGGACAGAGAGATGATCGAGGAACGGCTGAAAACCTATGCCCACCTGTTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCTGAGATACACCGGCTGGGGCAGGCTGAGCCGGAAGCTGATCAACGGCATCCGGGACAAGCAGTCCGGCAAGACAATCCTGGATTTCCTGAAGTCCGACGGCTTCGCCAACAGAAACTTCATGCAGCTGATCCACGACGACAGCCTGACCTTTAAAGAGGACATCCAGAAAGCCCAGGTGTCCGGCCAGGGCGATAGCCTGCACGAGCACATTGCCAATCTGGCCGGCAGCCCCGCCATTAAGAAGGGCATCCTGCAGACAGTGAAGGTGGTGGACGAGCTCGTGAAAGTGATGGGCGGCCACAAGCCCGAGAACATCGTGATCGAAATGGCCAGAGAGAACCAGACCACCCAGAAGGGACAGAAGAACAGCCGCGAGAGAATGAAGCGGATCGAAGAGGGCATCAAAGAGCTGGGCAGCCAGATCCTGAAAGAACACCCCGTGGAAAACACCCAGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAATGGGCGGGATATGTACGTGGACCAGGAACTGGACATCAACCGGCTGTCCGACTACGATGTGGACCATATCGTGCCTCAGAGCTTTCTGAAGGACGACTCCATCGACAACAAGGTGCTGACCAGAAGCGACAAGAACCGGGGCAAGAGCGACAACGTGCCCTCCGAAGAGGTCGTGAAGAAGATGAAGAACTACTGGCGGCAGCTGCTGAACGCCAAGCTGATTACCCAGAGAAAGTTCGACAATCTGACCAAGGCCGAGAGAGGCGGCCTGAGCGAACTGGATAAGGCCGGCTTCATCAAGAGACAGCTGGTGGAAACCCGGCAGATCACAAAGCACGTGGCACAGATCCTGGACTCCCGGATGAACACTAAGTACGACGAGAATGACAAGCTGATCCGGGAAGTGAAAGTGATCACCCTGAAGTCCAAGCTGGTGTCCGATTTCCGGAAGGATTTCCAGTTTTACAAAGTGCGCGAGATCAACAACTACCACCACGCCCACGACGCCTACCTGAACGCCGTCGTGGGAACCGCCCTGATCAAAAAGTACCCTAAGCTGGAAAGCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGCGGAAGATGATCGCCAAGAGCGAGCAGGAAATCGGCAAGGCTACCGCCAAGTACTTCTTCTACAGCAACATCATGAACTTTTTCAAGACCGAGATTACCCTGGCCAACGGCGAGATCCGGAAGCGGCCTCTGATCGAGACAAACGGCGAAACCGGGGAGATCGTGTGGGATAAGGGCCGGGATTTTGCCACCGTGCGGAAAGTGCTGAGCATGCCCCAAGTGAATATCGTGAAAAAGACCGAGGTGCAGACAGGCGGCTTCAGCAAAGAGTCTATCCTGCCCAAGGGTAACAGCGATAAGCTGATCGCCAGAAAGAAGGACTGGGACCCTAAGAAGTACGGCGGCTTCAACAGCCCCACCGTGGCCTATTCTGTGCTGGTGGTGGCCAAAGTGGAAAAGGGCAAGTCCAAGAAACTGAAGAGTGTGAAAGAGCTGCTGGGGATCACCATCATGGAAAGAAGCAGCTTCGAGAAGAATCCCATCGACTTTCTGGAAGCCAAGGGCTACAAAGAAGTGAAAAAGGACCTGATCATCAAGCTGCCTAAGTACTCCCTGTTCGAGCTGGAAAACGGCCGGAAGAGAATGCTGGC CTCTGCCGGCGTGCTGCAGAAGGGAAACGAACTGGCCCTGCCCTCCAAATATGTGAACTTCCTGTACCTGGCCAGCCACTATGAGAAGCTGAAGGGCTCCCCCGAGGATAATGAGCAGAAACAGCTGTTTGTGGAACAGCACAAGCACTACCTGGACGAGATCATCGAGCAGATCAGCGAGTTCTCCAAGAGAGTGATCCTGGCCGACGCTAATCTGGACAAAGTGCTGTCCGCCTACAACAAGCACCGGGATAAGCCCATCAGAGAGCA GGCCGAGAATATCATCCACCTGTTTACCCTGACCAATCTGGGAGCCCCTGCCGCCTTCAAGTACTTTGACACCACCATCAACCGGAAGCAATACAACACGACCAAAGAGGTGCTGGACGCCACCCTGATCCGTCAGAGCATCACCGGCCTGTACGAGACACGGATCGACCTGTCTCAGCTGGGAGGTGACTCTGGCGGCTCAAAAAGAACCGCCGACGGCAGCGAATTCGAGCCCAAGAAGAAGAGGAAAGTCTAA (SEQ ID NO: 20)REFERENCESThe following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.U.S. Patent No. 3,687,808U.S. Patent No. 4,587,044U.S. Patent No. 4,605,735U.S. Patent No. 4,667,025U.S. Patent No. 4,762,779U.S. Patent No. 4,789,737U.S. Patent No. 4,824,941U.S. Patent No. 4,828,979U.S. Patent No. 4,835,263U.S. Patent No. 4,845,205U.S. Patent No. 4,876,335U.S. Patent No. 4,904,582U.S. Patent No. 4,948,882U.S. Patent No. 4,958,013U.S. Patent No. 5,082,830U.S. Patent No. 5,109,124U.S. Patent No. 5,112,963U.S. Patent No. 5,118,802U.S. Patent No. 5,130,302U.S. Patent No. 5,134,066U.S. Patent No. 5,138,045U.S. Patent No. 5,175,273U.S. Patent No. 5,214,136U.S. Patent No. 5,218,105U.S. Patent No. 5,245,022U.S. Patent No. 5,254,469U.S. Patent No. 5,258,506U.S. Patent No. 5,262,536U.S. Patent No. 5,272,250U.S. Patent No. 5,292,873 U.S. Patent No. 5,317,098 U.S. Patent No. 5,367,066 U.S. Patent No. 5,371,241 U.S. Patent No. 5,391,723 U.S. Patent No. 5,414,077 U.S. Patent No. 5,416,203 U.S. Patent No. 5,432,272 U.S. Patent No. 5,451,463 U.S. Patent No. 5,457,187 U.S. Patent No. 5,459,255 U.S. Patent No. 5,484,908 U.S. Patent No. 5,486,603 U.S. Patent No. 5,502,177 U.S. Patent No. 5,510,475 U.S. Patent No. 5,512,439 U.S. Patent No. 5,512,667 U.S. Patent No. 5,514,785 U.S. Patent No. 5,525,465 U.S. Patent No. 5,525,711 U.S. Patent No. 5,541,313 U.S. Patent No. 5,545,730 U.S. Patent No. 5,552,538 U.S. Patent No. 5,552,540 U.S. Patent No. 5,565,552 U.S. Patent No. 5,567,810 U.S. Patent No. 5,574,142 U.S. Patent No. 5,578,717 U.S. Patent No. 5,578,718 U.S. Patent No. 5,580,731 U.S. Patent No. 5,585,481 U.S. Patent No. 5,587,371 U.S. Patent No. 5,587,469 U.S. Patent No. 5,591,584U.S. Patent No. 5,594,121U.S. Patent No. 5,595,726U.S. Patent No. 5,596,091U.S. Patent No. 5,597,696U.S. Patent No. 5,599,923U.S. Patent No. 5,599,928U.S. Patent No. 5,608,046U.S. Patent No. 5,614,617U.S. Patent No. 5,645,985U.S. Patent No. 5,681,941U.S. Patent No. 5,688,941U.S. Patent No. 5,750,692U.S. Patent No. 5,763,588U.S. Patent No. 5,830,653U.S. Patent No. 5,830,873U.S. Patent No. 6,005,096U.S. Patent No. 6,268,490U.S. Patent No. 6,525,191U.S. Patent No. 6,670,461U.S. Patent No. 6,770,748U.S. Patent No. 6,794,499U.S. Patent No. 7,034,133U.S. Patent No. 7,053,207U.S. Patent No. 7,399,845U.S. Patent No. 7,404,969U.S. Patent No. 7,427,672U.S. Patent No. 7,893,302U.S. Patent No. 8,283,333U.S. Patent No. 8,450,298U.S. Patent No. 8,466,122U.S. Patent Pub. No. 2004 / 0171570U.S. Patent Pub. No. 2005 / 0130923U.S. Patent Pub. No. 2007 / 0287831U.S. Patent Pub. No. 2008 / 0039618U.S. Patent Pub. No. 20100036115U.S. Patent Pub. No. 20120202871U.S. Patent Pub. No. 20130064894U.S. Patent Pub. No. 20130129785U.S. Patent Pub. No. 20130150625U.S. Patent Pub. No. 20130178541U.S. Patent Pub. No. 20130225836U.S. Serial No. 12 / 129,154U.S. Serial No. 60 / 989,574U.S. Serial No. 61 / 026,995U.S. Serial No. 61 / 026,998U.S. Serial No. 61 / 056,564U.S. Serial No. 61 / 086,231U.S. Serial No. 61 / 097,787U.S. Serial No. 61 / 099,844PCT / US2008 / 064591PCT / US2008 / 066154PCT / US2008 / 068922WO1994 / 14226W02004 / 106356W02005 / 021570W02007 / 134181W02007 / 134181W02008 / 101157W02008103276W02008 / 150729W02008154401W02009 / 006478W02010080724W02010 / 141069W02010144740W0201021865WO2011022460WO2011043913WO2011153120WO2012040184WO2012044638WO2012054365WO2012061259WO2013063468WO2013086354WO2013086373W02013149140WO2015095340WO2015184256WO2015199952WO2016004202WO2016118724WO2016118725WO2016205691W02017004143WO2017049245WO2017075531WO2017117528WO2017173054Akinc et al., Mol Ther 18, 1357-1364, 2010.Albaek et al., J. Org. Chem., 71, 7731-7740, 2006.Anzalone et al., Nature 576, 149-157, 2019.Atschul et al. J. Mo. Biol., 215:403-10, 1990.Barreto et al., Front Oncol 12, 931050, 2022.Bauer et al., Blood 108, 3313-3320, 2006.Blaese et al., Science 270, 475-480, 1995.Boulais & Frenette, Blood 125, 2621-2629, 2015.Boztug et al., N Engl J Med 363, 1918-1927, 2010.Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65.Carrillo and Lipman Siam J. Appl. Math. 48(5), 1988.Chattopadhyaya et al., J- Org. Chem., 74, 118-134, 2009.Cheng et al., Nat Nanotechnol 15, 313-320, 2020.Computational Molecular Biology, Lesk, AM, ed., 1989.The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., JohnWiley & Sons, 1990, 858-859, 1990.Cowan et al., Biol Blood Marrow Transplant 26, S88-S89, 2020.Crooke et al., 1996.Dayhoff et al., Atlas of Protein Sequence and Structure, vol. 5, supp. 3, 1978.Devereux, et al., Nucleic Acids Res. 12:387-95, 1984.Dvomic and Tomalia, Chem. in Britain, 641-645, August 1994.Dilliard et al., Proc Natl Acad Sci U S A 118, e2109256118, 2021.Dilliard & Siegwart, Nat Rev Mater 8, 282-300, 2023.Enache et al., Nat Genet 52, 662-668, 2020.Englisch et al., 1991.Eppert et al., Nat Med 17, 1086-1093, 2011.Farbiak et al., Adv Mater 33, e2006619, 2021.Freier et al., Nucleic Acids Research, 25(22), 4429-4443, 1997.Fleischer & Payne, J Phys Chem B 118, 14017-14026, 2014.Gaspar et al., Lancet 364, 2181-2187, 2004.Gribskov and Devereux, J., eds. 1993.Griffin and Griffin, eds., 1994.Haapaniemi et al., Nat Med 24, 927-930, 2018.Handbook of Pharmaceutical Salts: Properties, and Use, 2002.Hou et al., Nat Nanotechnol 15, 41-46, 2020.Hou et cd., Nat Rev Mater 6, 1078-1094, 2021.Ikonomi et al., Front Physiol 11, 848, 2020.Itskovich et al., Nat Commun 11, 2369, 2020.Kabanov et al., 1990.Kang et al., Nat Cell Biol 17, 665-677, 2015.Kanter et al., N Engl J Med 386, 617-628, 2022.Kiely-Collins et al., Cell Chem Biol 28, 952-968, 2021.Kim et al., Sci Adv 7, 2021.Kohn & Kohn, Front Immunol 12, 648951, 2021.Kondo, et al., Anna Rev Immunol 21, 759-806, 2003.Lapidot et al., Nature 367, 645-648, 1994.Laurenti & Gottgens, Nature 553, 418-426, 2018.Leibowitz et al., Nat Genet 53, 895-905, 2021.Lek et al., medRxiv 2023.05.16.23289881 , 2023.Letsinger et al. , 1989.Leumann, J. C, Bioorganic & Medicinal Chemistry, 10, 841-854, 2002.Li et al., Cancer Res 80, 549-560, 2020.Li et al., Blood Adv 5, 1122-1135, 2021a.Li, Exp Hematol 39, 511-520, 2011.Li et al., Mol Ther 29, 822-837, 2021b.Li et al., Mol Ther Methods Clin Dev 24, 127-141, 2022.Liu et al., Nat Mater 20, 701-710, 2021.Liu et al., J Am Chem Soc 143, 21321-21330, 2021.Locatelli et al., N Engl J Med 386, 415-427. 2022.Madeira et al. Nucleic Acids Res. 50(Wl):W276-W279, 2022.Madisen et al., Nat Neurosci 13, 133-140, 2010.Malech et al., Proc Natl Acad Sci U SA 94, 12133-12138, 1997.Man et al., Front Cell Dev Biol 9, 621214, 2021.Mandal et al., Sci Rep 8, 989, 2018.Manoharan etal., 1992.Manoharan et al. , 1993Manoharan et al. , 1994.Manoharan et al. , 1995 / Marschalek, Arch Pharm (Weinheim) 348, 221-228, 2015.Mayuranathan et al., Nat Genet, 2023.Metais et al., Blood Adv 3, 3379-3392, 2019.Miller et al., Nat Biotechnol 38, 471-481, 2020.Morales -Tenorio et al., Eur J Med Chem 223, 113654, 2021.Morgan et al., Cell Stem Cell 21, 574-590, 2017.Muruve et al., Hum Gene Ther 10, 965-976, 1999.Myerson et al., Nat Nanotechnol Yl, 86-97, 2022.Nakamura-Ishizu et al., Development 141, 4656-4666, 2014.Needleman and Wunsch, Mol. Biol. 48:443, 1970Newby et al., Nature 595, 295-302, 2021.Oberhauser et al. , 1992.Pei & Jordan, Best Pract Res Clin Haematol 25, 415-418, 2012.Psatha et al., Blood 138, 1540-1553, 2021.Reagan-Shaw et al., FASEB J., 22(3):659-661, 2008.Richter et al., Nat Biotechnol 38, 883-891, 2020.Sago et al., J Am Chem Soc 140, 17095-17105, 2018.Saison-Behmoaras et al., 1991.Sanghvi, Y. S., 1993.Shea et al. , 1990.Shi et al., Nano Lett 23, 2938-2944, 2023.Smith, DW, ed„ 1993.Sou et al., Expert Opin Drug Deliv 8, 317-328, 2011.Sou et al., J Pharmacol Exp Ther 312, 702-709, 2005.Srivastava et al., 2007.Stavropoulou et al., Cancer Cell 30, 43-58, 2016.Stavropoulou et al., Mol Cell Oncol 5, e!241854, 2018.Svinarchuk et al. , 1993.Sweeney & De Ravin, Blood 141, 2039-2040, 2023. von Heinje, 2012.Wang et al., Nat Protoc 18, 265-291. 2023.Wei et al., Nat Commun 11, 3232, 2020.Worgall et al., Hum Gene Ther 8, 37-44, 1997.Wu er a / ., Blood 108, 1183-1188, 2006.Wu et al., Nat Cancer 2, 1170-1184, 2021.Xue et al., J Am Chem Soc 144, 9926-9937, 2022.Zhang et al., J Am Chem Soc 142, 8827-8836, 2020.Zhang et al., Nat Nanotechnol 17, 777-787, 2022.Zheng et al., Nature 485, 656-660, 2012.Zhou et al., Proc Natl Acad Sci U SA 113, 520-525, 2016.Zuccaro et al., Cell 183, 1650-1664 el615, 2020.Zuo et al., Nat Nanotechnol, 2023.
Claims
WHAT IS CLAIMED IS:
1. A lipid nanoparticle comprising: a covalent lipid, wherein the covalent lipid is selected from the group consisting of:
2. The lipid nanoparticle of claim 1, wherein the lipid nanoparticle is administered to a patient.
3. The lipid nanoparticle of claim 2, wherein the lipid nanoparticles localize to the patient’s bone marrow.
4. The lipid nanoparticle of claim 2, wherein the lipid nanoparticles localize to the patient’s hematopoietic stem cells.
5. The lipid nanoparticle of claim 1, wherein the lipid nanoparticles also comprise a cationic lipid and one or more additional lipids.
6. The lipid nanoparticle of claim 5, wherein the lipid nanoparticles also comprise a therapeutic agent.
7. A lipid nanoparticle comprising: a covalent lipid, wherein the covalent lipid is selected from Table 5.
8. The lipid nanoparticle of claim 7, wherein the lipid nanoparticle is administered to a patient, and the lipid nanoparticles localize to the patient’s bone marrow.
9. The lipid nanoparticle of claim 1, wherein the lipid nanoparticles also comprise a cationic lipid and one or more additional lipids.
10. A composition comprising:(A) a lipid nanoparticle comprising:(i) a covalent lipid; wherein the covalent lipid is an amino reactive group, a carboxylic acid reactive group, a thiol reactive group, a crosslinker comprising two or more amino reactive groups, carboxylic acid reactive groups, or thiol reactive groups, a covalent lipid of the formula:or a crosslinker of the formula:(ii) a cationic lipid; and(iii) one or more additional lipids; and(B) a therapeutic agent encapsulated in the lipid nanoparticle.
11. The composition of claim 10, wherein the covalent lipid is an amino reactive group.
12. The composition of claim 11, wherein the amino reactive group comprises an isocyanate group, an isothiocyanate group, an anhydride group, or an aldehyde group.
13. The composition of claim 12, wherein the amino reactive group comprises an isocyanate group.
14. The composition of claim 13, wherein the amino reactive group is further defined as:RiNCO wherein:Ri is alkyl(c≤24), substituted alkyl(C≤24), alkenyl(c≤24), or substituted alkenyl(C224).
15. The composition of claim 14, wherein Ri is alkyl(c≤24) or substituted alkyl(c≤24).
16. The composition of claim 15, wherein Ri is alkyl(C6-24).
17. The composition of claim 12, wherein the amino reactive group comprises an isothiocyanate group.
18. The composition of claim 17, wherein the amino reactive group is further defined as:R2NCS wherein:R2 is alkyl(c≤24), substituted alkyl(C≤24), alkenyl(c≤24), or substituted alkenyl(C≤24).
19. The composition of claim 18, wherein R2 is alkyl(c≤24) or substituted alkyl(c≤24).
20. The composition of claim 19, wherein R2 is alkyl(C6-24).
21. The composition of claim 12, wherein the amino reactive group comprises an aldehyde group.
22. The composition of claim 21, wherein the amino reactive group is further defined as:R3C(O)H wherein:R3is alkyl(C≤24), substituted alkyl(c≤24), alkenyl(c≤24), or substituted alkenyl(cs24).
23. The composition of claim 22, wherein R3 is alkyl ,( 241 or substituted alkyl(c≤24).
24. The composition of claim 23, wherein R3 is alkyl(C6-24).
25. The composition of claim 12, wherein the amino reactive group is an anhydride group.
26. The composition of claim 25, wherein the anhydride groups is further defined as:wherein:R4 is alkyl(c≤24), substituted alkyl(c≤24), alkenyl(c≤24), or substituted alkenyl(c≤24); orwherein:R5and R5' are each independently alkyl(c≤24), substituted alkyl(c≤24), alkenyl(c≤24), or substituted alkenyl(c≤24).
27. The composition of claim 26, wherein R4 is alkyllc 24) or substituted alkyl(c≤24).
28. The composition of claim 26, wherein R5 is alkyl(c≤24) or substituted alkyl(c≤24).
29. The composition of claim 26, wherein R5' is alkyl(c≤24) or substituted alkyl(c≤24).
30. The composition of claim 10, wherein the covalent lipid is further defined as:wherein:Re is alkyl(c≤24), substituted alkyl(c≤24), alkenyl(c≤24), substituted alkenyl(c≤24), cycloalkyl(c≤24), substituted cycloalkykc≤24), cycloalkenyl(c≤24), substituted cycloalkenyl (c≤24), aryl(c≤24), substituted aryl(c≤24), aralkyl(c≤24), or substituted aralkyl(C≤24); andR? is hydrogen or -S(O)3-.
31. The composition of claim 10, wherein the covalent lipid is a thiol reactive group.
32. The composition of claim 31, wherein the thiol reactive group is further defined by the formula:wherein:R5is alkyl(c≤24), substituted alkyl(c≤24), alkenyl(c≤24), or substituted alkenyl(c≤24); andXi is O or NRa, wherein Rais hydrogen, alkyl<C≤8), or substituted alkyl(C≤8).
33. The composition of claim 31, wherein the thiol reactive group is further defined as:wherein:R5is alkyl(c≤24), substituted alkyl(c≤24), alkenyl(c≤24), or substituted alkenykc≤24).
34. The composition of claim 31, wherein R5is alkykc≤24) or substituted alkyl(c≤24).
35. The composition of claim 34, wherein R5is alkyl(C6-24).
36. The composition of claim 31, wherein the thiol reactive group is maleimide or a disulfide.
37. The composition of claim 36, wherein the thiol reactive group is further defined as:wherein:R9 and R9' are each independently alkyl(c≤24), substituted alkyltc≤24), alkenyl(c≤24), or substituted alkenyl(c≤24i; andRio is a maleimide or disulfide containing group.
38. The composition of claim 37, wherein R9 is alkenyl(c≤24) or substituted alkcnyfc 241-39. The composition of claim 38, wherein R9 is alkenyl(C6-24).
40. The composition of claim 37, wherein R9' is alkenyl(c≤24) or substituted alkenyl(c≤24).
41. The composition of claim 40, wherein R9' is alkenyl(C6-24).
42. The composition of claim 37, wherein Rio is a maleimide containing group.
43. The composition of claim 42, wherein the maleimide containing group further comprises one or more methylene units.
44. The composition of claim 42, wherein the maleimide containing group further comprises a benzenediyl linker.
45. The composition of claim 37, wherein Rio is a disulfide containing group.
46. The composition of claim 45, wherein the disulfide containing group further comprises one or more methylene units.
47. The composition of claim 45, wherein the disulfide containing group further comprises a heteroaryl(c≤12) or substituted heteroaryl ,c 12).
48. The composition of claim 1, wherein the covalent lipid is a carboxylic acid reactive group.
49. The composition of claim 48, wherein the carboxylic acid reactive group comprises a hydrazine or a carbodiimide group.
50. The composition of claim 49, wherein the carboxylic acid reactive group comprises a hydrazine.
51. The composition of claim 50, wherein the carboxylic acid reactive group further defined by the formula:wherein:R11is alkyfc 24), substituted alkyl, c 24,, alkenyl(c≤24), substituted alkcnyfc 24,, aryl(c≤12), substituted aryl(c≤12), aralkyl(c≤18), or substituted aralkyl(c≤18); andX2 is C(O), S(O)2, or a covalent bond.
52. The composition of claim 51, wherein R11is alkyl(c≤24) or substituted alkyl (Cs24).
53. The composition of claim 51, wherein R11is aryl(c≤12) or substituted aryl(c≤12).
54. The composition of claim 51, wherein Ri i is aralkyl(c≤18) or substituted aralkyl(c≤18).
55. The composition of claim 51, wherein X2 is a covalent bond.
56. The composition of claim 51, wherein X2is a C(O).
57. The composition of claim 51, wherein X2 is a S(O)2-58. The composition of claim 49, wherein the carboxylic acid reactive group further defined by the formula:wherein:R12 and R12' are each independently selected from alkyl(c≤24), substituted alkyl(c≤24), cycloalkyl(c≤12), or substituted cycloalkyl(c≤12).
59. The composition of claim 58, wherein R12 is alkyl(c≤24) or substituted alkyl(c≤24).
60. The composition of claim 58, wherein R12 is cycloalkyl(c≤12) or substituted cycloalkyl(C≤12).
61. The composition of claim 58, wherein R12' is alkyl(c≤24) or substituted alkyl(c≤24).
62. The composition of claim 58, wherein R12' is cycloalkyl(c≤12) or substituted cycloalky l(c≤12).
Citation Information
Patent Citations
Encapsulated nanoparticles, products containing the same, and methods for using the same
US20050065238A1
Nicotine immunonanotherapeutics
US20120027808A1
Lipid nanoparticle compositions and methods of formulating the same
US20220339185A1
Mitochondria as a targeted delivery platform
WO2023237788A1