Compositions and methods for inhibiting expression of synuclein alpha (SNCA) gene

SNCA-specific RNAi agents, particularly dsRNA agents with complementary strands, are developed to inhibit SNCA gene expression, addressing the limitations of current therapies for Parkinson's disease and other synucleinopathies by reducing alpha-synuclein protein aggregation and neuronal cell death.

WO2025162214A1PCT designated stage Publication Date: 2025-08-07SHANGHAI ARGO BIOPHARMACEUTICAL CO LTD

Patent Information

Application Number
PCT/CN2025/074542
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-29
Filing Date
2025-01-24
Publication Date
2025-08-07

AI Technical Summary

Technical Problem

Current therapies for Parkinson's disease and other synucleinopathies do not prevent or cure the disease, and there is a need for novel therapies that can effectively inhibit the expression of the SNCA gene to address neuronal cell death caused by alpha-synuclein protein aggregation.

Method used

Development of SNCA-specific RNAi agents, including double-stranded ribonucleic acid (dsRNA) agents with complementary sense and antisense strands, designed to selectively and efficiently inhibit SNCA gene expression in human or animal subjects.

Benefits of technology

The SNCA RNAi agents effectively decrease and silence SNCA gene expression, providing a potential therapeutic approach for treating SNCA-related diseases such as Parkinson's disease, Alzheimer's Disease, multiple system atrophy, and Lewy body dementia.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025074542-FTAPPB-I100001
    Figure PCTCN2025074542-FTAPPB-I100001
  • Figure PCTCN2025074542-FTAPPB-I100002
    Figure PCTCN2025074542-FTAPPB-I100002
  • Figure PCTCN2025074542-FTAPPB-I100003
    Figure PCTCN2025074542-FTAPPB-I100003
Patent Text Reader

Abstract

Compositions and methods useful to reduce expression of synuclein alpha (SNCA) gene and for treatment of SNCA-associated diseases and conditions are provided. Provided are SNCA dsRNA agents, compositions or cells comprising SNCA dsRNA agents, that can be used to reduce SNCA expression in cells and subjects.
Need to check novelty before this filing date? Find Prior Art

Description

COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF SYNUCLEIN ALPHA (SNCA) GENEField of the Invention

[0001] The invention relates, in part, to compositions and methods that can be used to inhibit synuclein alpha (SNCA) gene expression.Background

[0002] Expression of the SNCA gene produces the protein alpha-synuclein. Mutations in the SNCA gene and SNCA gene multiplications have been linked to familial Parkinson's disease (PD) . Parkinson's disease is the second most prevalent neurodegenerative disorder in the western world. The disease is clinically manifested by tremors, bradykinesia and muscle stiffness as well as impaired posture and gait. The symptoms are associated with the loss of dopaminergic neurons in the substantia nigra of the brain, which results in striatal dopamine deficiency. Neuronal cell death in large portion of PD patients is caused by the inclusion and accumulation of aggregates of the protein alpha synuclein. Alpha-synuclein protein aggregation is often observed in the PD patient brains. Similar aggregates are also observed in patients diagnosed with sporadic PD, Alzheimer's Disease, multiple system atrophy, and Lewy body dementia. Currently available therapies do not prevent or cure Parkinson’s disease.

[0003] Accordingly, there is an urgent need to develop new therapies for treating all synucleinopathies and siRNA therapeutics silencing SNCA represents a novel approach for treating SNCA-related diseases.Summary of the Invention

[0004] In general, the present disclosure provides novel SNCA gene-specific RNAi agents, compositions that include SNCA RNAi agents, and methods for inhibiting expression of a SNCA gene in vitro and / or in vivo using the SNCA RNAi agents and compositions that include SNCA RNAi agents described herein. The SNCA RNAi agents described herein can selectively and efficiently decrease, inhibit, or silence expression of a SNCA gene in a subject, e.g., a human or animal subject.

[0005] According to an aspect of the invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of synucleinsynuclein alpha (SNCA) is provided, wherein the dsRNA agent includes a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2 or 3 nucleotides from the nucleotide sequence of SEQ ID NO: l, 3, 5 or 7 and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2 or 3 nucleotides from the nucleotide sequence of SEQ ID NO: 2, 4, 6 or 8, wherein the sense strand and the antisense strand can be partially, substantially, or fully complementary to each other.

[0006] In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to part of an mRNA encoding SNCA which comprises at least 15, 16, 17, 18 or 19 contiguous nucleotides with 0, 1, 2, 3, 4 or 5 mismatches. In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to a target region of SNCA mRNA transcript which comprises at least 15, 16, 17, 18 or 19 contiguous nucleotides with 0, 1, 2, 3, 4 or 5 mismatches.

[0007] In some embodiments, the SNCA mRNA transcript is SEQ ID NO: 1.

[0008] In some embodiments, the target region of SNCA mRNA transcript is any one of nucleotides 776-796, 699-719, 628-648, 614-634, 913-933, 828-848, 238-258, 325-345, 326-346, 337-357, 397-417, 587-607, 591-611, 201-221, 202-222, 203-223, 204-224, 206-226, 207-227, 209-229, 214-234, 215-235, 216-236, 217-237, 220-240, 223-243, 224-244, 225-245, 226-246, 227-247, 228-248, 230-250, 232-252, 235-255, 236-256, 238-258, 239-259, 241-261, 268-288, 275-295, 277-297, 278-298, 306-326, 307-327, 308-328, 322-342, 324-344, 326-346, 327-347, 328-348, 338-358, 378-398, 386-406, 392-412, 394-414, 396-416, 398-418, 399-419, 400-420, 401-421, 402-422, 403-423, 405-425, 406-426, 409-429, 506-526, 513-533, 580-600, 583-603, 584-604, 585-605, 587-607, 594-614, 595-615, 598-618, 616-636, 617-637, 620-640, 623-643, 635-655, 638-658, 640-660, 642-662, 644-664, 654-674, 657-677, 664-684, 667-687, 697-717, 700-720, 704-724, 705-725, 719-739, 722-742, 726-746, 728-748, 729-749, 731-751, 735-755, 737-757, 771-791, 773-793, 775-795, 778-798, 781-801, 782-802, 783-803, 822-842, 825-845, 826-846, 831-851, 832-852, 835-855, 837-857, 839-859, 856-876, 864-884, 867-887, 869-889, 872-892, 873-893, 875-895, 876-896, 906-926, 911-931, 912-932, 915-935, 919-939, 920-940, 921-941, 923-943, 925-945, 926-946, 929-949, 938-958, 943-963, 945-965, 948-968, 949-969, 957-977, 962-982, 963-983, 967-987, 968-988, 970-990, 971-991, 976-996, 979-999, 980-1000, 1003-1023, 1005-1025, 1006-1026, 1010-1030, 1011-1031, 1012-1032, 1014-1034, 1016-1036, 1017-1037, 1023-1043, 1026-1046, 1028-1048, 1049-1069, 1066-1086, 1081-1101, 1083-1103, 1085-1105, 1086-1106, 1088-1108, 1089-1109, 1090-1110, 1091-1111, 1092-1112, 1097-1117, 1099-1119, 1105-1125, 1106-1126, 1107-1127, 1166-1186, 1168-1188, 778-796, 701-719, 630-648, 616-634, 915-933, 830-848, 240-258, 327-345, 328-346, 339-357, 399-417, 589-607, 593-611, 203-221, 204-222, 205-223, 206-224, 208-226, 209-227, 211-229, 216-234, 217-235, 218-236, 219-237, 222-240, 225-243, 226-244, 227-245, 228-246, 229-247, 230-248, 232-250, 234-252, 237-255, 238-256, 240-258, 241-259, 243-261, 270-288, 277-295, 279-297, 280-298, 308-326, 309-327, 310-328, 324-342, 326-344, 328-346, 329-347, 330-348, 340-358, 380-398, 388-406, 394-412, 396-414, 398-416, 400-418, 401-419, 402-420, 403-421, 404-422, 405-423, 407-425, 408-426, 411-429, 508-526, 515-533, 582-600, 585-603, 586-604, 587-605, 589-607, 596-614, 597-615, 600-618, 618-636, 619-637, 622-640, 625-643, 637-655, 640-658, 642-660, 644-662, 646-664, 656-674, 659-677, 666-684, 669-687, 699-717, 702-720, 706-724, 707-725, 721-739, 724-742, 728-746, 730-748, 731-749, 733-751, 737-755, 739-757, 773-791, 775-793, 777-795, 778-796, 780-798, 783-801, 784-802, 785-803, 824-842, 827-845, 828-846, 833-851, 834-852, 837-855, 839-857, 841-859, 858-876, 866-884, 869-887, 871-889, 874-892, 875-893, 877-895, 878-896, 908-926, 913-931, 914-932, 917-935, 921-939, 922-940, 923-941, 925-943, 927-945, 928-946, 931-949, 940-958, 945-963, 947-965, 950-968, 951-969, 959-977, 964-982, 965-983, 969-987, 970-988, 972-990, 973-991, 978-996, 981-999, 982-1000, 1005-1023, 1007-1025, 1008-1026, 1012-1030, 1013-1031, 1014-1032, 1016-1034, 1018-1036, 1019-1037, 1025-1043, 1028-1046, 1030-1048, 1051-1069, 1068-1086, 1083-1101, 1085-1103, 1087-1105, 1088-1106, 1090-1108, 1091-1109, 1092-1110, 1093-1111, 1094-1112, 1099-1117, 1101-1119, 1107-1125, 1108-1126, 1109-1127, 1168-1186, 1170-1188, 777-795, 700-718, 629-647, 615-633, 914-932, 829-847, 239-257, 326-344, 327-345, 338-356, 398-416, 588-606, 592-610, 202-220, 203-221, 204-222, 205-223, 207-225, 208-226, 210-228, 215-233, 216-234, 217-235, 218-236, 221-239, 224-242, 225-243, 226-244, 227-245, 228-246, 229-247, 231-249, 233-251, 236-254, 237-255, 239-257, 240-258, 242-260, 269-287, 276-294, 278-296, 279-297, 307-325, 308-326, 309-327, 323-341, 325-343, 327-345, 328-346, 329-347, 339-357, 379-397, 387-405, 393-411, 395-413, 397-415, 399-417, 400-418, 401-419, 402-420, 403-421, 404-422, 406-424, 407-425, 410-428, 507-525, 514-532, 581-599, 584-602, 585-603, 586-604, 588-606, 595-613, 596-614, 599-617, 617-635, 618-636, 621-639, 624-642, 636-654, 639-657, 641-659, 643-661, 645-663, 655-673, 658-676, 665-683, 668-686, 698-716, 701-719, 705-723, 706-724, 720-738, 723-741, 727-745, 729-747, 730-748, 732-750, 736-754, 738-756, 772-790, 774-792, 776-794, 777-795, 779-797, 782-800, 783-801, 784-802, 823-841, 826-844, 827-845, 832-850, 833-851, 836-854, 838-856, 840-858, 857-875, 865-883, 868-886, 870-888, 873-891, 874-892, 876-894, 877-895, 907-925, 912-930, 913-931, 916-934, 920-938, 921-939, 922-940, 924-942, 926-944, 927-945, 930-948, 939-957, 944-962, 946-964, 949-967, 950-968, 958-976, 963-981, 964-982, 968-986, 969-987, 971-989, 972-990, 977-995, 980-998, 981-999, 1004-1022, 1006-1024, 1007-1025, 1011-1029, 1012-1030, 1013-1031, 1015-1033, 1017-1035, 1018-1036, 1024-1042, 1027-1045, 1029-1047, 1050-1068, 1067-1085, 1082-1100, 1084-1102, 1086-1104, 1087-1105, 1089-1107, 1090-1108, 1091-1109, 1092-1110, 1093-1111, 1098-1116, 1100-1118, 1106-1124, 1107-1125, 1108-1126, 1167-1185, 1169-1187, 777-793, 700-716, 629-645, 615-631, 914-930, 829-845, 239-255, 326-342, 327-343, 338-354, 398-414, 588-604, 592-608, 202-218, 203-219, 204-220, 205-221, 207-223, 208-224, 210-226, 215-231, 216-232, 217-233, 218-234, 221-237, 224-240, 225-241, 226-242, 227-243, 228-244, 229-245, 231-247, 233-249, 236-252, 237-253, 239-255, 240-256, 242-258, 269-285, 276-292, 278-294, 279-295, 307-323, 308-324, 309-325, 323-339, 325-341, 327-343, 328-344, 329-345, 339-355, 379-395, 387-403, 393-409, 395-411, 397-413, 399-415, 400-416, 401-417, 402-418, 403-419, 404-420, 406-422, 407-423, 410-426, 507-523, 514-530, 581-597, 584-600, 585-601, 586-602, 588-604, 595-611, 596-612, 599-615, 617-633, 618-634, 621-637, 624-640, 636-652, 639-655, 641-657, 643-659, 645-661, 655-671, 658-674, 665-681, 668-684, 698-714, 701-717, 705-721, 706-722, 720-736, 723-739, 727-743, 729-745, 730-746, 732-748, 736-752, 738-754, 772-788, 774-790, 776-792, 777-793, 779-795, 782-798, 783-799, 784-800, 823-839, 826-842, 827-843, 832-848, 833-849, 836-852, 838-854, 840-856, 857-873, 865-881, 868-884, 870-886, 873-889, 874-890, 876-892, 877-893, 907-923, 912-928, 913-929, 916-932, 920-936, 921-937, 922-938, 924-940, 926-942, 927-943, 930-946, 939-955, 944-960, 946-962, 949-965, 950-966, 958-974, 963-979, 964-980, 968-984, 969-985, 971-987, 972-988, 977-993, 980-996, 981-997, 1004-1020, 1006-1022, 1007-1023, 1011-1027, 1012-1028, 1013-1029, 1015-1031, 1017-1033, 1018-1034, 1024-1040, 1027-1043, 1029-1045, 1050-1066, 1067-1083, 1082-1098, 1084-1100, 1086-1102, 1087-1103, 1089-1105, 1090-1106, 1091-1107, 1092-1108, 1093-1109, 1098-1114, 1100-1116, 1106-1122, 1107-1123, 1108-1124, 1167-1183 or 1169-1185 of SEQ ID NO: 1.

[0009] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences of nucleotides 776-796, 699-719, 628-648, 614-634, 913-933, 828-848, 238-258, 325-345, 326-346, 337-357, 397-417, 587-607, 591-611, 201-221, 202-222, 203-223, 204-224, 206-226, 207-227, 209-229, 214-234, 215-235, 216-236, 217-237, 220-240, 223-243, 224-244, 225-245, 226-246, 227-247, 228-248, 230-250, 232-252, 235-255, 236-256, 238-258, 239-259, 241-261, 268-288, 275-295, 277-297, 278-298, 306-326, 307-327, 308-328, 322-342, 324-344, 326-346, 327-347, 328-348, 338-358, 378-398, 386-406, 392-412, 394-414, 396-416, 398-418, 399-419, 400-420, 401-421, 402-422, 403-423, 405-425, 406-426, 409-429, 506-526, 513-533, 580-600, 583-603, 584-604, 585-605, 587-607, 594-614, 595-615, 598-618, 616-636, 617-637, 620-640, 623-643, 635-655, 638-658, 640-660, 642-662, 644-664, 654-674, 657-677, 664-684, 667-687, 697-717, 700-720, 704-724, 705-725, 719-739, 722-742, 726-746, 728-748, 729-749, 731-751, 735-755, 737-757, 771-791, 773-793, 775-795, 776-796, 778-798, 781-801, 782-802, 783-803, 822-842, 825-845, 826-846, 831-851, 832-852, 835-855, 837-857, 839-859, 856-876, 864-884, 867-887, 869-889, 872-892, 873-893, 875-895, 876-896, 906-926, 911-931, 912-932, 915-935, 919-939, 920-940, 921-941, 923-943, 925-945, 926-946, 929-949, 938-958, 943-963, 945-965, 948-968, 949-969, 957-977, 962-982, 963-983, 967-987, 968-988, 970-990, 971-991, 976-996, 979-999, 980-1000, 1003-1023, 1005-1025, 1006-1026, 1010-1030, 1011-1031, 1012-1032, 1014-1034, 1016-1036, 1017-1037, 1023-1043, 1026-1046, 1028-1048, 1049-1069, 1066-1086, 1081-1101, 1083-1103, 1085-1105, 1086-1106, 1088-1108, 1089-1109, 1090-1110, 1091-1111, 1092-1112, 1097-1117, 1099-1119, 1105-1125, 1106-1126, 1107-1127, 1166-1186, 1168-1188, 778-796, 701-719, 630-648, 616-634, 915-933, 830-848, 240-258, 327-345, 328-346, 339-357, 399-417, 589-607, 593-611, 203-221, 204-222, 205-223, 206-224, 208-226, 209-227, 211-229, 216-234, 217-235, 218-236, 219-237, 222-240, 225-243, 226-244, 227-245, 228-246, 229-247, 230-248, 232-250, 234-252, 237-255, 238-256, 240-258, 241-259, 243-261, 270-288, 277-295, 279-297, 280-298, 308-326, 309-327, 310-328, 324-342, 326-344, 328-346, 329-347, 330-348, 340-358, 380-398, 388-406, 394-412, 396-414, 398-416, 400-418, 401-419, 402-420, 403-421, 404-422, 405-423, 407-425, 408-426, 411-429, 508-526, 515-533, 582-600, 585-603, 586-604, 587-605, 589-607, 596-614, 597-615, 600-618, 618-636, 619-637, 622-640, 625-643, 637-655, 640-658, 642-660, 644-662, 646-664, 656-674, 659-677, 666-684, 669-687, 699-717, 702-720, 706-724, 707-725, 721-739, 724-742, 728-746, 730-748, 731-749, 733-751, 737-755, 739-757, 773-791, 775-793, 777-795, 778-796, 780-798, 783-801, 784-802, 785-803, 824-842, 827-845, 828-846, 833-851, 834-852, 837-855, 839-857, 841-859, 858-876, 866-884, 869-887, 871-889, 874-892, 875-893, 877-895, 878-896, 908-926, 913-931, 914-932, 917-935, 921-939, 922-940, 923-941, 925-943, 927-945, 928-946, 931-949, 940-958, 945-963, 947-965, 950-968, 951-969, 959-977, 964-982, 965-983, 969-987, 970-988, 972-990, 973-991, 978-996, 981-999, 982-1000, 1005-1023, 1007-1025, 1008-1026, 1012-1030, 1013-1031, 1014-1032, 1016-1034, 1018-1036, 1019-1037, 1025-1043, 1028-1046, 1030-1048, 1051-1069, 1068-1086, 1083-1101, 1085-1103, 1087-1105, 1088-1106, 1090-1108, 1091-1109, 1092-1110, 1093-1111, 1094-1112, 1099-1117, 1101-1119, 1107-1125, 1108-1126, 1109-1127, 1168-1186, 1170-1188, 777-795, 700-718, 629-647, 615-633, 914-932, 829-847, 239-257, 326-344, 327-345, 338-356, 398-416, 588-606, 592-610, 202-220, 203-221, 204-222, 205-223, 207-225, 208-226, 210-228, 215-233, 216-234, 217-235, 218-236, 221-239, 224-242, 225-243, 226-244, 227-245, 228-246, 229-247, 231-249, 233-251, 236-254, 237-255, 239-257, 240-258, 242-260, 269-287, 276-294, 278-296, 279-297, 307-325, 308-326, 309-327, 323-341, 325-343, 327-345, 328-346, 329-347, 339-357, 379-397, 387-405, 393-411, 395-413, 397-415, 399-417, 400-418, 401-419, 402-420, 403-421, 404-422, 406-424, 407-425, 410-428, 507-525, 514-532, 581-599, 584-602, 585-603, 586-604, 588-606, 595-613, 596-614, 599-617, 617-635, 618-636, 621-639, 624-642, 636-654, 639-657, 641-659, 643-661, 645-663, 655-673, 658-676, 665-683, 668-686, 698-716, 701-719, 705-723, 706-724, 720-738, 723-741, 727-745, 729-747, 730-748, 732-750, 736-754, 738-756, 772-790, 774-792, 776-794, 777-795, 779-797, 782-800, 783-801, 784-802, 823-841, 826-844, 827-845, 832-850, 833-851, 836-854, 838-856, 840-858, 857-875, 865-883, 868-886, 870-888, 873-891, 874-892, 876-894, 877-895, 907-925, 912-930, 913-931, 916-934, 920-938, 921-939, 922-940, 924-942, 926-944, 927-945, 930-948, 939-957, 944-962, 946-964, 949-967, 950-968, 958-976, 963-981, 964-982, 968-986, 969-987, 971-989, 972-990, 977-995, 980-998, 981-999, 1004-1022, 1006-1024, 1007-1025, 1011-1029, 1012-1030, 1013-1031, 1015-1033, 1017-1035, 1018-1036, 1024-1042, 1027-1045, 1029-1047, 1050-1068, 1067-1085, 1082-1100, 1084-1102, 1086-1104, 1087-1105, 1089-1107, 1090-1108, 1091-1109, 1092-1110, 1093-1111, 1098-1116, 1100-1118, 1106-1124, 1107-1125, 1108-1126, 1167-1185, 1169-1187, 777-793, 700-716, 629-645, 615-631, 914-930, 829-845, 239-255, 326-342, 327-343, 338-354, 398-414, 588-604, 592-608, 202-218, 203-219, 204-220, 205-221, 207-223, 208-224, 210-226, 215-231, 216-232, 217-233, 218-234, 221-237, 224-240, 225-241, 226-242, 227-243, 228-244, 229-245, 231-247, 233-249, 236-252, 237-253, 239-255, 240-256, 242-258, 269-285, 276-292, 278-294, 279-295, 307-323, 308-324, 309-325, 323-339, 325-341, 327-343, 328-344, 329-345, 339-355, 379-395, 387-403, 393-409, 395-411, 397-413, 399-415, 400-416, 401-417, 402-418, 403-419, 404-420, 406-422, 407-423, 410-426, 507-523, 514-530, 581-597, 584-600, 585-601, 586-602, 588-604, 595-611, 596-612, 599-615, 617-633, 618-634, 621-637, 624-640, 636-652, 639-655, 641-657, 643-659, 645-661, 655-671, 658-674, 665-681, 668-684, 698-714, 701-717, 705-721, 706-722, 720-736, 723-739, 727-743, 729-745, 730-746, 732-748, 736-752, 738-754, 772-788, 774-790, 776-792, 777-793, 779-795, 782-798, 783-799, 784-800, 823-839, 826-842, 827-843, 832-848, 833-849, 836-852, 838-854, 840-856, 857-873, 865-881, 868-884, 870-886, 873-889, 874-890, 876-892, 877-893, 907-923, 912-928, 913-929, 916-932, 920-936, 921-937, 922-938, 924-940, 926-942, 927-943, 930-946, 939-955, 944-960, 946-962, 949-965, 950-966, 958-974, 963-979, 964-980, 968-984, 969-985, 971-987, 972-988, 977-993, 980-996, 981-997, 1004-1020, 1006-1022, 1007-1023, 1011-1027, 1012-1028, 1013-1029, 1015-1031, 1017-1033, 1018-1034, 1024-1040, 1027-1043, 1029-1045, 1050-1066, 1067-1083, 1082-1098, 1084-1100, 1086-1102, 1087-1103, 1089-1105, 1090-1106, 1091-1107, 1092-1108, 1093-1109, 1098-1114, 1100-1116, 1106-1122, 1107-1123, 1108-1124, 1167-1183 or 1169-1185 of SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 2.

[0010] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences of nucleotides 776-796, 699-719, 628-648, 614-634, 913-933, 828-848, 238-258, 325-345, 326-346, 337-357, 397-417, 587-607, 591-611, 201-221, 202-222, 203-223, 204-224, 206-226, 207-227, 209-229, 214-234, 215-235, 216-236, 217-237, 220-240, 223-243, 224-244, 225-245, 226-246, 227-247, 228-248, 230-250, 232-252, 235-255, 236-256, 238-258, 239-259, 241-261, 268-288, 275-295, 277-297, 278-298, 306-326, 307-327, 308-328, 322-342, 324-344, 326-346, 327-347, 328-348, 338-358, 378-398, 386-406, 392-412, 394-414, 396-416, 398-418, 399-419, 400-420, 401-421, 402-422, 403-423, 405-425, 406-426, 409-429, 506-526, 513-533, 580-600, 583-603, 584-604, 585-605, 587-607, 594-614, 595-615, 598-618, 616-636, 617-637, 620-640, 623-643, 635-655, 638-658, 640-660, 642-662, 644-664, 654-674, 657-677, 664-684, 667-687, 697-717, 700-720, 704-724, 705-725, 719-739, 722-742, 726-746, 728-748, 729-749, 731-751, 735-755, 737-757, 771-791, 773-793, 775-795, 776-796, 778-798, 781-801, 782-802, 783-803, 822-842, 825-845, 826-846, 831-851, 832-852, 835-855, 837-857, 839-859, 856-876, 864-884, 867-887, 869-889, 872-892, 873-893, 875-895, 876-896, 906-926, 911-931, 912-932, 915-935, 919-939, 920-940, 921-941, 923-943, 925-945, 926-946, 929-949, 938-958, 943-963, 945-965, 948-968, 949-969, 957-977, 962-982, 963-983, 967-987, 968-988, 970-990, 971-991, 976-996, 979-999, 980-1000, 1003-1023, 1005-1025, 1006-1026, 1010-1030, 1011-1031, 1012-1032, 1014-1034, 1016-1036, 1017-1037, 1023-1043, 1026-1046, 1028-1048, 1049-1069, 1066-1086, 1081-1101, 1083-1103, 1085-1105, 1086-1106, 1088-1108, 1089-1109, 1090-1110, 1091-1111, 1092-1112, 1097-1117, 1099-1119, 1105-1125, 1106-1126, 1107-1127, 1166-1186, 1168-1188, 778-796, 701-719, 630-648, 616-634, 915-933, 830-848, 240-258, 327-345, 328-346, 339-357, 399-417, 589-607, 593-611, 203-221, 204-222, 205-223, 206-224, 208-226, 209-227, 211-229, 216-234, 217-235, 218-236, 219-237, 222-240, 225-243, 226-244, 227-245, 228-246, 229-247, 230-248, 232-250, 234-252, 237-255, 238-256, 240-258, 241-259, 243-261, 270-288, 277-295, 279-297, 280-298, 308-326, 309-327, 310-328, 324-342, 326-344, 328-346, 329-347, 330-348, 340-358, 380-398, 388-406, 394-412, 396-414, 398-416, 400-418, 401-419, 402-420, 403-421, 404-422, 405-423, 407-425, 408-426, 411-429, 508-526, 515-533, 582-600, 585-603, 586-604, 587-605, 589-607, 596-614, 597-615, 600-618, 618-636, 619-637, 622-640, 625-643, 637-655, 640-658, 642-660, 644-662, 646-664, 656-674, 659-677, 666-684, 669-687, 699-717, 702-720, 706-724, 707-725, 721-739, 724-742, 728-746, 730-748, 731-749, 733-751, 737-755, 739-757, 773-791, 775-793, 777-795, 778-796, 780-798, 783-801, 784-802, 785-803, 824-842, 827-845, 828-846, 833-851, 834-852, 837-855, 839-857, 841-859, 858-876, 866-884, 869-887, 871-889, 874-892, 875-893, 877-895, 878-896, 908-926, 913-931, 914-932, 917-935, 921-939, 922-940, 923-941, 925-943, 927-945, 928-946, 931-949, 940-958, 945-963, 947-965, 950-968, 951-969, 959-977, 964-982, 965-983, 969-987, 970-988, 972-990, 973-991, 978-996, 981-999, 982-1000, 1005-1023, 1007-1025, 1008-1026, 1012-1030, 1013-1031, 1014-1032, 1016-1034, 1018-1036, 1019-1037, 1025-1043, 1028-1046, 1030-1048, 1051-1069, 1068-1086, 1083-1101, 1085-1103, 1087-1105, 1088-1106, 1090-1108, 1091-1109, 1092-1110, 1093-1111, 1094-1112, 1099-1117, 1101-1119, 1107-1125, 1108-1126, 1109-1127, 1168-1186, 1170-1188, 777-795, 700-718, 629-647, 615-633, 914-932, 829-847, 239-257, 326-344, 327-345, 338-356, 398-416, 588-606, 592-610, 202-220, 203-221, 204-222, 205-223, 207-225, 208-226, 210-228, 215-233, 216-234, 217-235, 218-236, 221-239, 224-242, 225-243, 226-244, 227-245, 228-246, 229-247, 231-249, 233-251, 236-254, 237-255, 239-257, 240-258, 242-260, 269-287, 276-294, 278-296, 279-297, 307-325, 308-326, 309-327, 323-341, 325-343, 327-345, 328-346, 329-347, 339-357, 379-397, 387-405, 393-411, 395-413, 397-415, 399-417, 400-418, 401-419, 402-420, 403-421, 404-422, 406-424, 407-425, 410-428, 507-525, 514-532, 581-599, 584-602, 585-603, 586-604, 588-606, 595-613, 596-614, 599-617, 617-635, 618-636, 621-639, 624-642, 636-654, 639-657, 641-659, 643-661, 645-663, 655-673, 658-676, 665-683, 668-686, 698-716, 701-719, 705-723, 706-724, 720-738, 723-741, 727-745, 729-747, 730-748, 732-750, 736-754, 738-756, 772-790, 774-792, 776-794, 777-795, 779-797, 782-800, 783-801, 784-802, 823-841, 826-844, 827-845, 832-850, 833-851, 836-854, 838-856, 840-858, 857-875, 865-883, 868-886, 870-888, 873-891, 874-892, 876-894, 877-895, 907-925, 912-930, 913-931, 916-934, 920-938, 921-939, 922-940, 924-942, 926-944, 927-945, 930-948, 939-957, 944-962, 946-964, 949-967, 950-968, 958-976, 963-981, 964-982, 968-986, 969-987, 971-989, 972-990, 977-995, 980-998, 981-999, 1004-1022, 1006-1024, 1007-1025, 1011-1029, 1012-1030, 1013-1031, 1015-1033, 1017-1035, 1018-1036, 1024-1042, 1027-1045, 1029-1047, 1050-1068, 1067-1085, 1082-1100, 1084-1102, 1086-1104, 1087-1105, 1089-1107, 1090-1108, 1091-1109, 1092-1110, 1093-1111, 1098-1116, 1100-1118, 1106-1124, 1107-1125, 1108-1126, 1167-1185, 1169-1187, 777-793, 700-716, 629-645, 615-631, 914-930, 829-845, 239-255, 326-342, 327-343, 338-354, 398-414, 588-604, 592-608, 202-218, 203-219, 204-220, 205-221, 207-223, 208-224, 210-226, 215-231, 216-232, 217-233, 218-234, 221-237, 224-240, 225-241, 226-242, 227-243, 228-244, 229-245, 231-247, 233-249, 236-252, 237-253, 239-255, 240-256, 242-258, 269-285, 276-292, 278-294, 279-295, 307-323, 308-324, 309-325, 323-339, 325-341, 327-343, 328-344, 329-345, 339-355, 379-395, 387-403, 393-409, 395-411, 397-413, 399-415, 400-416, 401-417, 402-418, 403-419, 404-420, 406-422, 407-423, 410-426, 507-523, 514-530, 581-597, 584-600, 585-601, 586-602, 588-604, 595-611, 596-612, 599-615, 617-633, 618-634, 621-637, 624-640, 636-652, 639-655, 641-657, 643-659, 645-661, 655-671, 658-674, 665-681, 668-684, 698-714, 701-717, 705-721, 706-722, 720-736, 723-739, 727-743, 729-745, 730-746, 732-748, 736-752, 738-754, 772-788, 774-790, 776-792, 777-793, 779-795, 782-798, 783-799, 784-800, 823-839, 826-842, 827-843, 832-848, 833-849, 836-852, 838-854, 840-856, 857-873, 865-881, 868-884, 870-886, 873-889, 874-890, 876-892, 877-893, 907-923, 912-928, 913-929, 916-932, 920-936, 921-937, 922-938, 924-940, 926-942, 927-943, 930-946, 939-955, 944-960, 946-962, 949-965, 950-966, 958-974, 963-979, 964-980, 968-984, 969-985, 971-987, 972-988, 977-993, 980-996, 981-997, 1004-1020, 1006-1022, 1007-1023, 1011-1027, 1012-1028, 1013-1029, 1015-1031, 1017-1033, 1018-1034, 1024-1040, 1027-1043, 1029-1045, 1050-1066, 1067-1083, 1082-1098, 1084-1100, 1086-1102, 1087-1103, 1089-1105, 1090-1106, 1091-1107, 1092-1108, 1093-1109, 1098-1114, 1100-1116, 1106-1122, 1107-1123, 1108-1124, 1167-1183 or 1169-1185 of SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 2.

[0011] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences of nucleotides 776-796, 699-719, 628-648, 614-634, 913-933, 828-848, 238-258, 325-345, 326-346, 337-357, 397-417, 587-607, 591-611, 201-221, 202-222, 203-223, 204-224, 206-226, 207-227, 209-229, 214-234, 215-235, 216-236, 217-237, 220-240, 223-243, 224-244, 225-245, 226-246, 227-247, 228-248, 230-250, 232-252, 235-255, 236-256, 238-258, 239-259, 241-261, 268-288, 275-295, 277-297, 278-298, 306-326, 307-327, 308-328, 322-342, 324-344, 326-346, 327-347, 328-348, 338-358, 378-398, 386-406, 392-412, 394-414, 396-416, 398-418, 399-419, 400-420, 401-421, 402-422, 403-423, 405-425, 406-426, 409-429, 506-526, 513-533, 580-600, 583-603, 584-604, 585-605, 587-607, 594-614, 595-615, 598-618, 616-636, 617-637, 620-640, 623-643, 635-655, 638-658, 640-660, 642-662, 644-664, 654-674, 657-677, 664-684, 667-687, 697-717, 700-720, 704-724, 705-725, 719-739, 722-742, 726-746, 728-748, 729-749, 731-751, 735-755, 737-757, 771-791, 773-793, 775-795, 776-796, 778-798, 781-801, 782-802, 783-803, 822-842, 825-845, 826-846, 831-851, 832-852, 835-855, 837-857, 839-859, 856-876, 864-884, 867-887, 869-889, 872-892, 873-893, 875-895, 876-896, 906-926, 911-931, 912-932, 915-935, 919-939, 920-940, 921-941, 923-943, 925-945, 926-946, 929-949, 938-958, 943-963, 945-965, 948-968, 949-969, 957-977, 962-982, 963-983, 967-987, 968-988, 970-990, 971-991, 976-996, 979-999, 980-1000, 1003-1023, 1005-1025, 1006-1026, 1010-1030, 1011-1031, 1012-1032, 1014-1034, 1016-1036, 1017-1037, 1023-1043, 1026-1046, 1028-1048, 1049-1069, 1066-1086, 1081-1101, 1083-1103, 1085-1105, 1086-1106, 1088-1108, 1089-1109, 1090-1110, 1091-1111, 1092-1112, 1097-1117, 1099-1119, 1105-1125, 1106-1126, 1107-1127, 1166-1186, 1168-1188, 778-796, 701-719, 630-648, 616-634, 915-933, 830-848, 240-258, 327-345, 328-346, 339-357, 399-417, 589-607, 593-611, 203-221, 204-222, 205-223, 206-224, 208-226, 209-227, 211-229, 216-234, 217-235, 218-236, 219-237, 222-240, 225-243, 226-244, 227-245, 228-246, 229-247, 230-248, 232-250, 234-252, 237-255, 238-256, 240-258, 241-259, 243-261, 270-288, 277-295, 279-297, 280-298, 308-326, 309-327, 310-328, 324-342, 326-344, 328-346, 329-347, 330-348, 340-358, 380-398, 388-406, 394-412, 396-414, 398-416, 400-418, 401-419, 402-420, 403-421, 404-422, 405-423, 407-425, 408-426, 411-429, 508-526, 515-533, 582-600, 585-603, 586-604, 587-605, 589-607, 596-614, 597-615, 600-618, 618-636, 619-637, 622-640, 625-643, 637-655, 640-658, 642-660, 644-662, 646-664, 656-674, 659-677, 666-684, 669-687, 699-717, 702-720, 706-724, 707-725, 721-739, 724-742, 728-746, 730-748, 731-749, 733-751, 737-755, 739-757, 773-791, 775-793, 777-795, 778-796, 780-798, 783-801, 784-802, 785-803, 824-842, 827-845, 828-846, 833-851, 834-852, 837-855, 839-857, 841-859, 858-876, 866-884, 869-887, 871-889, 874-892, 875-893, 877-895, 878-896, 908-926, 913-931, 914-932, 917-935, 921-939, 922-940, 923-941, 925-943, 927-945, 928-946, 931-949, 940-958, 945-963, 947-965, 950-968, 951-969, 959-977, 964-982, 965-983, 969-987, 970-988, 972-990, 973-991, 978-996, 981-999, 982-1000, 1005-1023, 1007-1025, 1008-1026, 1012-1030, 1013-1031, 1014-1032, 1016-1034, 1018-1036, 1019-1037, 1025-1043, 1028-1046, 1030-1048, 1051-1069, 1068-1086, 1083-1101, 1085-1103, 1087-1105, 1088-1106, 1090-1108, 1091-1109, 1092-1110, 1093-1111, 1094-1112, 1099-1117, 1101-1119, 1107-1125, 1108-1126, 1109-1127, 1168-1186, 1170-1188, 777-795, 700-718, 629-647, 615-633, 914-932, 829-847, 239-257, 326-344, 327-345, 338-356, 398-416, 588-606, 592-610, 202-220, 203-221, 204-222, 205-223, 207-225, 208-226, 210-228, 215-233, 216-234, 217-235, 218-236, 221-239, 224-242, 225-243, 226-244, 227-245, 228-246, 229-247, 231-249, 233-251, 236-254, 237-255, 239-257, 240-258, 242-260, 269-287, 276-294, 278-296, 279-297, 307-325, 308-326, 309-327, 323-341, 325-343, 327-345, 328-346, 329-347, 339-357, 379-397, 387-405, 393-411, 395-413, 397-415, 399-417, 400-418, 401-419, 402-420, 403-421, 404-422, 406-424, 407-425, 410-428, 507-525, 514-532, 581-599, 584-602, 585-603, 586-604, 588-606, 595-613, 596-614, 599-617, 617-635, 618-636, 621-639, 624-642, 636-654, 639-657, 641-659, 643-661, 645-663, 655-673, 658-676, 665-683, 668-686, 698-716, 701-719, 705-723, 706-724, 720-738, 723-741, 727-745, 729-747, 730-748, 732-750, 736-754, 738-756, 772-790, 774-792, 776-794, 777-795, 779-797, 782-800, 783-801, 784-802, 823-841, 826-844, 827-845, 832-850, 833-851, 836-854, 838-856, 840-858, 857-875, 865-883, 868-886, 870-888, 873-891, 874-892, 876-894, 877-895, 907-925, 912-930, 913-931, 916-934, 920-938, 921-939, 922-940, 924-942, 926-944, 927-945, 930-948, 939-957, 944-962, 946-964, 949-967, 950-968, 958-976, 963-981, 964-982, 968-986, 969-987, 971-989, 972-990, 977-995, 980-998, 981-999, 1004-1022, 1006-1024, 1007-1025, 1011-1029, 1012-1030, 1013-1031, 1015-1033, 1017-1035, 1018-1036, 1024-1042, 1027-1045, 1029-1047, 1050-1068, 1067-1085, 1082-1100, 1084-1102, 1086-1104, 1087-1105, 1089-1107, 1090-1108, 1091-1109, 1092-1110, 1093-1111, 1098-1116, 1100-1118, 1106-1124, 1107-1125, 1108-1126, 1167-1185, 1169-1187, 777-793, 700-716, 629-645, 615-631, 914-930, 829-845, 239-255, 326-342, 327-343, 338-354, 398-414, 588-604, 592-608, 202-218, 203-219, 204-220, 205-221, 207-223, 208-224, 210-226, 215-231, 216-232, 217-233, 218-234, 221-237, 224-240, 225-241, 226-242, 227-243, 228-244, 229-245, 231-247, 233-249, 236-252, 237-253, 239-255, 240-256, 242-258, 269-285, 276-292, 278-294, 279-295, 307-323, 308-324, 309-325, 323-339, 325-341, 327-343, 328-344, 329-345, 339-355, 379-395, 387-403, 393-409, 395-411, 397-413, 399-415, 400-416, 401-417, 402-418, 403-419, 404-420, 406-422, 407-423, 410-426, 507-523, 514-530, 581-597, 584-600, 585-601, 586-602, 588-604, 595-611, 596-612, 599-615, 617-633, 618-634, 621-637, 624-640, 636-652, 639-655, 641-657, 643-659, 645-661, 655-671, 658-674, 665-681, 668-684, 698-714, 701-717, 705-721, 706-722, 720-736, 723-739, 727-743, 729-745, 730-746, 732-748, 736-752, 738-754, 772-788, 774-790, 776-792, 777-793, 779-795, 782-798, 783-799, 784-800, 823-839, 826-842, 827-843, 832-848, 833-849, 836-852, 838-854, 840-856, 857-873, 865-881, 868-884, 870-886, 873-889, 874-890, 876-892, 877-893, 907-923, 912-928, 913-929, 916-932, 920-936, 921-937, 922-938, 924-940, 926-942, 927-943, 930-946, 939-955, 944-960, 946-962, 949-965, 950-966, 958-974, 963-979, 964-980, 968-984, 969-985, 971-987, 972-988, 977-993, 980-996, 981-997, 1004-1020, 1006-1022, 1007-1023, 1011-1027, 1012-1028, 1013-1029, 1015-1031, 1017-1033, 1018-1034, 1024-1040, 1027-1043, 1029-1045, 1050-1066, 1067-1083, 1082-1098, 1084-1100, 1086-1102, 1087-1103, 1089-1105, 1090-1106, 1091-1107, 1092-1108, 1093-1109, 1098-1114, 1100-1116, 1106-1122, 1107-1123, 1108-1124, 1167-1183 or 1169-1185 of SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 2.

[0012] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences of nucleotides 776-796, 699-719, 628-648, 614-634, 913-933, 828-848, 238-258, 325-345, 326-346, 337-357, 397-417, 587-607, 591-611, 201-221, 202-222, 203-223, 204-224, 206-226, 207-227, 209-229, 214-234, 215-235, 216-236, 217-237, 220-240, 223-243, 224-244, 225-245, 226-246, 227-247, 228-248, 230-250, 232-252, 235-255, 236-256, 238-258, 239-259, 241-261, 268-288, 275-295, 277-297, 278-298, 306-326, 307-327, 308-328, 322-342, 324-344, 326-346, 327-347, 328-348, 338-358, 378-398, 386-406, 392-412, 394-414, 396-416, 398-418, 399-419, 400-420, 401-421, 402-422, 403-423, 405-425, 406-426, 409-429, 506-526, 513-533, 580-600, 583-603, 584-604, 585-605, 587-607, 594-614, 595-615, 598-618, 616-636, 617-637, 620-640, 623-643, 635-655, 638-658, 640-660, 642-662, 644-664, 654-674, 657-677, 664-684, 667-687, 697-717, 700-720, 704-724, 705-725, 719-739, 722-742, 726-746, 728-748, 729-749, 731-751, 735-755, 737-757, 771-791, 773-793, 775-795, 776-796, 778-798, 781-801, 782-802, 783-803, 822-842, 825-845, 826-846, 831-851, 832-852, 835-855, 837-857, 839-859, 856-876, 864-884, 867-887, 869-889, 872-892, 873-893, 875-895, 876-896, 906-926, 911-931, 912-932, 915-935, 919-939, 920-940, 921-941, 923-943, 925-945, 926-946, 929-949, 938-958, 943-963, 945-965, 948-968, 949-969, 957-977, 962-982, 963-983, 967-987, 968-988, 970-990, 971-991, 976-996, 979-999, 980-1000, 1003-1023, 1005-1025, 1006-1026, 1010-1030, 1011-1031, 1012-1032, 1014-1034, 1016-1036, 1017-1037, 1023-1043, 1026-1046, 1028-1048, 1049-1069, 1066-1086, 1081-1101, 1083-1103, 1085-1105, 1086-1106, 1088-1108, 1089-1109, 1090-1110, 1091-1111, 1092-1112, 1097-1117, 1099-1119, 1105-1125, 1106-1126, 1107-1127, 1166-1186, 1168-1188, 778-796, 701-719, 630-648, 616-634, 915-933, 830-848, 240-258, 327-345, 328-346, 339-357, 399-417, 589-607, 593-611, 203-221, 204-222, 205-223, 206-224, 208-226, 209-227, 211-229, 216-234, 217-235, 218-236, 219-237, 222-240, 225-243, 226-244, 227-245, 228-246, 229-247, 230-248, 232-250, 234-252, 237-255, 238-256, 240-258, 241-259, 243-261, 270-288, 277-295, 279-297, 280-298, 308-326, 309-327, 310-328, 324-342, 326-344, 328-346, 329-347, 330-348, 340-358, 380-398, 388-406, 394-412, 396-414, 398-416, 400-418, 401-419, 402-420, 403-421, 404-422, 405-423, 407-425, 408-426, 411-429, 508-526, 515-533, 582-600, 585-603, 586-604, 587-605, 589-607, 596-614, 597-615, 600-618, 618-636, 619-637, 622-640, 625-643, 637-655, 640-658, 642-660, 644-662, 646-664, 656-674, 659-677, 666-684, 669-687, 699-717, 702-720, 706-724, 707-725, 721-739, 724-742, 728-746, 730-748, 731-749, 733-751, 737-755, 739-757, 773-791, 775-793, 777-795, 778-796, 780-798, 783-801, 784-802, 785-803, 824-842, 827-845, 828-846, 833-851, 834-852, 837-855, 839-857, 841-859, 858-876, 866-884, 869-887, 871-889, 874-892, 875-893, 877-895, 878-896, 908-926, 913-931, 914-932, 917-935, 921-939, 922-940, 923-941, 925-943, 927-945, 928-946, 931-949, 940-958, 945-963, 947-965, 950-968, 951-969, 959-977, 964-982, 965-983, 969-987, 970-988, 972-990, 973-991, 978-996, 981-999, 982-1000, 1005-1023, 1007-1025, 1008-1026, 1012-1030, 1013-1031, 1014-1032, 1016-1034, 1018-1036, 1019-1037, 1025-1043, 1028-1046, 1030-1048, 1051-1069, 1068-1086, 1083-1101, 1085-1103, 1087-1105, 1088-1106, 1090-1108, 1091-1109, 1092-1110, 1093-1111, 1094-1112, 1099-1117, 1101-1119, 1107-1125, 1108-1126, 1109-1127, 1168-1186, 1170-1188, 777-795, 700-718, 629-647, 615-633, 914-932, 829-847, 239-257, 326-344, 327-345, 338-356, 398-416, 588-606, 592-610, 202-220, 203-221, 204-222, 205-223, 207-225, 208-226, 210-228, 215-233, 216-234, 217-235, 218-236, 221-239, 224-242, 225-243, 226-244, 227-245, 228-246, 229-247, 231-249, 233-251, 236-254, 237-255, 239-257, 240-258, 242-260, 269-287, 276-294, 278-296, 279-297, 307-325, 308-326, 309-327, 323-341, 325-343, 327-345, 328-346, 329-347, 339-357, 379-397, 387-405, 393-411, 395-413, 397-415, 399-417, 400-418, 401-419, 402-420, 403-421, 404-422, 406-424, 407-425, 410-428, 507-525, 514-532, 581-599, 584-602, 585-603, 586-604, 588-606, 595-613, 596-614, 599-617, 617-635, 618-636, 621-639, 624-642, 636-654, 639-657, 641-659, 643-661, 645-663, 655-673, 658-676, 665-683, 668-686, 698-716, 701-719, 705-723, 706-724, 720-738, 723-741, 727-745, 729-747, 730-748, 732-750, 736-754, 738-756, 772-790, 774-792, 776-794, 777-795, 779-797, 782-800, 783-801, 784-802, 823-841, 826-844, 827-845, 832-850, 833-851, 836-854, 838-856, 840-858, 857-875, 865-883, 868-886, 870-888, 873-891, 874-892, 876-894, 877-895, 907-925, 912-930, 913-931, 916-934, 920-938, 921-939, 922-940, 924-942, 926-944, 927-945, 930-948, 939-957, 944-962, 946-964, 949-967, 950-968, 958-976, 963-981, 964-982, 968-986, 969-987, 971-989, 972-990, 977-995, 980-998, 981-999, 1004-1022, 1006-1024, 1007-1025, 1011-1029, 1012-1030, 1013-1031, 1015-1033, 1017-1035, 1018-1036, 1024-1042, 1027-1045, 1029-1047, 1050-1068, 1067-1085, 1082-1100, 1084-1102, 1086-1104, 1087-1105, 1089-1107, 1090-1108, 1091-1109, 1092-1110, 1093-1111, 1098-1116, 1100-1118, 1106-1124, 1107-1125, 1108-1126, 1167-1185, 1169-1187, 777-793, 700-716, 629-645, 615-631, 914-930, 829-845, 239-255, 326-342, 327-343, 338-354, 398-414, 588-604, 592-608, 202-218, 203-219, 204-220, 205-221, 207-223, 208-224, 210-226, 215-231, 216-232, 217-233, 218-234, 221-237, 224-240, 225-241, 226-242, 227-243, 228-244, 229-245, 231-247, 233-249, 236-252, 237-253, 239-255, 240-256, 242-258, 269-285, 276-292, 278-294, 279-295, 307-323, 308-324, 309-325, 323-339, 325-341, 327-343, 328-344, 329-345, 339-355, 379-395, 387-403, 393-409, 395-411, 397-413, 399-415, 400-416, 401-417, 402-418, 403-419, 404-420, 406-422, 407-423, 410-426, 507-523, 514-530, 581-597, 584-600, 585-601, 586-602, 588-604, 595-611, 596-612, 599-615, 617-633, 618-634, 621-637, 624-640, 636-652, 639-655, 641-657, 643-659, 645-661, 655-671, 658-674, 665-681, 668-684, 698-714, 701-717, 705-721, 706-722, 720-736, 723-739, 727-743, 729-745, 730-746, 732-748, 736-752, 738-754, 772-788, 774-790, 776-792, 777-793, 779-795, 782-798, 783-799, 784-800, 823-839, 826-842, 827-843, 832-848, 833-849, 836-852, 838-854, 840-856, 857-873, 865-881, 868-884, 870-886, 873-889, 874-890, 876-892, 877-893, 907-923, 912-928, 913-929, 916-932, 920-936, 921-937, 922-938, 924-940, 926-942, 927-943, 930-946, 939-955, 944-960, 946-962, 949-965, 950-966, 958-974, 963-979, 964-980, 968-984, 969-985, 971-987, 972-988, 977-993, 980-996, 981-997, 1004-1020, 1006-1022, 1007-1023, 1011-1027, 1012-1028, 1013-1029, 1015-1031, 1017-1033, 1018-1034, 1024-1040, 1027-1043, 1029-1045, 1050-1066, 1067-1083, 1082-1098, 1084-1100, 1086-1102, 1087-1103, 1089-1105, 1090-1106, 1091-1107, 1092-1108, 1093-1109, 1098-1114, 1100-1116, 1106-1122, 1107-1123, 1108-1124, 1167-1183 or 1169-1185 of SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 2.

[0013] In some embodiments, the antisense strand comprises at least 14, 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides which differ by 0, 1, 2, or 3 nucleotides from the complement of nucleotides 776-796, 699-719, 628-648, 614-634, 913-933, 828-848, 238-258, 325-345, 326-346, 337-357, 397-417, 587-607, 591-611, 201-221, 202-222, 203-223, 204-224, 206-226, 207-227, 209-229, 214-234, 215-235, 216-236, 217-237, 220-240, 223-243, 224-244, 225-245, 226-246, 227-247, 228-248, 230-250, 232-252, 235-255, 236-256, 238-258, 239-259, 241-261, 268-288, 275-295, 277-297, 278-298, 306-326, 307-327, 308-328, 322-342, 324-344, 326-346, 327-347, 328-348, 338-358, 378-398, 386-406, 392-412, 394-414, 396-416, 398-418, 399-419, 400-420, 401-421, 402-422, 403-423, 405-425, 406-426, 409-429, 506-526, 513-533, 580-600, 583-603, 584-604, 585-605, 587-607, 594-614, 595-615, 598-618, 616-636, 617-637, 620-640, 623-643, 635-655, 638-658, 640-660, 642-662, 644-664, 654-674, 657-677, 664-684, 667-687, 697-717, 700-720, 704-724, 705-725, 719-739, 722-742, 726-746, 728-748, 729-749, 731-751, 735-755, 737-757, 771-791, 773-793, 775-795, 776-796, 778-798, 781-801, 782-802, 783-803, 822-842, 825-845, 826-846, 831-851, 832-852, 835-855, 837-857, 839-859, 856-876, 864-884, 867-887, 869-889, 872-892, 873-893, 875-895, 876-896, 906-926, 911-931, 912-932, 915-935, 919-939, 920-940, 921-941, 923-943, 925-945, 926-946, 929-949, 938-958, 943-963, 945-965, 948-968, 949-969, 957-977, 962-982, 963-983, 967-987, 968-988, 970-990, 971-991, 976-996, 979-999, 980-1000, 1003-1023, 1005-1025, 1006-1026, 1010-1030, 1011-1031, 1012-1032, 1014-1034, 1016-1036, 1017-1037, 1023-1043, 1026-1046, 1028-1048, 1049-1069, 1066-1086, 1081-1101, 1083-1103, 1085-1105, 1086-1106, 1088-1108, 1089-1109, 1090-1110, 1091-1111, 1092-1112, 1097-1117, 1099-1119, 1105-1125, 1106-1126, 1107-1127, 1166-1186, 1168-1188, 778-796, 701-719, 630-648, 616-634, 915-933, 830-848, 240-258, 327-345, 328-346, 339-357, 399-417, 589-607, 593-611, 203-221, 204-222, 205-223, 206-224, 208-226, 209-227, 211-229, 216-234, 217-235, 218-236, 219-237, 222-240, 225-243, 226-244, 227-245, 228-246, 229-247, 230-248, 232-250, 234-252, 237-255, 238-256, 240-258, 241-259, 243-261, 270-288, 277-295, 279-297, 280-298, 308-326, 309-327, 310-328, 324-342, 326-344, 328-346, 329-347, 330-348, 340-358, 380-398, 388-406, 394-412, 396-414, 398-416, 400-418, 401-419, 402-420, 403-421, 404-422, 405-423, 407-425, 408-426, 411-429, 508-526, 515-533, 582-600, 585-603, 586-604, 587-605, 589-607, 596-614, 597-615, 600-618, 618-636, 619-637, 622-640, 625-643, 637-655, 640-658, 642-660, 644-662, 646-664, 656-674, 659-677, 666-684, 669-687, 699-717, 702-720, 706-724, 707-725, 721-739, 724-742, 728-746, 730-748, 731-749, 733-751, 737-755, 739-757, 773-791, 775-793, 777-795, 778-796, 780-798, 783-801, 784-802, 785-803, 824-842, 827-845, 828-846, 833-851, 834-852, 837-855, 839-857, 841-859, 858-876, 866-884, 869-887, 871-889, 874-892, 875-893, 877-895, 878-896, 908-926, 913-931, 914-932, 917-935, 921-939, 922-940, 923-941, 925-943, 927-945, 928-946, 931-949, 940-958, 945-963, 947-965, 950-968, 951-969, 959-977, 964-982, 965-983, 969-987, 970-988, 972-990, 973-991, 978-996, 981-999, 982-1000, 1005-1023, 1007-1025, 1008-1026, 1012-1030, 1013-1031, 1014-1032, 1016-1034, 1018-1036, 1019-1037, 1025-1043, 1028-1046, 1030-1048, 1051-1069, 1068-1086, 1083-1101, 1085-1103, 1087-1105, 1088-1106, 1090-1108, 1091-1109, 1092-1110, 1093-1111, 1094-1112, 1099-1117, 1101-1119, 1107-1125, 1108-1126, 1109-1127, 1168-1186, 1170-1188, 777-795, 700-718, 629-647, 615-633, 914-932, 829-847, 239-257, 326-344, 327-345, 338-356, 398-416, 588-606, 592-610, 202-220, 203-221, 204-222, 205-223, 207-225, 208-226, 210-228, 215-233, 216-234, 217-235, 218-236, 221-239, 224-242, 225-243, 226-244, 227-245, 228-246, 229-247, 231-249, 233-251, 236-254, 237-255, 239-257, 240-258, 242-260, 269-287, 276-294, 278-296, 279-297, 307-325, 308-326, 309-327, 323-341, 325-343, 327-345, 328-346, 329-347, 339-357, 379-397, 387-405, 393-411, 395-413, 397-415, 399-417, 400-418, 401-419, 402-420, 403-421, 404-422, 406-424, 407-425, 410-428, 507-525, 514-532, 581-599, 584-602, 585-603, 586-604, 588-606, 595-613, 596-614, 599-617, 617-635, 618-636, 621-639, 624-642, 636-654, 639-657, 641-659, 643-661, 645-663, 655-673, 658-676, 665-683, 668-686, 698-716, 701-719, 705-723, 706-724, 720-738, 723-741, 727-745, 729-747, 730-748, 732-750, 736-754, 738-756, 772-790, 774-792, 776-794, 777-795, 779-797, 782-800, 783-801, 784-802, 823-841, 826-844, 827-845, 832-850, 833-851, 836-854, 838-856, 840-858, 857-875, 865-883, 868-886, 870-888, 873-891, 874-892, 876-894, 877-895, 907-925, 912-930, 913-931, 916-934, 920-938, 921-939, 922-940, 924-942, 926-944, 927-945, 930-948, 939-957, 944-962, 946-964, 949-967, 950-968, 958-976, 963-981, 964-982, 968-986, 969-987, 971-989, 972-990, 977-995, 980-998, 981-999, 1004-1022, 1006-1024, 1007-1025, 1011-1029, 1012-1030, 1013-1031, 1015-1033, 1017-1035, 1018-1036, 1024-1042, 1027-1045, 1029-1047, 1050-1068, 1067-1085, 1082-1100, 1084-1102, 1086-1104, 1087-1105, 1089-1107, 1090-1108, 1091-1109, 1092-1110, 1093-1111, 1098-1116, 1100-1118, 1106-1124, 1107-1125, 1108-1126, 1167-1185, 1169-1187, 777-793, 700-716, 629-645, 615-631, 914-930, 829-845, 239-255, 326-342, 327-343, 338-354, 398-414, 588-604, 592-608, 202-218, 203-219, 204-220, 205-221, 207-223, 208-224, 210-226, 215-231, 216-232, 217-233, 218-234, 221-237, 224-240, 225-241, 226-242, 227-243, 228-244, 229-245, 231-247, 233-249, 236-252, 237-253, 239-255, 240-256, 242-258, 269-285, 276-292, 278-294, 279-295, 307-323, 308-324, 309-325, 323-339, 325-341, 327-343, 328-344, 329-345, 339-355, 379-395, 387-403, 393-409, 395-411, 397-413, 399-415, 400-416, 401-417, 402-418, 403-419, 404-420, 406-422, 407-423, 410-426, 507-523, 514-530, 581-597, 584-600, 585-601, 586-602, 588-604, 595-611, 596-612, 599-615, 617-633, 618-634, 621-637, 624-640, 636-652, 639-655, 641-657, 643-659, 645-661, 655-671, 658-674, 665-681, 668-684, 698-714, 701-717, 705-721, 706-722, 720-736, 723-739, 727-743, 729-745, 730-746, 732-748, 736-752, 738-754, 772-788, 774-790, 776-792, 777-793, 779-795, 782-798, 783-799, 784-800, 823-839, 826-842, 827-843, 832-848, 833-849, 836-852, 838-854, 840-856, 857-873, 865-881, 868-884, 870-886, 873-889, 874-890, 876-892, 877-893, 907-923, 912-928, 913-929, 916-932, 920-936, 921-937, 922-938, 924-940, 926-942, 927-943, 930-946, 939-955, 944-960, 946-962, 949-965, 950-966, 958-974, 963-979, 964-980, 968-984, 969-985, 971-987, 972-988, 977-993, 980-996, 981-997, 1004-1020, 1006-1022, 1007-1023, 1011-1027, 1012-1028, 1013-1029, 1015-1031, 1017-1033, 1018-1034, 1024-1040, 1027-1043, 1029-1045, 1050-1066, 1067-1083, 1082-1098, 1084-1100, 1086-1102, 1087-1103, 1089-1105, 1090-1106, 1091-1107, 1092-1108, 1093-1109, 1098-1114, 1100-1116, 1106-1122, 1107-1123, 1108-1124, 1167-1183 or 1169-1185 of SEQ ID NO: 1

[0014] In some embodiments, the dsRNA agent includes at least one modified nucleotide. In certain embodiments, all or substantially all of the nucleotides of the antisense strand are modified nucleotides. In some embodiments, all or substantially all of the nucleotides of the sense strand and the antisense strand are modified nucleotides. In some embodiments, at least one of the modified nucleotides comprises: 2’-O-methyl nucleotide, 2’-fluoro nucleotide, 2’-deoxy nucleotide, 2’3’-seco nucleotide mimic, locked nucleotide, unlocked nucleic acid nucleotide (UNA) , glycol nucleic acid nucleotide (GNA) , 2’-F-Arabino nucleotide, 2’-methoyxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted abasic nucleotide, inverted 2’-OMe nucleotide, inverted 2’-deoxy nucleotide, isomannide nucleotide, 2’-amino-modified nucleotide, 2’-alkyl-modified nucleotide, mopholino nucleotide, and 3’-OMe nucleotide, a nucleotide including a 5’-phosphorothioate group, a 5'-phosphonate modified nucleotide, a 5'-phosphate or 5'-phosphate mimic modified nucleotide, or a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a 2’-amino-modified nucleotide, a phosphoramidite, or a non-natural base including nucleotide.

[0015] In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from a 2’-O-methyl nucleotide, a 2’-fluoro nucleotide and an UNA modified nucleotide, wherein less than 6 modified nucleotides are 2’-fluoro nucleotides. In some embodiments, the antisense strand comprises 3 or 5 2’-fluoro nucleotides, preferably, the antisense strand comprises 5 2’-fluoro nucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from a 2’-O-methyl nucleotide and a 2’-fluoro nucleotide, wherein less than 4 modified nucleotides are 2’-fluoro nucleotides. In certain embodiments, the sense strand comprises 3 2’-fluoro nucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from a 2’-O-methyl nucleotide and a 2’-fluoro nucleotide, wherein at least 14 modified nucleotides are 2’-O-methyl nucleotides and the nucleotides at positions 2, 5, 7, 12, 14, 16 and / or 18 counting from the first matching position from the 5’ end of the antisense strand is independently a 2’-fluoro nucleotide. In some embodiments, the antisense strand comprises at least one UNA modified nucleotide and 5 2’-fluoro nucleotides. In some embodiments, the antisense strand comprises one UNA modified nucleotide at position 7 and 5 2’-fluoro nucleotides at positions 2, 5, 12, 14 and 16 counting from the first matching position from the 5’ end, and the rest are 2’-O-methyl nucleotides. In some embodiments, the antisense strand comprises 5 2’-fluoro nucleotides at positions 2, 5, 12, 14 and 18 counting from the first matching position from the 5’ end, and the rest are 2’-O-methyl nucleotides. In some embodiments, the antisense strand comprises 5 2’-fluoro nucleotides at positions 2, 7, 12, 14 and 16 counting from the first matching position from the 5’ end, and the rest are 2’-O-methyl nucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from a 2’-O-methyl nucleotide and a 2’-fluoro nucleotide. In some embodiments, at least 18 modified nucleotides are 2’-O-methyl nucleotides and the nucleotides at positions 9, 11 and / or 13 counting from the first matching position from the 3’ end of the sense strand are 2’-fluoro nucleotides. In some embodiments, at least 18 modified nucleotides are 2’-O-methyl nucleotides and the nucleotides at positions 8, 11 and / or 13 counting from the first matching position from the 3’ end of the sense strand are 2’-fluoro nucleotides.

[0016] In some embodiments, the dsRNA agent further comprises a phosphate or phosphate mimic. In some embodiments, the dsRNA agent comprises one or more nucleotides modified with a 5’-phosphate or 5’-phosphate mimic. In some embodiments, the phosphate mimic is a 5'-vinyl phosphonate (VP) . In some embodiments, the nucleotide modified with a 5’-phosphate or 5’-phosphate mimic is introduced at the 5’-end of the antisense strand.

[0017] In some embodiments, the phosphate mimic of the 5'-terminal nucleotide has a fragment represented by the following formula:

[0018] wherein: Q8 is O, S, SO, SO2, PR16R17 or NR11; R16 and R17 are independently selected from (=O) , (=S) , OH, SH, C1-C6 alkyl and NR18R19;

[0019] Ra and Rc are each independently selected from hydroxyl or protected hydroxyl, sulfhydryl or protected sulfhydryl, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, protected or optional substituted amino, natural or modified nucleosides; and Rb is O or S or NR12, R12 is hydrogen, C1-C6 alkyl and amino protecting group;

[0020] the substituents in the substituted amino group are selected from: optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, sulfinyl, sulfonyl and acetyl;

[0021] R11, R18 and R19 are independently selected from H, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, methanesulfonyl and sulfonic acid group;

[0022] each substituted group comprises one or more optional substituent groups independently selected from: halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylsulfhydryl and CN;

[0023] indicates the bond attached to fragment of the 5'-terminal nucleotide. In certain embodiments, Q8 is bonded to 4'-carbon or 5'-carbon of the sugar or sugar surrogate moiety of the 5'-terminal nucleotide.

[0024] In some embodiments, the dsRNA agent includes an E-vinylphosphonate nucleotide at the 5 end of the guide strand.

[0025] In some embodiments, the dsRNA agent includes a 5'-phosphate mimic nucleotide represented by formula (VIII) or their stereoisomers or racemates at the 5 -end of the guide strand:

[0026] wherein: Q8 is O, S, SO, SO2, PR16R17 or NR11; R16 and R17 are independently (=O) , (=S) , OH, SH, C1-C6 alkyl, NR18R19; Ra and Rc are each independently selected from hydroxyl or protected hydroxyl, sulfhydryl or protected sulfhydryl, optionally substituted C1-C6 alkyl , optionally substituted C1-C6 alkoxy , protected or optionally substituted amino, natural or modified nucleosides; and Rb is O or S or NR12, R12 is hydrogen, C1-C6 alkyl, amino protecting group;

[0027] Q1 and Q2 are each independently H, halogen, -CN, optionally substituted C1-C6 alkyl;

[0028] the substituents in the substituted amino group are selected from: optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, sulfinyl, sulfonyl, acetyl;

[0029] R11, R18 and R19 are independently H, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, methanesulfonyl, and sulfonic acid group;

[0030] Z is a nucleoside containing a sugar or a sugar surrogate moiety;

[0031] T3 is an internucleotide linking group connecting the 5'-terminal nucleotide of formula (VIII) or its stereoisomer to the existing guide strand;

[0032] each substituted group comprises one or more substituent groups optionally independently selected from: halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylsulfhydryl, CN.

[0033] In a particular embodiments, Q8 in formula (VIII) is S, SO or SO2. In a particular embodiment, Q1 and Q2 in formula (VIII) are each independently H. In a particular embodiment, the sugar or sugar surrogate moiety in formula (VIII) includes a 5 membered furanose ring, a non-furanose ring or 5-6 membered carbocyclic system or open system. In a particular embodiment, the sugar-substituted moiety in Formula (VIII) is selected from morpholinyl, cyclohexenyl, cyclohexyl, cyclopentyl, pyranyl or cyclohexanol. In a particular embodiment, the sugar moiety in Formula (VIII) is a furanose. In a particular embodiment, the sugar or sugar surrogate moiety in Formula (VIII) includes an unlocked nucleobase analog (UNA) or a glycerol nucleobase analog (GNA) . In a particular embodiment, the sugar or sugar surrogate moiety in Formula (VIII) include locked nucleic acid (LNA) or bridged nucleic acid (BNA) . In a particular embodiment, Q8 in formula (VIII) is bonded to the 4'-carbon or 5'-carbon of the sugar or sugar surrogate moiety. In particular embodiment, Rb in formula (VIII) is oxygen. In a particular embodiment, Ra and Rc in formula (VIII) are each independently selected from OH, SH, NH2 or NHSO2CH3.

[0034] In some embodiments, the dsRNA agent includes a 5'-phosphate mimic modified nucleotide at the 5′-end of the guide strand, wherein the 5'-phosphate mimic modified nucleotide is any one of the following structures or their stereoisomers or racemates:

[0035] Phos-16*, or their stereoisomers or racemates,

[0036] represents the bond connecting to the 5 -end of the existing guide strand.

[0037] In certain embodiments, a internucleotide linking group is independently selected from a phosphodiester linking group, a phosphotriester linking group , or a phosphorothioate linking group, phosphorodithioate linking group , alkylphosphonate linking group, aminophosphonate linking group , phosphonate linking group , phosphinate linking group , phosphorothioamidate linking group or phosphoramidate linking groups. To illustrate a 5'-phosphate mimic modified nucleotide with phosphodiester linking group, a non-limiting example is Phos-15-1*has the structure

[0038] In some embodiments, the dsRNA agent includes at least one modified nucleotide and further includes one or more targeting groups or linking groups. In some embodiments, the one or more targeting ligands are independently selected from the group comprising small molecules, lipids and lipid derivatives, peptides, aptamers, polysaccharides, protein ligands, nanobodies and antibodies. In some embodiments, the one or more targeting groups or linking groups target a receptor which mediates delivery to a CNS tissue or a liver tissue, e.g., a hydrophilic ligand. In some embodiments, the one or more targeting groups or linking group targets a brain tissue or a spinal tissue, e.g., the striatum or a dorsal root ganglion. In some embodiments, the one or more targeting groups or linking groups are conjugated to the sense strand. In certain embodiments, the dsRNA agent includes a targeting group that is conjugated to the 5’-terminal end of the sense strand. In some embodiments, the dsRNA agent includes a targeting group that is conjugated to the 3'-terminal end of the sense strand. In some embodiments, the targeting group or linking group includes N-acetyl-galactosamine (GalNAc) . In some embodiments, the targeting group has a structure as Formula (X) :

[0039] Each n” is independently selected from 1 or 2.

[0040] In some embodiments, the targeting group has a structure:

[0041] In some embodiments, the dsRNA agent includes a targeting group that is conjugated to the 5’-terminal end of the sense strand, preferably, the targeting group is any one selected from aforesaid GLO-1 through GLO-16 and GLS-1*through GLS-16*, more preferably, the targeting group is aforesaid GLS-15*.

[0042] In some embodiments, one or more lipophilic moieties are conjugated to one or more terminal or internal positions on at least one strand. In some embodiments, the one or more lipophilic moieties are conjugated to one or more internal positions on at least one strand via a linker or carrier. In some embodiments, the internal positions include all positions except the terminal two positions from each end of the at least one strand. In some embodiments, the internal positions include all positions except the terminal three positions from each end of the at least one strand. In some embodiments, the internal positions exclude a cleavage site region of the sense strand. In some embodiments, the internal positions include all positions except positions 9-11, counting from the first matching position from the 3'-end of the sense strand. I some embodiments, the internal positions include all positions except positions 11-13, counting the first matching position from the 3'-end of the sense strand. In some embodiments, the internal positions exclude a cleavage site region of the sense strand. In some embodiments, the internal positions exclude a cleavage site region of the antisense strand. In some embodiments, the internal positions include all positions except positions 12-14, counting from the 5'-end of the antisense strand. In some embodiments, the internal positions include all positions except positions 11-13 on the sense strand, counting from the 3'-end, and positions 12-14 on the antisense strand, counting from the 5'-end (both from the first matching position) .

[0043] In some embodiments, the lipophilic moiety is an aliphatic, alicyclic, or polyalicyclic compound. In some embodiments, the lipophilic moiety is selected from the group consisting of lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1, 3-bis-O (hexadecyl) glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1, 3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl) lithocholic acid, O3- (oleoyl) cholenic acid, dimethoxytrityl, or phenoxazine. In some embodiments, the lipophilic moiety contains a saturated or unsaturated C4-C30 hydrocarbon chain, and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne. In some embodiments, the lipophilic moiety contains a saturated or unsaturated C6-C18 hydrocarbon chain. In some embodiments, the lipophilic moiety contains a saturated or unsaturated C16 hydrocarbon chain.

[0044] In some embodiments, the lipophilic moiety is conjugated via a carrier that replaces one or more nucleotide (s) in the internal position (s) or the double stranded region. In some embodiments, the carrier is a cyclic group selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1, 3] dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl; or is an acyclic moiety based on a serinol backbone or a diethanolamine backbone.

[0045] In some embodiments, the lipophilic moiety is conjugated to the double-stranded RNAi agent via a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide linkage, a product of a click reaction, or carbamate. In some embodiments, the lipophilic moiety is conjugated to a nucleobase, sugar moiety, or internucleoside linkage. In some embodiments, the lipophilic moiety or targeting ligand is conjugated via a bio-cleavable linker selected from the group consisting of DNA, RNA, disulfide, amide, functionalized monosaccharides or oligosaccharides of galactosamine, glucosamine, glucose, galactose, mannose, and combinations thereof.

[0046] In some embodiments, the antisense strand includes one inverted abasic residue (invab) at 3’-terminal end. In certain embodiments, the sense strand includes one or two inverted abasic residues and / or one or two imann residues at 3’ or / and 5’ terminal end. In certain embodiments, each end of the sense strand includes one inverted abasic residue respectively. In certain embodiments, each end of the sense strand includes one imann residue respectively. In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand includes a 3’ overhang of at least 1 nucleotide. In some embodiments, at least one strand includes a 3’ overhang of at least 2 nucleotides.

[0047] In certain embodiments, the antisense strand includes one inverted abasic residue at 3’-terminal end. In certain embodiments, the sense strand includes one or two inverted abasic residues and / or one or two imann residues at 3’ or / and 5’ terminal end. In certain embodiments, each 3’ and 5’ terminal end of the sense strand independently includes an inverted abasic residue. In certain embodiments, each 3’ and 5’ terminal end of the sense strand independently includes an imann residue. In certain embodiments, the sense strand includes two inverted abasic residues at 3’ and 5’ terminal end and either residue at 3’ or 5’ terminal end is further conjugated to a targeting group, which preferably is aforesaid GLS-15*. In certain embodiments, the sense strand includes one inverted abasic residue at 3’-terminal end and 5’-terminal end is further conjugated to a targeting group, which preferably is aforesaid GLS-15*. In certain embodiments, the sense strand includes two imann residues at 3’ and 5’ terminal end and either residue at 3’ or 5’ terminal end is further conjugated to a targeting group, which preferably is aforesaid GLS-15*.

[0048] In some embodiments, at least one linkage of the sense strand and / or the antisense strand is a phosphodiester (PO) linkage. In some embodiments, at least one linkage of the sense strand and / or the antisense strand is a modified linkage. In some embodiments, at least one linkage of the sense strand and / or the antisense strand is a phosphorothioate (PS) linkage. In some embodiments, the dsRNA agent includes at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand includes at least one phosphorothioate internucleoside linkage. In some embodiments, the antisense strand includes at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand includes 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages. In some embodiments, the antisense strand includes 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages. In some embodiments, at least one phosphorothioate (PS) linkage is introduced at the 5’-end, 3’-end or both ends of the sense strand and / or the antisense strand. In some embodiments, 1, 2, 3, 4, 5, or 6 phosphorothioate (PS) linkages are introduced at the 5’-end, 3’-end or both ends of the sense strand and / or the antisense strand independently. In some embodiments, the 5' end of antisense strand includes 2 phosphorothioate internucleoside linkages. In some embodiments, the 3' end of antisense strand includes 2 phosphorothioate internucleoside linkages. In some embodiments, the 5' end of antisense strand and 3' end of antisense strand independently includes 2 phosphorothioate internucleoside linkages. In some embodiments, at least the terminal two modified or unmodified nucleotides at one end or both ends of the antisense strand are linked through phosphorothioate linkages. In some embodiments, the terminal three modified or unmodified nucleotides at one end or both ends of the antisense strand are linked through phosphorothioate linkages. In some embodiments, at least the terminal two modified or unmodified nucleotides at one end or both ends of the sense strand are linked through phosphorothioate linkages. In some embodiments, the terminal three modified or unmodified nucleotides at one end or both ends of the sense strand are linked through phosphorothioate linkages. In some embodiments, the terminal three modified or unmodified nucleotides at 5’ end of the sense strand are linked through phosphorothioate linkages and the terminal two modified or unmodified nucleotides at 3’ end of the sense strand are linked through phosphorothioate linkages. In some embodiments, one or more inverted abasic residues or one or more imann residues conjugate to either end or both ends of the sense strand via phosphorothioate linkages. In some embodiments, the targeting group further conjugates to either end of the sense strand via a phosphorothioate linkage. In some embodiments, the targeting group further conjugates to 5’-end of the sense strand via a phosphorothioate linkage.

[0049] In some embodiments, the sense strand sequence of the SNCA dsRNA agent of this invention may be represented by formula (I) :

[0050] 5′- (N′L) n′N′LN′L N′N1 N′N2 N′N3 N′N4 N′L N′F N′L N′N5N′N6 N′L N′L N′L (N′L) m′-3′ (I)

[0051] wherein:

[0052] each N′F represents a 2'-fluoro-modified nucleotide; each N′N1, N′N2, N′N3, N′N4, N′N5, and N′N6 independently represents a modified or unmodified nucleotide; each N′L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and m′and n′are each independently an integer of 0 to 7.

[0053] In some embodiments, the modified nucleotide is a modified nucleotide defined above.

[0054] In some embodiments, the modified nucleotide is a 2’-OMe modified nucleotide or a 2’-F modified nucleotide.

[0055] In some embodiments, N′N1 and N′N3 each independently represents a 2'-fluoro-modified nucleotide.

[0056] In some embodiments, N′N4 and N′N5 each independently represents a 2'-fluoro-modified nucleotide.

[0057] In some embodiments, N′N2 and N′N4 each independently represents a 2'-fluoro-modified nucleotide.

[0058] In some embodiments, m′ is 1 and n′ is 3, or m′ is 1 and n′ is 4, or m′ is 1 and n′ is 5.

[0059] In some embodiments, m′ is 4 and n′ is 3.

[0060] In some embodiments, m′ is 2 and n′ is 3, or m′ is 2 and n′ is 4, or m′ is 2 and n′ is 5.

[0061] In some embodiments, N′N4 and N′N5 each independently represents a 2'-fluoro-modified nucleotide, m’ is 2 and each N′L, N′N1, N′N2, N′N3, and N′N6 independently represents a 2’-O-methyl nucleotide.

[0062] In some embodiments, N′N2 and N′N4 each independently represents a 2'-fluoro-modified nucleotide, m’ is 4 and each N′L, N′N1, N′N3, N′N5, and N′N6 independently represents a 2’-O-methyl nucleotide.

[0063] In some embodiments, the antisense strand sequence of the SNCA dsRNA agent of this invention may be independently represented by formula (II) :

[0064] 3′- (NL) n NM1 NL NM2 NL NF NL NM3 NM9 NM4 NL NM5 NM6 NL NM7 NM8 NL NF NZ-5′ (II)

[0065] wherein:

[0066] each NF represents a 2'-fluoro-modified nucleotide; each NM1, NM2, NM3, NM4, NM5, NM6, NM7, NM8 and NM9 independently represents a modified or unmodified nucleotide; each of NL and NZ independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide; and n is an integer of 0 to 7.

[0067] In some embodiments, the modified nucleotide is a modified nucleotide defined above.

[0068] In some embodiments, the modified nucleotide is a 2’-OMe modified nucleotide, a 2’-F modified nucleotide, an UNA modified nucleotide or a nucleotide comprising phosphate mimic.

[0069] In some embodiments, NM1, NM3 and NM7 each independently represents a 2'-fluoro-modified nucleotide.

[0070] In some embodiments, NM2, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide.

[0071] In some embodiments, NM2, NM3 and NM7 each independently represents a 2'-fluoro-modified nucleotide and NM6 represents an UNA modified nucleotide;

[0072] In some embodiments, NM2, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide, and each NM1, NM4, NM5, NM7, NM8 and NL independently represents a 2’-O-methyl nucleotide.

[0073] In some embodiments, NM2, NM3 and NM7 each independently represents a 2'-fluoro-modified nucleotide and NM6 represents an UNA modified nucleotide, and each NM1, NM4, NM5, NM8 and NL independently represents a 2’-O-methyl nucleotide.

[0074] In some embodiments, NZ represents a 5'-phosphonate modified nucleotide.

[0075] In some embodiments, NZ is a vinyl phosphonate modified nucleotide.

[0076] In some embodiments, NZ is Vpu*, which has the structure

[0077] In some embodiments, NZ is selected from the group consisting of or their stereoisomers or racemates.

[0078] In some embodiments, n is 1, or n is 2, or n is 3.

[0079] In some embodiments, the SNCA dsRNA duplex of this invention may be represented by formula (III) , and the region of complementarity comprises at least 15 contiguous nucleotides, wherein,

[0080] sense: 5′- (N′L) n′N′LN′L N′N1 N′N2 N′N3 N′N4 N′L N′F N′L N′N5N′N6 N′L N′L N′L (N′L) m′-3′

[0081] antisense: 3′- (NL) n NM1 NL NM2 NL NF NL NM3 NM9 NM4 NL NM5 NM6 NL NM7 NM8 NL NF Nz-5′

[0082] (III)

[0083] wherein:

[0084] each strand is about 17 to about 30 nucleotides in length;

[0085] each NF and N′F independently represents a 2'-fluoro-modified nucleotide; NM1, NM2, NM3, NM4, NM5, NM6, NM7, NM8, NM9, N′N1, N′N2, N′N3, N′N4, N′N5, and N′N6 each independently represents a modified or unmodified nucleotide; each Nz, NL and N′L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and m′, n′and n are each independently an integer of 0 to 7.

[0086] In some embodiments, the modified nucleotide is a modified nucleotide defined above.

[0087] In some embodiments, the modified nucleotide is a 2’-OMe modified nucleotide, a 2’-F modified nucleotide, an UNA modified nucleotide or a nucleotide comprising phosphate mimic.

[0088] In some embodiments, each N′N1, N′N2, N′N3, N′N4, N′N5, and N′N6 independently represents a 2'-fluoro-modified nucleotide or a 2'-O-methyl nucleotide.

[0089] In some embodiments, each N′L and NL independently represents a 2'-O-methyl nucleotide.

[0090] In some embodiments, each NM1, NM2, NM3, NM4, NM5, NM6, NM7, NM8, NM9 and NZ independently represents a 2'-fluoro-modified nucleotide, a 2’-O-methyl nucleotide, an UNA modified nucleotide or a nucleotide comprising phosphate mimic.

[0091] In some embodiments, N′N1 and N′N3 each independently represents a 2'-fluoro-modified nucleotide.

[0092] In some embodiments, N′N2 and N′N4 each independently represents a 2'-fluoro-modified nucleotide.

[0093] In some embodiments, N′N4 and N′N5 each independently represents a 2'-fluoro-modified nucleotide.

[0094] In some embodiments, NM1, NM3 and NM7 each independently represents a 2'-fluoro-modified nucleotide.

[0095] In some embodiments, NM2, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide; in certain embodiment, NM2, NM3 and NM6 are all 2'-fluoro-modified nucleotides.

[0096] In some embodiments, NM2, NM3 and NM7 each independently represents a 2'-fluoro-modified nucleotide and NM6 represents an UNA modified nucleotide.

[0097] In some embodiments, NM2, NM6 and NM9 each independently represents a 2'-fluoro-modified nucleotide.

[0098] In some embodiments, NM2, NM7 and NM9 each independently represents a 2'-fluoro-modified nucleotide and NM6 represents an UNA modified nucleotide.

[0099] In some embodiments, NZ represents a 5'-phosphonate modified nucleotide.

[0100] In some embodiments, NZ is a vinyl phosphonate modified nucleotide.

[0101] In some embodiments, NZ is Vpu*, which has the structure

[0102] In some embodiments, NZ is selected from the group consisting of or their stereoisomers or racemates.

[0103] In some embodiments, n′ is 1 and m′ is 2, n′ is 2 and m′ is 2, or n′ is 1 and m′ is 4, or n′ is 3 and m′ is 2, or n′ is 3 and m′ is 4, or n′ is 4 and m′ is 2, or n′ is 5 and m′ is 2, or m′ is 1 and n′ is 3, or m′ is 1 and n′ is 4, or m′ is 1 and n′ is 5.

[0104] In some embodiments, n is 1, or n is 2, or n is 3.

[0105] In some embodiments of Formula (II) or (III) , the antisense strand includes one inverted abasic residue at 3’-terminal end. In some embodiments of Formula (I) or (III) , the sense strand includes one or two inverted abasic residues and / or one or two imann residues at 3’ or / and 5’ terminal end. In certain embodiments, each 3’ and 5’ terminal end of the sense strand independently includes an inverted abasic residue. In some embodiments of Formula (I) or (III) , 3’ terminal end of the sense strand independently includes an inverted abasic residue. In some embodiments of Formula (I) or (III) , each 3’ and 5’ terminal end of the sense strand independently includes an imann residue. In some embodiments of Formula (I) or (III) , the sense strand includes one inverted abasic residues at 3’ terminal end and 5’ terminal end is further conjugated to a targeting group which mediates delivery to a CNS tissue or a liver tissue, e.g., a hydrophilic ligand, which optionally is aforesaid GLS-15*. In some embodiments of Formula (I) or (III) , the sense strand includes one inverted abasic residues at 3’ and 5’ terminal end respectively and either residue at 3’ or 5’ terminal end is further conjugated to a targeting group which mediates delivery to a CNS tissue or a liver tissue, e.g., a hydrophilic ligand, which optionally is aforesaid GLS-15*. In some embodiments of Formula (I) or (III) , the sense strand includes one imann residues at 3’ and 5’ terminal end respectively and either residue at 3’ or 5’ terminal end is further conjugated to a targeting group which mediates delivery to a CNS tissue or a liver tissue, e.g., a hydrophilic ligand, which optionally is aforesaid GLS-15*. In certain embodiments, the aforesaid dsRNA agent has two blunt ends. In certain embodiments of Formula (I) , (II) or (III) , at least one strand includes a 3’ overhang of at least 1 nucleotide. In certain embodiments of Formula (I) , (II) or (III) , at least one strand includes a 3’ overhang of at least 2 nucleotides.

[0106] In some embodiments of Formula (I) , (II) or (III) , NM1, NM2, NM3, NM4, NM5, NM6, NM7, NM8, NM9, N′N1, N′N2, N′N3, N′N4, N′N5, N′N6, N′L, NL and Nz each independently is linked to a neighboring nucleotide via phosphodiester (PO) linkage. In some embodiments of Formula (I) , (II) or (III) , at least one of NM1, NM2, NM3, NM4, NM5, NM6, NM7, NM8, NM9, N′N1, N′N2, N′N3, N′N4, N′N5, N′N6, N′L, NL and Nz is linked to a neighboring nucleotide via phosphorothioate (PS) linkage. In some embodiments of aforesaid Formula (I) , (II) or (III) further includes inverted abasic residues, imann residues and / or targeting groups, and the linkage within positions 1-10 of the termini positions of each end of the strand independently comprises 1, 2, 3, 4, 5 or 6 phosphorothioate (PS) linkages. In some embodiments of aforesaid Formula (I) , (II) or (III) including inverted abasic residues, imann residues and / or targeting groups, the linkage within positions 1-5 of the termini positions of each end of the strand independently comprises 1, 2 or 3 phosphorothioate (PS) linkages. In some embodiments of aforesaid Formula (I) , (II) or (III) including inverted abasic residues, imann residues and / or targeting groups, the linkage within positions 1-3 of the termini positions of each end of the strand independently comprises 1 or 2 phosphorothioate (PS) linkages.

[0107] In some embodiments, any one of the sense strands in Table 1 may further be modified in a pattern shown in aforesaid Formula (I) or (III) .

[0108] In some embodiments, any one of the antisense strands in Table 1 may further be modified in a pattern shown in aforesaid Formula (II) or (III) .

[0109] In some embodiments, any one of the duplexes in Table 1 may further be modified in a pattern shown in aforesaid Formula (III) .

[0110] In some embodiments, the antisense strand of the dsRNA agent is independently 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the sense strand of the dsRNA agent is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. In some embodiments, the sense strand and the antisense strand are both 23 nucleotides in length. In some embodiments, the sense strand and the antisense strand are both 21 nucleotides in length.

[0111] In some embodiments of aforesaid dsRNA agents, the SNCA mRNA transcript is SEQ ID NO: 1.

[0112] In some embodiments, the dsRNA agent targets a corresponding portion of a SNCA mRNA transcript disclosed in Table 1 and / or the target region of SNCA mRNA transcript described above.

[0113] In some embodiments of aforesaid dsRNA agents, the region of complementarity to part of an mRNA encoding SNCA comprises at least 15, 16, 17, 18 or 19 contiguous nucleotides differing by no more than 0, 1, 2, or 3 nucleotides from the complement of any one of the aforesaid target regions of SNCA mRNA transcript.

[0114] In some embodiments, the dsRNA agent including a sense strand and an antisense strand, nucleotide positions 2 to 18 in the antisense strand including a region of complementarity to a SNCA mRNA transcript of at least 15, 16 or 17 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally including one or more targeting ligand.

[0115] In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to part of an mRNA encoding SNCA which comprises at least 15, 16, 17, 18 or 19 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from any one of the antisense sequences listed in any one of Tables 1-3. In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to part of an mRNA encoding SNCA which comprises at least 15, 16, 17, 18 or 19 contiguous nucleotides from any one of the antisense sequences listed in any one of Tables 1-3.

[0116] In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any one of the target regions of SEQ ID NO: 1, and preferably is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent is fully complementary to any one of the target regions of SEQ ID NO: 1, and preferably is provided in any one of Tables 1-3. In some embodiments, the dsRNA agent includes a sense strand sequence set forth in any one of Tables 1-3, wherein the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In certain embodiments, the dsRNA agent includes a sense strand sequence set forth in any one of Tables 1-3, wherein the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent includes an antisense strand sequence set forth in any one of Tables 1-3. In some embodiments, the dsRNA agent includes the sequences set forth as a duplex sequence in any of Tables 1-3.

[0117] In some embodiments, the modified sense strand has a modification pattern set forth in any one of Tables 2-3. In some embodiments, the modified antisense strand has a modification pattern set forth in any one of Tables 2-3. In some embodiments, the modified sense strand is a modified sense strand sequence set forth in one of Tables 2-3. In some embodiments, the modified antisense strand is a modified antisense strand sequence set forth in one of Tables 2-3.

[0118] According to an aspect of the invention, a composition is provided that includes any embodiment of the aforementioned dsRNA agent aspect of the invention. In certain embodiments, the composition also includes a pharmaceutically acceptable carrier. In some embodiments, the composition also includes one or more additional therapeutic agents. In certain embodiments, the composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial. In some embodiments, the composition is formulated for subcutaneous administration, is formulated for intrathecal administration, is formulated for intracranial administration, is formulated for intraventricular administration, is formulated for intracerebral administration or is formulated for intravenous (IV) administration.

[0119] According to another aspect of the invention a cell is provided that includes any embodiment of an aforementioned dsRNA agent aspect of the invention. In some embodiments, the cell is a mammalian cell, optionally a human cell. In some embodiments, the cell is a neuron (e.g., primary sensory neuron) .

[0120] According to another aspect of the invention, a method of inhibiting the expression of a SNCA gene in a cell, is provided, the method including: (i) preparing a cell including an effective amount of any embodiment of the aforementioned dsRNA agent aspect of the invention or any embodiment of an aforementioned composition of the invention. In certain embodiments, the method also includes: (ii) maintaining the prepared cell for a time sufficient to obtain degradation of the mRNA transcript of a SNCA gene, thereby inhibiting expression of the SNCA gene in the cell. In some embodiments, the cell is in a subject and the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the cell is in a subject and the dsRNA agent is administered to the subject by IV administration. In some embodiments, the cell is in a subject and the dsRNA agent is administered to the subject intracranially or intrathecally. In some embodiments, the cell is in a subject and the dsRNA agent is administered to the subject intrathecally, intraventricularly, or intracerebrally. In certain embodiments, the method also includes assessing inhibition of the SNCA gene, following the administration of the dsRNA agent to the subject, wherein a means for the assessing comprises: (i) determining one or more physiological characteristics of a SNCA-associated disease or condition in the subject and (ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the SNCA-associated disease or condition and / or to a control physiological characteristic of the SNCA-associated disease or condition, wherein the comparison indicates one or more of a presence or absence of inhibition of expression of the SNCA gene in the subject. In some embodiments, the physiological characteristic is one or more of: SNCA mRNA, α-synuclein protein, or the level of another parameter functionally linked to the level of expression of SNCA. A reduction in the expression of SNCA may also be assessed indirectly by measuring a decrease in biological activity of SNCA, e.g., a decrease in one or more of: SNCA mRNA, α-synuclein protein, or the level of another parameter functionally linked to the level of expression of SNCA, etc.

[0121] Another aspect of the instant disclosure provides a method for identifying a subject as having or at risk of developing a disease or disorder characterized by enlarged endosomes in neuronal cells and selecting a treatment for the subject, the method involving: a) obtaining a nucleic acid sample from the subject; b) identifying the subject as having a mutation in synuclein alpha (SNCA) associated with enlargement of endosomes in neuronal cells having the SNCA mutation; and c) selecting an synuclein alpha (SNCA) -targeting double stranded ribonucleic acid inhibitory (dsRNAi) agent for administration to the subject in an amount sufficient to reduce SNCA levels in neuronal cells of the subject, thereby identifying the subject as having or at risk of developing a disease or disorder characterized by enlarged endosomes in neuronal cells and selecting a treatment for the subject.

[0122] According to another aspect of the invention, a method of inhibiting expression of a SNCA gene in a subject, is provided, the method including administering to the subject an effective amount of an embodiment of the aforementioned dsRNA agent aspect of the invention or an embodiment of an aforementioned composition of the invention. In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In certain embodiments, the dsRNA agent is administered to the subject by IV administration. In some embodiments, the dsRNA agent is administered to the subject intracranially, intrathecally, intraventricularly, or intracerebrally. In some embodiments, the method also includes: assessing inhibition of the SNCA gene, following the administration of the dsRNA agent, wherein a means for the assessing comprises: (i) determining one or more physiological characteristics of a SNCA-associated disease or condition in the subject and (ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the SNCA-associated disease or condition and / or to a control physiological characteristic of the SNCA-associated disease or condition, wherein the comparison indicates one or more of a presence or absence of inhibition of expression of the SNCA gene in the subject. In some embodiments, expression of the SNCA gene can be assessed based on the level or change in level of any variable associated with SNCA gene expression, such as SNCA mRNA, α-synuclein protein, or the level of another parameter functionally linked to the level of expression of SNCA. A reduction in the expression of SNCA may also be assessed indirectly by clinical synucleinopathy characteristics, such as a chronic and progressive decline in motor, cognitive, behavioral, and autonomic functions, depending on the distribution of the lesions in the brain, etc.

[0123] According to another aspect of the invention, a method of treating a disease or condition associated with the presence of SNCA protein is provided, the method including: administering to a subject an effective amount of an embodiment of any aforementioned dsRNA agent aspect of the invention or an embodiment of any aforementioned composition of the invention, to inhibit SNCA gene expression. In some embodiments, the disease or condition is a SNCA-associated disease. In some embodiments, the disease or condition is a synucleinopathy. In some embodiments, the disease, disorder or condition associated with SNCA is selected from the group consisting of: Parkinson’s Disease (PD) , multisystemic atrophy (MSA) , Lewy Body Dementia (LBD) , pure Autonomic Failure (PAF) , Pick's disease, progressive supranuclear palsy, dementia pugilistica, chromosome 17-related parkinsonism, Lytico-Bodig disease, tangle predominant dementia, Argyrophilic grain disease, silver-philic granulosis, gangliocytoma, meningioma, subacute sclerotic encephalitis, lead-poisoning encephalopathy, tuberous sclerosis, hallervorden-Spatz disease, lipofuscin deposition, corticobasal degeneration, frontotemporal dementia, frontotemporal lobar degeneration, Alzheimer's disease, Huntington's disease, Down's syndrome, psychosis, schizophrenia, and / or Crottzfeldt-Jab disease, or other disorders related to SNCA expression.

[0124] In some embodiments, the method also includes: administering an additional therapeutic regimen to the subject. In some embodiments, the additional therapeutic regimen includes a treatment for the SNCA-associated disease or condition. In certain embodiments, the additional therapeutic regimen comprises: administering to the subject one or more SNCA antisense polynucleotides of the invention, administering to the subject a non-SNCA dsRNA therapeutic agent, and a behavioral modification in the subject. In some embodiments, the additional therapeutic regimen is selected from the classes of: antipruritics, astringents, local anesthetics, anti-inflammatory agents, cholinesterase inhibitors, muscarinic agonists, antioxidants or anti-inflammatories. In some embodiments, the additional therapeutic regimen is one or more of: carbidopa-levodopa, levodopa, entacopone, tolcapone, opicapone, pramipexole, ropinirole, apomorphine, rotigotine, selegiline, rasagiline, safinamide, amantadine, istradefylline, trihexyphenidyl, benztropine, rivastigmine, donepezil, galantamine, acetyl-L-carnitine, vinpocetine, huperzine A, alpha lipoic acid, vitamin E, rhodiola, biotin, galantamine (Reminyl) , tacrine (Cognex) , selegiline, physostigmine, revistigmin, donepezil, (Aricept) , rivastigmine (Exelon) , metrifonate, milameline, xanomeline, saeluzole, idebenone, ENA-713, mermic, quetiapine, neurestrol, idebenone, propentofylline, and neuromidal and memantine, as well as physical, occupational and speech therapy, an exercise program including cardiorespiratory, resistance, flexibility, and gait and balance exercises, and deep brain stimulation (DBS) involving the implantation of an electrode into a targeted area of the brain. In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In certain embodiments, the dsRNA agent is administered to the subject by IV administration. In some embodiments, the dsRNA agent is administered to the subject intracranially, intrathecally, intraventricularly, or intracerebrally. By intrathecally administering the bifilar RNAi agent, the method can reduce expression of the SNCA target gene in brain (e.g., striatum) or spinal tissues, such as cortex, cerebellum, cervical, lumbar and thoracic vertebrae. In some embodiments, the dsRNA agent and the non-SNCA dsRNA therapeutic agents may be administered at the same time and / or in the same combination or the non-SNCA dsRNA therapeutic agents can be administered as part of a separate composition or at separate times and / or by another method known in the art or described herein. In some embodiments, the method also includes determining an efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject. In some embodiments, a means of determining an efficacy of the treatment in the subject comprises: (i) determining one or more physiological characteristics of the SNCA-associated disease or condition in the subject and (ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the SNCA-associated disease or condition wherein the comparison indicates one or more of a presence, absence, and level of efficacy of the administration of the double-stranded ribonucleic acid (dsRNA) agent to the subject. In some embodiments, expression of the SNCA gene can be assessed based on the level or change in level of any variable associated with SNCA gene expression, such as SNCA mRNA, α-synuclein protein, or the level of another parameter functionally linked to the level of expression of SNCA, etc.

[0125] According to another aspect of the invention, a method of decreasing a level of SNCA protein in a subject compared to a baseline pre-treatment level of SNCA protein in the subject, is provided, the method including administering to the subject an effective amount of an embodiment of any aforementioned dsRNA agent of the invention or an embodiment of any aforementioned composition of the invention, to decrease the level of SNCA gene expression. In some embodiments, the dsRNA agent is administered to the subject subcutaneously, or is administered to the subject intracranially, intrathecally, intraventricularly, or intracerebrally, or is administered to the subject by IV administration. By intrathecally administering the bifilar RNAi agent, the method can reduce expression of the SNCA target gene in brain (e.g., striatum) or spinal tissues, such as cortex, cerebellum, cervical, lumbar and thoracic vertebrae.

[0126] According to another aspect of the invention, a method of altering a physiological characteristic of a SNCA-associated disease or condition in a subject compared to a baseline pre-treatment physiological characteristic of the SNCA-associated disease or condition in the subject is provided, the method including administering to the subject an effective amount of an embodiment of any aforementioned dsRNA agent of the invention or an embodiment of any aforementioned composition of the invention, to alter the physiological characteristic of the SNCA-associated disease or condition in the subject. In some embodiments, the dsRNA agent is administered to the subject subcutaneously, is administered to the subject intracranially, intrathecally, intraventricularly, or intracerebrally or is administered to the subject by IV administration. In certain embodiments, the physiological characteristic is one or more of: SNCA mRNA, α-synuclein protein, or the level of another parameter functionally linked to the level of expression of SNCA in the subject, etc.

[0127] According to another aspect of the invention, the aforementioned dsRNA agent for use in a method of treating a disease or condition associated with the presence of SNCA protein is provided. In some embodiments, the disease or condition is a SNCA-associated disease. In some embodiments, the disease or condition is a synucleinopathy. In some embodiments, the disease or condition is one or more of: Parkinson’s Disease (PD) , multisystemic atrophy (MSA) , Lewy Body Dementia (LBD) , pure Autonomic Failure (PAF) , Pick's disease, progressive supranuclear palsy, dementia pugilistica, chromosome 17-related parkinsonism, Lytico-Bodig disease, tangle predominant dementia, Argyrophilic grain disease, silver-philic granulosis, gangliocytoma, meningioma, subacute sclerotic encephalitis, lead-poisoning encephalopathy, tuberous sclerosis, hallervorden-Spatz disease, lipofuscin deposition, corticobasal degeneration, frontotemporal dementia, frontotemporal lobar degeneration, Alzheimer's disease, Huntington's disease, Down's syndrome, psychosis, schizophrenia, and / or Crottzfeldt-Jab disease, or other disorders related to SNCA expression.

[0128] According to another aspect of the invention, an antisense polynucleotide agent for inhibiting expression of SNCA protein is provided, the agent including from 10 to 30 contiguous nucleotides, wherein at least one of the contiguous nucleotides is a modified nucleotide, and wherein the nucleotide sequence of the agent is about 80%complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the equivalent region is any one of the target regions of SEQ ID NO: 1 and the complementary sequence is one provided in one of Tables 1-3. In certain embodiments, the antisense polynucleotide agent includes one of the antisense sequences provided in one of Tables 1-3.

[0129] According to another aspect of the invention, a composition including an embodiment of any aforementioned antisense polynucleotide agents is provided. In some embodiments, the composition also includes a pharmaceutically acceptable carrier. In some embodiments, the composition also includes one or more additional therapeutic agents for treatment of a SNCA-associated disease or condition. In certain embodiments, the composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial. In certain embodiments, the composition is formulated for subcutaneous, intrathecal, intracranial, intrathecal, intraventricular, or intracerebral or IV administration.

[0130] According to another aspect of the invention a cell that includes an embodiment of any of the aforementioned antisense polynucleotide agents is provided. In some embodiments, the cell is a mammalian cell, optionally a human cell.

[0131] According to another aspect of the invention, a method of inhibiting the expression of a SNCA gene in a cell is provided, the method including: (i) preparing a cell including an effective amount of an embodiment of any aforementioned antisense polynucleotide agents. In some embodiments, the method also includes (ii) maintaining the cell prepared in (i) for a time sufficient to obtain degradation of the mRNA transcript of a SNCA gene, thereby inhibiting expression of the SNCA gene in the cell.

[0132] According to another aspect of the invention, a method of inhibiting expression of a SNCA gene in a subject is provided, the method including administering to the subject an effective amount of an embodiment of any of the aforementioned antisense polynucleotide agent.

[0133] According to another aspect of the invention, a method of treating a disease or condition associated with the presence of SNCA protein, the method including administering to a subject an effective amount of an embodiment of any of the aforementioned antisense polynucleotide agents or an embodiment of any aforementioned composition of the invention, to inhibit SNCA gene expression. In certain embodiments, the disease or condition is a SNCA-associated disease. In certain embodiments, the disease or condition is a synucleinopathy. In certain embodiments, the disease or condition is one or more of: Parkinson’s Disease (PD) , multisystemic atrophy (MSA) , Lewy Body Dementia (LBD) , pure Autonomic Failure (PAF) , Pick's disease, progressive supranuclear palsy, dementia pugilistica, chromosome 17-related parkinsonism, Lytico-Bodig disease, tangle predominant dementia, Argyrophilic grain disease, silver-philic granulosis, gangliocytoma, meningioma, subacute sclerotic encephalitis, lead-poisoning encephalopathy, tuberous sclerosis, hallervorden-Spatz disease, lipofuscin deposition, corticobasal degeneration, frontotemporal dementia, frontotemporal lobar degeneration, Alzheimer's disease, Huntington's disease, Down's syndrome, psychosis, schizophrenia, and / or Crottzfeldt-Jab disease, or other disorders related to SNCA expression.

[0134] According to another aspect of the invention, a method of decreasing a level of SNCA protein in a subject compared to a baseline pre-treatment level of SNCA protein in the subject is provided, the method including administering to the subject an effective amount of an embodiment of any of the aforementioned antisense polynucleotide agents or an embodiment of any aforementioned composition of the invention, to decrease the level of SNCA gene expression. In certain embodiments, the antisense polynucleotide agent is administered to the subject subcutaneously, intracranially, intrathecally, intraventricularly, or intracerebrally or by IV administration.

[0135] According to another aspect of the invention, an antisense polynucleotide agent for inhibiting expression of SNCA gene, is provided, the agent including from 10 to 30 contiguous nucleotides, wherein at least one of the contiguous nucleotides is a modified nucleotide, and wherein the nucleotide sequence of the agent is about 80%or about 85%complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: 1.

[0136] According to another aspect of the invention, a method of altering a physiological characteristic of a SNCA-associated disease or condition in a subject compared to a baseline pre-treatment physiological characteristic of the SNCA-associated disease or condition in the subject is provided, the method including administering to the subject an effective amount of an embodiment of any of the aforementioned antisense polynucleotide agents or an embodiment of any aforementioned composition of the invention, to alter the physiological characteristic of the SNCA disease or condition in the subject. In some embodiments, the antisense polynucleotide agent is administered to the subject subcutaneously, intrathecally or by IV administration. In some embodiments, the physiological characteristic is one or more of:SNCA mRNA, α-synuclein protein, or the level of another parameter functionally linked to the level of expression of SNCA, etc.

[0137] Brief Description of the Sequences

[0138] SEQ ID NO: 1 and SEQ ID NO: 2 (reverse complement) are Homo sapiens synuclein alpha (SNCA) mRNA [NCBI Reference Sequence: NM_000345.4] .

[0139] SEQ ID NO: 3 and SEQ ID NO: 4 (reverse complement) are Predicted Macaca fascicularis synuclein alpha (SNCA) mRNA [NCBI Reference Sequence: XM_005555422.3] .

[0140] SEQ ID NO: 5 and SEQ ID NO: 6 (reverse complement) are Predicted Macaca mulatta synuclein alpha (SNCA) mRNA [NCBI Reference Sequence: XM_015138783.2] .

[0141] SEQ ID NO: 7 and SEQ ID NO: 8 (reverse complement) are Rattus norvegicus synuclein alpha (SNCA) mRNA [NCBI Reference Sequence: NM_019169.3] .

[0142] SEQ ID NOs: 9-368, 1861-1862 are shown in Table 1 and are sense strand sequences.

[0143] SEQ ID NOs: 369-728, 1863-1864 are shown in Table 1 and are antisense strand sequences.

[0144] SEQ ID NOs: 729-1088, 1355-1860 are shown in Table 2 with chemical modifications.

[0145] SEQ ID NOs: 1089-1202, 1203-1354 are shown in Table 3. A delivery molecule is indicated as “GLX-__” at the 3’ end or 5’ end of each sense strand.Detailed Description

[0146] The invention in part, includes RNAi agents, for example, though not limited to double stranded (ds) RNAi agents, which are capable of inhibiting synuclein alpha (SNCA) gene expression. The invention, in part also includes compositions comprising SNCA RNAi agents and methods of use of the compositions. SNCA RNAi agents disclosed herein may be attached to delivery compounds for delivery to cells, including to CNS (e.g., brain) cells, hepatocytes. Pharmaceutical compositions of the invention may include at least one dsRNAi SNCA agent and a delivery compound. In some embodiments of compositions and methods of the invention, the delivery compound is a GalNAc-containing delivery compound. SNCA RNAi agents delivered to cells are capable of inhibiting SNCA gene expression, thereby reducing activity in the cell of the SNCA protein product of the gene. DsRNAi agents of the invention can be used to treat SNCA-associated diseases and conditions.

[0147] In some embodiments of the invention reducing SNCA expression in a cell or subject treats a disease or condition associated with SNCA expression in the cell or subject, respectively. In some embodiments, the dsRNA causes a decrease in SNCA gene mRNA in brain (e.g., striatum) or spinal tissues, such as the hippocampus, striatum, cortex, cerebellum, thalamus, hypothalamus, cervical, lumbar and thoracic vertebrae and spinal cord. Non-limiting examples of diseases and conditions that may be treated by reducing SNCA activity are: Parkinson’s Disease (PD) , multisystemic atrophy (MSA) , Lewy Body Dementia (LBD) , pure Autonomic Failure (PAF) , Pick's disease, progressive supranuclear palsy, dementia pugilistica, chromosome 17-related parkinsonism, Lytico-Bodig disease, tangle predominant dementia, Argyrophilic grain disease, silver-philic granulosis, gangliocytoma, meningioma, subacute sclerotic encephalitis, lead-poisoning encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, lipofuscin deposition, corticobasal degeneration, frontotemporal dementia, frontotemporal lobar degeneration, Alzheimer's disease, Huntington's disease, Down's syndrome, psychosis, schizophrenia, and / or Crottzfeldt-Jab disease, or other diseases for which reducing a level and activity of SNCA protein is medically beneficial.

[0148] As used herein, "G, " "C, " "A" and "U" each generally stands for a nucleotide that contains guanine, cytosine, adenine, and uracil as a base, respectively. However, it will be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person understands that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of the invention by a nucleotide containing, for example, inosine. Sequences comprising such replacement moieties are embodiments of the invention.

[0149] As used herein, "synuclein alpha" used interchangeably with the term "SNCA" refers to the naturally occurring gene that encodes a synuclein alpha from any vertebrate or mammalian source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, and guinea pig, unless specified otherwise. The term also refers to fragments and variants of native SNCA that maintain at least one in vivo or in vitro activity of a native SNCA. The amino acid and complete coding sequences of the reference sequence of the huma SNCA gene may be found in, for example, GenBank Ref Seq Accession No. NM_000345.4 (SEQ ID NO: 1 and SEQ ID NO: 2) . Mammalian orthologs of the huma SNCA gene may be found in, for example, GenBank Ref Seq Accession No. XM_005555422.3, Cynomolgus monkey (SEQ ID NO: 3 and SEQ ID NO: 4) , GenBank Ref Seq Accession No. XM_015138783.2, Rhesus monkey (SEQ ID NO: 5 and SEQ ID NO: 6) , GenBank Ref Seq Accession No. NM_019169.3, Rattus norvegicus (SEQ ID NO: 7 and SEQ ID NO: 8) . Additional examples of SNCA mRNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, Ensembl and OMIM. It is understood by a skilled artisan that a substitution of a T with a U in any target sequences or mRNA transcripts (e.g., SEQ ID NO: 1 to SEQ ID NO: 8) does not count as a difference.

[0150] The following describes how to make and use compositions comprising SNCA single-stranded (ssRNA) and dsRNA agents to inhibit SNCA gene expression, as well as compositions and methods for treating diseases and conditions caused by or modulated by SNCA gene expression. The term “RNAi” is also known in the art, and may be referred to as “siRNA” .

[0151] As used herein, the term “RNAi” refers to an agent that comprises RNA and mediates targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. As is known in the art, an RNAi target region, which is also defined as “target region” or “target portion” , refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a gene, including messenger RNA (mRNA) that is a product of RNA processing of a primary transcription product. The target portion or target region of the sequence will be at least long enough to serve as a substrate for RNAi-directed cleavage at or near that portion. A target sequence may be from 8-30 nucleotides long (inclusive) , from 10 -30 nucleotides long (inclusive) , from 12 -25 nucleotides long (inclusive) , from 15 -23 nucleotides long (inclusive) , from 16 -23 nucleotides long (inclusive) , or from 18 –23 nucleotides long (inclusive) , including all shorter lengths within each stated range. In some embodiments of the invention, a target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides long. In certain embodiment a target sequence is between 9 and 26 nucleotides long (inclusive) , including all sub-ranges and integers there between. For example, though not intended to be limiting, in certain embodiments of the invention a target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long, with the sequence fully or at least substantially complementary to at least part of an RNA transcript of a SNCA gene. Some aspects of the invention include pharmaceutical compositions comprising one or more SNCA dsRNA agents and a pharmaceutically acceptable carrier. In certain embodiments of the invention, a SNCA RNAi as described herein inhibits expression of SNCA protein.

[0152] As used herein, a “dsRNA agent” means a composition that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting translation of messenger RNA (mRNA) transcripts of a target mRNA in a sequence specific manner. Although not wishing to be limited to a particular theory, dsRNA agents of the invention may operate through the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells) , or by any alternative mechanism (s) or pathway (s) . Methods for silencing genes in plant, invertebrate, and vertebrate cells are well known in the art [see, for example, (Sharp et al., Genes Dev. 2001, 15: 485; Bernstein, et al., (2001) Nature 409: 363; Nykanen, et al., (2001) Cell 107: 309; and Elbashir, et al., (2001) Genes Dev. 15: 188) ] , the disclosure of each of which is incorporated herein by reference in its entirety. ] . Art-known gene silencing procedures can be used in conjunction with the disclosure provided herein to inhibit expression of SNCA.

[0153] DsRNA agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to: short interfering RNAs (siRNAs) , RNAi agents, micro RNAs (miRNAs) , short hairpin RNAs (shRNA) , and dicer substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the mRNA being targeted. It is understood in the art that different lengths of dsRNA duplex structure can be used to inhibit target gene expression. For example, dsRNAs having a duplex structure of 19, 20, 21, 22, and 23 base pairs are known to be effective to induce RNA interference (Elbashir et al., EMBO 2001, 20: 6877-6888) . It is also known in the art that shorter or longer RNA duplex structures are also effective to induce RNA interference. In some embodiments, the sense strand and the antisense strand may be the same length or different lengths. In some embodiments, each strand is no more than 40 nucleotides in length. In some embodiments, each strand is no more than 30 nucleotides in length. In some embodiments, each strand is no more than 25 nucleotides in length. In some embodiments, each strand is no more than 23 nucleotides in length. In some embodiments, each strand is no more than 21 nucleotides in length. In some embodiments, the sense and antisense strands of the RNAi agents can each be 15 to 49 nucleotides in length. In some embodiments, the antisense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the length of the sense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. As used herein, the terms “double stranded region” , “duplex region” and “the region of complementarity” can be used interchangeably, and refer to the region that the sense strand is complementary or substantially complementary to the antisense strand as is known in the art. In some embodiments, the sense strand and the antisense strand are both 21 nucleotides in length. In some embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity is between 15 and 23 nucleotides in length. In some embodiments, the region of complementarity is 19-21 nucleotides in length. In some embodiments, the region of complementarity is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. SNCA dsRNAs in certain embodiments of the invention can include at least one strand of a length of minimally 21 nt or may have shorter duplexes based on one of the sequences set forth in any one of Tables 1-3, but minus 1, 2, 3, or 4 nucleotides on one or both ends may also be effective as compared to the dsRNAs set forth in Tables 1-3, respectively. In some embodiments of the invention, SNCA dsRNA agents may have a partial sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from one or more sequences of Tables 1-3, and differ in their ability to inhibit the expression of a SNCA gene by not more than 5%, 10%, 15%, 20%, 25%, or 30%from the level of inhibition resulting from a dsRNA comprising the full sequence. A sense sequence, an antisense sequence and a duplex disclosed in Tables 1-3 may be referred to herein as a “parent” sequence, meaning that the sequences disclosed in Tables 1-3 may be modified, shorten, lengthened, include substitutions, etc. as set forth herein, with the resulting sequences retaining all or at least a portion of the efficacy of their parent sequences in methods and compositions of the invention. Sense and antisense strands included in a dsRNA of the invention are independently selected. As used herein the term “independently selected” means each of two or more like elements can be selected independent of the selection of the other elements. For example, though not intended to be limiting, in preparing a dsRNA of the invention, one may select the “elements” of the two strands to include in the duplex. One selected element, the sense sequence may be SEQ ID NO: 729 (shown in Table 2) and the other selected element, the antisense sequence, may be SEQ ID NO: 909, or may be SEQ ID NO: 909 that is modified, shortened, lengthened, and / or includes 1, 2, or 3 substitutions as compared to its parent sequence SEQ ID NO: 909. It will be understood that a duplex of the invention need not include both sense and antisense sequences shown as paired in duplexes in Tables 1-3. Each sense and antisense strand sequence in the tables is immediately followed by its SEQ ID NO.

[0154] Certain embodiments of compositions and methods of the invention comprise a single-strand RNA in a composition and / or administered to a subject. For example, an antisense strand such as one listed in any one of Tables 1-3 may be a composition or in a composition administered to a subject to reduce SNCA polypeptide activity and / or expression of SNCA gene in the subject. Tables 1 shows certain SNCA dsRNA agent antisense strand and sense strand core stretch base sequences. A single-strand antisense molecule that may be included in certain compositions and / or administered in certain methods of the invention are referred to herein as a “single-strand antisense agent” or an “antisense polynucleotide agent” . A single-strand sense molecule that may be included in certain compositions and / or administered in certain methods of the invention are referred to herein as a “single-strand sense agent” or a “sense polynucleotide agent” . The term “base sequence” is used herein in reference to a polynucleotide sequence without chemical modifications or delivery compounds. For example, the sense strand GGUGGUGUAAAGGAAUUCAUA (SEQ ID NO: 22) shown in Table 1 is the base sequence for SEQ ID NO: 742 in Table 2 and for SEQ ID NO: 1106 in Table 3, with SEQ ID NO: 742 and SEQ ID NO: 1106 shown with their chemical modifications and a delivery compound. Sequences disclosed herein may be assigned identifiers. For example, a single-stranded sense sequence may be identified with a “Sense strand SS#” ; a single stranded antisense sequence may be identified with an “Antisense strand AS#” and a duplex that includes a sense strand and an antisense strand may be identified with a “Duplex AD# / AV#” .

[0155] Table 1 includes sense and antisense strands and provides the identification number of duplexes formed from the sense and antisense strand on the same line in Table 1. In certain embodiments of the invention an antisense sequence includes nucleobase u or nucleobase a in position 1 of the antisense sequence. In certain embodiments of the invention an antisense sequence includes nucleobase u in position 1 of the antisense sequence. As used herein, the term “matching position” in a sense and an antisense strand are the positions in each strand that “pair” when the two strands are duplexed strands. For example, in a 21 nucleobases sense strand and a 21 nucleobases antisense strand, nucleobase in position 1 of the sense strand and position 21 in the antisense strand are in “matching positions” . In yet another non-limiting example in a 23 nucleobases sense strand and a 23 nucleobases antisense strand, nucleobase 2 of the sense strand and position 22 of the antisense strand are in matching positions. In another non-limiting example, in an 18 nucleobases sense strand and an 18 nucleobases antisense strand, nucleobase in position 1 of the sense strand and nucleobase 18 in the antisense strand are in matching positions, and nucleobase 4 in the sense strand and nucleobase 15 in the antisense strand are in matching positions. A skilled artisan will understand how to identify matching positions in sense and antisense strands that are or will be duplexed strands and paired strands.

[0156] The first column in Table 1 indicates a Duplex AV#for a duplex that includes the sense and antisense sequences in the same table row. For example, Table 1 discloses the duplex assigned Duplex AV#AV03096. um, which includes sense strand SEQ ID NO: 22 and antisense strand SEQ ID NO: 382. Thus, each row in Table 1 identifies a duplex of the invention, each comprising the sense and antisense sequences shown in the same row, with the assigned identifier for each duplex shown in the first column in the row.

[0157] In some embodiments of methods of the invention, an RNAi agent comprising a polynucleotide sequence shown in any one of Tables 1-3 is administered to a subject. In some embodiments of the invention an RNAi agent administered to a subject comprises is a duplex comprising at least one of the base sequences set forth in Table 1, including 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 sequence modifications. In some embodiments of methods of the invention an RNAi agent comprising a polynucleotide sequence shown in any one of Tables 1-3 is attached to a delivery molecule, a non-limiting example of which is a delivery compound comprising a GalNAc compound, or a GLS-15*compound.

[0158] Table 3 shows certain chemically modified SNCA RNAi agent antisense strand and sense strand sequences of the invention. In some embodiments of methods of the invention, RNAi agents shown in Table 3 are administered to a cell and / or subject. In some embodiments of methods of the invention, a RNAi agent with a polynucleotide sequence shown in Table 3 is administered to a subject. In some embodiments of the invention an RNAi agent administered to a subject comprises is a duplex identified in a row in Table 3, column one and includes the sequence modifications and / or delivery compound show in the sense and antisense strand sequences in the same row in Table 3, columns three and six, respectively. The sequences were used in certain in vivo testing studies described elsewhere herein. In some embodiments of methods of the invention, a sequence shown in Table 3 may be attached to (also referred to herein as “conjugated to” ) a compound for delivery, a non-limiting example of which is a GalNAc-containing compound, with a delivery compound identified in Table 3 as “GLX-n” on sense strands in column three. As used herein, “GLX-n” is used to represent either a “GLS-n*” or a GLO-n” delivery compound ( “X” can be either “S” or “O” ) that can be attached to 3'-end of oligonucleotide during synthesis. As used herein and shown in Table 3, “GLX-n” is used to indicate the attached GalNAc-containing compound is any one of compounds GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structure of each of which is provided elsewhere herein. One skilled in the art will be able to prepare and use a dsRNA compound of the invention in which the attached delivery compound is one of GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. Column one of Table 3 provides a Duplex AD#assigned to the duplex of the sense and antisense sequences in that row of the table. For example, Duplex AD#AD01746 is the duplex of sense strand SEQ ID NO: 1106 and antisense strand SEQ ID NO: 1163. Each line in Table 3 provides a sense strand and an antisense strand, and discloses the duplex of the sense and antisense strands shown. The “Sense strand SS#” in Table 3 column two is the assigned identifier for the Sense Sequence (including modifications) shown column 3 in the same row. The “Antisense strand AS#” in Table 3 column five is the assigned identifier for the Antisense sequence (including modifications) shown in column six. An identifier for certain attached GalNAc-containing “GLO-n” or “GLS-n*” compounds is shown as GLS-5*or GLS-15*, with the resulting compound included in an embodiment of a method and / or a composition of the invention.

[0159] In certain embodiments of the invention a dsRNA (also referred to herein as a “duplex” ) is one disclosed in one of Tables 1-3. Each row in Tables 1-3 discloses a duplex comprising the sequence of the sense strand and the sequence of the antisense strand in that table row. In addition to the duplexes disclosed in Tables 1-3, it will be understood that in some embodiments, a duplex of the invention may include sense and antisense sequences shown in Tables 1-3, that differ by zero, one, two, or three nucleotides shown in a sequence shown in Tables 1-3. Thus, as non-limiting examples, in some embodiments, an antisense strand in a duplex of the invention may be SEQ ID NO: 1162, 1163, 1164, 1165, 1166, 1167, 1168, 1169 or 1170 with zero, one, two, or three different nucleotides than those in SEQ ID NO: 1162, 1163, 1164, 1165, 1166, 1167, 1168, 1169 or 1170, respectively.

[0160] It will be understood that the sequence of the sense strand and the sequence of the antisense strand in a duplex of the invention may be independently selected. Thus, a dsRNA of the invention may comprise a sense strand and an antisense strand of a duplex disclosed in a row in Tables 1-3. Alternatively, in a dsRNA of the invention, one or both of the selected sense and antisense strand in the dsRNA may include sequences shown in Tables 1-3 but with one or both of the sense and antisense sequences including 1, 2, 3, or more nucleobase substitutions from the parent sequence. The selected sequences may in some embodiments be longer or shorter than their parent sequence. Thus, dsRNA agents included in the invention can but need not include exact sequences of the sense and antisense pairs disclosed as duplexes in Tables 1-3.

[0161] In some embodiments, a dsRNA agent comprises a sense strand and an antisense strand, nucleotide positions 2 to 18 in the antisense strand comprising a region of complementarity to a SNCA RNA transcript, wherein the region of complementarity comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally comprising a targeting ligand. In some instances, the region of complementarity to the SNCA RNA transcript comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by no more than 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3. In some embodiments of a dsRNA agent of the invention, the antisense strand of the dsRNA is at least substantially complementary to any one of a target region of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments, an antisense strand of a dsRNA agent of the invention is fully complementary to any one of a target region of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments a dsRNA agent includes a sense strand sequence set forth in any one of Tables 1-3, and the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In other embodiments, a dsRNA agent of the invention comprises a sense strand sequence set forth in any one of Tables 1-3, and the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some instances, a dsRNA agent of the invention comprises an antisense strand sequence set forth in any one of Tables 1-3. Some embodiments of a dsRNA agent of the invention comprises the sense and antisense sequences disclosed as duplex in any of Tables 1-3. As described herein, it will be understood that the sense and antisense strands in a duplex of the invention may be independently selected.

[0162] Mismatches

[0163] It is known to skilled in art, mismatches are tolerated for efficacy in dsRNA, especially the mismatches are within terminal region of dsRNA. Certain mismatches tolerate better, for example mismatches with wobble base pairs G: U and A: C are tolerated better for efficacy (Du et el., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21; 33 (5) : 1671-7. Doi: 10. 1093 / nar / gki312. Nucleic Acids Res. 2005; 33 (11) : 3698) . Some embodiments of methods and compounds of the invention a SNCA dsRNA agent may contain one or more mismatches to the SNCA target sequence. In some embodiments, SNCA dsRNA agent of the invention includes no mismatches. In certain embodiments, SNCA dsRNA agent of the invention includes no more than 1 mismatch. In some embodiments, SNCA dsRNA agent of the invention includes no more than 2 mismatches. In certain embodiments, SNCA dsRNA agent of the invention includes no more than 3 mismatches. In some embodiments of the invention, an antisense strand of a SNCA dsRNA agent contains mismatches to a SNCA target sequence that are not located in the center of the region of complementarity. In some embodiments, the antisense strand of the SNCA dsRNA agent includes 1, 2, 3, 4, or more mismatches that are within the last 5, 4, 3, 2, or 1 nucleotide from one or both of the 5' or 3' end of the region of complementarity. Methods described herein and / or methods known in the art can be used to determine whether a SNCA dsRNA agent containing a mismatch to a SNCA target sequence is effective in inhibiting the expression of the SNCA gene.

[0164] Complementarity

[0165] As used herein, unless otherwise indicated, the term “complementary” when used to describe a first nucleotide sequence (e.g., SNCA dsRNA agent sense strand or targeted SNCA mRNA) in relation to a second nucleotide sequence (e.g., SNCA dsRNA agent antisense strand or a single-stranded antisense polynucleotide) , means the ability of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize [form base pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro) ] and form a duplex or double helical structure under certain conditions with an oligonucleotide or polynucleotide including the second nucleotide sequence. Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. A skilled artisan will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity is independent of modification.

[0166] Complementary sequences, for example, within a SNCA dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. It will be understood that in embodiments when two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs are not regarded herein as mismatches with regard to the determination of complementarity. For example, a SNCA dsRNA agent comprising one oligonucleotide 19 nucleotides in length and another oligonucleotide 20 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 19 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein. Thus, as used herein, “fully complementary” means that all (100%) of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

[0167] The term “substantially complementary” as used herein means that in a hybridized pair of nucleobase sequences, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, but not all, of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The term “substantially complementary” can be used in reference to a first sequence with respect to a second sequence if the two sequences include one or more, for example at least 1, 2, 3, 4, or 5 mismatched base pairs upon hybridization for a duplex up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs (bp) , while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of SNCA gene expression via a RISC pathway.

[0168] The term, “partially complementary” may be used herein in reference to a hybridized pair of nucleobase sequences, in which at least 75%, but not all, of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. In some embodiments, “partially complementary” means at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide.

[0169] The terms “complementary, ” “fully complementary, ” “substantially complementary, ” and “partially complimentary” are used herein in reference to the base matching between the sense strand and the antisense strand of a SNCA dsRNA agent, between the antisense strand of a SNCA dsRNA agent and a sequence of a target SNCA mRNA, or between a single-stranded antisense oligonucleotide and a sequence of a target SNCA mRNA. It will be understood that the term “antisense strand of a SNCA dsRNA agent” may refer to the same sequence of an “SNCA antisense polynucleotide agent” .

[0170] As used herein, the term “substantially identical” or “substantial identity” used in reference to a nucleic acid sequence means a nucleic acid sequence comprising a sequence with at least about 85%sequence identity or more, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, compared to a reference sequence. Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. The inventions disclosed herein encompasses nucleotide sequences substantially identical to those disclosed herein. e.g., in Tables 1-3. In some embodiments, the sequences disclosed herein are exactly identical, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%percent identical to those disclosed herein, e.g., in Tables 1-3.

[0171] As used herein, the term “strand comprising a sequence” means an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature. The term “double-stranded RNA” or “dsRNA, ” as used herein, refers to an RNAi that includes an RNA molecule or complex of molecules having a hybridized duplex region comprising two anti-parallel and substantially or fully complementary nucleic acid strands, which are referred to as having “sense” and “antisense” orientations with respect to a target SNCA RNA. The duplex region can be of any length that permits specific degradation of a desired target SNCA RNA through a RISC pathway but will typically range from 9 to 30 base pairs in length, e.g., 15-30 base pairs in length. Considering a duplex between 9 and 30 base pairs, the duplex can be any length in this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and any sub-range therein between, including, but not limited to 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. SNCA dsRNA agents generated in the cell by processing with Dicer and similar enzymes are generally in the range of 19-22 base pairs in length. One strand of the duplex region of a SNCA dsDNA agent comprises a sequence that is substantially complementary to a region of a target SNCA RNA. The two strands forming the duplex structure can be from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules. Where the duplex region is formed from two strands of a single molecule, the molecule can have a duplex region separated by a single stranded chain of nucleotides (herein referred to as a “hairpin loop” ) between the 3'-end of one strand and the 5'-end of the respective other strand forming the duplex structure. In some embodiments of the invention, a hairpin look comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more unpaired nucleotides. Where the two substantially complementary strands of a SNCA dsRNA agent are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than a hairpin loop, the connecting structure is referred to as a “linker. ” The term “siRNA” is also used herein to refer to a dsRNA agent as described herein.

[0172] In some embodiments of the invention a SNCA dsRNA agent may include a sense and antisense sequence that have no-unpaired nucleotides or nucleotide analogs at one or both terminal ends of the dsRNA agent. An end with no unpaired nucleotides is referred to as a “blunt end” and as having no nucleotide overhang. If both ends of a dsRNA agent are blunt, the dsRNA is referred to as “blunt ended. ” In some embodiments of the invention, a first end of a dsRNA agent is blunt, in some embodiments a second end of a dsRNA agent is blunt, and in certain embodiments of the invention, both ends of a SNCA dsRNA agent are blunt.

[0173] In some embodiments of dsRNA agents of the invention, the dsRNA does not have one or two blunt ends. In such instances there is at least one unpaired nucleotide at the end of a strand of a dsRNA agent. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least 1, 2, 3, 4, 5, 6, or more nucleotides. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide / nucleoside. It will be understood that in some embodiments a nucleotide overhang is on a sense strand of a dsRNA agent, on an antisense strand of a dsRNA agent, or on both ends of a dsRNA agent and nucleotide (s) of an overhang can be present on the 5' end, 3' end or both ends of either an antisense or sense strand of a dsRNA. In certain embodiments of the invention, one or more of the nucleotides in an overhang is replaced with a nucleoside thiophosphate.

[0174] As used herein, the term “antisense strand” or “guide strand” refers to the strand of a SNCA dsRNA agent that includes a region that is substantially complementary to a SNCA target sequence. As used herein the term “sense strand, ” or “passenger strand” refers to the strand of a SNCA dsRNA agent that includes a region that is substantially complementary to a region of the antisense strand of the SNCA dsRNA agent.

[0175] Modifications

[0176] In some embodiments of the invention the RNA of a SNCA RNAi agent is chemically modified to enhance stability and / or one or more other beneficial characteristics. Nucleic acids in certain embodiments of the invention may be synthesized and / or modified by methods well established in the art, for example, those described in “Current protocols in Nucleic Acid Chemistry, "Beaucage, S. L. et al. (Eds. ) , John Wiley &Sons, Inc., New York, N. Y., USA, which is incorporated herein by reference. Modifications that can be present in certain embodiments of SNCA dsRNA agents of the invention include, for example, (a) end modifications, e.g., 5' end modifications (phosphorylation, conjugation, inverted linkages, etc. ) 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc. ) , (b) base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides) , or conjugated bases, (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar, as well as (d) backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of RNA compounds useful in certain embodiments of SNCA dsRNA agents, SNCA antisense polynucleotides, and SNCA sense polynucleotides of the invention include, but are not limited to RNAs comprising modified backbones or no natural internucleoside linkages. As a non-limiting example, an RNA having a modified backbone may not have a phosphorus atom in the backbone. RNAs that do not have a phosphorus atom in their internucleoside backbone may be referred to as oligonucleosides. In certain embodiments of the invention, a modified RNA has a phosphorus atom in its internucleoside backbone.

[0177] It will be understood that the term “RNA molecule” or “RNA” or “ribonucleic acid molecule” encompasses not only RNA molecules as expressed or found in nature, but also analogs and derivatives of RNA comprising one or more ribonucleotide / ribonucleoside analogs or derivatives as described herein or as known in the art. The terms “ribonucleoside” and “ribonucleotide” , “nucleoside” and “nucleotide” may be used interchangeably herein. An RNA molecule can be modified in the nucleobase structure or in the ribose-phosphate backbone structure, e.g., as described herein below, and molecules comprising ribonucleoside analogs or derivatives must retain the ability to form a duplex. As non-limiting examples, an RNA molecule can also include at least one modified ribonucleoside including but not limited to a 2'-O-methyl modified nucleoside, a nucleoside comprising a 5' phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a locked nucleoside, an abasic nucleoside, a 2'-deoxy-2'-fluoro modified nucleoside, a 2'-amino-modified nucleoside, 2'-alkyl-modified nucleoside, a 5'-phosphonate modified nucleoside, morpholino nucleoside, a phosphoramidate or a non-natural base comprising nucleoside, or any combination thereof. In some embodiments of the invention, an RNA molecule comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or up to the full length of the SNCA dsRNA agent molecule’s ribonucleosides that are modified ribonucleosides. The modifications need not be the same for each of such a plurality of modified ribonucleosides in an RNA molecule.

[0178] DsRNA agents, SNCA antisense polynucleotides, and / or SNCA sense polynucleotides of the invention may, in some embodiments comprise one or more independently selected modified nucleotide and / or one or more independently selected non-phosphodiester linkage. As used herein, the terms “internucleotide linkage” , “internucleoside linkage” , “linkage” , , “backbone linkage” , and “linker” may be used interchangeably, and refer to the linking groups in the backbone of the dsRNA of this invention, which may specifically indicates the linkages between unmodified or modified nucleosides, and / or between an unmodified or modified nucleoside and one or more residues, and / or between an unmodified or modified nucleoside and one or more targeting groups in an oligonucleotide strand. In some embodiments, the linkage may be independently selected from a phosphodiester (PO) linkage, a phosphorothioate (PS) linkage, and / or a phosphorodithioate (PS2) linkage of a dinucleotide at any position of single stranded or double stranded oligonucleotide. As used herein the term “independently selected” used in reference to a selected element, such as a modified nucleotide, non-phosphodiester linkage, etc., means that two or more selected elements can but need not be the same as each other.

[0179] As used herein, a “nucleotide base, ” “nucleotide, ” or “nucleobase” is a heterocyclic pyrimidine or purine compound, which is a standard constituent of all nucleic acids, and includes the bases that form the nucleotides adenine, guanine, cytosine, thymine, and uracil. A nucleobase may further be modified to include, though not intended to be limiting: universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. The term “ribonucleotide” or “nucleotide” may be used herein to refer to an unmodified nucleotide, a modified nucleotide, a nucleotide analog, or a surrogate replacement moiety. Those in the art will recognize that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety.

[0180] As used herein, "optionally" or "optionally" means that the event or environment described later may, but need not, occur, including where the event or environment occurred or did not occur. For example, "C1-6 alkyl optionally substituted by halogen or cyano" means that halogen or cyano may, but not necessarily, be present, including the case where alkyl is substituted by halogen or cyano and the case where alkyl is not substituted by halogen and cyano.

[0181] As used herein, in the chemical structures of the compounds of the present disclosure, the bond represents an unspecified configuration, i.e., if a chiral isomer is present in the chemical structure, the bond can be or or both and two configurations. Although some of the above structural formulas are depicted as some isomeric forms for simplicity, the present disclosure may include all isomers, such as tautomers, rotamers, and mixtures thereof. Suitable chiral compounds include: geometric isomers, diastereomers, racemates and enantiomers.

[0182] As used herein,  used in the chemical formulas of the present disclosure may be attached to any one or more groups according to the scope of the invention described herein.

[0183] In one embodiment, modified RNAs contemplated for use in methods and compositions described herein are peptide nucleic acids (PNAs) that have the ability to form the required duplex structure and that permit or mediate the specific degradation of a target RNA via a RISC pathway. In certain embodiments of the invention, a SNCA RNA interference agent includes a single stranded RNA that interacts with a target SNCA RNA sequence to direct the cleavage of the target SNCA RNA.

[0184] Modified RNA backbones can include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those) having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. Means of preparing phosphorus-containing linkages are routinely practiced in the art and such methods can be used to prepare certain modified SNCA dsRNA agents, certain modified SNCA antisense polynucleotides, and / or certain modified SNCA sense polynucleotides of the invention.

[0185] Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside) ; siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. Means of preparing modified RNA backbones that do not include a phosphorus atom are routinely practiced in the art and such methods can be used to prepare certain modified SNCA dsRNA agents, certain modified SNCA antisense polynucleotides, and / or certain modified SNCA sense polynucleotides of the invention.

[0186] In certain embodiments of the invention, RNA mimetics are included in SNCA dsRNAs, SNCA antisense polynucleotides, and / or SNCA sense polynucleotides, such as, but not limited to: replacement of the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units with novel groups. In such embodiments, base units are maintained for hybridization with an appropriate SNCA nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA) . In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Means of preparing RNA mimetics are routinely practiced in the art and such methods can be used to prepare certain modified SNCA dsRNA agents of the invention.

[0187] Some embodiments of the invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular -CH2-NH-CH2-, -CH2-N (CH3) -O-CH2- [known as a methylene (methylimino) or MMI backbone] , -CH2-O-N (CH3) -CH2-, -CH2-N (CH3) -N (CH3) -CH2-and -N (CH3) -CH2- [wherein the native phosphodiester backbone is represented as -O-P-O-CH2-] . Means of preparing RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones are routinely practiced in the art and such methods can be used to prepare certain modified SNCA dsRNA agents, certain SNCA antisense polynucleotides, and / or certain SNCA sense polynucleotides of the invention.

[0188] Modified RNAs can also contain one or more substituted sugar moieties. SNCA dsRNAs, SNCA antisense polynucleotides, and / or SNCA sense polynucleotides of the invention may comprise one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Exemplary suitable modifications include O [ (CH2) nO] mCH3, O (CH2) nOCH3, O (CH2) nNH2, O (CH2) nCH3, O (CH2) nONH2, and O (CH2) nON [ (CH2) nCH3) ] 2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2' position: C1 to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of a SNCA dsRNA agent, or a group for improving the pharmacodynamic properties of a SNCA dsRNA agent, SNCA antisense polynucleotide, and / or SNCA sense polynucleotide, and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O- (2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78: 486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a O (CH2) 2ON (CH3) 2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE) , i.e., 2'-O-CH2-O-CH2-N (CH2) 2. Means of preparing modified RNAs such as those described are routinely practiced in the art and such methods can be used to prepare certain modified SNCA dsRNA agents of the invention.

[0189] Other modifications include 2'-methoxy (2'-OCH3) , 2'-aminopropoxy (2'-OCH2CH2CH2NH2) and 2'-fluoro (2'-F) . Similar modifications can also be made at other positions on the RNA of a SNCA dsRNA agent, SNCA antisense polynucleotide, and / or SNCA sense polynucleotide of the invention, particularly the 3' position of the sugar on the 3'terminal nucleotide or in 2'-5'linked SNCA dsRNAs, SNCA antisense polynucleotides, or SNCA sense polynucleotides, and the 5' position of 5' terminal nucleotide. SNCA dsRNA agents, SNCA antisense polynucleotides, and / or SNCA sense polynucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Means of preparing modified RNAs such as those described are routinely practiced in the art and such methods can be used to prepare certain modified SNCA dsRNA agents, SNCA antisense polynucleotides, and / or SNCA sense polynucleotides of the invention.

[0190] A SNCA dsRNA agent, SNCA antisense polynucleotide, and / or SNCA sense polynucleotide may, in some embodiments, include nucleobase (often referred to in the art simply as "base" ) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine and guanine, and the pyrimidine bases thymine, cytosine and uracil. Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-Me-C) , 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil) , 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Additional nucleobases that may be included in certain embodiments of SNCA dsRNA agents of the invention are known in the art, see for example: Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, Ed. John Wiley &Sons, 1990, English et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B., Ed., CRC Press, 1993. Means of preparing dsRNAs, SNCA antisense strand polynucleotides and / or SNCA sense strand polynucleotides that comprise nucleobase modifications and / or substitutions such as those described herein are routinely practiced in the art and such methods can be used to prepare certain modified SNCA dsRNA agents, SNCA sense polynucleotides, and / or SNCA antisense polynucleotides of the invention.

[0191] Certain embodiments of SNCA dsRNA agents, SNCA antisense polynucleotides, and / or SNCA sense polynucleotides of the invention include RNA modified to include one or more locked nucleic acids (LNA) . A locked nucleic acid is a nucleotide with a modified ribose moiety comprising an extra bridge connecting the 2' and 4' carbons. This structure effectively “locks” the ribose in the 3'-endo structural conformation. The addition of locked nucleic acids in a SNCA dsRNA agent, SNCA antisense polynucleotides, and / or SNCA sense polynucleotides of the invention may increase stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33 (1) : 439-447; Mook, O R. et al., (2007) Mol Canc Ther 6 (3) : 833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31 (12) : 3185-3193) . Means of preparing dsRNA agents, SNCA antisense polynucleotides, and / or SNCA sense polynucleotides that comprise locked nucleic acid (s) are routinely practiced in the art and such methods can be used to prepare certain modified SNCA dsRNA agents of the invention.

[0192] Certain embodiments of SNCA dsRNA compounds, sense polynucleotides, and / or antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises: a 2’-O-methyl nucleotide, 2’-Fluoro nucleotide, 2’-deoxy nucleotide, 2’3’-seco nucleotide mimic, locked nucleotide, 2’-F-Arabino nucleotide, 2’-methoyxyethyl nucleotide, 2’-amino-modified nucleotide, 2’-alkyl-modified nucleotide, mopholino nucleotide, and 3’-OMe nucleotide, a nucleotide comprising a 5’-phosphorothioate group, a nucleotide comprising vinyl phosphonate, a nucleotide comprising adenosine-glycol nucleic acid (GNA) , a nucleotide comprising thymidine-glycol nucleic acid (GNA) S-Isomer, a nucleotide comprising 2-hydroxymethyl-tetrahydrofuran-5-phosphate, a nucleotide comprising 2’-deoxythymidine-3’-phosphate, a nucleotide comprising 2’-deoxyguanosine-3’-phosphate, a nucleotide comprising 2’-deoxyadenosine-3’-phosphate, a nucleotide comprising 2’-deoxycytidine-3’-phosphate, a nucleotide comprising 2’-deoxyuridine-3’-phosphate, or a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a 2’-amino-modified nucleotide, a phosphoramidate, or a non-natural base comprising nucleotide. In some embodiments, a SNCA dsRNA compound includes an E-vinylphosphonate nucleotide at the 5 -end of the antisense strand, also referred to herein as the guide strand.

[0193] Certain embodiments of SNCA dsRNA compounds, 3’ and 5’ end of sense polynucleotides, and / or 3’ end of antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises: abasic nucleotide, ribitol, inverted nucleotide, inverted abasic nucleotide, inverted 2’-OMe nucleotide, inverted 2’-deoxy nucleotide. It is known to skilled in art, including an abasic or inverted abasic nucleotide at the end of oligonucleotide enhances stability (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003; 31 (11) : 2705-2716. doi: 10.1093 / nar / gkg393) . In some embodiments, a SNCA dsRNA compound includes one or more inverted abasic residues (invab) at either 3’-end or 5’-end, or both 3’-end and 5’-end. Exemplified inverted abasic residues (invab) include, but are not limited to the following:

[0194] Certain embodiments of SNCA dsRNA compounds, 3’ and 5’ end of sense polynucleotides, and / or 3’ end of antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises: isomannide nucleotide or stereoisomer of said isomannide nucleotide. Specific examples of isomannide nucleotides or stereoisomers of said isomannide nucleotides include, but are not limited to: wherein the phrase “Olig” each independently represents a polynucleotide moiety. Exemplified isomannide residues (imann) include, but are not limited to, the following:

[0195] In certain embodiments, the isomannide nucleotides may further conjugate to one or more targeting groups or delivery molecules, such as GalNAc moieties.

[0196] Certain embodiments of SNCA dsRNA compounds, antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises unlocked nucleic acid nucleotide (UNA) or / and glycol nucleic acid nucleotide (GNA) . It is known to skilled in art, UNA and GNA are thermally destabilizing chemical modifications, can significantly improves the off-target profile of a siRNA compound (Janas, et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018; 9 (1) : 723. doi: 10.1038 / s41467-018-02989-4; Laursen et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010; 6: 862–70) .

[0197] Certain embodiments of SNCA dsRNA compounds, antisense polynucleotides of the invention further comprise a phosphate moiety. As used herein, a phosphate moiety refers to a phosphate group including phosphates or phosphates mimics that attached to the sugar moiety (e.g., a ribose or deoxyribose or analog thereof) of a nucleotide. A nucleotide comprising a phosphate mimic may also be defined as a phosphonate modified nucleotide.

[0198] In some embodiments, the phosphate mimic is a 5’-vinyl phosphonate (VP) . In exemplary embodiments, a vinyl phosphonate of the disclosure has the following structure:

[0199] A vinyl phosphonate of the instant disclosure may be attached to either the antisense or the sense strand of a dsRNA of the disclosure. In certain preferred embodiments, a vinyl phosphonate of the instant disclosure is attached to the antisense strand of a dsRNA, optionally at the 5’ end of the antisense strand of the dsRNA.

[0200] In certain embodiments, a vinyl phosphonate modified nucleotide of the disclosure has the structure of formula (IV) :

[0201] wherein X is O or S;

[0202] R is hydrogen, hydroxy, fluoro, or C1-20 alkoxy (e.g., methoxy or n-hexadecyloxy) ;

[0203] R5' is =C (H) -P (O) (OH) 2 and the double bond between the C5'carbon and R5'is in the E or Z orientation (e.g., E orientation) ; and

[0204] B is a nucleobase or a modified nucleobase, optionally where B is adenine, guanine, cytosine, thymine, or uracil.

[0205] In certain embodiments, R5'is =C (H) -P (O) (OH) 2 and the double bond between the C5’ carbon and R5’ is in the E orientation. In certain embodiments, R is methoxy and R5' is =C (H) -P (O) (OH) 2 and the double bond between the C5’ carbon and R5’ is in the E orientation. In certain embodiments, X is S, R is methoxy, and R5'is =C (H) -P (O) (OH) 2 and the double bond between the C5’ carbon and R5’ is in the E orientation.

[0206] Vinyl phosphonate modifications are also contemplated for the dsRNAs, the compositions and methods of the instant disclosure. An exemplary vinyl phosphonate structure is:

[0207] In certain embodiments, a vinyl phosphonate modified nucleotide is VPu*which has the structure of as follows:

[0208] In certain embodiments, dsRNA comprises a phosphate or phosphate mimic at the 5'-terminal nucleotide at the of the guide strand, wherein the phosphate or phosphate mimic fragment of 5'-terminal nucleoside may be represented by one of the following specific structures or stereoisomers thereof:

[0209] In many cases, protecting groups are used during the preparation of the compounds of the invention. As used herein, the term "protected" means that the indicated moiety has a protecting group appended thereon. In some embodiments of the invention, compounds contain one or more protecting groups. A wide variety of protecting groups can be employed in the methods of the invention. In general, protecting groups render chemical functionalities inert to specific reaction conditions, and can be appended to and removed from such functionalities in a molecule without substantially damaging the remainder of the molecule. Protecting groups in general and hydroxyl protecting groups in particular are well known in the art (Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed., John Wiley &Sons, New York, 1991) .

[0210] As used herein, examples of protecting groups (e.g., hydroxyl protecting groups) include, but are not limited to, methyl, ethyl, benzyl (Bn) , phenyl, isopropyl, tert-butyl, acetyl, chloroacetyl, trichloro acetyl, trifluoroacetyl, pivaloyl, tert-butoxymethyl, methoxymethyl, 1-ethoxyethyl, 1- (2-chloroethoxy) ethyl, allyl, cyclohexyl, 9-fluorenylmethoxycarbonyl (Fmoc) , methanesulfonate, toluenesulfonate, triflate, benzoyl, benzoylformate , p-phenylbenzoyl, 4-methoxybenzyl, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl, 4-chlorobenzyl, 4-nitrobenzyl, 2, 4-dinitrophenyl, 4-acyloxybenzyl, 2-methylphenyl, 2, 6-dimethylphenyl, 2-chlorophenyl, 2, 6-dichlorobenzyl, diphenylmethyl, triphenylmethyl, 4-methylthio-1-butyl, S-acetylthioacetate (SATA) , 2-cyanoethyl, 2-cyanol, 1-dimethylethyl (CDM) , 4-cyano-2-butenyl, 2- (trimethylsilyl) ethyl (TSE) , 2- (phenylthio) ethyl, 2- (triphenylsilyl) ethyl, 2- (benzylsulfonyl) ethyl, 2, 2, 2-trichloroethyl, 2, 2, 2-tribromoethyl, 2, 3-dibromopropyl, 2, 2, 2-trifluoroethyl, phenylthio, 2-chloro-4-tritylphenyl, 2-bromophenyl, 2- [N-isopropyl-N- (4-methoxybenzoyl) amino] ethyl, 4- (N-trifluoroacetylamino) butyl, 4-oxopentyl, 4-tritylaminophenyl, 4-benzyl aminophenyl, tetrahydropyranyl, morpholino, trimethylsilyl, triethylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triphenyl Silyl, triisopropylsilyl, pivaloyloxymethyl (POM) and 9-phenylxanthine-9-yl.

[0211] As used herein, examples of amino protecting groups include, but are not limited to, carbamate protecting groups, such as 2-trimethylsilylethoxycarbonyl (Teoc) , 1-methyl-1- (4-biphenyl) ethoxycarbonyl (Bpoc) , tert-butyloxycarbonyl (BOC) , allyloxycarbonyl (Alloc) , 9-fluorenyl-methoxycarbonyl (Fmoc) , benzyloxycarbonyl (Cbz) ; amide protecting groups, such as formyl, acetyl, pivaloyl, trihaloacetyl, benzoyl, 2-nitrobenzenesulfonyl; and imine and cyclic imide protecting groups, such as phthalimido and dithiasuccinoyl. Equivalents of these amino-protecting groups are also encompassed by the compounds and methods of the invention.

[0212] Certain embodiments of the SNCA dsRNA agents include at least one the lipophilic moiety which comprising, for example, , but are not limited to, a saturated or unsaturated C16 hydrocarbon chain (e.g., a linear C16 alkyl or alkenyl) . A lipophilic moiety included in any of the positions of the dsRNA agent is provided in the instant application. In some embodiments, the lipophilic moiety is conjugated to a nucleobase, sugar moiety, or internucleosidic linkage of the double-stranded iRNA agent. For example, a C16 moiety may be conjugated via the 2’-oxygen of a ribonucleotide as shown in the following structure:

[0213] As used herein, “lipophile” or “lipophilic moiety” broadly refers to any compound or chemical moiety having an affinity for lipids. One way to characterize the lipophilicity of the lipophilic moiety is by the octanol-water partition coefficient, logKow, where Kow is the ratio of a chemicals concentration in the octanol-phase to its concentration in the aqueous phase of a two-phase system at equilibrium. The octanol-water partition coefficient is a laboratory-measured property of a substance. However, it may also be predicted by using coefficients attributed to the structural components of a chemical which are calculated using first-principle or empirical methods (see, for example, Tetko et al., J. Chem. Inf. Comput. Sci. 41: 1407-21 (2001) , which is incorporated herein by reference in its entirety) . It provides a thermodynamic measure of the tendency of the substance to prefer a non-aqueous or oily milieu rather than water (i.e., its hydrophilic / lipophilic balance) . In principle, a chemical substance is lipophilic in character when its logKow exceeds 0.

[0214] Another modification that may be included in the RNA of certain embodiments of SNCA dsRNA agents, SNCA antisense polynucleotides, and / or SNCA sense polynucleotides of the invention, comprises chemically linking to the RNA one or more ligands, moieties or conjugates that enhance one or more characteristics of the SNCA dsRNA agent, SNCA antisense polynucleotide, and / or SNCA sense polynucleotide, respectively. Non-limiting examples of characteristics that may be enhanced are: SNCA dsRNA agent, SNCA antisense polynucleotide, and / or SNCA sense polynucleotide activity, cellular distribution, delivery of a SNCA dsRNA agent, pharmacokinetic properties of a SNCA dsRNA agent, and cellular uptake of the SNCA dsRNA agent. In some embodiments of the invention, a SNCA dsRNA agent comprises one or more targeting groups or linking groups, which in certain embodiments of SNCA dsRNA agents of the invention are conjugated to the sense strand. A non-limiting example of a targeting group is a compound comprising N-acetyl-galactosamine (GalNAc) . The terms “targeting group” , “targeting agent” , “linking agent” , “targeting compound” , “delivery molecule” , “delivery compound” and “targeting ligand” may be used interchangeably herein. In certain embodiments of the invention a SNCA dsRNA agent comprises a targeting compound that is conjugated to the 5'-terminal end of the sense strand. In certain embodiments of the invention a SNCA dsRNA agent comprises a targeting compound that is conjugated to the 3'-terminal end of the sense strand. In some embodiments of the invention, a SNCA dsRNA agent comprises a targeting group that comprises GalNAc. In some embodiments of the invention, a SCN9A dsRNA agent comprises a targeting group that comprises lipophilic moiety. In certain embodiments of the invention a SNCA dsRNA agent does not include a targeting compound conjugated to one or both of the 3'-terminal end and the 5'-terminal end of the sense strand. In certain embodiments of the invention a SNCA dsRNA agent does not include a GalNAc containing targeting compound conjugated to one or both of the 5'-terminal end and the 3'-terminal end of the sense strand.

[0215] Additional targeting and linking agents are well known in the art, for example, targeting and linking agents that may be used in certain embodiments of the invention include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556) , cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4: 1053-1060) , a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660: 306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3: 2765-2770) , a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20: 533-538) , an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10: 1111-1118; Kabanov et al., FEBS Lett., 1990, 259: 327-330; Svinarchuk et al., Biochimie, 1993, 75: 49-54) , a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1, 2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18: 3777-3783) , a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides &Nucleotides, 1995, 14: 969-973) , or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654) , a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264: 229-237) , or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277: 923-937) .

[0216] Certain embodiments of a composition comprising a SNCA dsRNA agent, SNCA antisense polynucleotide, and / or SNCA sense polynucleotide may comprise a ligand that alters distribution, targeting, or etc. of the SNCA dsRNA agent. In some embodiments of a composition comprising a SNCA dsRNA agent of the invention, the ligand increases affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. A ligand useful in a composition and / or method of the invention may be a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA) , low-density lipoprotein (LDL) , or globulin) ; a carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid) ; or a lipid. A ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid or polyamine. Examples of polyamino acids are a polylysine (PLL) , poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly (L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N- (2-hydroxypropyl) methacrylamide copolymer (HMPA) , polyethylene glycol (PEG) , polyvinyl alcohol (PVA) , polyurethane, poly (2-ethylacryllic acid) , N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL) , spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.

[0217] A ligand included in a composition and / or method of the invention may comprise a targeting group, non-limiting examples of which are a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody that binds to a specified cell type such as a CNS cell or a kidney cell or a liver cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.

[0218] Other examples of ligands include dyes, intercalating agents (e.g. acridines) , cross-linkers (e.g. psoralene, mitomycin C) , porphyrins (TPPC4, texaphyrin, Sapphyrin) , polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, phenanthroline, pyrenes) , lys-tyr-lys tripeptide, aminoglycosides, guanidium aminoglycodies, artificial endonucleases (e.g. EDTA) , lipophilic molecules, e.g, cholesterol (and thio analogs thereof) , cholic acid, cholanic acid, lithocholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, glycerol (e.g., esters (e.g., mono, bis, or tris fatty acid esters, e.g., C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20 fatty acids) and ethers thereof, e.g., C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20 alkyl; e.g., l, 3-bis-O (hexadecyl) glycerol, l, 3-bis-O (octaadecyl) glycerol) , geranyl oxy hexyl group, hexadecylglycerol, borneol, menthol, 1, 3 -propanediol, heptadecyl group, palmitic acid, stearic acid (e.g., glyceryl distearate) , oleic acid, myristic acid, O3- (oleoyl) lithocholic acid, O3- (oleoyl) cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide) , alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K) , MPEG, [MPEG] 2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin) , transport / absorption facilitators (e.g., aspirin, naproxen, vitamin E, folic acid) , synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles) , dinitrophenyl, HRP or AP.

[0219] A ligand included in a composition and / or method of the invention may be a protein, e.g., glycoprotein, or peptide, for example a molecule with a specific affinity for a co-ligand, or an antibody, for example an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, cardiac cell, or bone cell. A ligand useful in an embodiment of a composition and / or method of the invention can be a hormone or hormone receptor. A ligand useful in an embodiment of a composition and / or method of the invention can be a lipid, lectin, carbohydrates, vitamin, cofactos, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, or multivalent fucose. A ligand useful in an embodiment of a composition and / or method of the invention can be a substance that can increase uptake of the SNCA dsRNA agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and / or intermediate filaments. Non-limiting examples of this type of agent are: taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, and myoservin.

[0220] In some embodiments, a ligand attached to a SNCA dsRNA agent of the invention functions as a pharmacokinetic (PK) modulator. An example of a PK modulator that may be used in compositions and methods of the invention includes but is not limited to: a lipophiles, a bile acid, a steroid, a phospholipid analogue, a peptide, a protein binding agent, PEG, a vitamin, cholesterol, a fatty acid, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, a phospholipid, a sphingolipid, naproxen, ibuprofen, vitamin E, biotin, an aptamer that binds a serum protein, etc. Oligonucleotides comprising a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone may also be used in compositions and / or methods of the invention as ligands.

[0221] SNCA dsRNA agent compositions

[0222] In some embodiments of the invention, a SNCA dsRNA agent is in a composition. A composition of the invention may include one or more SNCA dsRNA agent and optionally one or more of a pharmaceutically acceptable carrier, a delivery agent, a targeting agent, detectable label, etc. A non-limiting example of a targeting agent that may be useful according to some embodiments of methods of the invention is an agent that directs a SNCA dsRNA agent of the invention to and / or into a cell to be treated. A targeting agent of choice will depend upon such elements as: the nature of the SNCA-associated disease or condition, and on the cell type being targeted. In a non-limiting example, in some embodiments of the invention it may be desirable to target a SNCA dsRNA agent to and / or into a liver cell. In a non-limiting example, in some embodiments of the invention it may be desirable to target a SNCA dsRNA agent to and / or into a brain cell. In a non-limiting example, in some embodiments of the invention it may be desirable to target a SNCA dsRNA agent to and / or into a spine cell. It will be understood that in some embodiments of methods of the invention, a therapeutic agent comprises a SNCA dsRNA agent with only a delivery agent, such as a delivery agent comprising N-Acetylgalactosamine (GalNAc) , without any additional attached elements. For example, in some aspects of the invention a SNCA dsRNA agent may be attached to a delivery compound comprising GalNAc and included in a composition comprising a pharmaceutically acceptable carrier and administered to a cell or subject without any detectable labels, or targeting agents, etc. attached to the SNCA dsRNA agent.

[0223] In cases where a SNCA dsRNA agent of the invention is administered with and / or attached to one or more delivery agents, targeting agents, labeling agents, etc. a skilled artisan will be aware of and able to select and use suitable agents for use in methods of the invention. Labeling agents may be used in certain methods of the invention to determine the location of a SNCA dsRNA agent in cells and tissues and may be used to determine a cell, tissue, or organ location of a treatment composition comprising a SNCA dsRNA agent that has been administered in methods of the invention. Procedures for attaching and utilizing labeling agents such as enzymatic labels, dyes, radiolabels, etc. are well known in the art. It will be understood that in some embodiments of compositions and methods of the invention, a labeling agent is attached to one or both of a sense polynucleotide and an antisense polynucleotide included in a SNCA dsRNA agent.

[0224] Delivery of SNCA dsRNA agents and SNCA antisense polynucleotide agents

[0225] Certain embodiments of methods of the invention, includes delivery of a SNCA dsRNA agent into a cell. As used herein the term, “delivery” means facilitating or effecting uptake or absorption into the cell. Absorption or uptake of a SNCA dsRNA agent can occur through unaided diffusive or active cellular processes, or by use of delivery agents, targeting agents, etc. that may be associated with a SNCA dsRNA agent of the invention. Delivery means that are suitable for use in methods of the invention include, but are not limited to: in vivo delivery, in which a SNCA dsRNA agent is in injected into a tissue site or administered systemically. In some embodiments of the invention, a SNCA dsRNA agent is attached to a delivery agent.

[0226] Non-limiting examples of methods that can be used to deliver SNCA dsRNA agents to cells, tissues and / or subjects include: SNCA dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have been used successfully in the art to deliver therapeutic RNAi agents for treatment of various diseases and conditions, such as but not limited to: neurodegenerative diseases, liver diseases, acute intermittent porphyria (AIP) , hemophilia, pulmonary fibrosis, etc. Details of various delivery means are found in publications such as: Nikam, R.R. &K.R. Gore (2018) Nucleic Acid Ther, 28 (4) , 209-224 Aug 2018; Springer A.D. &S.F. Dowdy (2018) Nucleic Acid Ther. Jun 1; 28 (3) : 109–118; Lee, K. et al., (2018) Arch Pharm Res, 41 (9) , 867-874; Nair, J.K. et al., (2014) J. Am. Chem. Soc. 136: 16958-16961; Imran Sajid M. et al., (2023) Adv Drug Deliv Rev. 199: 114968, and Padmakumar S. et al., (2022) J Control Release. 352: 121-145; the content each of which is incorporated by reference herein.

[0227] Some embodiments of the invention comprise use of lipid nanoparticles (LNPs) to deliver a SNCA dsRNA agent of the invention to a cell, tissue, and / or subject. LNPs are routinely used for in vivo delivery of SNCA dsRNA agents, including therapeutic SNCA dsRNA agents. One benefit of using an LNP or other delivery agent is an increased stability of the SNCA RNA agent when it is delivered to a subject using the LNP or other delivery agent. In some embodiments of the invention an LNP comprises a cationic LNP that is loaded with one or more SNCA RNAi molecules of the invention. The LNP comprising the SNCA RNAi molecule (s) is administered to a subject, the LNPs and their attached SNCA RNAi molecules are taken up by cells via endocytosis, their presence results in release of RNAi trigger molecules, which mediate RNAi.

[0228] Some embodiments of the invention comprise use of functional Moieties to deliver a SNCA dsRNA agent of the invention to a cell, tissue, and / or subject.

[0229] A functional moiety is a molecule that confers one or more additional activities to the RNA silencing agent. In certain embodiments, the functional moieties enhance cellular uptake by target cells (e.g., neuronal cells) . Thus, the disclosure includes RNA silencing agents which are conjugated or unconjugated (e.g., at its 5’ and / or 3' terminus) to another moiety (e.g. a non-nucleic acid moiety such as a peptide) , an organic compound (e.g., a dye) , or the like. The conjugation can be accomplished by methods known in the art, e.g., using the methods of Lambert et al., Drug Deliv. Rev.: 47 (1) , 99-112 (2001) (describes nucleic acids loaded to polyalkylcyanoacrylate (PACA) nanoparticles) ; Fattal et al., J. Control Release 53 (1-3) : 137-43 (1998) (describes nucleic acids bound to nanoparticles) ; Schwab et al., Ann. Oncol. 5 Suppl. 4: 55-8 (1994) (describes nucleic acids linked to intercalating agents, hydrophobic groups, polycations or PACA nanoparticles) ; and Godard et al., Eur. J. Biochem. 232 (2) : 404-10 (1995) (describes nucleic acids linked to nanoparticles) .

[0230] In a certain embodiment, the functional moiety is a hydrophobic moiety. In a certain embodiment, the hydrophobic moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, gangliosides and nucleoside analogs, endocannabinoids, and vitamins. In a certain embodiment, the steroid selected from the group consisting of cholesterol and Lithocholic acid (LCA) . In a certain embodiment, the fatty acid selected from the group consisting of Eicosapentaenoic acid (EPA) , Docosahexaenoic acid (DHA) and Docosanoic acid (DCA) . In a certain embodiment, the vitamin selected from the group consisting of choline, vitamin A, vitamin E, and derivatives or metabolites thereof. In a certain embodiment, the vitamin is selected from the group consisting of retinoic acid and alpha-tocopheryl succinate.

[0231] In a certain embodiment, an RNA silencing agent of disclosure is conjugated to a lipophilic moiety. In one embodiment, the lipophilic moiety is a ligand that includes a cationic group. In another embodiment, the lipophilic moiety is attached to one or both strands of an siRNA. In an exemplary embodiment, the lipophilic moiety is attached to one end of the sense strand of the siRNA. In another exemplary embodiment, the lipophilic moiety is attached to the 3' end of the sense strand. In certain embodiments, the lipophilic moiety is selected from the group consisting of cholesterol, vitamin E, vitamin K, vitamin A, folic acid, a cationic dye (e.g., Cy3) . In an exemplary embodiment, the lipophilic moiety is cholesterol. Other lipophilic moi eties include cholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, 1, 3-Bis-O (hexadecyl) glycerol, geranyl oxy hexyl group, hexadecylglycerol, borneol, menthol, 1, 3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3- (oleoyl) lithocholic acid, O3- (oleoyl) cholenic acid, dimethoxytrityl, or phenoxazine.

[0232] In certain embodiments, the functional moieties may comprise one or more ligands tethered to an RNA silencing agent to improve stability, hybridization thermodynamics with a target nucleic acid, targeting to a particular tissue or cell-type, or cell permeability, e.g., by an endocytosis-dependent or -independent mechanism. Ligands and associated modifications can also increase sequence specificity and consequently decrease off-site targeting. A tethered ligand can include one or more modified bases or sugars that can function as intercalators. These can be located in an internal region, such as in a bulge of RNA silencing agent / target duplex. The intercalator can be an aromatic, e.g., a polycyclic aromatic or heterocyclic aromatic compound. A polycyclic intercalator can have stacking capabilities, and can include systems with 2, 3, or 4 fused rings. The universal bases described herein can be included on a ligand. In one embodiment, the ligand can include a cleaving group that contributes to target gene inhibition by cleavage of the target nucleic acid. The cleaving group can be, for example, a bleomycin (e.g., bleomycin-A5, bleomycin-A2, or bleomycin-B2) , pyrene, phenanthroline (e.g., O-phenanthroline) , a polyamine, a tripeptide (e.g., lys-tyr-lys tripeptide) , or a metal ion chelating group. The metal ion chelating group can include, e.g., an Lu (III) or EU (III) macrocyclic complex, a Zn (II) 2, 9-dimethylphenanthroline derivative, a Cu (II) terpyridine, or acridine, which can promote the selective cleavage of target RNA at the site of the bulge by free metal ions, such as Lu (III) . In some embodiments, a peptide ligand can be tethered to a RNA silencing agent to promote cleavage of the target RNA, e.g., at the bulge region. For example, l, 8-dimethyl-l, 3, 6, 8, 10, 13-hexaazacyclotetradecane (cyclam) can be conjugated to a peptide (e.g., by an amino acid derivative) to promote target RNA cleavage. A tethered ligand can be an aminoglycoside ligand, which can cause an RNA silencing agent to have improved hybridization properties or improved sequence specificity. Exemplary aminoglycosides include glycosylated polylysine, galactosylated polylysine, neomycin B, tobramycin, kanamycin A, and acridine conjugates of aminoglycosides, such as Neo-N-acridine, Neo-S-acridine, Neo-C-acridine, Tobra-N-acridine, and KanaA-N-acridine. Use of an acridine analog can increase sequence specificity. For example, neomycin B has a high affinity for RNA as compared to DNA, but low sequence-specificity. An acridine analog, neo-5-acridine, has an increased affinity for the HIV Rev-response element (RRE) . In some embodiments, the guanidine analog (the guanidinoglycoside) of an aminoglycoside ligand is tethered to an RNA silencing agent. In a guanidinoglycoside, the amine group on the amino acid is exchanged for a guanidine group. Attachment of a guanidine analog can enhance cell permeability of an RNA silencing agent. A tethered ligand can be a poly-arginine peptide, peptoid or peptidomimetic, which can enhance the cellular uptake of an oligonucleotide agent.

[0233] Exemplary ligands are coupled, either directly or indirectly, via an intervening tether, to a ligand-conjugated carrier. In certain embodiments, the coupling is through a covalent bond. In certain embodiments, the ligand is attached to the carrier via an intervening tether. In certain embodiments, a ligand alters the distribution, targeting or lifetime of an RNA silencing agent into which it is incorporated. In certain embodiments, a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand.

[0234] Exemplary ligands can improve transport, hybridization, and specificity properties and may also improve nuclease resistance of the resultant natural or modified RNA silencing agent, or a polymeric molecule comprising any combination of monomers described herein and / or natural or modified ribonucleotides. Ligands in general can include therapeutic modifiers, e.g., for enhancing uptake; diagnostic compounds or reporter groups e.g., for monitoring distribution; cross-linking agents; nuclease-resistance conferring moieties; and natural or unusual nucleobases. General examples include lipophiles, lipids, steroids (e.g., uvaol, hecigenin, diosgenin) , terpenes (e.g., triterpenes, e.g., sarsasapogenin, Friedelin, epifriedelanol derivatized lithocholic acid) , vitamins (e.g., folic acid, vitamin A, biotin, pyridoxal) , carbohydrates, proteins, protein binding agents, integrin targeting molecules, polycationics, peptides, polyamines, and peptide mimics. Ligands can include a naturally occurring substance, (e.g., human serum albumin (HSA) , low-density lipoprotein (LDL) , or globulin) ; carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid) ; amino acid, or a lipid. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL) , poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly (L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N- (2-hydroxypropyl) methacrylamide copolymer (HMPA) , polyethylene glycol (PEG) , polyvinyl alcohol (PVA) , polyurethane, poly (2-ethylacryllic acid) , N-isopropyl acrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL) , spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.

[0235] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine (GalNAc) or derivatives thereof, N-acetyl-glucosamine, multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B 12, biotin, or an RGD peptide or RGD peptide mimetic. Other examples of ligands include dyes, intercalating agents (e.g. acridines and substituted acridines) , crosslinkers (e.g. psoralene, mitomycin C) , porphyrins (TPPC4, texaphyrin, Sapphyrin) , polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, phenanthroline, pyrenes) , lys-tyr-lys tripeptide, aminoglycosides, guanidium aminoglycodies, artificial endonucleases (e.g. EDTA) , lipophilic molecules, e.g, cholesterol (and thio analogs thereof) , cholic acid, cholanic acid, lithocholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, glycerol (e.g., esters (e.g., mono, bis, or tris fatty acid esters, e.g., C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20 fatty acids) and ethers thereof, e.g., C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20 alkyl; e.g., l, 3-bis-O (hexadecyl) glycerol, l, 3-bis-O (octaadecyl) glycerol) , geranyl oxy hexyl group, hexadecylglycerol, borneol, menthol, 1, 3 -propanediol, heptadecyl group, palmitic acid, stearic acid (e.g., glyceryl distearate) , oleic acid, myristic acid, O3- (oleoyl) lithocholic acid, O3- (oleoyl) cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide) , alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K) , MPEG, [MPEG] 2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin) , transport / absorption facilitators (e.g., aspirin, naproxen, vitamin E, folic acid) , synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles) , dinitrophenyl, HRP or AP. In certain embodiments, the ligand is GalNAc or a derivative thereof.

[0236] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell. Ligands may also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fucose.

[0237] In certain embodiments, the functional moiety is linked to the 5’ end and / or 3’ end of the RNA silencing agent of the disclosure. In certain embodiments, the functional moiety is linked to the 5’ end and / or 3’ end of an antisense strand of the RNA silencing agent of the disclosure. In certain embodiments, the functional moiety is linked to the 5’ end and / or 3’ end of a sense strand of the RNA silencing agent of the disclosure. In certain embodiments, the functional moiety is linked to the 3’ end of a sense strand of the RNA silencing agent of the disclosure.

[0238] In certain embodiments, the functional moiety is linked to the RNA silencing agent by a linker. In certain embodiments, the functional moiety is linked to the antisense strand and / or sense strand by a linker. In certain embodiments, the functional moiety is linked to the 3’ end of a sense strand by a linker. In certain embodiments, the linker comprises a divalent or trivalent linker. In certain embodiments, the linker comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphodiester, a phosphorothioate, a phosphoramidate, an amide, a carbamate, or a combination thereof.

[0239] Another non-limiting example of a delivery agent that may be used in embodiments of the invention to deliver a SNCA dsRNA agent of the invention to a cell, tissue and / or subject is an agent comprising GalNAc that is attached to a SNCA dsRNA agent of the invention and delivers the SNCA dsRNA agent to a cell, tissue, and / or subject. Examples of certain additional delivery agents comprising GalNAc that can be used in certain embodiments of methods and composition of the invention are disclosed in PCT Application: WO2020191183A1 and WO2023045995 (incorporated herein in its entirety) . A non-limiting example of a GalNAc targeting ligand that can be used in compositions and methods of the invention to deliver a SNCA dsRNA agent to a cell is a targeting ligand cluster. Examples of targeting ligand clusters that are presented herein are referred to as: GalNAc Ligand with phosphodiester link (GLO) and GalNAc Ligand with phosphorothioate link (GLS) . The term “GLX-n” may be used herein to indicate the attached GalNAc-containing compound is any one of compounds GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structure of each of which is shown below, with the below with location of attachment of the GalNAc-targeting ligand to an RNAi agent of the invention at far right of each (shown with ) . It will be understood that any RNAi and dsRNA molecule of the invention can be attached to the GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, GLO-1 through GLO-16 and GLS-1*through GLS-16*structures are shown below.

[0240] In certain embodiments, the aforesaid isomannide nucleotides may further conjugate to one or more GalNAc targeting ligands. Specific examples of isomannide nucleotides conjugated to a GalNAc targeting ligand include, but are not limited to:

[0241] wherein the phrase "olig" each independently represents a polynucleotide moiety.

[0242] In some embodiments of the invention, in vivo delivery can also be by a beta-glucan delivery system, such as those described in U.S. Pat. Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005 / 0281781, which are hereby incorporated by reference in their entirety. In vitro introduction of a SNCA RNAi agent into a cell may also be done using art-known methods such as electroporation and lipofection. In certain embodiments of methods of the invention, a SNCA dsRNA is delivered without a targeting agent. These RNAs may be delivered as “naked” RNA molecules. As a non-limiting example, a SNCA dsRNA of the invention may be administered to a subject to treat a SNCA-associated disease or condition in the subject, such as PD, in a pharmaceutical composition comprising the RNAi agent, but not including a targeting agent such as a GalNAc targeting compound.

[0243] In addition to certain delivery means described herein, it will be understood that RNAi delivery means, such as but not limited to those described herein and those used in the art, can be used in conjunction with embodiments of SNCA RNAi agents and treatment methods described herein.

[0244] SNCA dsRNA agents of the invention may be administered to a subject in an amount and manner effective to reduce a level and activity of SNCA polypeptide in a cell and / or subject. In some embodiments of methods of the invention one or more SNCA dsRNA agents are administered to a cell and / or subject to treat a disease or condition associated with SNCA expression and activity. Methods of the invention, in some embodiments, include administering one or more SNCA dsRNA agents to a subject in need of such treatment to reduce a disease or condition associated with SNCA expression in the subject. SNCA dsRNA agents or SNCA antisense polynucleotide agents of the invention can be administered to reduce SNCA expression and / or activity in one more of in vitro, ex vivo, and in vivo cells.

[0245] In some embodiments of the invention, a level, and thus an activity, of SNCA polypeptide in a cell is reduced by delivering (e.g. introducing) a SNCA dsRNA agent or SNCA antisense polynucleotide agent into a cell. Targeting agents and methods may be used to aid in delivery of a SNCA dsRNA agent or SNCA antisense polynucleotide agent to a specific cell type, cell subtype, organ, spatial region within a subject, and / or to a sub-cellular region within a cell. A SNCA dsRNA agent can be administered in certain methods of the invention singly or in combination with one or more additional SNCA dsRNA agents. In some embodiments, 2, 3, 4, or more independently selected SNCA dsRNA agents are administered to a subject.

[0246] In certain embodiments of the invention, a SNCA dsRNA agent is administered to a subject to treat a SNCA-associated disease or condition in conjunction with one or more additional therapeutic regimens for treating the SNCA-associate disease or condition. Non-limiting examples of additional therapeutic regimens are: administering one or more SNCA antisense polynucleotides of the invention, administering a non-SNCA dsRNA therapeutic agent, and a behavioral modification. An additional therapeutic regimen may be administered at a time that is one or more of: prior to, simultaneous with, and following administration of a SNCA dsRNA agent of the invention. It will be understood that simultaneous with as used herein, within five minutes of time zero, within 10 minutes of time zero, within 30 minutes of time zero, within 45 minutes of time zero, and within 60 minutes of time zero, with “time zero” the time of administration of the SNCA dsRNA agent of the invention to the subject. Non-limiting examples of non-SNCA dsRNA therapeutic agents are: carbidopa-levodopa, levodopa, entacopone, tolcapone, opicapone, pramipexole, ropinirole, apomorphine, rotigotine, selegiline, rasagiline, safinamide, amantadine, istradefylline, trihexyphenidyl, benztropine, rivastigmine, donepezil, galantamine, acetyl-L-carnitine, vinpocetine, huperzine A, alpha lipoic acid, vitamin E, rhodiola, biotin, galantamine (Reminyl) , tacrine (Cognex) , selegiline, physostigmine, revistigmin, donepezil, (Aricept) , rivastigmine (Exelon) , metrifonate, milameline, xanomeline, saeluzole, idebenone, ENA-713, mermic, quetiapine, neurestrol, idebenone, propentofylline, and neuromidal and memantine, or other agents included to treat SNCA-associated neurodegenerative disease in a subject disclosed herein or otherwise known in the art. Non-limiting examples of behavioral modifications are: physical, occupational and speech therapy, an exercise program including cardiorespiratory, resistance, flexibility, and gait and balance exercises, and deep brain stimulation (DBS) involving the implantation of an electrode into a targeted area of the brain. These and other therapeutic agents and behavior modifications are known in the art and used to treat a SNCA-associated disease or condition in a subject and may be administered to a subject in combination with the administration of one or more SNCA dsRNA agents of the invention to treat the SNCA-associated disease or condition. A SNCA dsRNA agent of the invention administered to a cell or subject to treat a SNCA-associated disease or condition may act in a synergistic manner with one or more other therapeutic agents or activities and increase the effectiveness of the one or more therapeutic agents or activities and / or to increase the effectiveness of the SNCA dsRNA agent at treating the SNCA-associated disease or condition.

[0247] Treatment methods of the invention that include administration of a SNCA dsRNA agent can be used prior to the onset of a SNCA-associated disease or condition and / or when a SNCA-associated disease or condition is present, including at an early stage, mid-stage, and late stage of the disease or condition and all times before and after any of these stages. Methods of the invention may also be to treat subjects who have previously been treated for a SNCA-associated disease or condition with one or more other therapeutic agents and / or therapeutic activities that were not successful, were minimally successful, and / or are no longer successful at treating the SNCA-associated disease or condition in the subject.

[0248] Vector Encoded dsRNAs

[0249] In certain embodiments of the invention, a SNCA dsRNA agent can be delivered into a cell using a vector. SNCA dsRNA agent transcription units can be included in a DNA or RNA vector. Prepare and use of such vectors encoding transgenes for delivering sequences into a cell and or subject are well known in the art. Vectors can be used in methods of the invention that result in transient expression of SNCA dsRNA, for example for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks. The length of the transient expression can be determined using routine methods based on elements such as, but not limited to the specific vector construct selected and the target cell and / or tissue. Such transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92: 1292) .

[0250] An individual strand or strands of a SNCA dsRNA agent can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced to a cell using means such as transfection or infection. In certain embodiments each individual strand of a SNCA dsRNA agent of the invention can be transcribed by promoters that are both included on the same expression vector. In certain embodiments of the invention a SNCA dsRNA agent is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the SNCA dsRNA agent has a stem and loop structure.

[0251] Non-limiting examples of RNA expression vectors are DNA plasmids or viral vectors. Expression vectors useful in embodiments of the invention can be compatible with eukaryotic cells. Eukaryotic cell expression vectors are routinely used in the art and are available from a number of commercial sources. Delivery of SNCA dsRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from a subject followed by reintroduction into the subject, or by any other means that allows for introduction into a desired target cell.

[0252] Viral vector systems that may be included in an embodiment of a method of the include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Constructs for the recombinant expression of a SNCA dsRNA agent may include regulatory elements, such as promoters, enhancers, etc., which may be selected to provide constitutive or regulated / inducible expression. Viral vector systems, and the use of promoters and enhancers, etc. are routine in the art and can be used in conjunction with methods and compositions described herein.

[0253] Certain embodiments of the invention include use of viral vectors for delivery of SNCA dsRNA agents into cells. Numerous adenovirus-based delivery systems are routinely used in the art for deliver to, for example, lung, liver, the central nervous system, endothelial cells, and muscle. Non-limiting examples of viral vectors that may be used in methods of the invention are: AAV vectors, a pox virus such as a vaccinia virus, a Modified Virus Ankara (MVA) , NYVAC, an avipox such as fowl pox or canary pox.

[0254] Certain embodiments of the invention include methods of delivering SNCA dsRNA agents into cells using a vector and such vectors may be in a pharmaceutically acceptable carrier that may, but need not, include a slow release matrix in which the gene delivery vehicle is imbedded. In some embodiments, a vector for delivering a SNCA dsRNA can be produced from a recombinant cell, and a pharmaceutical composition of the invention may include one or more cells that produced the SNCA dsRNA delivery system.

[0255] Pharmaceutical Compositions Containing SNCA dsRNA or ssRNA agents

[0256] Certain embodiments of the invention include use of pharmaceutical compositions containing a SNCA dsRNA agent or SNCA antisense polynucleotide agent and a pharmaceutically acceptable carrier. The pharmaceutical composition containing the SNCA dsRNA agent or SNCA antisense polynucleotide agent can be used in methods of the invention to reduce SNCA gene expression and SNCA activity in a cell and is useful to treat a SNCA-associated disease or condition. Such pharmaceutical compositions can be formulated based on the mode of delivery. Non-limiting examples of formulations for modes of delivery are: a composition formulated for subcutaneous delivery, a composition formulated for intrathecal delivery, a composition formulated for systemic administration via parenteral delivery, a composition formulated for intravenous (IV) delivery, a composition formulated for direct delivery into brain, etc. Administration of a pharmaceutic composition of the invention to deliver a SNCA dsRNA agent or SNCA antisense polynucleotide agent into a cell may be done using one or more means such as: topical (e.g., by a transdermal patch) , pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intracerebroventricular, intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intracerebroventricular, intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration. A SNCA dsRNA agent or SNCA antisense polynucleotide agent can also be delivered directly to a target tissue, for example directly into the liver, directly into a kidney, etc. It will be understood that “delivering a SNCA dsRNA agent” or “delivering a SNCA antisense polynucleotide agent” into a cell encompasses delivering a SNCA dsRNA agent or SNCA antisense polynucleotide agent, respectively, directly as well as expressing a SNCA dsRNA agent in a cell from an encoding vector that is delivered into a cell, or by any suitable means with which the SNCA dsRNA or SNCA antisense polynucleotide agent becomes present in a cell. Preparation and use of formulations and means for delivering inhibitory RNAs are well known and routinely used in the art.

[0257] As used herein, a “pharmaceutical composition” comprises a pharmacologically effective amount of a SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention and a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” refers to a carrier for administration of a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture medium. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binding agents may include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract. Agents included in drug formulations are described further herein below.

[0258] As used herein terms such as: “pharmacologically effective amount, ” “therapeutically effective amount” and “effective amount” refers to that amount of a SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention to produce the intended pharmacological, therapeutic or preventive result. For example, if a given clinical treatment is considered effective when there is at least a 10%reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary to effect at least a 10%reduction in that parameter. For example, a therapeutically effective amount of a SNCA dsRNA agent or SNCA antisense polynucleotide agent can reduce SNCA protein levels by at least 10%.

[0259] Effective amounts

[0260] Methods of the invention, in some aspects comprise contacting a cell with a SNCA dsRNA agent or SNCA antisense polynucleotide agent in an effective amount to reduce SNCA gene expression in the contacted cell. Certain embodiments of methods of the invention comprise administering a SNCA dsRNA agent or a SNCA antisense polynucleotide agent to a subject in an amount effective to reduce SNCA gene expression and treat a SNCA-associated disease or condition in the subject. An “effective amount” used in terms of reducing expression of SNCA and / or for treating a SNCA-associated disease or condition, is an amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of a SNCA dsRNA agent or SNCA antisense polynucleotide agent to treat a SNCA-associated disease or condition could be that amount necessary to (i) slow or halt progression of the disease or condition; or (ii) reverse, reduce, or eliminate one or more symptoms of the disease or condition. In some aspects of the invention, an effective amount is that amount of a SNCA dsRNA agent or SNCA antisense polynucleotide agent that when administered to a subject in need of a treatment of a SNCA-associated disease or condition, results in a therapeutic response that prevents and / or treats the disease or condition. According to some aspects of the invention, an effective amount is that amount of a SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention that when combined or co-administered with another therapeutic treatment for a SNCA-associated disease or condition, results in a therapeutic response that prevents and / or treats the disease or condition. In some embodiments of the invention, a biologic effect of treating a subject with a SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention may be the amelioration and or absolute elimination of symptoms resulting from the SNCA-associated disease or condition. In some embodiments of the invention, a biologic effect is the complete abrogation of the SNCA-associated disease or condition, as evidenced for example, by a diagnostic test that indicates the subject is free of the SNCA-associated disease or condition. A non-limiting example of a physiological symptom that may be detected includes a reduction in SNCA level in liver of a subject following administration of an agent of the invention. Additional art-known means of assessing the status of a SNCA-associated disease or condition can be used to determine an effect of an agent and / or methods of the invention on a SNCA-associated disease or condition.

[0261] Typically, an effective amount of a SNCA dsRNA agent or SNCA antisense polynucleotide agent to decrease SNCA polypeptide activity to a level to treat a SNCA-associated disease or condition will be determined in clinical trials, establishing an effective dose for a test population versus a control population in a blind study. In some embodiments, an effective amount will be that results in a desired response, e.g., an amount that diminishes a SNCA-associated disease or condition in cells, tissues, and / or subjects with the disease or condition. Thus, an effective amount of a SNCA dsRNA agent or SNCA antisense polynucleotide agent to treat a SNCA-associated disease or condition that can be treated by reducing SNCA polypeptide activity may be the amount that when administered decreases the amount of SNCA polypeptide activity in the subject to an amount that is less than the amount that would be present in the cell, tissue, and / or subject without the administration of the SNCA dsRNA agent or SNCA antisense polynucleotide agent. In certain aspects of the invention the level of SNCA polypeptide activity, and / or SNCA gene expression present in a cell, tissue, and / or subject that has not been contacted with or administered a SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention is referred to as a “control” amount. In some embodiments of methods of the invention a control amount for a subject is a pre-treatment amount for the subject, in other words, a level in a subject before administration of a SNCA agent can be a control level for that subject and compared to a level of SNCA polypeptide activity and / or SNCA gene expression in the subject following siRNA administered to the subject. In the case of treating a SNCA-associated disease or condition the desired response may be reducing or eliminating one or more symptoms of the disease or condition in the cell, tissue, and / or subject. The reduction or elimination may be temporary or may be permanent. It will be understood that the status of a SNCA-associated disease or condition can be monitored using methods of determining SNCA polypeptide activity, SNCA gene expression, symptom evaluation, clinical testing, etc. In some aspects of the invention, a desired response to treatment of a SNCA-associated disease or condition is delaying the onset or even preventing the onset of the disease or condition.

[0262] An effective amount of a compound that decreases SNCA polypeptide activity may also be determined by assessing physiological effects of administration of a SNCA dsRNA agent or SNCA antisense polynucleotide agent on a cell or subject, such as a decrease of a SNCA-associated disease or condition following administration. Assays and / or symptomatic monitoring of a subject can be used to determine efficacy of a SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention, which may be administered in a pharmaceutical compound of the invention, and to determine the presence or absence of a response to the treatment. A non-limiting example, is that one or more art-known tests of SNCA mRNA, α-synuclein protein, and / or the level of another parameter functionally linked to the level of expression of SNCA.

[0263] Some embodiments of the invention include methods of determining an efficacy of an dsRNA agent or SNCA antisense polynucleotide agent of the invention administered to a subject, to treat a SNCA-associated disease or condition by assessing and / or monitoring one or more “physiological characteristics” of the SNCA-associated disease or condition in the subject. Non-limiting examples of physiological characteristics of a SNCA-associated disease or condition are SNCA mRNA, α-synuclein protein, or the level of another parameter functionally linked to the level of expression of SNCA, etc. Standard means of determining such physiological characteristic are known in the art and include, but are not limited to, blood tests, imaging studies, physical examination, etc.

[0264] It will be understood that the amount of a SNCA dsRNA agent or SNCA antisense polynucleotide agent administered to a subject can be modified based, at least in part, on such determinations of disease and / or condition status and / or physiological characteristics determined for a subject. The amount of a treatment may be varied for example by increasing or decreasing the amount of a SNCA-dsRNA agent or SNCA antisense polynucleotide agent, by changing the composition in which the SNCA dsRNA agent or SNCA antisense polynucleotide agent, respectively, is administered, by changing the route of administration, by changing the dosage timing and so on. The effective amount of a SNCA dsRNA agent or SNCA antisense polynucleotide agent will vary with the particular condition being treated, the age and physical condition of the subject being treated; the severity of the condition, the duration of the treatment, the nature of the concurrent therapy (if any) , the specific route of administration, and additional factors within the knowledge and expertise of the health practitioner. For example, an effective amount may depend upon the desired level of SNCA polypeptide activity and or SNCA gene expression that is effective to treat the SNCA-associated disease or condition. A skilled artisan can empirically determine an effective amount of a particular SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention for use in methods of the invention without necessitating undue experimentation. Combined with the teachings provided herein, by selecting from among various SNCA dsRNA agents or SNCA antisense polynucleotide agents of the invention, and weighing factors such as potency, relative bioavailability, patient body weight, severity of adverse side-effects and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned that is effective to treat the particular subject. As used in embodiments of the invention, an effective amount of a SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention can be that amount that when contacted with a cell results in a desired biological effect in the cell.

[0265] It will be recognized that SNCA gene silencing may be determined in any cell expressing SNCA, either constitutively or by genomic engineering, and by any appropriate assay. In some embodiments of the invention, SNCA gene expression is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%by administration of a SNCA dsRNA agent of the invention. In some embodiments of the invention, SNCA gene expression is reduced by at between 5%and 10%, 5%and 25%, 10%and 50%, 10%and 75%, 25%and 75%, 25%and 100%, or 50%and 100%by administration of a SNCA dsRNA agent of the invention.

[0266] Dosing

[0267] SNCA dsRNA agents and SNCA antisense polynucleotide agents are delivered in pharmaceutical compositions in dosages sufficient to inhibit expression of SNCA genes. In certain embodiments of the invention, a dose of SNCA dsRNA agent or SNCA antisense polynucleotide agent is in a range of 0.01 to 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of 1 to 50 mg per kilogram body weight, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, 4 to 15 mg / kg body weight per day, inclusive. For example, the SNCA dsRNA agent or SNCA antisense polynucleotide agent can be administered in an amount that is from about 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3.0 mg / kg, 3.1 mg / kg, 3.2 mg / kg, 3.3 mg / kg, 3.4 mg / kg, 3.5 mg / kg, 3.6 mg / kg, 3.7 mg / kg, 3.8 mg / kg, 3.9 mg / kg, 4 mg / kg, 4.1 mg / kg, 4.2 mg / kg, 4.3 mg / kg, 4.4 mg / kg, 4.5 mg / kg, 4.6 mg / kg, 4.7 mg / kg, 4.8 mg / kg, 4.9 mg / kg, 5 mg / kg, 5.1 mg / kg, 5.2 mg / kg, 5.3 mg / kg, 5.4 mg / kg, 5.5 mg / kg, 5.6 mg / kg, 5.7 mg / kg, 5.8 mg / kg, 5.9 mg / kg, 6 mg / kg, 6.1 mg / kg, 6.2 mg / kg, 6.3 mg / kg, 6.4 mg / kg, 6.5 mg / kg, 6.6 mg / kg, 6.7 mg / kg, 6.8 mg / kg, 6.9 mg / kg, 7 mg / kg, 7.1 mg / kg, 7.2 mg / kg, 7.3 mg / kg, 7.4 mg / kg, 7.5 mg / kg, 7.6 mg / kg, 7.7 mg / kg, 7.8 mg / kg, 7.9 mg / kg, 8 mg / kg, 8.1 mg / kg, 8.2 mg / kg, 8.3 mg / kg, 8.4 mg / kg, 8.5 mg / kg, 8.6 mg / kg, 8.7 mg / kg, 8.8 mg / kg, 8.9 mg / kg, 9 mg / kg, 9.1 mg / kg, 9.2 mg / kg, 9.3 mg / kg, 9.4 mg / kg, 9.5 mg / kg, 9.6 mg / kg, 9.7 mg / kg, 9.8 mg / kg, 9.9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, through 50 mg / kg body per single dose.

[0268] Various factors may be considered in the determination of dosage and timing of delivery of a SNCA dsRNA agent of the invention. The absolute amount of a SNCA dsRNA agent or SNCA antisense polynucleotide agent delivered will depend upon a variety of factors including a concurrent treatment, the number of doses and the individual subject parameters including age, physical condition, size and weight. These are factors well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. In some embodiments, a maximum dose can be used, that is, the highest safe dose according to sound medical judgment.

[0269] Methods of the invention may in some embodiments include administering to a subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses of a SNCA dsRNA agent or SNCA antisense polynucleotide agent. In some instances, a pharmaceutical compound, (e.g., comprising a SNCA dsRNA agent or comprising a SNCA antisense polynucleotide agent) can be administered to a subject at least daily, every other day, weekly, every other week, monthly, etc. Doses may be administered once per day or more than once per day, for example, 2, 3, 4, 5, or more times in one 24 hour period. A pharmaceutical composition of the invention may be administered once daily, or the SNCA dsRNA agent or SNCA antisense polynucleotide agent may be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In some embodiments of methods of the invention, a pharmaceutical composition of the invention is administered to a subject one or more times per day, one or more times per week, one or more times per month, or one or more times per year.

[0270] Methods of the invention, in some aspects, include administration of a pharmaceutical compound alone, in combination with one or more other SNCA dsRNA agents or SNCA antisense polynucleotide agents, and / or in combination with other drug therapies or treatment activities or regimens that are administered to subjects with a SNCA-associated disease or condition. Pharmaceutical compounds may be administered in pharmaceutical compositions. Pharmaceutical compositions used in methods of the invention may be sterile and contain an amount of a SNCA dsRNA agent or SNCA antisense polynucleotide agent that will reduce activity of a SNCA polypeptide to a level sufficient to produce the desired response in a unit of weight or volume suitable for administration to a subject. A dose administered to a subject of a pharmaceutical composition that includes a SNCA dsRNA agent or SNCA antisense polynucleotide agent to reduce SNCA protein activity can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits.

[0271] Treatment

[0272] As used herein, “SNCA-associated disease” , “SNCA-associated diseases and conditions” and “diseases and conditions caused and / or modulated by SNCA” is intended to include any disease associated with the SNCA gene or protein. Such diseases may be caused, for example, by overproduction of SNCA protein, by mutation of the SNCA gene, by abnormal cleavage of the SNCA protein, by abnormal interaction between SNCA and other proteins or other endogenous or exogenous substances. Exemplary SNCA-associated diseases include, but are not limited to: Parkinson’s Disease (PD) , multisystemic atrophy (MSA) , Lewy Body Dementia (LBD) , pure Autonomic Failure (PAF) , Pick's disease, progressive supranuclear palsy, dementia pugilistica, chromosome 17-related parkinsonism, Lytico-Bodig disease, tangle predominant dementia, Argyrophilic grain disease, silver-philic granulosis, gangliocytoma, meningioma, subacute sclerotic encephalitis, lead-poisoning encephalopathy, tuberous sclerosis, hallervorden-Spatz disease, lipofuscin deposition, corticobasal degeneration, frontotemporal dementia, frontotemporal lobar degeneration, Alzheimer's disease, Huntington's disease, Down's syndrome, psychosis, schizophrenia, and / or Crottzfeldt-Jab disease, or other disorders related to SNCA expression.

[0273] In certain aspects of the invention, a subject may be administered a SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention at a time that is one or more of before or after diagnosis of a SNCA-associated disease or condition. In some aspects of the invention, a subject is at risk of having or developing a SNCA-associated disease or condition. A subject at risk of developing a SNCA-associated disease or condition is one who has an increased probability of developing the SNCA-associated disease or condition, compared to a control risk of developing the SNCA-associated disease or condition. In some embodiments of the invention, a level of risk may be statistically significant compared to a control level of risk. A subject at risk may include, for instance, a subject who is, or will be, a subject who has a preexisting disease and / or a genetic abnormality that makes the subject more susceptible to a SNCA-associated disease or condition than a control subject without the preexisting disease or genetic abnormality; a subject having a family and / or personal medical history of the SNCA-associated disease or condition; and a subject who has previously been treated for a SNCA-associated disease or condition. It will be understood that a preexisting disease and / or a genetic abnormality that makes the subject more susceptible to a SNCA-associated disease or condition, may be a disease or genetic abnormality that when present has been previously identified as having a correlative relation to a higher likelihood of developing a SNCA-associated disease or condition.

[0274] It will be understood that a SNCA dsRNA agent or SNCA antisense polynucleotide agent may be administered to a subject based on a medical status of the individual subject. For example, a health-care provided for a subject may assess a SNCA level measured in a sample obtained from a subject and determine it is desirable to reduce the subject’s SNCA level, by administration of a SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention. In this example, the SNCA level may be considered to be a physiological characteristic of a SNCA-associated condition, even if the subject is not diagnosed as having a SNCA-assoicated disease such as one disclosed herein. A healthcare provider may monitor changes in the subject’s SNCA level, as a measure of efficacy of the administered SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention. In a non-limiting example, a biological sample, such as a blood or tissue sample may be obtained from a subject and a SNCA level for the subject determined in the sample. A SNCA dsRNA agent or SNCA antisense polynucleotide agent is administered to the subject and a blood sample is obtained from the subject following the administration and the SNCA level determined using the sample and the results compared to the results determined in the subject’s pre-administration (prior) sample. A reduction in the subject’s SNCA level in the later sample compared to the pre-administration level indicates the administered SNCA dsRNA agent or SNCA antisense polynucleotide agent efficacy in reducing the SNCA level in the subject.

[0275] Certain embodiments of methods of the invention include adjusting a treatment that includes administering a dsRNA agent or a SNCA antisense polynucleotide agent of the invention to a subject based at least in part on assessment of a change in one or more of the subject’s physiological characteristics of a SNCA-associated disease or condition resulting from the treatment. For example, in some embodiments of the invention, an effect of an administered dsRNA agent or SNCA antisense polynucleotide agent of the invention may be determined for a subject and used to assist in adjusting an amount of a dsRNA agent or SNCA antisense polynucleotide agent of the invention subsequently administered to the subject. In a non-limiting example, a subject is administered a dsRNA agent or SNCA antisense polynucleotide agent of the invention, the subject’s SNCA level is determined after the administration, and based at least in part on the determined level, a greater amount of the dsRNA agent or SNCA antisense polynucleotide agent is determined to be desirable in order to increase the physiological effect of the administered agent, for example to reduce or further reduce the subject’s SNCA level. In another non-limiting example, a subject is administered a dsRNA agent or SNCA antisense polynucleotide agent of the invention, the subject’s SNCA level is determined after the administration and based at least in part on the determined level, a lower amount of the dsRNA agent or SNCA antisense polynucleotide agent is desirable to administer to the subject.

[0276] Thus, some embodiments of the invention include assessing a change in one or more physiological characteristics of resulting from a subject’s previous treatment to adjust an amount of a dsRNA agent or SNCA antisense polynucleotide agent of the invention subsequently administered to the subject. Some embodiments of methods of the invention include 1, 2, 3, 4, 5, 6, or more determinations of a physiological characteristic of a SNCA-associated disease or condition to assess and / or monitor the efficacy of an administered SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention, and optionally using the determinations to adjust one or more of: a dose, administration regimen, and or administration frequency of a dsRNA agent or SNCA antisense polynucleotide agent of the invention to treat a SNCA-associated disease or condition in a subject. In some embodiments of methods of the invention, a desired result of administering an effective amount of a dsRNA agent or SNCA antisense polynucleotide agent of the invention to a subject is a reduction of the subject’s SNCA mRNA, α-synuclein protein, or the level of another parameter functionally linked to the level of expression of SNCA, etc, as compared to a prior level determined for the subject, or to a control level.

[0277] As used herein, the terms “treat” , “treated” , or “treating” when used with respect to a SNCA-associated disease or condition may refer to a prophylactic treatment that decreases the likelihood of a subject developing the SNCA-associated disease or condition, and also may refer to a treatment after the subject has developed a SNCA-associated disease or condition in order to eliminate or reduce the level of the SNCA-associated disease or condition, prevent the SNCA-associated disease or condition from becoming more advanced (e.g., more severe) , and / or slow the progression of the SNCA-associated disease or condition in a subject compared to the subject in the absence of the therapy to reduce activity in the subject of SNCA polypeptide.

[0278] Certain embodiments of agents, compositions, and methods of the invention can be used to inhibit SNCA gene expression. As used herein in reference to expression of a SNCA gene, the terms “inhibit, ” “silence, ” “reduce, ” “down-regulate, ” and “knockdown” mean the expression of the SNCA gene, as measured by one or more of: a level of RNA transcribed from the gene, a level of activity of SNCA expressed, and a level of SNCA polypeptide, protein or protein subunit translated from the mRNA in a cell, group of cells, tissue, organ, or subject in which the SNCA gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is contacted with (e.g., treated with) a SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention, compared to a control level of RNA transcribed from the SNCA gene, a level of activity of expressed SNCA, or a level of SNCA translated from the mRNA, respectively. In some embodiments, a control level is a level in a cell, tissue, organ or subject that has not been contacted with (e.g., treated with) the SNCA dsRNA agent or SNCA antisense polynucleotide agent.

[0279] Administration methods

[0280] A variety of administration routes for a SNCA dsRNA agent or SNCA antisense polynucleotide agent are available for use in methods of the invention. The particular delivery mode selected will depend at least in part, upon the particular condition being treated and the dosage required for therapeutic efficacy. Methods of this invention, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of treatment of a SNCA-associated disease or condition without causing clinically unacceptable adverse effects. The siRNA molecules of the disclosure can be delivered directly to the CNS or neurons of a subject in need of SNCA silencing by way of, for example, injection intrathecally, intracerebroventricularly, intrastriatally, intraparenchymally, direct injection into a specific nerve or ganglion (ganglia) (e.g., trigeminal or dorsal root ganglia) , intra-cisterna magna injection, such as by catheterization, intravenous injection, subcutaneous injection, or intramuscular injection. In some embodiments of the invention, a SNCA dsRNA agent or SNCA antisense polynucleotide agent may be administered via an oral, enteral, mucosal, subcutaneous, and / or parenteral route. The term “parenteral” includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal, and intrasternal injection, or infusion techniques. Other routes include but are not limited to nasal (e.g., via a gastro-nasal tube) , dermal, vaginal, rectal, sublingual, and inhalation. Delivery routes of the invention may include intrathecal, intraventricular, intracerebroventricular (ICV) , intrastriatal, intraparenchymal, intra-cisterna magna or intracranial.

[0281] Some embodiments of the method include injection intrathecally or by intra-cisterna magna injection by catheterization. Some embodiments of the method include direct injection into a specific nerve or ganglion (ganglia) (e.g., trigeminal or dorsal root ganglia) .

[0282] Intrathecal injection is the direct injection into the spinal column or subarachnoid space. By injecting directly into the CSF of the spinal column the siRNA molecules of the disclosure have direct access to cells (e.g., neurons and glial cells) in the spinal column and a route to access the cells in the brain by bypassing the blood brain barrier, or a route to access cell bodies of those neurons that are outside the blood brain barrier.

[0283] Intracerebroventricular (ICV) injection is a method to directly inject into the CSF of the cerebral ventricles. Similar to intrathecal injection, ICV is a method of injection which bypasses the blood brain barrier. Using ICV allows the advantage of access to the cells of the brain and spinal column without the danger of the therapeutic being degraded in the blood.

[0284] Intrastriatal injection is the direct injection into the striatum, or corpus striatum. The striatum is an area in the subcortical basal ganglia in the brain. Injecting into the striatum bypasses the blood brain barrier and the pharmacokinetic challenges of injection into the blood stream and allows for direct access to the cells of the brain.

[0285] Intraparenchymal administration is the direct injection into the parenchyma (e.g., the brain parenchyma) . Injection into the brain parenchyma allows for injection directly into brain regions affected by a disease or disorder while bypassing the blood brain barrier.

[0286] Intra-cisterna magna injection by catheterization is the direct injection into the cisterna magna. The cisterna magna is the area of the brain located between the cerebellum and the dorsal surface of the medulla oblongata. Injecting into the cisterna magna results in more direct delivery to the cells of the cerebellum, brainstem, and spinal cord. In some embodiments of the methods described herein, the therapeutic composition may be delivered to the subject by way of systemic administration, e.g., intravenously, intramuscularly, or subcutaneously.

[0287] Intravenous (IV) injection is a method to directly inject into the bloodstream of a subject. The IV administration may be in the form of a bolus dose or by way of continuous infusion, or any other method tolerated by the therapeutic composition.

[0288] Intramuscular (IM) injection is injection into a muscle of a subject, such as the deltoid muscle or gluteal muscle. IM may allow for rapid absorption of the therapeutic composition.

[0289] In some embodiments of the invention, a SNCA dsRNA agent or a SNCA antisense polynucleotide agent may be placed within a slow-release matrix and administered by placement of the matrix in the subject. In some aspects of the invention, a SNCA dsRNA agent or SNCA antisense polynucleotide agent may be delivered to a subject cell using nanoparticles coated with a delivery agent that targets a specific cell or organelle. Various delivery means, methods, agents are known in the art. Non-limiting examples of delivery methods and delivery agents are additionally provided elsewhere herein. In some aspects of the invention, the term “delivering” in reference to a SNCA dsRNA agent or SNCA antisense polynucleotide agent may mean administration to a cell or subject of one or more “naked” SNCA dsRNA agent or SNCA antisense polynucleotide agent sequences and in certain aspects of the invention “delivering” means administration to a cell or subject via transfection means, delivering a cell comprising a SNCA dsRNA agent or a SNCA antisense polynucleotide agent to a subject, delivering a vector encoding a SNCA dsRNA agent or SNCA antisense polynucleotide agent into a cell and / or subject, etc. Delivery of a SNCA dsRNA agent or SNCA antisense polynucleotide agent using a transfection means may include administration of a vector to a cell and / or subject.

[0290] In some methods of the invention one or more SNCA dsRNA agents or SNCA antisense polynucleotide agents may be administered in formulations, which may be administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients. In some embodiments of the invention a SNCA dsRNA agent or SNCA antisense polynucleotide agent may be formulated with another therapeutic agent for simultaneous administration. According to methods of the invention, a SNCA dsRNA agent or SNCA antisense polynucleotide agent may be administered in a pharmaceutical composition. In general, a pharmaceutical composition comprises a SNCA dsRNA agent or SNCA antisense polynucleotide agent and optionally, a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well-known to those of ordinary skill in the art. As used herein, a pharmaceutically acceptable carrier means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients, e.g., the ability of the SNCA dsRNA agent or SNCA antisense polynucleotide agent to inhibit SNCA gene expression in a cell or subject. Numerous methods to administer and deliver dsRNA agents or SNCA antisense polynucleotide agents for therapeutic use are known in the art and may be utilized in methods of the invention.

[0291] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers and other materials that are well-known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Pat. No. 5,211,657 and others are known by those skilled in the art. Such preparations may routinely contain salt, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.

[0292] Some embodiments of methods of the invention include administering one or more SNCA dsRNA agents or SNCA antisense polynucleotide agents directly to a tissue. In some embodiments, the tissue to which the compound is administered is a tissue in which the SNCA-associated disease or condition is present or is likely to arise, non-limiting examples of which are the brain. Direct tissue administration may be achieved by direct injection or other means. Many orally delivered compounds naturally travel to and through the liver and kidneys and some embodiments of treatment methods of the invention include oral administration of one or more SNCA dsRNA agents to a subject. SNCA dsRNA agents or SNCA antisense polynucleotide agents, either alone or in conjunction with other therapeutic agents, may be administered once, or alternatively they may be administered in a plurality of administrations. If administered multiple times, the SNCA dsRNA agent or SNCA antisense polynucleotide agent may be administered via different routes. For example, though not intended to be limiting, a first (or first several) administrations may be made via subcutaneous means and one or more additional administrations may be oral and / or systemic administrations.

[0293] For embodiments of the invention in which it is desirable to administer a SNCA dsRNA agent or SNCA antisense polynucleotide agent systemically, the SNCA dsRNA agent or SNCA antisense polynucleotide agent may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with or without an added preservative. SNCA dsRNA agent formulations (also referred to as pharmaceutical compositions) may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents.

[0294] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's , or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose) , and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. Lower doses will result from other forms of administration, such as intravenous administration. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. Multiple doses per day may be used as needed to achieve appropriate systemic or local levels of one or more SNCA dsRNA agents or SNCA antisense polynucleotide agents and to achieve appropriate reduction in SNCA protein activity.

[0295] In yet other embodiments, methods of the invention include use of a delivery vehicle such as biocompatible microparticle, nanoparticle, or implant suitable for implantation into a recipient, e.g., a subject. Exemplary bioerodible implants that may be useful in accordance with this method are described in PCT Publication No. WO 95 / 24929 (incorporated by reference herein) , which describes a biocompatible, biodegradable polymeric matrix for containing a biological macromolecule.

[0296] Both non-biodegradable and biodegradable polymeric matrices can be used in methods of the invention to deliver one or more SNCA dsRNA agents or SNCA antisense polynucleotide agents to a subject. In some embodiments, a matrix may be biodegradable. Matrix polymers may be natural or synthetic polymers. A polymer can be selected based on the period of time over which release is desired, generally in the order of a few hours to a year or longer. Typically, release over a period ranging from between a few hours and three to twelve months can be used. The polymer optionally is in the form of a hydrogel that can absorb up to about 90%of its weight in water and further, optionally is cross-linked with multivalent ions or other polymers.

[0297] In general, SNCA dsRNA agents or SNCA antisense polynucleotide agents may be delivered in some embodiments of the invention using the bioerodible implant by way of diffusion, or by degradation of the polymeric matrix. Exemplary synthetic polymers for such use are well known in the art. Biodegradable polymers and non-biodegradable polymers can be used for delivery of SNCA dsRNA agents or SNCA antisense polynucleotide agents using art-known methods. Bioadhesive polymers such as bioerodible hydrogels (see H.S. Sawhney, C.P. Pathak and J. A. Hubell in Macromolecules, 1993, 26, 581-587, the teachings of which are incorporated by reference herein) may also be used to deliver SNCA dsRNA agents or SNCA antisense polynucleotide agents for treatment of a SNCA-associated disease or condition. Additional suitable delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of a SNCA dsRNA agent or SNCA antisense polynucleotide agent, increasing convenience to the subject and the medical care professional. Many types of release delivery systems are available and known to those of ordinary skill in the art. (See for example: U.S. Pat. Nos. 5,075,109; 4,452,775; 4,675,189; 5,736,152; 3,854,480; 5,133,974; and 5,407,686 (the teaching of each of which is incorporated herein by reference) . In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.

[0298] Use of a long-term sustained release implant may be suitable for prophylactic treatment of subjects and for subjects at risk of developing a recurrent SNCA-associated disease or condition. Long-term release, as used herein, means that the implant is constructed and arranged to deliver a therapeutic level of a SNCA dsRNA agent or SNCA antisense polynucleotide agent for at least up to 10 days, 20 days, 30 days, 60 days, 90 days, six months, a year, or longer. Long-term sustained release implants are well-known to those of ordinary skill in the art and include some of the release systems described above.

[0299] Therapeutic formulations of SNCA dsRNA agents or SNCA antisense polynucleotide agents may be prepared for storage by mixing the molecule or compound having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers [Remington's Pharmaceutical Sciences 21st edition, (2006) ] , in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol) ; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes) ; and / or non-ionic surfactants such as or polyethylene glycol (PEG) .

[0300] Cells, Subjects, and Controls

[0301] Methods of the invention may be used in conjunction with cells, tissues, organs and / or subjects. In some aspects of the invention a subject is a human or vertebrate mammal including but not limited to a dog, cat, horse, cow, goat, mouse, rat, and primate, e.g., monkey. Thus, the invention can be used to treat SNCA-associated diseases or conditions in human and non-human subjects. In some aspects of the invention a subject may be a farm animal, a zoo animal, a domesticated animal or non-domesticated animal and methods of the invention can be used in veterinary prevention and treatment regimens. In some embodiments of the invention, the subject is a human and methods of the invention can be used in human prevention and treatment regimens.

[0302] Non-limiting examples of subjects to which the present invention can be applied are subjects who are diagnosed with, suspected of having, or at risk of having a disease or condition associated with a higher than desirable SNCA expression and / or activity, also referred to as “elevated levels of SNCA expression” . Non-limiting examples of diseases and conditions associated with a higher than desirable levels of SNCA expression and / or activity are described elsewhere herein. Methods of the invention may be applied to a subject who, at the time of treatment, has been diagnosed as having the disease or condition associated with a higher than desirable SNCA expression and / or activity, or a subject who is considered to be at risk for having or developing a disease or condition associated with a higher than desirable SNCA expression and / or activity. In some aspects of the invention a disease or condition associated with a higher than desirable SNCA level of expression and / or activity is an acute disease or condition, and in certain aspects of the invention a disease or condition associated with a higher than desirable SNCA level of expression and / or activity is a chronic disease or condition.

[0303] In a non-limiting example, a SNCA dsRNA agent of the invention is administered to a subject diagnosed with, suspected of having, or at risk of having symptoms of SNCA-associated neurodegenerative disease, which is a disease in which it is desirable to reduce SNCA expression. Methods of the invention may be applied to the subject who, at the time of treatment, has been diagnosed as having the disease or condition, or a subject who is considered to be at risk for having or developing the disease or condition.

[0304] In another non-limiting example, a SNCA dsRNA agent of the invention is administered to a subject diagnosed with, suspected of having, or at risk of having symptoms of PD, which is a disease in which it is desirable to reduce SNCA expression. Methods of the invention may be applied to the subject who, at the time of treatment, has been diagnosed as having the disease or condition, or a subject who is considered to be at risk for having or developing the disease or condition.

[0305] A cell to which methods of the invention may be applied include cells that are in vitro, in vivo, ex vivo cells. Cells may be in a subject, in culture, and / or in suspension, or in any other suitable state or condition. A cell to which a method of the invention may be applied can be a liver cell, a hepatocyte, a brain cell, a spine cell, a cardiac cell, a pancreatic cell, a cardiovascular cell, kidney cell or other type of vertebrate cell, including human and non-human mammalian cells. In some embodiments, the cell is a neuronal cell. In some embodiments, the neuronal cell or tissue is a peripheral sensory neuron, e.g., a peripheral sensory neuron in a dorsal root ganglion, or a nociceptive neuron, e.g., an A-delta fiber or a C-type fiber. In certain aspects of the invention, a cell to which methods of the invention may be applied is a healthy, normal cell that is not known to be a disease cell. In certain embodiments of the invention a cell to which methods and compositions of the invention are applied to a liver cell, a hepatocyte, a brain cell, a spine cell, a cardiac cell, a pancreatic cell, a cardiovascular cell, and / or a kidney cell. In certain aspects of the invention, a control cell is a normal cell, but it will be understood that a cell having a disease or condition may also serve as a control cell in particular circumstances for example to compare results in a treated cell having a disease or condition versus an untreated cell having the disease or condition, etc.

[0306] A level of SNCA polypeptide activity can be determined and compared to control level of SNCA polypeptide activity, according to methods of the invention. A control may be a predetermined value, which can take a variety of forms. It can be a single cut-off value, such as a median or mean. It can be established based upon comparative groups, such as in groups having normal levels of SNCA polypeptide and / or SNCA polypeptide activity and groups having increased levels of SNCA polypeptide and / or SNCA polypeptide activity. Another non-limiting example of comparative groups may be groups having one or more symptoms of or a diagnosis of a SNCA-associated disease or condition; groups without having one or more symptoms of or a diagnosis of the disease or condition; groups of subjects to whom an siRNA treatment of the invention has been administered; groups of subjects to whom an siRNA treatment of the invention has not been administered. Typically, a control may be based on apparently healthy normal individuals in an appropriate age bracket or apparently healthy cells. It will be understood that controls according to the invention may be, in addition to predetermined values, samples of materials tested in parallel with the experimental materials. Examples include samples from control populations or control samples generated through manufacture to be tested in parallel with the experimental samples. In some embodiments of the invention, a control may include a cell or subject not contacted or treated with a SNCA dsRNA agent of the invention and in such instances, a control level of SNCA polypeptide and / or SNCA polypeptide activity can be compared to a level of SNCA polypeptide and / or SNCA polypeptide activity in a cell or subject contacted with a SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention.

[0307] In some embodiments of the invention a level of SNCA polypeptide determined for a subject can be a control level against which a level of SNCA polypeptide determined for the same subject at a different time is compared. In a non-limiting example, a level of SNCA is determined in a biological sample obtained from a subject who has not been administered a SNCA treatment of the invention. In some embodiments, the biological sample is a tissue sample. The level of SNCA polypeptide determined in the sample obtained from the subject can serve as a baseline or control value for the subject. After one or more administrations of a SNCA dsRNA agent to the subject in a treatment method of the invention, one or more additional tissue samples can be obtained from the subject and the level of SNCA polypeptide in the subsequent sample or samples can be compared to the control / baseline level for the subject. Such comparisons can be used to assess onset, progression, or recession of a SNCA associated disease or condition in the subject. For example, a level of SNCA polypeptide in the baseline sample obtained from the subject that is higher than a level obtained from the same subject after the subject has been administered a SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention indicates regression of the SNCA-associated disease or condition and indicates efficacy of the administered SNCA dsRNA agent of the invention for treatment of the SNCA-associated disease or condition.

[0308] In some aspects of the invention, values of one or more of a level of SNCA polypeptide and / or SNCA polypeptide activity determined for a subject may serve as control values for later comparison of levels of SNCA polypeptide and / or SNCA activity, in that same subject, thus permitting assessment of changes from a “baseline” SNCA polypeptide activity in a subject. Thus, an initial SNCA polypeptide level and / or initial SNCA polypeptide activity level may be present and / or determined in a subject and methods and compounds of the invention may be used to decrease the level of SNCA polypeptide and / or SNCA polypeptide activity in the subject, with the initial level serving as a control level for that subject.

[0309] Using methods of the invention, SNCA dsRNA agents and / or SNCA antisense polynucleotide agents of the invention may be administered to a subject. Efficacy of the administration and treatment of the invention can be assessed when a level of SNCA polypeptide in a tissue sample obtained from a subject is decreased by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to a pre-administration level of SNCA polypeptide in a tissue sample obtained from the subject at a prior time point, or compared to a non-contacted control level, for example a level of SNCA polypeptide in a control tissue sample. It will be understood that a level of SNCA polypeptide and a level of SNCA polypeptide activity both correlate with a level of SNCA gene expression. Certain embodiments of methods of the invention comprise administering a SNCA dsRNA and / or SNCA antisense agent of the invention to a subject in an amount effective to inhibit SNCA gene expression and thereby reduce a level of SNCA polypeptide and reduce a level of SNCA polypeptide activity in the subject.

[0310] Some embodiments of the invention, include determining presence, absence, and / or an amount (also referred to herein as a level) of SNCA polypeptide in one or more biological samples obtained from one or more subjects. The determination can be used to assess efficacy of a treatment method of the invention. For example, methods and compositions of the invention can be used to determine a level of SNCA polypeptide in a biological sample obtained from a subject previously treated with administration of a SNCA dsRNA agent and / or a SNCA antisense agent of the invention. A level of SNCA polypeptide determined in a tissue sample obtained from the treated subject that is lower by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to a pretreatment level of SNCA polypeptide determined for the subject, or compared to a non-contacted control biological sample level, indicates a level of efficacy of the treatment administered to the subject.

[0311] In some embodiments of the invention a physiological characteristic of a SNCA-associated disease or condition determined for a subject can be a control determination against which a determination of the physiological characteristic in the same subject at a different time is compared. In a non-limiting example, a physiological characteristic such as SNCA mRNA, α-synuclein protein, or the level of another parameter functionally linked to the level of expression of SNCA in the plasma or the tissue sample is determined in a biological sample, such as a tissue sample, obtained from a subject who has not been administered a SNCA treatment of the invention. The SNCA mRNA level (and / or other physiological characteristic of a SNCA disease or condition) determined in the sample obtained from the subject can serve as a baseline or control value for the subject. After one or more administrations of a SNCA dsRNA agent to the subject in a treatment method of the invention, one or more additional tissue samples can be obtained from the subject and SNCA mRNA, α-synuclein protein, or the level of another parameter functionally linked to the level of expression of SNCA in the subsequent sample or samples are compared to the control / baseline level and / or ratio, respectively, for the subject. Such comparisons can be used to assess onset, progression, or recession of a SNCA associated disease or condition in the subject. For example, SNCA mRNA level in the baseline sample obtained from the subject that is higher than SNCA mRNA level determined in a sample obtained from the same subject after the subject has been administered a SNCA dsRNA agent or SNCA antisense polynucleotide agent of the invention indicates regression of the SNCA-associated disease or condition and indicates efficacy of the administered SNCA dsRNA agent of the invention for treatment of the SNCA-associated disease or condition.

[0312] In some aspects of the invention, values of one or more of a physiological characteristic of a SNCA-associcated disease or condition determined for a subject may serve as control values for later comparison of the physiological characteristics in that same subject, thus permitting assessment of changes from a “baseline” physiological characteristic in a subject. Thus, an initial physiological characteristic may be present and / or determined in a subject and methods and compounds of the invention may be used to decrease the level of SNCA polypeptide and / or SNCA polypeptide activity in the subject, with the initial physiological characteristic determination serving as a control for that subject.

[0313] Using methods of the invention, SNCA dsRNA agents and / or SNCA antisense polynucleotide agents of the invention may be administered to a subject in an effective amount to treat a SNCA disease or condition. Efficacy of the administration and treatment of the invention can be assessed by determining a change in one or more physiological characteristics of the SNCA disease or condition. In a non-limiting example, a SNCA mRNA level in a tissue sample obtained from a subject is decreased by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to a pre-administration SNCA mRNA level in a tissue sample obtained from the subject at a prior time point, or compared to a non-contacted control level, for example SNCA mRNA level in a control tissue sample. It will be understood that SNCA mRNA, α-synuclein protein, or the level of another parameter functionally linked to the level of expression of SNCA in the plasma or the tissue sample each correlates with a level of SNCA gene expression. Certain embodiments of methods of the invention comprise administering a SNCA dsRNA and / or SNCA antisense agent of the invention to a subject in an amount effective to inhibit SNCA gene expression and thereby reduce SNCA mRNA, α-synuclein protein, or the level of another parameter functionally linked to the level of expression of SNCA in the subject, or otherwise positively impact a physiological characteristic of a SNCA-associated disease or condition in the subject.

[0314] Some embodiments of the invention, include determining presence, absence, and / or a change in a physiological characteristic of a SNCA-associated disease or condition using methods such as but not limited to: (1) assessing one or more biological samples obtained from one or more subjects for the physiological characteristic; (2) imaging a subject (for example but not limited to obtaining a liver image) ; and (3) or physical examination of the subject. The determination can be used to assess efficacy of a treatment method of the invention.

[0315] Kits

[0316] Also within the scope of the invention are kits that comprise one or more SNCA dsRNA agents and / or SNCA antisense polynucleotide agents and instructions for its use in methods of the invention. Kits of the invention may include one or more of a SNCA dsRNA agent, SNCA sense polynucleotide, and SNCA antisense polynucleotide agent that may be used to treat a SNCA-associated disease or condition. Kits containing one or more SNCA dsRNA agents, SNCA sense polynucleotides, and SNCA antisense polynucleotide agents can be prepared for use in treatment methods of the invention. Components of kits of the invention may be packaged either in aqueous medium or in lyophilized form. A kit of the invention may comprise a carrier being compartmentalized to receive in close confinement therein one or more container means or series of container means such as test tubes, vials, flasks, bottles, syringes, or the like. A first container means or series of container means may contain one or more compounds such as a SNCA dsRNA agent and / or SNCA sense or antisense polynucleotide agent. A second container means or series of container means may contain a targeting agent, a labelling agent, a delivery agent, etc. that may be included as a portion of a SNCA dsRNA agent and / or SNCA antisense polynucleotide to be administered in an embodiment of a treatment method of the invention.

[0317] A kit of the invention may also include instructions. Instructions typically will be in written form and will provide guidance for carrying-out a treatment embodied by the kit and for making a determination based upon that treatment.

[0318] The following examples are provided to illustrate specific instances of the practice of the present invention and are not intended to limit the scope of the invention. As will be apparent to one of ordinary skill in the art, the present invention will find application in a variety of compositions and methods.

[0319] Examples

[0320] Example 1. Phosphoramidite Compound 1

[0321] To a solution of compound B (500 mg, 1.11 mmol, 1.0 eq) in DCM (5.0 mL) was added compound D (607 mg, 3.34 mmol, 3.0 eq) and DIEA (432 mg, 3.34 mmol, 582 μL, 3.0 eq) under N2 atmosphere at 0-5 ℃, the mixture was stirred at 25 ℃ for 1.0 hrs. LC-MS showed Compound B was consumed completely, several new peaks were shown on LC-MS and ~70.9%of desired compound was detected. The resulting reaction mixture was cooled to -20 ℃ and poured into cold (0-5 ℃) sat. NaHCO3 (5.0 mL) solution, extracted with DCM (5.0 mL *2) , the combined organic layers were washed with cold (0-5 ℃) sat. NaHCO3 / brine =1: 1 (5.0 mL / 5.0 mL) , dried over Na2SO4 and concentrated in vacuum to get the residue (~5 mL) . The residue was purified by column chromatography (alkaline Al2O3, Petroleum ether / Ethyl acetate=10 / 1 to 5 / 1, 0.1%Et3N) to give compound 1 (280 mg, 471 μmol, 42.3%yield) was obtained as a white solid. 1H NMR: EC10615-49-P1N (400 MHz, DMSO-d6) δ ppm 7.44 (br d, J=7.63 Hz, 2 H) , 7.31 (br t, J=7.94 Hz, 6 H) , 7.18 -7.26 (m, 1 H) , 6.89 (brd, J=8.00 Hz, 4 H) , 4.08 -4.13 (m, 1 H) , 3.95 -4.03 (m, 1 H) , 3.84 -3.93 (m, 1 H) , 3.77 -3.83 (m, 1 H) , 3.74 (s, 6 H) , 3.43 -3.53 (m, 3 H) , 3.38 (br d, J=6.75 Hz, 1 H) , 2.94 -3.04 (m, 1 H) , 2.70 -2.85 (m, 1 H) , 1.09 -1.15 (m, 12 H) , 1.07 (br s, 3 H) .

[0322] Example 2. Phosphoramidite Compound 2

[0323] DMTrCl (232 g, 684 mmol, 1.0 eq) in pyridine (400 mL) was added to the solution of isomannide compound A (100 g, 684 mmol, 1.0 eq) in pyridine (600 mL) , and the mixture was stirred at 25 ℃ for 12 hrs. LC-MS showed compound A was consumed completely and one main peak with desired mass was detected. The resulting reaction mixture was diluted with water (500 mL) , extracted with DCM (500 mL *2) , and the combined organic phases were washed with brine (500 mL) , dried over Na2SO4 and concentrated in vacuum to get the residue. The residue was purified by column chromatography (DCM / MeOH=100 / 1 to 50 / 1, 0.1%Et3N) to give compound B (150 g, 48.9%yield) a yellow solid.

[0324] 1H NMR: EC4783-404-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.46 (br d, J=7.63 Hz, 2 H) 7.28 -7.37 (m, 6 H) 7.19 -7.25 (m, 1 H) 6.90 (br d, J=7.88 Hz, 4 H) 4.70 (d, J=6.50 Hz, 1 H) 3.99 -4.09 (m, 6 H) 3.88 -3.96 (m, 2 H) 3.83 (br dd, J=7.82, 6.94 Hz, 1 H) 3.74 (s, 6 H) 3.41 (br t, J=8.13 Hz, 1 H) 3.05 (t, J=8.44 Hz, 1 H) 2.85 (br t, J=7.50 Hz, 1 H) .

[0325] To a solution of compound B (80.0 g, 178 mmol, 1.0 eq) in DCM (800 mL) at 25 ℃under N2 atmosphere was added dropwise 2H-tetrazole (0.45 M, 436 mL, 1.1 eq) , then compound C (80.6 g, 267 mmol, 85.0 mL, 1.5 eq) in DCM (200 mL) was added dropwise to the mixture. The reaction mixture was stirred at 25℃ under for 1.0 hr. LC-MS showed compound B was consumed completely and one main peak with desired mass was detected. The resulting reaction mixture was cooled to -20 ℃ and poured into ice cold sat. NaHCO3 (500 mL) , extracted with DCM (500 mL *3) , the combined organic layers were washed with sat. NaHCO3 / brine=1: 1 (3 00 mL / 300 mL) , dried over Na2SO4 and concentrated in vacuum (35 ℃) to get the residue (100 mL) . The residue was purified by column chromatography (Al2O3, DCM / MeOH=100 / 1 to 50 / 1, 0.1%Et3N) to give compound 2 (77 g, 119 mmol, 66.5%yield) as a white solid.

[0326] 1H NMR: EC4783-423-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.22 (br d, J=7.50 Hz, 2 H) 7.05 -7.14 (m, 6 H) 6.96 -7.02 (m, 1 H) 6.67 (br dd, J=8.82, 1.81 Hz, 4 H) 3.95 -4.07 (m, 2 H) 3.73 -3.83 (m, 1 H) 3.62 -3.72 (m, 2 H) 3.48 -3.53 (m, 6 H) 3.27 -3.37 (m, 3 H) 3.11 (s, 6 H) 2.82 (td, J=8.54, 2.31 Hz, 1 H) 2.47 -2.63 (m, 3 H) 2.28 (br d, J=1.63 Hz, 3 H) 0.82 -1.00 (m, 13 H) .

[0327] Other phosphoramidites may be prepared according to procedures described herein and / or prior arts such as, but are not limited to, US426, 220 and WO02 / 36743.

[0328] Example 3. Preparation of a solid support comprising phosphoramidites monomers of the present invention

[0329] reprensents amine methyl polyethylene macroporous resin carrier part

[0330] Dichloromethane (19.50kg) was added to the 50 L glass kettle under the protection of nitrogen and started stirring. The temperature was controlled at 20~30 ℃, and DMTr imann (1.47 kg) , triethylamine (1.50 kg) , 4-dimethylaminopyridine (0.164 kg) and succinic anhydride (1.34 kg) was added to the glass kettle. The system was kept at 20~30 ℃ for 18h, samples were taken and the reaction was ended. Saturated sodium bicarbonate solution (22.50 kg) was added into the reaction system, stirred for 10-20 min, and allowed to separate into layers. The organic phase was separated, and the aqueous phase was extracted twice with dichloromethane, and the organic phase was combined and dried over anhydrous sodium sulfate, filtered, and concentrated in vacuum to get the residue forming a gray to off-white solid of 1.83 kg.

[0331] N, N-dimethylformamide (23.50 kg) was added into a 100L glass kettle and stirred. The temperature was controlled at 20~30 ℃. Under the protection of nitrogen, the products of the previous step, O-benzotriazole tetramethylurea hexafluorophosphate (0.33 kg) and N, N-diisopropylethylamine (0.13 kg) were added into the aforesaid 100L glass kettle through the solid feeding funnel and stirred for 10~30 minutes and were discharged into a 50 L zinc barrel for use. Macroporous amine methyl resin (3.25 kg) (purchased from Tianjin Nankai Hecheng Science and Technology Co., Ltd., batch number HA2X1209, load capacity 0.48 mmol / g) were added into the aforesaid 100 L solid phase synthesis reactor through the solid feeding funnel, the temperature was controlled at 20~30 ℃, N, N-dimethylformamide (21.00 kg+21.00 kg) and the reaction solution in the zinc barrel of the previous step were add into the solid phase synthesis reactor. The system was subject to thermal insulation reaction, and the solid load was tracked to ≥ 250umol / g, and the load detection method was UV. The system was filtered under the pressure of nitrogen, the filter cake was washed with N, N-dimethylformamide for three times (26.00kg+26.10kg+26.00kg) , and the filter cake was left in the kettle. CAP. A (50%acetonitrile and 50%acetic anhydride, 4.40kg+4.42kg+4.30kg) and CAP. B (20%pyridine and 30%N-methylimidazole and 50%acetonitrile, 4.40kg+4.40kg+4.47kg) were added into the 80L glass kettle, and stirred for 3~8min before use. This operation was repeated for three times to cap, and acetonitrile (18.00 kg+18.00 kg+18.00 kg+17.50 kg+17.50 kg) was added into the solid phase synthesis kettle. Filter-pressed after nitrogen bubbling for 10~30 min. This operation was repeated for four times, the filter cake was purged in the solid phase synthesis kettle with nitrogen for 2-4 h, and then was transferred to a 50 L filter press tank. The temperature was controlled at 15~30 ℃, continued drying, and obtained yellow to white solid product after drying, weight: 3.516 kg.

[0332] The isomannide residue can be added to the 5'-end or 3'-end of the oligonucleotide chain by a method well known to those skilled in the art, such as the reverse abasic (invab) method, and further added to the target to the group.

[0333] Example 4. Preparation of 5'-phosphate mimic phosphoramidite

[0334] Enantiomeric phosphoramidite-15-1 and enantiomeric phosphoramidite-15-2

[0335] Benzoyl chloride (126 g, 893 mmol, 104 mL) was added to a solution containing uracil (50.0 g, 446 mmol) in pyridine (735 g, 9.29 mol, 750 mL) and acetonitrile (1.50 L) at 0℃, the reaction solution was stirred at 20-25℃ for 12.0 hours, and TLC showed that the compound uracil was completely consumed. The reaction mixture was concentrated in vacuo to obtain a residue. The residue was diluted with cold water (1.0 L) and extracted with ethyl acetate (1.0 L *3) . The combined organic layers were washed with brine (500 mL) and dried over anhydrous sodium sulfate to obtain The residue was purified by column chromatography (SiO2 , ethyl acetate / petroleum ether = 1 / 10 to 1 / 1) to obtain white solid Phos-15-1A (63 g, 65.3%yield) .

[0336] 1 H NMR: EC4783-420-P1N (400 MHz, DMSO-d 6 ) δ ppm 7.96 (dd, J =8.4, 1.2 Hz, 2 H) , 7.76-7.81 (m, 1 H) , 7.67 (dd, J =7.6, 5.6 Hz, 1 H) , 7.58-7.64 (m, 2 H) , 5.75 (dd, J =7.6, 1.2 Hz, 1 H) .

[0337] To a solution of Phos-15-SM2 (4.0 g, 47.6 mmol) and compound Phos-15-1A (7.91 g, 36.6 mmol) in tetrahydrofuran (80 mL) was added triphenylphosphine (11.5 g, 43.9 mmol) and azo Diethyl dicarboxylate (7.64g, 43.9 mmol, 7.98 mL) , the mixture was stirred at 20-25℃ for 16 hours. LC-MS showed that compound Phos-15-1A was completely consumed. The reaction mixture was concentrated under reduced pressure to remove tetrahydrofuran. The residue was diluted with water (80 mL) , and then extracted with ethyl acetate (80 mL *3) . The combined organic phases were washed with brine (80 mL) , dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by column chromatography (SiO2, MeOH / DCM=0 / 10 to 1 / 10) to obtain compound Phos-15-1B (14 g, crude product) as a white solid.

[0338] Under nitrogen protection, a mixture of compound Phos-15-1B (7.0 g, 9.30 mmol) and m-chloroperoxybenzoic acid (2.27 g, 11.1 mmol, 85%purity) in dichloromethane (70 mL) was heated at 0-5℃. After 16 hours of reaction, TLC showed that compound Phos-15-1B was completely consumed, and a major new spot with lower polarity was detected. Slowly adjust the pH of the reaction mixture to 7~8 with saturated NaHSO3 and NaHCO3 solutions (1: 1) , then extract with ethyl acetate (70 mL *3) , and wash the combined organic phases with brine (700mL) . Dry over anhydrous sodium sulfate and concentrate under reduced pressure. The residue was purified by silica gel column chromatography (100-200 mesh silica gel) , eluting with ethyl acetate: petroleum ether (1: 30~1: 1) to obtain white solid compound Phos-15-1C (1.2 g, crude product) .

[0339] To a solution of compound Phos-15-SM3 (4.0 g, 14.4 mmol) in tetrahydrofuran (24.0 mL) was added KSAc (1.81 g, 15.8 mmol) and tetrabutylammonium iodide (TBAI, 531.4 mg, 1.44 mmol) , and the mixture was stirred at 70℃ for 4.0 hours. LC-MS showed that the raw material Phos-15-SM3 was completely consumed, and a main peak with the desired target molecule molecular weight was detected. The reaction mixture was cooled and concentrated under reduced pressure. The solid residue was removed by filtration with a short silica gel pad and rinsed with ethyl acetate. The filtrate was concentrated in vacuo to obtain compound Phos-15-1D (3.50 g, 98.5%yield) as a brown oil. Compound Phos-15-1D was used in the next step without further purification.

[0340] 1 H NMR: EC11950-13-P1B (400 MHz, DMSO-d6 ) δ ppm 3.96-4.07 (m, 4H) 3.27 (d, J =14.0 Hz, 2H) 2.40 (s, 3H) 1.22 (t, J =7.2 Hz, 6H) .

[0341] To a solution of compound Phos-15-1C (1.20 g, 4.02 mmol) in ethanol (15.0 mL) were added potassium carbonate (1.11 g, 8.05 mmol) and compound Phos-15-1D (1.91 g, 8.45 mmol) , and the mixture was added Stir at 20-25℃ for 3.0 hours. TLC showed that compound Phos-15-1C was completely consumed and a major new spot with greater polarity was detected. The resulting reaction mixture was filtered, diluted with water (20 mL) , extracted with dichloromethane (20 mL*3) , the combined organic layers were washed with brine, dried over anhydrous sodium sulfate and concentrated in vacuo to obtain a residue. The residue was purified by column chromatography (SiO2 , MeOH / DCM = 1 / 100 to 10 / 100) to obtain compound Phos-15-1E as a brown oil (1.00 g, 65.7%yield , 1: 1 mixture of enantiomeric compound-1E-1 and compound-1E-2) .

[0342] 1 H NMR: EC10615-82-P1N1 (400 MHz, DMSO-d 6 ) δ ppm 11.23 (br s, 1 H) , 7.69 (d, J =8.0 Hz, 1 H) , 5.58 (dd, J =8.0, 1.6 Hz, 1 H) , 4.93 (q, J =8.8 Hz, 1 H) , 3.96-4.17 (m, 5 H) , 3.08-3.17 (m, 1 H) , 3.03 (dd, J = 14.0, 2.0 Hz , 2 H) , 2.38-2.47 (m, 1 H) , 2.04-2.07 (m, 1 H) , 1.82-1.90 (m, 1 H) , 1.56-1.59 (m, 1 H) , 1.25 (t, J =6.8 Hz, 6 H) .

[0343] Compound Phos-15-1E can obtain enantiomers Phos-15-1E-1 and Phos-15-1E-2 through chiral resolution. Resolution conditions: DAICELCHIRALPAK AD 40mm column, 140 mL / min, ethanol: carbon dioxide = 35: 75. It can be understood that when it is necessary to obtain enantiomeric phosphoramidite-15-1 or enantiomeric phosphoramidite-15-2, as long as the corresponding enantiomer Phos-15-1E-1 or Phos-15-1E-2 is used as the starting material and reacted with the phosphorus reagent, it can be obtained

[0344] Under a nitrogen atmosphere at room temperature, to a solution of compound Phos-15-1E (400 mg, 1.06 mmol) and di-isopropylamine-tetrazolium salt (199 mg, 1.16 mmol) in dichloromethane (4.0 mL) was added a solution of bis (diisopropylamino) (2-cyanoethoxy) phosphine (P reagent, 956 mg, 3.17 mmol, 1.01 mL) in dichloromethane (0.5 mL) , and the mixture was stirred at 40℃ for 1.0 h. LC-MS showed that compound Phos-15-1E was completely consumed, several new peaks appeared on LC-MS, and approximately 80%of the desired compound was detected. The resulting reaction mixture was cooled to -20℃ and poured into cold (0-5℃) saturated aqueous sodium bicarbonate solution (10 mL) , extracted with dichloromethane (10 mL*2) , and the combined organic layers were washed with cold (0-5 ℃) saturated aqueous sodium bicarbonate solution / brine (5 mL / 5 mL) , dry over anhydrous sodium sulfate, and concentrate in vacuo to obtain a residue (~2.0 mL) . The residue was purified by column chromatography (basic Al2O3 , MeOH / DCM = 1 / 80 to 1 / 40, 0.1%Et3N) to give phosphoramidite-15 as a colorless oil (350 mg, 0.6 mmol, 57.2%yield, 1: 1 mixture of enantiomeric phosphoramidite-15-1 and enantiomeric phosphoramidite-15-2 ) .

[0345] Enantiophosphoramidite-15-1 or enantiophosphoramidite-15-2 can be obtained, from the corresponding Phos-15-1E-1 or Phos-15-1E-2 obtained by SFC separation and purification as the starting material, according the same process as above.

[0346] δ ppm 11.23 (br s, 1 H) , 7.70 (d, J =8.0 Hz, 1 H) , 5.55-5.60 (m, 1 H) , 4.89 (q, J =8.4 Hz, 1H) , 4.29-4.42 (m, 1H) , 3.99-4.09 (m, 4H) , 3.65-3.84 (m, 2H) , 3.53-3.62 (m, 2H) , 3.35-3.41 (m, 1H) , 3.02 (dd, J =14.0 , 8.0 Hz, 2H) , 2.76-2.79 (m, 2H) , 2.40-2.49 (m, 1H) , 2.15-2.25 (m, 1H) , 1.95-2.07 (m, 1H) , 1.65-1.75 (m, 1H) , 1.23-1.26 (m, 6H) 1.12-1.21 (m, 12H) .

[0347] The specific preparation method of Phos-15-1E-1 or Phos-15-1E-2 chiral is as follows:

[0348] System: Waters SFC 150

[0349] Column name:

[0350] Column model: 250*50 mm 10 m

[0351] Mobile phase A: Supercritical CO2

[0352] Mobile phase B: EtOH

[0353] Wavelength: 214 nm

[0354] Flow rate: 140 mL / min

[0355] Column temperature: RT

[0356] Injection volume: 7.0 mL Cycle time: 10.0 min

[0357] Solvent: supercritical CO2: food grade EtOH: redistilled grade;

[0358] Preparation of Phosphoramidite-43

[0359] Add (3aR, 6aR ) -2, 2-dimethyltetrahydro-3aH-cyclopenta [d] [1, 3] dioxole-4 (6aH) -one (phos-43-SM1, 16.2 g , 105 mmol , 1.0eq) , diethyl (mercaptomethyl) phosphonate (19.3 g , 105m mol , 1.0eq ) and dichloromethane (200mL) to 500mL flask. The flask was stirred and cooled to 0-5℃ under nitrogen protection, and then triethylamine (1.06 g, 10.5mmol, 0.1 eq) was added dropwise. After the addition was completed, the temperature was returned to 25℃and stirred overnight under nitrogen protection. LCMS detected that the reaction was complete, and the reaction solution was concentrated in vacuo to obtain crude product. The crude product was purified by flash column, and the eluent was (EA: DCM = 0%-15 %) to wash out the product. The product was concentrated in vacuum to obtain 25g of Phos-43-1A as a light yellow oil , 70.3%yield.

[0360] LCMS: M+H=339.5

[0361] Add Phos-43-1A (25 g , 73.9mmol , 1.0eq) and ethanol (250mL ) to the 500mL flask. Stir and cool the flask to 0-5℃ under nitrogen protection, then add sodium borohydride (3.1 g, 81.3m mol, 1.1 eq) in batches. After the addition is completed, keep stirring at 0-5℃ for 0.5h. LCMS detected that the reaction was complete. Ice water (200 mL) was added dropwise to the reaction solution and stirred for 10 min. Then, the mixture was extracted twice with dichloromethane (500 mL) . The combined organic phases were dried over anhydrous sodium sulfate and concentrated in vacuo to obtain the crude product. The crude product was purified by flash column, and the eluent was (MeOH: DCM = 0 %-5 %) to wash out the product. The product was concentrated in vacuum to obtain 24.5 g of Phos-43-1B as a light yellow oil. The yield was 97.4 %.

[0362] LCMS: M+H=341.5

[0363] 1H NMR: (400 MHz, CD3CN) , δ ppm 4.67-4.65 (d, J=8.0, 1 H) , 4.47-4.42 (m, 2 H) , 4.08-4.01 (m, 5 H) , 3.27-3.25 (m, 1 H) , 2.97-2.93 (d, J=16.0, 2 H) , 2.03-1.99 (m, 1 H) , 1.73-1.71 (m, 1 H) , 1.38 (s, 3 H) , 1.26-1.22 (m, 9 H) .

[0364] Add Phos-43-1B (10g, 29.4mmol, 1.0eq) , pyridine (7g, 88.1mmol, 3.0eq) and dichloromethane (100mL) to a 250mL flask. The flask was stirred and cooled to -78℃ under nitrogen protection, and then trifluoromethanesulfonic anhydride (12.4g, 44.1mmol, 1.5eq) was added dropwise. After the dropwise addition was completed, the flask was kept at -78℃and stirred under nitrogen protection for 3 hours. LCMS detected that the reaction was complete. The reaction solution is poured into 50mL of ice water, and then extracted twice with dichloromethane (100mL) . The combined organic phases are dried with anhydrous sodium sulfate and concentrated in vacuo to obtain the crude product Phos-43-1C, which is directly used to the next step.

[0365] LCMS: M+H=473.4

[0366] Add Phos-43-1C (16g, 33.8mmol, 1.0eq) , 3-benzoyluracil (8.8g, 40.6mmol, 1.2eq) , cesium carbonate (22g, 67.7mmol) and acetonitrile (200mL) to a 500mL flask. The flask was stirred overnight at 25℃ under nitrogen protection. LCMS detected that the reaction was complete, the reaction solution was filtered, and the filtrate was concentrated in vacuum to obtain the crude product. The crude product was purified by flash column, and the eluent was (MeOH: DCM=0%-5%) to wash out the product. The product was concentrated in vacuum to obtain 18g of Phos-43-1D as a brown oil, with a yield of 98.7%.

[0367] LCMS: M+H=539.4

[0368] To a 500 mL flask were added Phos-43-1D (18 g, 33.4 mmol, 1.0 eq) and methanol (180 mL) . Ammonia methanol (180 mL) was added dropwise to the flask under nitrogen protection. After the dropwise addition was completed, the mixture was stirred at 25℃ for 5 hours under nitrogen protection. LCMS detected that the reaction was complete, and the reaction solution was concentrated in vacuum to obtain the crude product Phos-43-1E, which was directly used in the next step.

[0369] LCMS: M+H=435.4

[0370] To a 500 mL flask was added Phos-43-1E (14.5 g, 33.4 mmol, 1.0 eq) and dioxane (180 mL) . Add dioxane hydrochloride (4M 180mL) dropwise and stir the flask at 25℃ overnight under nitrogen protection. LCMS detected that the reaction was complete, and the reaction solution was concentrated in vacuum to obtain crude product. The crude product was purified by flash column, and the eluent was (MeOH: DCM=0%-10%) to wash out the product. The product was concentrated in vacuum to obtain 5.2g of Phos-43-1F as a white solid, with a yield of 39.5%.

[0371] LCMS: M+H=395.4

[0372] Add Phos-43-1F (5.2g, 13.2mmol, 1.0eq) , toluene (100mL) and acetonitrile (20mL) to a 250mL flask, then add cyanomethylenetri-n-butylphosphine (6.4g, 26.5mmol, 2.0eq) and stir the flask at 90℃ for 48h under nitrogen protection. LCMS detected that the reaction was complete, and the reaction solution was concentrated in vacuum to obtain crude product. The crude product was purified by flash column using the eluant (MeOH: DCM=0%-10%) to elute the product. The product was concentrated in vacuum to obtain 3.5 g of Phos-43-1G as a white solid, with a yield of 70.5%.

[0373] LCMS: M+H=377.3

[0374] Add Phos-43-1G (2.0g, 5.3mmol, 1.0eq) , anhydrous methanol (20mL) , trimethyl borate (1.1g, 10.6mmol, 2.0eq) , and methyl orthoformate (0.56g, 5.3mmol, 1.0eq) and sodium bicarbonate (44.5mg, 0.52mmol, 0.2eq) into a 250mL stuffy jar. The above mixture was heated to 120℃ and stirred for 48 h. The stuffy jar was cooled to room temperature. LCMS detected that the reaction was complete, and the reaction solution was concentrated in vacuum to obtain a crude product. The crude product was purified by flash column using the eluant (MeOH: DCM=0%-10%) to elute the product. The product was concentrated in vacuum to obtain 1.3 g of Phos-43-1H as a white solid, with a yield of 60%.

[0375] LCMS: M+H=409.4

[0376] Add Phos-43-1H (0.6g, 1.47 mmol, 1.0eq) , anhydrous dichloromethane (10mL) to the 50mL flask, and then add tetrazole (0.13g, 1.76 mmol, 1.2eq) , bis (diisopropyl) (2-cyanoethoxy) phosphine (0.66 g, 2.2 mmol, 1.5eq) in sequence. The above mixture was stirred at 25℃ for 1 h under nitrogen protection. LCMS detected that the reaction was complete. The reaction solution was poured into a sodium bicarbonate aqueous solution and extracted twice with dichloromethane (20 mL) . The combined organic phases were dried over anhydrous sodium sulfate and concentrated in vacuo to obtain the crude product. The crude product was purified through a flash silica gel column, and the product was eluted with the eluent (DCM: MeOH: TEA=0%-5%+0.2%TEA) . Concentrate under vacuum at 35℃ to obtain phosphoramidite-43 (0.89g, yield 100%) as a colorless oil.

[0377] LCMS: M+H=609.6

[0378] 1 H NMR: (400 MHz, CD3CN) , δ ppm 8.97 (s, 1 H) , 7.43-7.41 (d, J=8.0, 1 H) , 5.61-5.59 (d, J=8.0, 1 H) , 4.76 -4.69 (m, 1 H) , 4.44-4.34 (m, 1 H) , 4.14-4.04 (m, 5 H) , 3.90-3.81 (m, 2 H) , 3.69-3.62 (m, 2 H) , 3.46 -3.44 (m, 1 H) , 3.36-3.33 (d, J=12.0, 3 H) , 2.97-2.87 (m, 2 H) , 2.77-2.65 (m, 3 H) , 1.67-1.56 (m, 1 H) , 1.32-1.27 (m, 6 H) , 1.24-1.18 (m, 12 H) .

[0379] 31P NMR: (400 MHz, CD3CN) , δ ppm 150.03, 148.62; 23.44, 23.24 .

[0380] The preparation method of phosphoramidite-47 is the same as that of phosphoramidite-43, except that the starting material 5-methyluracil is used as the nucleobase.

[0381] Preparation of Phosphoramidite-45

[0382] Add magnesium chips (0.26g, 10.6 mmol, 10.0eq) and absolute ethanol (40mL) to a 100mL stuffy jar, and heat the above mixture to 90℃ and stir for 18h. Cool the stuffy jar to room temperature, add Phos-43-1G (0.4g, 1.06 mmol, 1.0eq) , heat to 90℃ and stir for 18h. The stuffy jar was cooled to room temperature. LCMS detected that the reaction was incomplete and about 50%was converted into Phos-45-1A. The reaction solution was concentrated in vacuo to obtain crude product. The crude product was purified by flash column using the eluent (MeOH: DCM=0%-8%) to elute out the product. The product was concentrated in vacuum to obtain 0.13g of Phos-45-1A as a light yellow oil, with a yield of 29%.

[0383] LCMS: M+H=423.4

[0384] Add Phos-45-1A (0.11g, 0.26 mmol, 1.0eq) and anhydrous dichloromethane (3mL) to the 50mL flask, then add tetrazole (22 mg, 0.31 mmol, 1.2eq) , bis (diiso) Propylamino) (2-cyanoethoxy) phosphine (0.12 g, 0.4 mmol, 1.5eq) in sequence. The above mixture was stirred at 25℃ for 1 h under nitrogen protection. LCMS detected that the reaction was complete. The reaction solution was poured into aqueous sodium bicarbonate solution and extracted twice with dichloromethane (10 mL) . The combined organic phases were dried over anhydrous sodium sulfate and concentrated in vacuo to obtain the crude product. The crude product was purified through a flash silica gel column, and the product was eluted with the eluent (DCM: MeOH: TEA=0%-3%+0.2%TEA) . Concentrate under vacuum at 35℃ to obtain phosphonamidite yellow oil Phos-45 (0.1g, yield 61.7%) .

[0385] LCMS: M+H=623.5,

[0386] 1H NMR: (400 MHz, CD3CN) , δ ppm 7.42-7.40 (d, J=8.0, 1 H) , 5.61-5.59 (d, J=8.0, 1 H) , 4.73-4.68 (m, 1 H) , 4.34-4.30 (m, 1 H) , 4.12-4.06 (m, 5 H) , 3.88-3.83 (m, 2 H) , 3.68-3.65 (m, 2 H) , 3.58-3.42 (m, 2 H) , 2.97-2.86 (m, 3 H) , 2.72-2.62 (m, 3 H) , 1.65-1.53 (m, 1 H) , 1.32-1.17 (m, 18 H) , 1.13-1.10 (t, J=6.8, 3 H) .

[0387] 31P NMR: (400 MHz, CD3CN) , δ ppm 149.85, 148.50; 23.46, 23.25.

[0388] Preparation of phosphoramidite-46

[0389] Add magnesium chips (0.48g, 20.0 mmol, 15.0eq) and anhydrous ethylene glycol monomethyl ether (50mL) to a 100mL stuffy jar, and heat the above mixture to 90℃ and stir for 1 hour. Cool the stuffy jar to room temperature, add Phos-43-1G (0.5g, 1.33 mmol, 1.0eq) , heat to 90℃ and stir for 18h. The stuffy jar was cooled to room temperature, and LCMS detected that the reaction raw materials disappeared completely. The reaction solution was transferred into a flask, 0.5N dilute hydrochloric acid was added dropwise at 0℃ to adjust the pH to 6, and extract 5 times with dichloromethane (50mL) . The combined organic phases were dried over anhydrous sodium sulfate and concentrated in vacuo to obtain the crude product. The crude product was purified by flash column using the eluant (MeOH: DCM=0%-10%) to elute the product. The product was concentrated under vacuum to obtain 0.13g of Phos-46-1A as a light yellow oil, with a yield of 20%.

[0390] LCMS: M+H=513.4 .

[0391] Add Phos-46-1A (0.1g, 0.19 mmol, 1.0eq) , anhydrous dichloromethane (3mL) to the 50mL flask, and then add tetrazole (16 mg, 0.23 mmol, 1.2eq) bis (diisopropyl) (2-cyanoethoxy) phosphine (0.09 g, 0.3 mmol, 1.5eq) in sequence. The above mixture was stirred at 25℃ for 1 h under nitrogen protection. LCMS detected that the reaction was complete. The reaction solution was poured into a sodium bicarbonate aqueous solution and extracted twice with dichloromethane (10 mL) . The combined organic phases were dried over anhydrous sodium sulfate and concentrated in vacuo to obtain the crude product. The crude product was purified through a flash silica gel column, and the product was eluted with the eluent (DCM: MeOH: TEA=0%-5%+0.2%TEA) . Concentrate under vacuum at 35℃ to obtain phosphoramidite yellow oil Phos-46 (93 mg, yield 66.9%) .

[0392] LCMS: M+H=713.6 .

[0393] 1H NMR: (400 MHz, CD3CN) , δ ppm 8.92 (s, 1 H) , 7.47-7.44 (dd, J=8.0, J=2.8, 1 H) , 5.64-5.62 (d, J=8.0, 1 H) , 4.78-4.68 (m, 1 H) , 4.42-4.22 (m, 2H) , 4.18-4.15 (m, 4 H) , 3.92-3.85 (m, 2 H) , 3.78-3.66 (m, 3 H) , 3.60-3.52 (m, 5 H) , 3.48-3.45 (m, 3 H) , 3.36-3.35 (dd, J=2.4, J=0.8, 6 H) , 3.28-3.27 (d, J=5.6, 3 H) , 3.03-2.94 (m, 2 H) , 2.75-2.63 (m, 3 H) , 1.65-1.53 (m, 1 H) , 1.22-1.17 (m, 12 H) .

[0394] 31P NMR: (400 MHz, CD3CN) , δ ppm 149.85, 148.42; 24.43, 24.22.

[0395] 5'-phosphonate modified nucleoside analogs herein can be prepared using similar methods or synthetic routes well known in the art.

[0396] The phosphoramidite compound described here is coupled into the 5' end of the oligonucleotide, thereby producing a 5'-terminal nucleotide, as described in CN110072530A and CN103154014A, with each phosphonate group having a hydroxyl protecting group atoms, such as oxygen atoms containing two methyl or ethyl protections, remove one or both of the methyl or ethyl groups according to the deprotection step used. In some embodiments, use carbonitrile: trimethylsilyl iodide: pyridine e=50: 2: 2 (v / v / v) deethylation solution to remove ethyl protection.

[0397] Preparation of phosphoramidite-53

[0398] To a mixture of Phos-53-SM1 (25.00 g, 1.0 eq. ) and DMAP (2.72 g, 0.5 eq. ) in pyridine (250 mL) was added BzCl (31.34 g, 5.0 eq. ) dropwise at 0℃ and stirred at 24℃ for 18 hrs. LCMS indicated Phos-53-1A was generated and Phos-53-SM1 was consumed. The mixture was quenched by MeOH and evaporated under reduced pressure to give the crude which was used for next step directly. Analytical data: MS: [M-H] -=768.

[0399] To a solution of Phos-53-1A (100 g , crude) in DCM (500 mL) was added TFA (15 mL) and stirred at 24℃ for 2 hrs. LCMS indicated Phos-53-1A was consumed and Phos-53-1B was generated. The mixture was quenched by MeOH and evaporated under reduced pressure to give the crude which was purified by silica gel chromatography with a gradient of MeOH in DCM (0-50%) to give Phos-53-1B (20 g, 96%over two steps) . Analytical data: [M+H] +=467.

[0400] To a solution of Phos-53-1B (20 g, 1.0 eq. ) in ACN (210 mL) and H2O (140 mL) was added 4-OH TEMPO (2.95 g, 0.4 eq. ) and DIB (27.62 g, 2.0 eq. ) then stirred at 24℃ for 18 hrs. To the mixture was added 4-OH TEMPO (1.5 g, 0.2 eq. ) and DIB (13 g, 0.95 eq. ) and stirred at 24℃ for 4 hrs. The mixture was diluted with ethyl acetate. The organic layer was separated and washed with water, brine, dried over Na2SO4, filtered and concentrated to give the crude which was purified by silica gel chromatography (MeOH in DCM=0-10%) to give Phos-53-1C (26 g, quant. ) . Analytical data: MS: [M+H] +=481.

[0401] To a solution of Phos-53-1C (26 g, 1.0 eq. ) in THF (500 mL) was added Pb (OAc) 4 (71.98 g, 3.0 eq. ) and stirred at 24℃ for 18 hrs. LCMS indicated Phos-53-1...

Claims

1.A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of synuclein alpha (SNCA) , wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: l and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 2, wherein the sense strand and the antisense strand can be partially, substantially, or fully complementary to each other, and optionally comprising a targeting ligand.2.The dsRNA agent of claim 1, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 2, and the sense strand is complementary to the at least 15 contiguous nucleotides in the antisense strand.3.The dsRNA of any one of claims 1-2, wherein the dsRNA agent comprises at least one modified nucleotide.4.The dsRNA agent of any one of claims 1-3, wherein all or substantially all of the nucleotides of the sense strand and / or the antisense strand are modified nucleotides.5.A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of synuclein alpha (SNCA) , wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region of complementary to part of an mRNA encoding SNCA, wherein each strand is about 15 to about 30 nucleotides in length, wherein the sense strand sequence is represented by formula (I) : 5′- (N′L) n′N′LN′L N′N1 N′N2 N′N3 N′N4 N′L N′F N′L N′N5N′N6 N′L N′L N′L (N′L) m′-3′ (I)wherein:each N′F represents a 2'-fluoro-modified nucleotide;each N′N1, N′N2, N′N3, N′N4, N′N5, and N′N6 independently represents a modified or unmodified nucleotide;each N′L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide;and m′ and n′ are each independently an integer of 0 to 7.6.A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of synuclein alpha (SNCA) , wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to part of an mRNA encoding SNCA, wherein each strand is about 18 to about 30 nucleotides in length, wherein the antisense strand sequence is represented by formula (II) : 3′- (NL) n NM1 NL NM2 NL NF NL NM3 NM9 NM4 NL NM5 NM6 NL NM7 NM8 NL NF NZ-5′ (II)wherein:each NF represents a 2'-fluoro-modified nucleotide;each NM1, NM2, NM3, NM4, NM5, NM6, NM7, NM8 and NM9 independently represents a modified or unmodified nucleotide;each of NL and NZ independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide,optionally, NZ represents a 5'-terminal nucleotide comprising a phosphate mimic, preferably, NZ is a vinyl phosphonate modified nucleotide, more preferably, NZ is Vpu*, which has the structureor,optionally, NZ is any one selected from the group consisting ofor stereoisomers or racemates thereof,and n is an integer of 0 to 7.7.A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of synuclein alpha (SNCA) , wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein said sense strand complementary to the antisense strand, wherein said antisense strand comprises a region of complementarity to an mRNA encoding SNCA, wherein the region of complementarity comprises at least 15 contiguous nucleotides, wherein the dsRNA duplex is represented by formula (III) : sense: 5′- (N′L) n′N′LN′L N′N1 N′N2 N′N3 N′N4 N′L N′F N′L N′N5N′N6 N′L N′L N′L (N′L) m′-3′ antisense: 3′- (NL) n NM1 NL NM2 NL NF NL NM3 NM9 NM4 NL NM5 NM6 NL NM7 NM8 NL NF Nz-5′ (III)wherein:each strand is independently about 17 to about 30 nucleotides in length;each NF and N′F independently represents a 2'-fluoro-modified nucleotide;NM1, NM2, NM3, NM4, NM5, NM6, NM7, NM8, NM9, N′N1, N′N2, N′N3, N′N4, N′N5, and N′N6 each independently represents a modified or unmodified nucleotide;each Nz, NL and N′L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide;optionally, NZ represents a 5'-terminal nucleotide comprising a phosphate mimic, preferably, NZ is a vinyl phosphonate modified nucleotide, more preferably, NZ is Vpu*, which has the structureor,optionally, NZ is any one selected from the group consisting ofor stereoisomers or racemates thereof,and m′, n′ and n are each independently an integer of 0 to 7.8.The dsRNA agent of any one of claims 1-7, wherein said antisense strand comprises a region of complementarity to an mRNA encoding SNCA which comprises at least 15, 16, 17, 18, 19 or 20 contiguous nucleotides differing by no more than 0, 1, 2, or 3 nucleotides from complement of any one of nucleotides 776-796, 699-719, 628-648, 614-634, 913-933, 828-848, 238-258, 325-345, 326-346, 337-357, 397-417, 587-607, 591-611, 201-221, 202-222, 203-223, 204-224, 206-226, 207-227, 209-229, 214-234, 215-235, 216-236, 217-237, 220-240, 223-243, 224-244, 225-245, 226-246, 227-247, 228-248, 230-250, 232-252, 235-255, 236-256, 238-258, 239-259, 241-261, 268-288, 275-295, 277-297, 278-298, 306-326, 307-327, 308-328, 322-342, 324-344, 326-346, 327-347, 328-348, 338-358, 378-398, 386-406, 392-412, 394-414, 396-416, 398-418, 399-419, 400-420, 401-421, 402-422, 403-423, 405-425, 406-426, 409-429, 506-526, 513-533, 580-600, 583-603, 584-604, 585-605, 587-607, 594-614, 595-615, 598-618, 616-636, 617-637, 620-640, 623-643, 635-655, 638-658, 640-660, 642-662, 644-664, 654-674, 657-677, 664-684, 667-687, 697-717, 700-720, 704-724, 705-725, 719-739, 722-742, 726-746, 728-748, 729-749, 731-751, 735-755, 737-757, 771-791, 773-793, 775-795, 776-796, 778-798, 781-801, 782-802, 783-803, 822-842, 825-845, 826-846, 831-851, 832-852, 835-855, 837-857, 839-859, 856-876, 864-884, 867-887, 869-889, 872-892, 873-893, 875-895, 876-896, 906-926, 911-931, 912-932, 915-935, 919-939, 920-940, 921-941, 923-943, 925-945, 926-946, 929-949, 938-958, 943-963, 945-965, 948-968, 949-969, 957-977, 962-982, 963-983, 967-987, 968-988, 970-990, 971-991, 976-996, 979-999, 980-1000, 1003-1023, 1005-1025, 1006-1026, 1010-1030, 1011-1031, 1012-1032, 1014-1034, 1016-1036, 1017-1037, 1023-1043, 1026-1046, 1028-1048, 1049-1069, 1066-1086, 1081-1101, 1083-1103, 1085-1105, 1086-1106, 1088-1108, 1089-1109, 1090-1110, 1091-1111, 1092-1112, 1097-1117, 1099-1119, 1105-1125, 1106-1126, 1107-1127, 1166-1186, 1168-1188, 778-796, 701-719, 630-648, 616-634, 915-933, 830-848, 240-258, 327-345, 328-346, 339-357, 399-417, 589-607, 593-611, 203-221, 204-222, 205-223, 206-224, 208-226, 209-227, 211-229, 216-234, 217-235, 218-236, 219-237, 222-240, 225-243, 226-244, 227-245, 228-246, 229-247, 230-248, 232-250, 234-252, 237-255, 238-256, 240-258, 241-259, 243-261, 270-288, 277-295, 279-297, 280-298, 308-326, 309-327, 310-328, 324-342, 326-344, 328-346, 329-347, 330-348, 340-358, 380-398, 388-406, 394-412, 396-414, 398-416, 400-418, 401-419, 402-420, 403-421, 404-422, 405-423, 407-425, 408-426, 411-429, 508-526, 515-533, 582-600, 585-603, 586-604, 587-605, 589-607, 596-614, 597-615, 600-618, 618-636, 619-637, 622-640, 625-643, 637-655, 640-658, 642-660, 644-662, 646-664, 656-674, 659-677, 666-684, 669-687, 699-717, 702-720, 706-724, 707-725, 721-739, 724-742, 728-746, 730-748, 731-749, 733-751, 737-755, 739-757, 773-791, 775-793, 777-795, 778-796, 780-798, 783-801, 784-802, 785-803, 824-842, 827-845, 828-846, 833-851, 834-852, 837-855, 839-857, 841-859, 858-876, 866-884, 869-887, 871-889, 874-892, 875-893, 877-895, 878-896, 908-926, 913-931, 914-932, 917-935, 921-939, 922-940, 923-941, 925-943, 927-945, 928-946, 931-949, 940-958, 945-963, 947-965, 950-968, 951-969, 959-977, 964-982, 965-983, 969-987, 970-988, 972-990, 973-991, 978-996, 981-999, 982-1000, 1005-1023, 1007-1025, 1008-1026, 1012-1030, 1013-1031, 1014-1032, 1016-1034, 1018-1036, 1019-1037, 1025-1043, 1028-1046, 1030-1048, 1051-1069, 1068-1086, 1083-1101, 1085-1103, 1087-1105, 1088-1106, 1090-1108, 1091-1109, 1092-1110, 1093-1111, 1094-1112, 1099-1117, 1101-1119, 1107-1125, 1108-1126, 1109-1127, 1168-1186, 1170-1188, 777-795, 700-718, 629-647, 615-633, 914-932, 829-847, 239-257, 326-344, 327-345, 338-356, 398-416, 588-606, 592-610, 202-220, 203-221, 204-222, 205-223, 207-225, 208-226, 210-228, 215-233, 216-234, 217-235, 218-236, 221-239, 224-242, 225-243, 226-244, 227-245, 228-246, 229-247, 231-249, 233-251, 236-254, 237-255, 239-257, 240-258, 242-260, 269-287, 276-294, 278-296, 279-297, 307-325, 308-326, 309-327, 323-341, 325-343, 327-345, 328-346, 329-347, 339-357, 379-397, 387-405, 393-411, 395-413, 397-415, 399-417, 400-418, 401-419, 402-420, 403-421, 404-422, 406-424, 407-425, 410-428, 507-525, 514-532, 581-599, 584-602, 585-603, 586-604, 588-606, 595-613, 596-614, 599-617, 617-635, 618-636, 621-639, 624-642, 636-654, 639-657, 641-659, 643-661, 645-663, 655-673, 658-676, 665-683, 668-686, 698-716, 701-719, 705-723, 706-724, 720-738, 723-741, 727-745, 729-747, 730-748, 732-750, 736-754, 738-756, 772-790, 774-792, 776-794, 777-795, 779-797, 782-800, 783-801, 784-802, 823-841, 826-844, 827-845, 832-850, 833-851, 836-854, 838-856, 840-858, 857-875, 865-883, 868-886, 870-888, 873-891, 874-892, 876-894, 877-895, 907-925, 912-930, 913-931, 916-934, 920-938, 921-939, 922-940, 924-942, 926-944, 927-945, 930-948, 939-957, 944-962, 946-964, 949-967, 950-968, 958-976, 963-981, 964-982, 968-986, 969-987, 971-989, 972-990, 977-995, 980-998, 981-999, 1004-1022, 1006-1024, 1007-1025, 1011-1029, 1012-1030, 1013-1031, 1015-1033, 1017-1035, 1018-1036, 1024-1042, 1027-1045, 1029-1047, 1050-1068, 1067-1085, 1082-1100, 1084-1102, 1086-1104, 1087-1105, 1089-1107, 1090-1108, 1091-1109, 1092-1110, 1093-1111, 1098-1116, 1100-1118, 1106-1124, 1107-1125, 1108-1126, 1167-1185, 1169-1187, 777-793, 700-716, 629-645, 615-631, 914-930, 829-845, 239-255, 326-342, 327-343, 338-354, 398-414, 588-604, 592-608, 202-218, 203-219, 204-220, 205-221, 207-223, 208-224, 210-226, 215-231, 216-232, 217-233, 218-234, 221-237, 224-240, 225-241, 226-242, 227-243, 228-244, 229-245, 231-247, 233-249, 236-252, 237-253, 239-255, 240-256, 242-258, 269-285, 276-292, 278-294, 279-295, 307-323, 308-324, 309-325, 323-339, 325-341, 327-343, 328-344, 329-345, 339-355, 379-395, 387-403, 393-409, 395-411, 397-413, 399-415, 400-416, 401-417, 402-418, 403-419, 404-420, 406-422, 407-423, 410-426, 507-523, 514-530, 581-597, 584-600, 585-601, 586-602, 588-604, 595-611, 596-612, 599-615, 617-633, 618-634, 621-637, 624-640, 636-652, 639-655, 641-657, 643-659, 645-661, 655-671, 658-674, 665-681, 668-684, 698-714, 701-717, 705-721, 706-722, 720-736, 723-739, 727-743, 729-745, 730-746, 732-748, 736-752, 738-754, 772-788, 774-790, 776-792, 777-793, 779-795, 782-798, 783-799, 784-800, 823-839, 826-842, 827-843, 832-848, 833-849, 836-852, 838-854, 840-856, 857-873, 865-881, 868-884, 870-886, 873-889, 874-890, 876-892, 877-893, 907-923, 912-928, 913-929, 916-932, 920-936, 921-937, 922-938, 924-940, 926-942, 927-943, 930-946, 939-955, 944-960, 946-962, 949-965, 950-966, 958-974, 963-979, 964-980, 968-984, 969-985, 971-987, 972-988, 977-993, 980-996, 981-997, 1004-1020, 1006-1022, 1007-1023, 1011-1027, 1012-1028, 1013-1029, 1015-1031, 1017-1033, 1018-1034, 1024-1040, 1027-1043, 1029-1045, 1050-1066, 1067-1083, 1082-1098, 1084-1100, 1086-1102, 1087-1103, 1089-1105, 1090-1106, 1091-1107, 1092-1108, 1093-1109, 1098-1114, 1100-1116, 1106-1122, 1107-1123, 1108-1124, 1167-1183 or 1169-1185 of SEQ ID NO: 1.9.The dsRNA agent of any one of claims 1-8, wherein said antisense strand comprises a region of complementarity to an mRNA encoding SNCA which comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from any one of the antisense sequences listed in any one of Tables 1-3.10.The dsRNA agent of any one of claims 1-9, wherein said antisense strand comprises a region of complementarity to an mRNA encoding SNCA which comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from any one of the antisense sequences listed in any one of Tables 1-3.11.The dsRNA agent of any one of claims 1-10, wherein the antisense strand of dsRNA is substantially or fully complementary to any one of a target region of SEQ ID NO: 1, and preferably the dsRNA agent comprises an antisense strand sequence set forth in any one of Tables 1-3.12.The dsRNA agent of any one of claims 1-11, wherein the sense strand sequence is at least substantially complementary to or fully complementary to the antisense strand sequence in the dsRNA agent, preferably, wherein the dsRNA agent comprises a sense strand sequence set forth in any one of Tables 1-3.13.The dsRNA agent of any one of claims 1-12, wherein the dsRNA agent comprises the sequences set forth as a duplex sequence in any one of Tables 1-3.14.The dsRNA agent of any one of claims 1-13, wherein the one or more modified nucleotides are independently selected from the group consisting of: a 2’-O-methyl nucleotide, a 2’-Fluoro nucleotide, a 2’-deoxy nucleotide, a 2’ 3’-seco nucleotide mimic, a locked nucleotide, an unlocked nucleic acid nucleotide (UNA) , a glycol nucleic acid nucleotide (GNA) , a 2’-F-Arabino nucleotide, a 2’-methoyxyethyl nucleotide, an abasic nucleotide, an ribitol, inverted nucleotide, an inverted abasic nucleotide, an isomannide nucleotide, an inverted 2’-Ome nucleotide, an inverted 2’-deoxy nucleotide, a 2’-amino-modified nucleotide, a 2’-alkyl-modified nucleotide, a mopholino nucleotide, a 3’-OMe nucleotide, a 5'-phosphonate or 5'-phosphate mimic modified modified nucleotide, a nucleotide comprising a 5’-phosphorothioate group, a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a 2’-amino-modified nucleotide, a phosphoramidate, or a non-natural base comprising nucleotide.15.The dsRNA agent of any one of claims 1-14, comprises an E-vinylphosphonate nucleotide at the 5′ end of the guide strand, or comprises a 5'-phosphate mimic nucleotide represented by formula (VIII) or or their stereoisomers or racemates at the 5′-end of the antisense strand wherein: Q8 is O, S, SO, SO2, PR16R17 or NR11; R16 and R17 are independently (=O) , (=S) , OH, SH, C1-C6 alkyl, NR18R19; Ra and Rc are each independently selected from hydroxyl or protected hydroxyl, sulfhydryl or protected sulfhydryl, optionally substituted C1-C6 alkyl , optionally substituted C1-C6 alkoxy , protected or optionally substituted amino, natural or modified nucleosides; and Rb is O or S or NR12, R12 is hydrogen, C1-C6 alkyl, amino protecting group;Q1 and Q2 are each independently H, halogen, -CN, optionally substituted C1-C6 alkyl;the substituents in the substituted amino group are selected from: optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, sulfinyl, sulfonyl, acetyl;R11, R18 and R19 are independently H, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, methanesulfonyl, and sulfonic acid group;Z is a nucleoside containing a sugar or sugar surrogate moiety;T3 is an internucleotide linking group that connects the 5'-terminal nucleotide of formula (VIII) or its stereoisomer to the remainder of the 5′-end of the guide strand;each substituted group comprises one or more substituent groups optionally independently selected from: halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylsulfhydryl, CN.16.The dsRNA agent of any one of claims 1-15, wherein the dsRNA agent comprises at least one phosphorothioate internucleoside linkage.17.The dsRNA agent of any one of claims 1-15, wherein the sense strand comprises at least one phosphorothioate internucleoside linkage.18.The dsRNA agent of any one of claims 1-15, wherein the antisense strand comprises at least one phosphorothioate internucleoside linkage.19.The dsRNA agent of any one of claims 1-15, wherein the sense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages.20.The dsRNA agent of any one of claims 1-15, wherein the antisense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages.21.The dsRNA agent of any one of claims 1-20, wherein the modified sense strand is a modified sense strand sequence set forth in one of Tables 2-3.22.The dsRNA agent of any one of claims 1-20, wherein the modified antisense strand is a modified antisense strand sequence set forth in one of Tables 2-3.23.The dsRNA agent of any one of claims 1-22, wherein the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity is between 16 and 23 nucleotides in length.24.The dsRNA agent of any one of claims 1-23, wherein the region of complementarity is 19-21 nucleotides in length.25.The dsRNA agent of any one of claims 1-24, wherein each strand is no more than 30 nucleotides in length.26.The dsRNA agent of any one of claims 1-24, wherein each strand is no more than 25 nucleotides in length.27.The dsRNA agent of any one of claims 1-24, wherein each strand is no more than 23 nucleotides in length.28.The dsRNA agent of any one of claims 1-27, wherein the dsRNA agent comprises at least one modified nucleotide and further comprises one or more targeting groups or linking groups.29.The dsRNA agent of claim 28, wherein the one or more targeting groups or linking groups are conjugated to the sense strand.30.The dsRNA agent of claim 28 or 29, wherein the targeting group or linking group comprises N-acetyl-galactosamine (GalNAc) .31.The dsRNA agent of claim 28 or 29, wherein the targeting group has a structure: 32.The dsRNA agent of any one of claims 1-31, wherein the dsRNA agent comprises a targeting group that is conjugated to the 5’-terminal end of the sense strand.33.The dsRNA agent of any one of claims 1-31, wherein the dsRNA agent comprises a targeting group that is conjugated to the 3'-terminal end of the sense strand.34.The dsRNA agent of any one of claims 1-31, wherein the antisense strand comprises one inverted abasic residue at 3’-terminal end.35.The dsRNA agent of any one of claims 1-31, wherein the sense strand comprises one or two inverted abasic residues or imann residues at 3’ or / and 5’ terminal end.36.The dsRNA agent of any one of claims 1-35, wherein the dsRNA agent has two blunt ends.37.The dsRNA agent of any one of claims 1-35, wherein at least one strand comprises a 3’ overhang of at least 1 nucleotide.38.The dsRNA agent of any one of claims 1-35, wherein at least one strand comprises a 3’ overhang of at least 2 nucleotides.39.A composition comprising a dsRNA agent of any one of claims 1-38.40.The composition of claim 39, further comprising a pharmaceutically acceptable carrier.41.The composition of claim 40, further comprising one or more additional therapeutic agents.42.The composition of claim 41, wherein the composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial.43.The composition of any one of claims 39-42, wherein the composition is formulated for subcutaneous administration, is formulated intrathecally administration or is formulated for intravenous (IV) administration.44.A cell comprising a dsRNA agent of any one of claims 1-38, optionally, the cell is a mammalian cell, optionally a human cell, optionally a neuron.45.A method of inhibiting the expression of a SNCA gene in a cell, the method comprising:(i) preparing a cell comprising an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-38 or a composition of any one of claims 39-43.46.The method of claim 45, further comprising:(ii) maintaining the cell prepared in claim 45 (i) for a time sufficient to obtain degradation of the mRNA transcript of a SNCA gene, thereby inhibiting expression of the SNCA gene in the cell.47.The method of any one of claims 45-46, wherein the cell is in a subject and the dsRNA agent is administered to the subject subcutaneously.48.The method of any one of claims 45-46, wherein the cell is in a subject and the dsRNA agent is administered to the subject intrathecally, intracranially, intraventricularly, or intracerebrally.49.The method of any one of claims 45-46, wherein the cell is in a subject and the dsRNA agent is administered to the subject by IV administration.50.The method of any one of claims 47-49, further comprising assessing inhibition of the SNCA gene, following the administration of the dsRNA agent to the subject, wherein a means for the assessing comprises:(i) determining one or more physiological characteristics of a SNCA-associated disease or condition in the subject and(ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the SNCA-associated disease or condition and / or to a control physiological characteristic of the SNCA-associated disease or condition, wherein the comparison indicates one or more of a presence or absence of inhibition of expression of the SNCA gene in the subject.51.The method of claim 50, wherein the determined physiological characteristic is one or more of: SNCA mRNA, α-synuclein protein, and the level of another parameter functionally linked to the level of expression of SNCA in the subject.52.The method of claim 51, wherein a reduction in one or more of the subject’s the SNCA mRNA, the SNCA protein, and the level of another parameter functionally linked to the level of expression of SNCA indicates reduction of SNCA gene expression in the subject.53.A method of inhibiting expression of a SNCA gene in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-38 or a composition of any one of claims 39-43.54.The method of claim 53, wherein the dsRNA agent is administered to the subject subcutaneously.55.The method of claim 53, wherein the dsRNA agent is administered to the subject intrathecally, intracranially, intraventricularly, or intracerebrally.56.The method of claim 53, wherein the dsRNA agent is administered to the subject by IV administration.57.The method of any one of claims 54-56, further comprising assessing inhibition of the SNCA gene, following the administration of the dsRNA agent, wherein a means for the assessing comprises:(i) determining one or more physiological characteristics of a SNCA-associated disease or condition in the subject and(ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the SNCA-associated disease or condition and / or to a control physiological characteristic of the SNCA-associated disease or condition,wherein the comparison indicates one or more of a presence or absence of inhibition of expression of the SNCA gene in the subject.58.The method of claim 57, wherein the determined physiological characteristic is one or more of: SNCA mRNA, α-synuclein protein, or the level of another parameter functionally linked to the level of expression of SNCA.59.The method of claim 58, wherein a reduction in one or more of the subject’s SNCA mRNA, α-synuclein protein, or the level of another parameter functionally linked to the level of expression of SNCA indicates reduction of SNCA gene expression in the subject.60.A method of treating a disease or condition associated with the presence of SNCA protein, the method comprising administering to a subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-38, or a composition of any one of claims 39-43, to inhibit SNCA gene expression.61.The method of claim 60, wherein the disease or condition is a SNCA-associated disease.62.The method of claim 61, wherein the SNCA-associated disease is synucleinopathy.63.The method of claim 61, the SNCA-associated disease is Parkinson’s Disease (PD) , multisystemic atrophy (MSA) , Lewy Body Dementia (LBD) , pure Autonomic Failure (PAF) , Pick's disease, progressive supranuclear palsy, dementia pugilistica, chromosome 17-related parkinsonism, Lytico-Bodig disease, tangle predominant dementia, Argyrophilic grain disease, silver-philic granulosis, gangliocytoma, meningioma, subacute sclerotic encephalitis, lead-poisoning encephalopathy, tuberous sclerosis, hallervorden-Spatz disease, lipofuscin deposition, corticobasal degeneration, frontotemporal dementia, frontotemporal lobar degeneration, Alzheimer's disease, Huntington's disease, Down's syndrome, psychosis, schizophrenia, and / or Crottzfeldt-Jab disease.64.The method of any one of claims 60-63, further comprising administering an additional therapeutic regimen to the subject.65.The method of claim 64, wherein the additional therapeutic regimen comprises: administering to the subject one or more SNCA antisense polynucleotides of the invention, administering to the subject a non-SNCA dsRNA therapeutic agent, and a behavioral modification in the subject.66.The method of claim 65, wherein the additional therapeutic regimen is one of more of: antipruritics, astringents, local anesthetics, anti-inflammatory agents, cholinesterase inhibitors, muscarinic agonists, antioxidants or anti-inflammatories, or a combination of any of the foregoing, preferably, the additional therapeutic regimen is one or more of: carbidopa-levodopa, levodopa, entacopone, tolcapone, opicapone, pramipexole, ropinirole, apomorphine, rotigotine, selegiline, rasagiline, safinamide, amantadine, istradefylline, trihexyphenidyl, benztropine, rivastigmine, donepezil, galantamine, acetyl-L-carnitine, vinpocetine, huperzine A, alpha lipoic acid, vitamin E, rhodiola, biotin, galantamine (Reminyl) , tacrine (Cognex) , selegiline, physostigmine, revistigmin, donepezil, (Aricept) , rivastigmine (Exelon) , metrifonate, milameline, xanomeline, saeluzole, idebenone, ENA-713, mermic, quetiapine, neurestrol, idebenone, propentofylline, and neuromidal and memantine, as well as physical, occupational and speech therapy, an exercise program including cardiorespiratory, resistance, flexibility, and gait and balance exercises, and deep brain stimulation (DBS) involving the implantation of an electrode into a targeted area of the brain.67.The method of any one of claims 60-66, wherein the dsRNA agent is administered to the subject subcutaneously.68.The method of any one of claims 60-66, wherein the dsRNA agent is administered to the subject intrathecally, intracranially, intraventricularly, or intracerebrally.69.The method of any one of claims 60-66, wherein the dsRNA agent is administered to the subject by IV administration.70.The method of any one of claims 60-66, further comprising determining an efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject.71.The method of claim 70, wherein a means of determining an efficacy of the treatment in the subject comprises:(i) determining one or more physiological characteristics of the SNCA-associated disease or condition in the subject and(ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the SNCA-associated disease or conditionwherein the comparison indicates one or more of a presence, absence, and level of efficacy of the administration of the double-stranded ribonucleic acid (dsRNA) agent to the subject.72.The method of claim 71, wherein the determined physiological characteristic is: SNCA mRNA, α-synuclein protein, and the level of another parameter functionally linked to the level of expression of SNCA.73.The method of claim 71, wherein a reduction in one or more of the SNCA mRNA, α-synuclein protein, and the level of another parameter functionally linked to the level of expression of SNCA indicates the presence of efficacy of the administration of the double-stranded ribonucleic acid (dsRNA) agent to the subject.74.A method of decreasing a level of SNCA protein in a subject compared to a baseline pre-treatment level of SNCA protein in the subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-38, or a composition of any one of claims 39-43, to decrease the level of SNCA gene expression.75.The method of claim 74, wherein the dsRNA agent is administered to the subject subcutaneously, is administered to the subject intracranially, intrathecally, intraventricularly, intracerebrally or is administered to the subject by IV administration.76.A method of altering a physiological characteristic of a SNCA-associated disease or condition in a subject compared to a baseline pre-treatment physiological characteristic of the SNCA-associated disease or condition in the subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-38, or a composition of any one of claims 39-43, to alter the physiological characteristic of the SNCA-associated disease or condition in the subject.77.The method of claim 76, wherein the dsRNA agent is administered to the subject subcutaneously, is administered to the subject intrathecally, intraventricularly, intracerebrally or is administered to the subject by IV administration.78.The method of any one of claims 76-77, wherein the physiological characteristic is one or more of: SNCA mRNA, α-synuclein protein, and the level of another parameter functionally linked to the level of expression of SNCA.

Citation Information

Patent Citations

  • VARIANT RNAi AGAINST ALPHA-SYNUCLEIN

    US20210309999A1

  • Oligonucleotides for SNCA modulation

    US20210363524A1

  • SNCA irna compositions and methods of use thereof for treating or preventing SNCA-associated neurodegenerative diseases

    US20240011032A1

  • Antisense oligonucleotides for treatment of neurological disorders

    WO2021141917A1

  • Sirna compositions and methods targeting alpha-synuclein nucleic acids

    WO2024073609A2

Cited By

  • Oligonucleotide terminal phosphate derivatives and method of use

    WO2025191337A3