Riboswitches and logic-gated genetic medicine

Abstract

The present disclosure provides riboswitches to modulate gene expression or vector stability in response to the presence or absence of target nucleic acids. Also provided are vectors that include one or more of such riboswitches, for example, a plurality of the riboswitches combined into a logic gate. Such vectors are useful as programmable genetic medicines, permitting expression of desired cargos only in the precise cell types or disease states that have recognized molecular signatures. The present disclosure also provides related DNA vectors, host cells, manufacturing processes, and uses of the vectors in diagnostic and therapeutic methods.

Description

Attorney Docket No.: JMPG-001WO RIBOSWITCHES AND LOGIC-GATED GENETIC MEDICINE CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application No.63 / 554,398, filed on February 16, 2024, the entire contents of which are incorporated by reference herein for all purposes. FIELD OF THE DISCLOSURE

[0002] The present disclosure relates to riboswitches to modulate gene expression or vector stability in response to the presence or absence of target nucleic acids. The present disclosure also relates to vectors that include one or more of such riboswitches, for example, a plurality of the riboswitches combined into a logic gate. Such vectors are useful as programmable genetic medicines, permitting expression of desired cargos only in the precise cell types or disease states that have recognized molecular signatures. BACKGROUND

[0003] Nucleic acid-based therapeutics still suffer from major unwanted off-target based toxicity and side-effects. Current targeted delivery systems encapsulating nucleic acid cargoes continue to suffer from high levels of off-target uptake and nucleic acid expression, low duration of response in vivo, and high cost of developing a targeted delivery system. Although certain molecular switch systems have been designed, many of them are not yet suitable for genetic medicines given their leakiness and unwanted basal expression.

[0004] There remains a need for gene therapies that can discriminate between different cell types, tissues, and organs, as well as healthy versus disease phenotypes, to generate an output only in the desired target cells. SUMMARY OF THE DISCLOSURE

[0005] The present disclosure provides programmable genetic medicines that are capable of reading a cell’s molecular signature and generating a response only in the desired cells. The genetic medicines include riboswitches and logic-gated nucleic acid-based therapeutics capable of restricting expression of the desired cargo in the precise cell type or disease state by reading and responding to the cell’s molecular signature, such as the presence or absence of selected messenger RNA (mRNA) or microRNA (miRNA). Specifically, theAttorney Docket No.: JMPG-001WO present disclosure provides three types of riboswitches, including a torsionally modulated switch, a circularization switch, which are on-switches; and a cleavable switch, which is an off-switch but can be converted to an on-switch, as described below.

[0006] The cleavable switch is based on RNA self-cleavage in the presence of a target RNA. In this aspect, the present disclosure provides a cleavable RNA switch responsive to a target RNA, the cleavable RNA switch comprising, from 5’ to 3’: (a) a first target RNA binding sequence complementary to a first target RNA sequence of the target RNA; (b) a hammerhead ribozyme left (HHR-L) arm; (c) a loop forming region comprising a hammerhead ribozyme cleavage site comprising the nucleotide sequence of GUC; (d) a hammerhead ribozyme right (HHR-R) arm; (e) a second target RNA binding sequence complementary to a second target RNA sequence of the target RNA, wherein: in the presence of the target RNA, the HHR-L arm and the HHR-R arm together form a hammerhead ribozyme and the loop forming region forms a loop that is cleaved by the hammerhead ribozyme, and in the absence of the target RNA, the HHR-L arm and the HHR-R arm do not form a hammerhead ribozyme and the loop forming region is not cleaved.

[0007] In a hammerhead ribozyme in the regular orientation, the HHR-L arm can comprise a nucleotide sequence at least 80% identical to SEQ ID NO: 74, and the HHR-R arm can comprise a nucleotide sequence at least 80% identical to SEQ ID NO: 75. In certain embodiments, parts (b), (c), and (d) together comprise a nucleotide sequence at least 80% identical to SEQ ID NO: 26.

[0008] In a hammerhead ribozyme in a flipped orientation, the HHR-L arm can comprise a nucleotide sequence at least 80% identical to SEQ ID NO: 76, and the HHR-R arm can comprise a nucleotide sequence at least 80% identical to SEQ ID NO: 77. In certain embodiments, parts (b), (c), and (d) together comprise a nucleotide sequence at least 80% identical to SEQ ID NO: 63.

[0009] The first target RNA sequence can be adjacent to the second target RNA sequence. To bring the 3’ end of the first target RNA binding sequence to the proximity ofAttorney Docket No.: JMPG-001WO the 5’ end of the second target RNA binding sequence, the first target RNA sequence can be positioned 3’ to the second target RNA sequence in the target RNA. The first target RNA binding sequence and the second target RNA binding sequence can each be 20 to 100 (e.g., 50 to 100, or 80 to 100) nucleotides in length. The target RNA can be an mRNA or a non- coding RNA, such as an miRNA.

[0010] This type of off-switch is useful for conditionally cleaving a linear or circular RNA vector, rendering it susceptible to degradation (e.g., by exonucleases) in a cell. Accordingly, the present disclosure also provides an RNA vector for expressing a protein of interest, the RNA vector comprising a translation initiation element, a gene encoding the protein of interest, and a cleavable RNA switch as disclosed herein, wherein: in the presence of the target RNA, cleavage of the loop permits degradation of the RNA vector, and in the absence of the target RNA, the RNA vector is not degraded as a result of cleavage of the loop and is translated to produce the protein of interest.

[0011] The cleavable switch can also be converted to an on-switch. For example, where the protein of interest encoded by the vector can suppress expression of a downstream gene of interest, the downstream gene of interest is expressed in the presence of the target RNA, and expression of the downstream gene of interest is suppressed by the protein of interest in the absence of the target RNA. It is contemplated that the protein of interest can suppress translation and / or transcription of the downstream gene of interest.

[0012] The RNA vector can be a linear RNA vector that further comprises a 5’ N7- methylated guanosine cap, a 5’ UTR positioned 5’ to the gene encoding the protein of interest, a 3’ UTR positioned 3’ to the gene encoding the protein of interest, and a polyadenylation tail. In this linear RNA vector, the cleavable RNA switch can be positioned between the 5’ UTR and the gene encoding the protein of interest, between the 3’ UTR and the polyadenylation tail, or at other appropriate positions in the linear RNA. In a specific linear RNA vector, a cleavable RNA switch is positioned between the 5’ UTR and the gene encoding the protein of interest, and an additional cleavable RNA switch can be further included between the 3’ UTR and the polyadenylation tail.

[0013] The RNA vector can also be a circular RNA vector that further comprises an IRES operably linked to the gene of interest.Attorney Docket No.: JMPG-001WO

[0014] The circularization switch is based on operable linkage of an IRES to a protein coding sequence as a result of RNA circularization. In this aspect, the present disclosure provides a linear RNA vector capable of circularization responsive to a target RNA, which when circularized can express a protein of interest, the linear RNA vector comprising, from 5’ to 3’: (a) a first target RNA binding sequence complementary to a first target RNA sequence of the target RNA; (b) a 3’ fragment of a self-splicing intron; (c) a gene encoding the protein of interest having a 5’ end; (d) a unidirectional IRES having a 3’ end; (e) a 5’ fragment of the self-splicing intron; and (f) a second target RNA binding sequence complementary to a second target RNA sequence of the target RNA; wherein: in the presence of the target RNA, elements (b) and (e) form an active ribozyme that splices the 5’ end of the gene to the 3’ end of the unidirectional IRES, thereby to form a circular RNA, permitting translation of the protein of interest from the IRES; and in the absence of the target RNA, the protein of interest is not translated from the IRES.

[0015] Various self-splicing introns and fragments thereof are useful in this aspect to facilitate circularization. In one example, the self-splicing intron is a Group I self-splicing intron comprising, from 5’ to 3’, a 5’ splice site adjacent to a P1 sequence 5’ to the Group I self-splicing intron, an IGS, a P2 helix, a P3 helix, a P4 helix, a P5 helix, a P6 helix, a P7 helix, a P8 helix, a P9 helix, and a 3’ splice site adjacent to a P10 sequence 3’ to the Group I self-splicing intron. In a first way of splitting the self-splicing intron into fragments to facilitate circularization, the 5’ fragment of the Group I self-splicing intron comprises the 5’ splice site, the IGS, the P2 helix, the P3 helix, the P4 helix, the P5 helix, and a 5’ portion of the P6 helix; and the 3’ fragment of the Group I self-splicing intron comprises a 3’ portion of the P6 helix, the P7 helix, the P8 helix, the P9 helix, and the 3’ splice site. In a second way of splitting the self-splicing intron into fragments to facilitate circularization, the 5’ fragment of the Group I self-splicing intron comprises the 5’ splice site; and the 3’ fragment of the Group I self-splicing intron comprises the IGS, the P2 helix, the P3 helix, the P4 helix, the P5 helix, the P6 helix, the P7 helix, the P8 helix, the P9 helix, and the 3’ splice site. In anotherAttorney Docket No.: JMPG-001WO example, the self-splicing intron is a Group II self-splicing intron comprising, from 5’ to 3’, a 5’ splice site, a Domain 1, a Domain 2, a Domain 3, a Domain 4, a Domain 5, a Domain 6, and a 3’ splice site. In one way of splitting the self-splicing intron into fragments to facilitate circularization, the 5’ fragment of the Group II self-splicing intron comprises the 5’ splice site, the Domain 1, the Domain 2, and the Domain 3, and a 5’ portion of the Domain 4; and the 3’ fragment of the Group II self-splicing intron comprises a 3’ portion of the Domain 4, the Domain 5, the Domain 6, and the 3’ splice site.

[0016] The first target RNA sequence can be adjacent to the second target RNA sequence. To bring the 3’ end of the first target RNA binding sequence to the proximity of the 5’ end of the second target RNA binding sequence, the first target RNA sequence can be positioned 3’ to the second target RNA sequence in the target RNA. The first target RNA binding sequence and the second target RNA binding sequence can each be 20 to 100 nucleotides in length. The target RNA can be an mRNA or a non-coding RNA, such as an miRNA.

[0017] The linear RNA vector can further comprise a polyadenylation tail. It is contemplated, however, that in certain embodiments the linear RNA vector does not comprise a 5’ N7-methylated guanosine cap.

[0018] The torsionally modulated switch is based on a translation inhibitory sequence, such as a translation initiation element cis-repressive RNA (tecrRNA), that can be inhibited by torsional constraint in the presence of a target RNA. In this aspect, the present disclosure provides a tecrRNA switch responsive to a target RNA, the tecrRNA switch comprising, from 5’ to 3’: (a) a first target RNA binding sequence complementary to a first target RNA sequence of the target RNA; (b) a tecrRNA capable of binding and suppressing a translation initiation element; and (c) a second target RNA binding sequence complementary to a second target RNA sequence of the target RNA, wherein: in the absence of the target RNA, the tecrRNA binds the translation initiation element and suppresses its activity, and in the presence of the target RNA, the tecrRNA becomes torsionally constrained and unable to bind the translation initiation element.Attorney Docket No.: JMPG-001WO

[0019] The first target RNA sequence can be adjacent to the second target RNA sequence. The tecrRNA switch can bind the target RNA in an intercrossing pattern, where the first target RNA sequence is positioned 5’ to the second target RNA sequence in the target RNA. The first target RNA binding sequence and the second target RNA binding sequence can each be 20 to 100 nucleotides in length. The target RNA can be a messenger RNA (mRNA) or a non-coding RNA, such as a microRNA (miRNA). The tecrRNA can be 5 to 100 nucleotides in length.

[0020] The torsionally modulated switch is useful for conditionally suppressing a 5’ N7-methylated guanosine cap (an anti-Cap design) or an internal ribosome entry site (IRES) (an anti-IRES design).

[0021] In the anti-Cap design, the translation initiation element that can be bound and suppressed by the tecrRNA includes a 5’ N7-methylated guanosine cap. Such tecrRNA is useful in linear RNA vectors. In certain embodiments, the present disclosure provides a linear RNA vector for expressing a protein of interest, the RNA vector comprising a 5’ N7- methylated guanosine cap, a torsionally modulated tecrRNA switch as disclosed herein, and a gene encoding the protein of interest, wherein the tecrRNA comprises a nucleotide sequence complementary to a 5’ region of the linear RNA vector, wherein: in the absence of the target RNA, the tecrRNA suppresses translation of the protein of interest from the 5’ N7-methylated guanosine cap, and in the presence of the target RNA, the protein of interest is translated from the 5’ N7-methylated guanosine cap.

[0022] The linear RNA vector can further comprise a 5’ untranslated region (5’ UTR) positioned 5’ to the gene, a 3’ untranslated region (3’ UTR) positioned 3’ to the gene, and a polyadenylation tail. The tecrRNA switch can be positioned 5’ to the 5’ UTR, 3’ to the 3’ UTR, or at other appropriate positions in the linear RNA. In a specific example, the tecrRNA switch is positioned 3’ to the 3’ UTR. It is also contemplated that the 5’ region of the linear RNA vector complementary to the tecrRNA can include a 5’ portion of the 5’ UTR.

[0023] In a linear RNA vector disclosed herein, the 5’ portion of the 5’ UTR can be 20 to 60 nucleotides in length. An exemplary 5’ portion of the 5’ UTR comprises a nucleotide sequence at least 80% identical to SEQ ID NO: 69, and a corresponding tecrRNA comprises a complementary sequence and one or more additional nucleotides 3’ thereto. In certainAttorney Docket No.: JMPG-001WO embodiments, the first target RNA binding sequence and the second target RNA binding sequence are each 60 to 100 nucleotides in length.

[0024] In the anti-IRES design, the translation initiation element that can be bound and suppressed by the tecrRNA includes an IRES. In certain embodiments, the present disclosure provides an RNA vector for expressing a protein of interest, the RNA vector comprising a torsionally modulated tecrRNA switch as disclosed herein, an IRES that the tecrRNA is capable of binding and suppressing, and a gene encoding the protein of interest operably linked to the IRES, wherein the tecrRNA comprises a nucleotide sequence complementary to a nucleotide sequence in the IRES, wherein: in the absence of the target RNA, the tecrRNA suppresses translation of the protein of interest from the IRES, and in the presence of the target RNA, the protein of interest is translated from the IRES.

[0025] In such as anti-IRES tecrRNA switch, the tecrRNA can be 10 to 30 (e.g., 15 to 20) nucleotides in length. The first target RNA binding sequence and the second target RNA binding sequence can each be 20 to 60 nucleotides in length.

[0026] The RNA vector can be a circular RNA vector or a linear RNA vector.

[0027] The riboswitches of the three types described herein above can be combined to create logic gates.

[0028] One example is an AND gate utilizing torsionally modulated switches. In this aspect, the present disclosure provides an RNA vector for expressing a protein of interest, the RNA vector comprising a translation initiation element, a gene encoding the protein of interest, a first torsionally modulated tecrRNA switch as disclosed herein responsive to a first target RNA, and a second torsionally modulated tecrRNA switch as disclosed herein responsive to a second, different target RNA, wherein: the tecrRNA in the first tecrRNA switch and the tecrRNA in the second tecrRNA switch are each capable of binding and suppressing the translation initiation element, in the absence of the first target RNA, the tecrRNA in the first tecrRNA switch binds the translation initiation element and suppresses translation of the protein of interest, in the absence of the second target RNA, the tecrRNA in the second tecrRNAAttorney Docket No.: JMPG-001WO switch binds the translation initiation element and suppresses translation of the protein of interest, and in the presence of both the first target RNA and the second target RNA, the tecrRNA in the first tecrRNA switch and the tecrRNA in the second tecrRNA switch both become torsionally constrained and unable to bind the translation initiation element, thereby permitting translation of the protein of interest from the translation initiation element.

[0029] Another example is an OR gate utilizing torsionally modulated switches. In this aspect, the present disclosure provides an RNA vector for expressing a protein of interest, the RNA vector comprising a first translation initiation element operably linked to a first gene encoding the protein of interest, a second translation initiation element operably linked to a second gene encoding the protein of interest, a first torsionally modulated tecrRNA switch as disclosed herein responsive to a first target RNA, and a second torsionally modulated tecrRNA switch as disclosed herein responsive to a second, different target RNA, wherein: the tecrRNA in the first tecrRNA switch is capable of binding and suppressing the first translation initiation element, and the tecrRNA in the second tecrRNA switch is capable of binding and suppressing the second translation initiation element, in the absence of both the first target RNA and the second target RNA, the tecrRNA in the first tecrRNA switch binds and suppresses the first translation initiation element, and the tecrRNA in the second tecrRNA switch binds and suppresses the second translation initiation element, thereby suppressing translation of the protein of interest from either translation initiation element, in the presence of the first target RNA, the tecrRNA in the first tecrRNA switch becomes torsionally constrained and unable to bind the first translation initiation element, thereby permitting translation of the protein of interest from the first translation initiation element, and in the presence of the second target RNA, the tecrRNA in the second tecrRNA switch becomes torsionally constrained and unable to bind the second translation initiation element, thereby permitting translation of the protein of interest from the second translation initiation element.

[0030] Another example is a NOT gate utilizing a torsionally modulated switch and a cleavable switch. In this aspect, the present disclosure provides an RNA vector for expressing a protein of interest, the RNA vector comprising a translation initiation element, a gene encoding the protein of interest, a torsionally modulated tecrRNA switch as disclosedAttorney Docket No.: JMPG-001WO herein responsive to a first target RNA, and a cleavable RNA switch as disclosed herein responsive to a second, different target RNA, wherein: the tecrRNA in the tecrRNA switch is capable of binding and suppressing the translation initiation element, in the presence of the second target RNA, cleavage of the loop in the cleavable RNA switch permits degradation of the RNA vector, in the absence of the second target RNA and in the absence of the first target RNA, the tecrRNA in the tecrRNA switch binds the translation initiation element and suppresses translation of the protein of interest, and in the absence of the second target RNA but in the presence of the first target RNA, the tecrRNA in the tecrRNA switch becomes torsionally constrained and unable to bind the translation initiation element, thereby permitting translation of the protein of interest from the translation initiation element.

[0031] Another example is a complex gate utilizing a torsionally modulated switch and two cleavable switches. In this aspect, the present disclosure provides an RNA vector for expressing a protein of interest, the RNA vector comprising a translation initiation element, a gene encoding the protein of interest, a first cleavable RNA switch as disclosed herein responsive to a first target RNA, a second cleavable RNA switch as disclosed herein responsive to a second, different target RNA, and a torsionally modulated tecrRNA switch as disclosed herein responsive to a third, different target RNA, wherein: the tecrRNA in the tecrRNA switch is capable of binding and suppressing the translation initiation element, in the presence of either the first target RNA or the second target RNA, cleavage of the loop in the respective cleavable RNA switch permits degradation of the RNA vector, in the presence of neither the first target RNA nor the second target RNA, and in the absence of the third target RNA, the tecrRNA in the tecrRNA switch binds the translation initiation element and suppresses translation of the protein of interest, and in the presence of neither the first target RNA nor the second target RNA, but in the presence of the third target RNA, the tecrRNA in the tecrRNA switch becomes torsionally constrained and unable to bind the translation initiation element, thereby permitting translation of the protein of interest from the translation initiation element.

[0032] Also provided are related vectors, host cells, and manufacturing processes. In certain embodiments, the present disclosure provides a DNA vector encoding any one of theAttorney Docket No.: JMPG-001WO linear RNA vectors disclosed herein; and a method of producing a linear RNA vector, the method comprising contacting a producer cell with such a DNA vector under conditions to transcribe the linear RNA vector. In other embodiments, the present disclosure provides a precursor RNA of any one of the circular RNA vectors disclosed herein; a DNA vector encoding such a precursor RNA; and a method of producing a circular RNA vector, the method comprising contacting a producer cell with such a DNA vector under conditions to transcribe and circularize the precursor RNA. Additionally, the present disclosure provides a host cell comprising any one of the RNA vectors or DNA vectors disclosed herein.

[0033] Other embodiments and details of the disclosure are presented herein below. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] FIG.1A illustrates exemplary torsionally modulated tecrRNA switches capable of binding and suppressing a 5’ N7-methylated guanosine cap and vectors containing such riboswitches. The upper left panel shows a tecrRNA in an intercrossing pattern. The upper right panel shows a tecrRNA in a non-intercrossing pattern. The middle panel shows a linear RNA vector containing a torsionally modulated tecrRNA switch inserted between 3’ UTR and a polyadenylation tail (identified as “pA” in the figure). The lower panel shows a linear RNA vector containing a torsionally modulated tecrRNA switch inserted 5’ to a 5’ UTR in the vector.

[0035] FIG.1B illustrates an exemplary linear RNA vector containing a torsionally modulated tecrRNA switch in active and inactive states. The upper panel shows that in the absence of the target RNA, the tecrRNA binds and suppresses the 5’ N7-methylated guanosine cap of the vector by hybridizing with a 5’ portion of the vector (corresponding to the “5’ Cap and adjoining sequence in FIG.1A, middle and lower panels). The lower panel shows that in the presence of the target RNA, the tecrRNA is torsionally constrained and unable to bind the 5’ N7-methylated guanosine cap of the vector.

[0036] FIG.1C illustrates an exemplary circular RNA containing an IRES operably linked to a gene encoding a protein of interest (identified as “GOI” in the figure) and three torsionally modulated tecrRNA switches targeting the IRES.

[0037] FIG.1D illustrates exemplary internal ribosome entry site (IRES) elements and anti-IRES translation initiation element cis-suppressive RNA (tecrRNA) designs. The left panel shows an unmodified Coxsackievirus B3 (CVB3) IRES. The middle panel identifies aAttorney Docket No.: JMPG-001WO region in the unmodified CVB3 IRES, in a dashed box, that can be targeted by a tecrRNA via RNA hybridization. The right panel shows a modified CVB3 IRES with a synthetic sequence integrated between Domain V and Domain VI (gray line). A tecrRNA can be designed to target this IRES by hybridizing with the synthetic sequence.

[0038] FIG.2A illustrates an exemplary linear RNA vector containing a circularization switch. The upper panel shows the genetic elements in the linear vector. The lower panel shows a circular RNA generated from the linear RNA in the presence of the target RNA.

[0039] FIG.2B illustrates an exemplary self-splicing cis-repressive RNA (sicrRNA) switch design, wherein in the absence of a target RNA, the sicrRNA binds and suppresses a self-splicing intron fragment by hybridizing with sequences flanking the self-splicing intron fragment.

[0040] FIG.2C illustrates an exemplary linear RNA vector containing a circularization switch that includes sicrRNAs. The upper panel shows the genetic elements in the linear vector. The lower panel shows a circular RNA generated from the linear RNA in the presence of the target RNA.

[0041] FIG.3A illustrates an exemplary cleavable switch and linear RNA vectors containing such switches. The right panels show two structures of cleavable switches each containing a hammerhead ribozyme when the switch is hybridized with a target RNA. The left panels show linear vectors containing such switches between a 3’ UTR and a polyadenylation tail (upper left panel), between a 5’ UTR and a gene of interest (middle left panel), or at both locations (lower left panel).

[0042] FIG.3B illustrates an exemplary circular RNA vector containing three cleavable switches.

[0043] FIG.4 illustrates a circular RNA vector containing two torsionally modulated tecrRNA switches combined into an AND gate.

[0044] FIG.5 illustrates a circular RNA vector containing two torsionally modulated tecrRNA switches, combined into an OR gate.

[0045] FIG.6A illustrates a linear RNA vector containing a torsionally modulated tecrRNA switch and two cleavable switches, combined into a complex logic gate.

[0046] FIG.6B illustrates a circular RNA vector containing a torsionally modulated tecrRNA switch and two cleavable switches, combined into a complex logic gate.Attorney Docket No.: JMPG-001WO

[0047] FIG.7 shows a flow cytometric analysis of cleavable switches in HeLa vs. MLE-15 cells at 24 hrs (left panel) and 48 hrs (right panel).

[0048] FIG.8 shows a flow cytometric analysis of optimized cleavable switches in HeLa vs. MLE-15 cells at 24 hrs (left panel), florescence image analysis of optimized cleavable switches in HeLa vs. MLE-15 cells at 24 hrs (right top panel), and florescence image intensity analysis of optimized cleavable switches in HeLa vs. MLE-15 cells at 24 hrs (right bottom panel).

[0049] FIG.9 shows bioluminescence whole body imaging of mice treated with cleavable switches at 24hrs (left panel), total flux bioluminescence signal recorded from mice treated with cleavable switches at 24 hrs (right top panel), and immunohistochemistry of mice treated with cleavable switches at 24 hrs (right bottom panel).

[0050] FIG.10A illustrates an exemplary dual RNA system cleavable ON switch, wherein RNA #1 contains cleavable switches with sensor arms for binding target SFTPC mRNA and a L7Ae repressor gene, and RNA #2 that contains 4X K-turn (L7Ae binding site) and a luciferase gene.

[0051] FIG.10B shows luciferase assay analysis of dual RNA cleavable ON switches in HeLa vs. MLE-15 cells at 24 hrs.

[0052] FIG.11 shows agarose gel analysis of JG5 circularization switch in presence or absence of target mRNA (left panel) and percent circularization efficiency of JG5 circularization switch in presence or absence of target mRNA (right panel).

[0053] FIG.12 shows flow cytometric analysis of circularization switches in HeLa vs. MLE-15 cells at 24 hrs (left panel) and 48 hrs (right panel).

[0054] FIG.13 shows flow cytometric analysis of an anti-CAP tecrRNA switch in HeLa vs. MLE-15 cells at 24 hrs (left panel) and 48 hrs (right panel).

[0055] FIG.14 shows flow cytometric analysis of anti-IRES tecrRNA switches in HeLa vs. MLE-15 cells at 24 hrs (left panel) and 48 hrs (right panel). DETAILED DESCRIPTION

[0056] The present disclosure provides programmable genetic medicines that are capable of reading a cell’s molecular signature and generating response only in the desired cells. The genetic medicines include riboswitches and logic-gated nucleic acid-basedAttorney Docket No.: JMPG-001WO therapeutics capable of restricting expression of the desired cargo in the precise cell type or disease state by reading and responding to the cell’s molecular signature. Specifically, the present disclosure provides three types of riboswitches, including a torsionally modulated switch, a circularization switch, which are on-switches; and a cleavable switch, which is an off-switch.

[0057] The target RNA detected by the riboswitches disclosed herein can be an RNA expressed by or otherwise present in a target cell. In certain embodiments, the target RNA is a messenger RNA (mRNA). In certain embodiments, the target RNA is a non-coding RNA, such as a microRNA (miRNA). It is also contemplated that other types of nucleic acids, such as DNA, may be similarly detected by the riboswitches disclosed herein, if present in the same environment (e.g., the same subcellular compartment). Definitions

[0058] To facilitate an understanding of the present disclosure, a number of terms and phrases are defined below.

[0059] The terms “a” and “an” as used herein mean “one or more” and include the plural unless the context is inappropriate.

[0060] As used herein, the term “pharmaceutical formulation” refers to the combination of an active agent with a carrier, inert or active, making the composition especially suitable for diagnostic or therapeutic use in vivo or ex vivo.

[0061] As used herein, the terms “subject” and “patient” refer to an organism to be treated by the methods and compositions described herein. Such organisms preferably include, but are not limited to, mammals (e.g., murines, simians, equines, bovines, porcines, primates, canines, felines, and the like), and more preferably include humans.

[0062] The terms “treat,” “treating,” or “treatment,” and other grammatical equivalents as used in this disclosure, include alleviating, abating, ameliorating, or preventing a disease, condition or symptoms, preventing additional symptoms, ameliorating or preventing the underlying metabolic causes of symptoms, inhibiting the disease or condition, e.g., arresting the development of the disease or condition, relieving the disease or condition, causing regression of the disease or condition, relieving a condition caused by the disease or condition, or stopping the symptoms of the disease or condition, and are intended to include prophylaxis. The terms further include achieving a therapeutic benefit and / or a prophylactic benefit. The term “therapeutic benefit” refers to eradication or amelioration of the underlyingAttorney Docket No.: JMPG-001WO disorder being treated. Also, a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the patient, notwithstanding that the patient may still be afflicted with the underlying disorder.

[0063] As used herein, the term “effective amount” refers to the amount of a compound (e.g., a gene therapy of the present disclosure) sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations, applications, or dosages and is not intended to be limited to a particular formulation or administration route.

[0064] The term “about” refers to any minimal alteration to a given value, including ±5%, ±10%, or ±15% of a specified numerical value or data point. Ranges can be expressed in this disclosure as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it is understood that the particular value forms another aspect. It is further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed in this disclosure, and that each value is also disclosed as “about” that particular value in addition to the value itself.

[0065] Throughout the description, where compositions are described as having, including, containing, incorporating, or comprising specific components, or where processes and methods are described as having, including, or comprising specific steps, it is intended that compositions and methods are inclusive or open-ended and do not exclude additional, unrecited components or steps. It is contemplated that, additionally, there are compositions of the present disclosure that consist essentially of, or consist of, the recited components, and that there are processes and methods according to the present disclosure that consist essentially of, or consist of, the recited steps.

[0066] As a general matter, compositions specifying a percentage are by weight unless otherwise specified. Further, if a variable is not accompanied by a definition, then the previous definition of the variable controls. Translation Inhibitory Sequences

[0067] The present disclosure provides torsionally modulated switches, which both utilize translation inhibitory sequences. Translation inhibitory sequences can suppressAttorney Docket No.: JMPG-001WO translation of a protein of interest from an RNA (e.g., linear RNA or circular RNA) by inhibiting the interaction of ribosomes with the RNA or inhibiting the migration of ribosomes on the RNA.

[0068] To inhibit the interaction of ribosomes with the RNA, the translation inhibitory sequence can, for example, suppress a translation initiation element of the RNA, such as a 5’ N7-methylated guanosine cap or an internal ribosome entry site (IRES). Such translation inhibitory sequence is also referred to as a translation initiation element cis-repressive RNA (tecrRNA) herein. Anti-cap tecrRNAs

[0069] Exemplary tecrRNAs capable of binding and suppressing a 5’ N7-methylated guanosine (m7G) cap include but are not limited to a nucleotide sequence complementary to a 5’ region of a linear RNA vector. Them7G cap is also referred to herein as the “cap” or “Cap” where clear from the context. For example, where anm7G capped adenine-guanine (AG) dinucleotide is used as a primer to synthesize a linear RNA by in vitro transcription (see, e.g., Vaidyanathan et al., MOL. THER. NUCLEIC ACIDS (2018) 12: 530–42), the linear RNA includes them7G capped AG sequence at the 5’ end. The tecrRNA can comprise a nucleotide sequence complementary to a 5’ region of the linear RNA, including a CT dinucleotide at the 3’ end. It is contemplated that the linear vector can include a synthetic nucleotide sequence (e.g., a unique sequence) downstream to the Cap complementary to a synthetic sequence in the tecrRNA. In certain embodiments, the anti-cap tecrRNA inhibits recruitment of eukaryotic translation factors such as eIF4E to the linear RNA vector.

[0070] Where the linear RNA vector includes a 5’ UTR operably linked to the protein of interest, it is also contemplated that the 5’ region of the linear RNA vector complementary to the tecrRNA can include a 5’ portion of the 5’ UTR. Without wishing to be bound by theory, this design may confer additional suppression of translation by also inhibiting the 5’ UTR region, for example, by inhibiting recruitment of certain essential eukaryotic translation factors such as eIF4G and eIF4A to the linear RNA vector.

[0071] The complementary sequence in the tecrRNA can be 5 to 100 (e.g., 15 to 100, 15 to 90, 15 to 80, 15 to 70, 15 to 60, 15 to 50, 15 to 40, 15 to 30, 15 to 25, 15 to 20, 20 to 100, 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 100, 25 to 90, 25 to 80, 25 to 70, 25 to 60, 25 to 50, 25 to 40, 25 to 30, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 100, 40 to 90, 40 to 80, 40 to 70, 40 to 60, or 40 toAttorney Docket No.: JMPG-001WO 50) nucleotides in length. In certain embodiments, the entire length of the tecrRNA is complementary to a 5’ region of a linear RNA vector. Anti-IRES tecrRNAs

[0072] Exemplary tecrRNAs capable of binding and suppressing an IRES include but are not limited to a nucleotide sequence complementary to a portion of the IRES. IRES is an alternative translation initiation element that can recruit translation eukaryotic initiation factors, such as eIF4G. In silico methods exist to identify IRES elements such as IRESFinder, PatSearch and IRESpy. The identified sequences are then tested for functionality and their role in the IRES element, through RNA-protein interaction studies (see, e.g., Francisco-Velilla et al., METHODS (2015) 91:3-12). Exemplary IRES elements are described in Martinez-Salas et al., FRONT. MICROBIOL. (2018) 8:2629 and the Human IRES Atlas database (see Yang et al., DATABASE (OXFORD) (2021) baab025). Exemplary IRES elements are described in Martinez-Salas et al., FRONT. MICROBIOL. (2018) 8:2629. Briefly, IRES elements are classified as types I, II, III, and IV, based on common RNA structure cores.

[0073] Type I IRES elements include but are not limited to CVB3 IRES, poliovirus 1 (PV1), poliovirus 2 (PV2), poliovirus 3 (PV3), enterovirus 71 (EV71), enterovirus B107 (EV- B107), enterovirus D94 (EV-D94), human rhinovirus A1 (HRV-A1) human rhinovirus A2 (HRV-A2), human rhinovirus A100 (HRV-A100), human rhinovirus B3 (HRV-B3), human rhinovirus B4 (HRV-B4), human rhinovirus B37 (HRV-B37), human rhinovirus C3 (HRV- C3), and human rhinovirus C11 (HRV-C11). Exemplary sequences of these IRES elements are provided in Table 1. A type I IRES generally includes Domain I, Domain II, Domain III, Domain IV, Domain V, Domain VI, and Domain VII (FIG.1D). These structural components of a given type I IRES can be identified based on its secondary structure. A tecrRNA can be complementary to a 3’ portion of Domain V or a region linking Domain V and Domain VI (FIG.1D). Interrogation of IRES element or sequence functionality has also been performed using oligonucleotide-mediated targeting. For example, a locked nucleic acid (LNA) oligonucleotide can be designed to target specific regions in the IRES element to determine its effect on translation, and an LNA targeting the domain V region can suppress the IRES activity by abrogating eIF4G binding (see Chen et al., NAT. BIOTECHNOL. (2023) 41(2):262-72). The regions of 3’ portion of Domain V in CVB3 IRES element is from nucleotide #510-560 of SEQ ID NO: 1. The region linking Domain V and Domain VI can be a synthetic sequence that replaces the wild-type sequence in CVB3 IRES. By integratingAttorney Docket No.: JMPG-001WO different synthetic sequences, CVB3 IRES can be modified for selective targeting by different tecrRNAs, thereby to allow generation of logic gates. The regions linking Domain V and Domain VI in CVB3 IRES element is from nucleotide 561-586 of SEQ ID NO: 1.

[0074] In certain embodiments, the IRES comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 1, and the tecrRNA comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 71. In certain embodiments, the IRES comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 1, and the tecrRNA comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 35.

[0075] The sequence complementary to a region of IRES in the tecrRNA can be 5 to 100 (e.g., 10 to 50, 10 to 40, 10 to 30, 10 to 25, 10 to 20, 10 to 15, 15 to 50, 15 to 40, 15 to 30, 15 to 25, 15 to 20, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 50, 25 to 40, 25 to 30, 30 to 50, 30 to 40, or 40 to 50) nucleotides in length. In certain embodiments, the tecrRNA is flanked by a first target RNA binding sequence and a second target RNA binding sequence both having similar or greater length than the tecrRNA. For example, where the tecrRNA is about 15 nucleotides in length, the first and second target RNA binding sequences can each be 20 to 60 (e.g., 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 60, 25 to 50, 25 to 40, 25 to 30, 30 to 60, 30 to 50, 30 to 40, 40 to 60, 40 to 50, or 50 to 60) nucleotides in length. Where the tecrRNA is about 25 nucleotides in length, the first and second target RNA binding sequences can each be 25 to 60 (e.g., 25 to 50, 25 to 40, 25 to 30, 30 to 60, 30 to 50, 30 to 40, 40 to 60, 40 to 50, or 50 to 60) nucleotides in length. Table 1. Exemplary Type I IRES Elements Species Nucleotide Sequence SEQ ID NOAttorney Docket No.: JMPG-001WO Species Nucleotide Sequence SEQ ID NOAttorney Docket No.: JMPG-001WO Species Nucleotide Sequence SEQ ID NOAttorney Docket No.: JMPG-001WO Species Nucleotide Sequence SEQ ID NOAttorney Docket No.: JMPG-001WO Species Nucleotide Sequence SEQ ID NOAttorney Docket No.: JMPG-001WO Species Nucleotide Sequence SEQ ID NOAttorney Docket No.: JMPG-001WO Species Nucleotide Sequence SEQ ID NO

[0076] In addition to type I IRES elements, which utilize greatest number of initiation factors and RNA-binding proteins for ribosome recruitment, types II, III, and IV require lower number of factors for ribosome recruitment, with type IV requiring the least factors and having the most compact structure. All IRES types may be used for tecrRNA design. The tecrRNA mediated silencing of IRES would differ between classes. Classes I-III require eiF4G for ribosome requirement, where the eiF4G binding region may be silenced with the tecrRNA for IRES inactivation, whereas Class IV is eiF4G-independent, but does require eiF3, which could be used as the IRES inactivation site. The inactivation sites may occur at other sites within the IRES and can be determined experimentally.Attorney Docket No.: JMPG-001WO

[0077] In certain embodiments, the entire length of the tecrRNA is complementary to the IRES. Torsionally Modulated Switches

[0078] A torsionally modulated switch of the present disclosure is an on-switch based on a translation inhibitory sequence, such as a tecrRNA, that can be inhibited by torsional constraint in the presence of a target RNA. In this aspect, the present disclosure provides a tecrRNA switch responsive to a target RNA, the tecrRNA switch comprising, from 5’ to 3’: (a) a first target RNA binding sequence complementary to a first target RNA sequence of the target RNA; (b) a translation inhibitory sequence, e.g., a tecrRNA capable of binding and suppressing a translation initiation element; and (c) a second target RNA binding sequence complementary to a second target RNA sequence of the target RNA, wherein: in the absence of the target RNA, the tecrRNA binds the translation initiation element and suppresses its activity, and in the presence of the target RNA, the tecrRNA becomes torsionally constrained and unable to bind the translation initiation element.

[0079] To bring the first target RNA binding sequence to the proximity of the second target RNA binding sequence in order to generate a torsional constraint, the first target RNA sequence is near the second target RNA sequence in the target RNA. In certain embodiments, the first target RNA sequence is within 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) from the second target RNA sequence in the target RNA. In certain embodiments, the first target RNA binding sequence is adjacent to the second target RNA sequence, i.e., these two sequences are linked by an internucleotide bond in the target RNA. In certain embodiments, the first target RNA sequence is positioned 3’ to the second target RNA sequence in the target RNA (FIG.1B). In other embodiments, the first target RNA sequence is positioned 5’ to the second target RNA sequence in the target RNA, such that the tecrRNA switch can bind the target RNA in an intercrossing pattern (FIG.1A). In certain embodiments, the tecrRNA is within 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) from the first target RNA binding sequence. In certain embodiments, the tecrRNA is adjacent to the first target RNA binding sequence, i.e., these two sequences are linked by an internucleotide bond in the torsionally modulated tecrRNA switch. In certainAttorney Docket No.: JMPG-001WO embodiments, the tecrRNA is within 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) from the second target RNA binding sequence. In certain embodiments, the tecrRNA is adjacent to the second target RNA binding sequence, i.e., these two sequences are linked by an internucleotide bond in the torsionally modulated tecrRNA switch.

[0080] The torsional constraint in the presence of the target RNA requires hybridization of the first target RNA binding sequence to the first target RNA sequence and hybridization of the second target RNA binding sequence to the second target RNA sequence. In certain embodiments, the first target RNA binding sequence is 20 to 100 (e.g., 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 100, 25 to 90, 25 to 80, 25 to 70, 25 to 60, 25 to 50, 25 to 40, 25 to 30, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 100, 40 to 90, 40 to 80, 40 to 70, 40 to 60, 40 to 50, 50 to 100, 50 to 90, 50 to 80, 50 to 70, 50 to 60, 60 to 100, 60 to 90, 60 to 80, 60 to 70, 70 to 100, 70 to 90, 70 to 80, 80 to 100, 80 to 90, or 90 to 100) nucleotides in length. In certain embodiments, the second target RNA binding sequence is 20 to 100 (e.g., 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 100, 25 to 90, 25 to 80, 25 to 70, 25 to 60, 25 to 50, 25 to 40, 25 to 30, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 100, 40 to 90, 40 to 80, 40 to 70, 40 to 60, 40 to 50, 50 to 100, 50 to 90, 50 to 80, 50 to 70, 50 to 60, 60 to 100, 60 to 90, 60 to 80, 60 to 70, 70 to 100, 70 to 90, 70 to 80, 80 to 100, 80 to 90, or 90 to 100) nucleotides in length. In certain embodiments, the first target RNA binding sequence and the second target RNA binding sequence are each 20 to 100 (e.g., 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 100, 25 to 90, 25 to 80, 25 to 70, 25 to 60, 25 to 50, 25 to 40, 25 to 30, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 100, 40 to 90, 40 to 80, 40 to 70, 40 to 60, 40 to 50, 50 to 100, 50 to 90, 50 to 80, 50 to 70, 50 to 60, 60 to 100, 60 to 90, 60 to 80, 60 to 70, 70 to 100, 70 to 90, 70 to 80, 80 to 100, 80 to 90, or 90 to 100) nucleotides in length.

[0081] The torsionally modulated switch is useful for conditionally suppressing a translation initiation or elongation element, e.g., a 5’ N7-methylated guanosine cap (an anti- Cap design) or an IRES (an anti-IRES design), in the presence of the target RNA.

[0082] The anti-Cap design is useful in linear RNA vectors. In certain embodiments, the present disclosure provides a linear RNA vector for expressing a protein of interest, the RNA vector comprising a 5’ N7-methylated guanosine cap, a torsionally modulated tecrRNA switch as disclosed herein, and a gene encoding the protein of interest, wherein the tecrRNA comprises a nucleotide sequence complementary to a 5’ region of the linear RNA vector,Attorney Docket No.: JMPG-001WO wherein: in the absence of the target RNA, the tecrRNA suppresses translation of the protein of interest from the 5’ N7-methylated guanosine cap, and in the presence of the target RNA, the protein of interest is translated from the 5’ N7-methylated guanosine cap.

[0083] The 5’ N7-methylated guanosine cap can be modified for stability. For example, anm7G capped adenine-guanine (AG) dinucleotide can be used as a primer to synthesize a linear RNA by in vitro transcription, thereby allowing co-transcriptional capping during in vitro transcription process (see, e.g., Vaidyanathan et al., MOL. THER. NUCLEIC ACIDS (2018) 12: 530–42). The transcription product includes them7G capped AG sequence at the 5’ end. In certain embodiments, the AG sequence is not chemically modified. In other embodiments, the AG sequence is chemically modified, such as including a 3' OMe or M6 modification on them7G cap. Other Cap analogues may include m7GpppG, anti-reverse cap analog (ARCA), borano two-headed (BTH), Locked Nucleic Acid (LNA)-modified dinucleotide, or others.

[0084] The linear RNA vector can further comprise a 5’ untranslated region (5’ UTR) positioned 5’ to the gene, a 3’ untranslated region (3’ UTR) positioned 3’ to the gene, and a polyadenylation tail. The torsionally modulated tecrRNA switch can be positioned 5’ to the 5’ UTR, within the 5’ UTR, between the 5’ UTR and the gene encoding the protein of interest, between the gene encoding the protein of interest and the 3’ UTR, within the 3’ UTR, or 3’ to the 3’ UTR (e.g., between the 3’ UTR and the polyadenylation tail).

[0085] In certain embodiments, a linear RNA vector comprises a torsionally modulated tecrRNA switch positioned 3’ to the 3’ UTR. In certain embodiments, the linear RNA vector comprises a 5’ portion (e.g., a 5’ portion of a 5’ UTR) and an anti-Cap tecrRNA complementary to the 5’ portion within the torsionally modulated tecrRNA switch. In certain embodiments, the tecrRNA comprises one or more additional nucleotides 3’ to the complementary sequence, for example, a cytidine complementary to them7G in the Cap. The 5’ portion of the 5’ UTR can be 20 to 80 (e.g., 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 80, 25 to 70, 25 to 60, 25 to 50, 25 to 40, 25 to 30, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 80, 40 to 70, 40 to 60, 40 to 50, 50 to 80, 50 to 70, 50 to 60, 60 to 80, 60 to 70, or 70 to 80) nucleotides in length. In certain embodiments, the 5’ portion of the 5’ UTR is 40 to 60 nucleotides (e.g., about 50 nucleotides) in length. In certain embodiments, the 5’ portion of the 5’ UTR comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 69, andAttorney Docket No.: JMPG-001WO the tecrRNA comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 70. In certain embodiments, the tecrRNA is flanked by a first target RNA binding sequence and a second target RNA binding sequence both longer than the tecrRNA. For example, where the tecrRNA is about 50 nucleotides in length, the first and second target RNA binding sequences can each be 60 to 100 (e.g., 60 to 90, 60 to 80, 60 to 70, 70 to 100, 70 to 90, 70 to 80, 80 to 100, 80 to 90, or 90 to 100) nucleotides in length.

[0086] The anti-IRES design is useful in linear and circular RNA vectors. In certain embodiments, the present disclosure provides an RNA vector for expressing a protein of interest, the RNA vector comprising a torsionally modulated tecrRNA switch as disclosed herein, an IRES that the tecrRNA is capable of binding and suppressing, and a gene encoding the protein of interest operably linked to the IRES, wherein the tecrRNA comprises a nucleotide sequence complementary to a nucleotide sequence in the IRES, wherein: in the absence of the target RNA, the tecrRNA suppresses translation of the protein of interest from the IRES, and in the presence of the target RNA, the protein of interest is translated from the IRES.

[0087] In certain embodiments, the RNA vector adopting the anti-IRES design of the torsionally modulated tecrRNA is a circular RNA vector (FIG.1C). In certain embodiments, the torsionally modulated tecrRNA switch is positioned 3’ to the gene and 5’ to the IRES. In certain embodiments, the torsionally modulated tecrRNA switch is positioned 5’ to the gene and 3’ to the IRES.

[0088] In certain embodiments, the linear or circular RNA vector further comprises a Kozak sequence 5’ to the nucleotide sequence encoding the protein of interest. Kozak sequences are known to promote translation (see Nakagawa et al., NUCLEIC ACIDS RES. (2008) 36(3): 861–71). In certain embodiments, a vector disclosed herein comprises a Kozak sequence for promoting translation in human cells, e.g., having the nucleotide sequence of GCC(A / G)(C / A)C (SEQ ID NO: 42) or GCCGCC(A / G)(C / A)C (SEQ ID NO: 43) 5’ to the AUG start codon. In certain embodiments, the Kozak sequence comprises the nucleotide sequence of GCCACC (SEQ ID NO: 44) or GCCGCCACC (SEQ ID NO: 45).Attorney Docket No.: JMPG-001WO

[0089] A torsionally modulated design can also be used to suppress RNA elements other than translation inhibitory sequence, where the RNA elements can be inhibited by torsional constraint. Such designs similarly include a torsionally suppressable RNA element flanked by a first target RNA binding sequence complementary to a first target RNA sequence of a target RNA, and a second target RNA binding sequence complementary to a second target RNA sequence of the target RNA approximate to (e.g., adjacent to) the first target RNA sequence. The two target RNA binding sequences bind approximate target sequences in the presence of the target RNA, resulting in torsional constraint in the RNA element in between.

[0090] It is contemplated that this RNA element can be a splicing intron cis-repressive RNA (sicrRNA) complementary to a 5’ or 3’ fragment of a self-splicing intron, the latter described in the “Circularization Switches” subsection below. For example, a sicrRNA can be used to inhibit the self-splicing function of a corresponding self-splicing intron fragment, where the sicrRNA is flanked by a first target RNA binding sequence and a second target RNA binding sequence (FIG.2B). This design can be used to inhibit background level of self-splicing, in the event it occurs in the circularization switches described herein. In the presence of a target RNA that includes nucleotide sequences complementary to the first and second target RNA binding sequence approximate to (e.g., adjacent to) each other, the sicrRNA is removed from the self-splicing intron fragment as a result of torsional constrain, thereby activating the self-splicing intron and allowing self-splicing to occur. The genetic elements of the sicrRNA and the two target RNA binding sites, combined as a functional unit, are referred to as “sicrRNA switch” herein.

[0091] The sicrRNA switch described above can be applied in plurality in a vector. For example, a first sicrRNA and a second sicrRNA, each flanked by a pair of target RNA binding sequences, can be used to inhibit a 5’ fragment and a 3’ fragment of a self-splicing intron, respectively. In the presence of target RNAs corresponding to the two pairs of target RNA binding sequences, both siRNAs are removed from the self-splicing intron fragments as a result of torsional constrain, thereby activating the self-splicing intron and allowing self- splicing to occur. In addition, one target RNA binding sequence of the first pair and one target RNA binding sequence of the second pair can be designed to (1) each positioned adjacent to a different self-splicing intron fragment and (2) hybridize with adjacent sequences in the target RNA, thereby bringing the two self-splicing fragments in proximity to enhance self-splicing. An example is described in the “Circularization Switches” subsection below.Attorney Docket No.: JMPG-001WO Circularization Switches

[0092] A circularization switch of the present disclosure is an on-switch based on operable linkage of an IRES to a protein coding sequence as a result of RNA circularization. In this aspect, the present disclosure provides a linear RNA vector capable of circularization responsive to a target RNA, which when circularized can express a protein of interest, the linear RNA vector comprising, from 5’ to 3’: (a) a first target RNA binding sequence complementary to a first target RNA sequence of the target RNA; (b) a 3’ fragment of a self-splicing intron; (c) a gene encoding the protein of interest having a 5’ end; (d) a unidirectional IRES having a 3’ end; (e) a 5’ fragment of the self-splicing intron; and (f) a second target RNA binding sequence complementary to a second target RNA sequence of the target RNA, wherein: in the presence of the target RNA, elements (b) and (e) form an active ribozyme that splices the 5’ end of the gene to the 3’ end of the unidirectional IRES, thereby to form a circular RNA, permitting translation of the protein of interest from the IRES; and in the absence of the target RNA, the protein of interest is not translated from the IRES.

[0093] Circularization of the linear RNA can occur when a 5’ fragment of a self- splicing intron at the 3’ end of a linear RNA is brought into proximity to a 3’ fragment of the self-splicing intron at the 5’ end of the linear RNA. Such strategy is known as “permuted intron exon” or “PIE” as reviewed by Obi and Chen, METHODS (2021) 196: 85–103. Various self-splicing introns and fragments thereof are useful to facilitate circularization in the present disclosure, such as Group I and Group II self-splicing introns.

[0094] Self-splicing introns are introns capable of removing itself from an RNA sequence it is inserted into in the absence of factors in trans. Radioassay experiments have been used for identifying RNA splicing activity (see Reinhold-Hurek et al., METHODS IN ENZYMOLOGY (1993) 224:491-502; Vicens et al., RNA (2008) 14(10):2013-29). Correlations are then made between the sequence, predicted structure, and splicing activity. Various self-splicing introns and fragments thereof are useful in a self-splicing riboswitch, such as Group I and Group II self-splicing introns.Attorney Docket No.: JMPG-001WO

[0095] In certain embodiments, the self-splicing intron is a Group I self-splicing intron. Exemplary Group I self-splicing introns can be from genes including but not limited to Cyanobaterium Anabaena sp. pre-tRNA-Leu gene, T4 phage Td gene, Tetrahymena thermophila pre-rRNA gene, with corresponding sequences provided in Table 2. In certain embodiments, the Group I self-splicing intron is derived from Cyanobaterium Anabaena sp. pre-tRNA-Leu gene, for example, comprising a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 16. In certain embodiments, the Group I self- splicing intron is derived from T4 phage Td gene, for example, comprising a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 17. In certain embodiments, the Group I self-splicing intron is derived from Tetrahymena thermophila pre- rRNA gene, for example, comprising a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 18. In certain embodiments, the Group I self-splicing intron is a chimeric intron derived from Cyanobaterium Anabaena sp. pre-tRNA-Leu gene and T4 phage Td gene, for example, comprising a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 78. In certain embodiments, the Group I self- splicing intron facilitates self-splicing in a eukaryotic cell (e.g., a mammalian cell, a human cell). Table 2. Exemplary Group I Self-splicing Introns Species and Nucleotide Sequence SEQ ID G NOAttorney Docket No.: JMPG-001WO Species and Nucleotide Sequence SEQ ID Gene NO

[0096] Group I self-splicing introns generally comprise, from 5’ to 3’, a 5’ splice site adjacent to a P1 sequence 5’ to the Group I self-splicing intron, an internal guide sequence (IGS), a P2 helix, a P3 helix, a P4 helix, a P5 helix, a P6 helix, a P7 helix, a P8 helix, a P9 helix, and a 3’ splice site adjacent to a P10 sequence 3’ to the Group I self-splicing intron (see, e.g., Hausner et al., MOBILE DNA (2014) 5:8).Attorney Docket No.: JMPG-001WO

[0097] The Group I self-splicing intron can be split into two fragments that flank the tecrRNA, while retaining its enzymatic activity when the two fragments are brought into proximity. For example, in certain embodiments, the Group I self-splicing intron is split in the loop of the P6 helix, resulting in a 5’ fragment comprising the 5’ splice site, the IGS, the P2 helix, the P3 helix, the P4 helix, the P5 helix, and a 5’ portion of the P6 helix; and a 3’ fragment comprising a 3’ portion of the P6 helix, the P7 helix, the P8 helix, the P9 helix, and the 3’ splice site. In certain embodiments, the Group I self-splicing intron is split in the loop between the 5’ splice site and the IGS, resulting in a 5’ fragment comprising the 5’ splice site; and a 3’ fragment comprising the IGS, the P2 helix, the P3 helix, the P4 helix, the P5 helix, the P6 helix, the P7 helix, the P8 helix, the P9 helix, and the 3’ splice site. Other contemplated split sites include but are not limited to the loop of the P2 helix, the loop of the P8 helix, the loop of the P9 helix, the region connecting the IGS to the P2 helix, and the region connecting the P6 helix to P7 helix.

[0098] In certain embodiments, a Group I self-splicing intron from Cyanobaterium Anabaena sp. pre-tRNA-Leu gene is split between nucleotides 151 and 275 of SEQ ID NO: 16, wherein one or more nucleotides from positions 152 to 274 can be absent from the intron fragments. In certain embodiments, the 5’ fragment comprises or consists of nucleotides 20- 151 of SEQ ID NO: 16, and the 3’ fragment comprises or consists of nucleotides 275-393 of SEQ ID NO: 16. In certain embodiments, a Group I self-splicing intron derived from the Cyanobaterium Anabaena sp. pre-tRNA-Leu intron (e.g., comprising a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 16) is split between corresponding positions, which can be identified based on sequence alignment of the intron and SEQ ID NO: 16, resulting in 5’ and 3’ fragments that can be incorporated into a circularization switch.

[0099] In certain embodiments, a Group I self-splicing intron from T4 Phage Td is split between nucleotides 157 and 256 of SEQ ID NO: 17. In certain embodiments, the 5’ fragment comprises or consists of nucleotides 1-256 of SEQ ID No: 17, and the 3’ fragment comprises or consists of nucleotides 157-463 of SEQ ID NO: 17. In certain embodiments, a Group I self-splicing intron derived from the T4 Phage Td intron (e.g., comprising a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 17) is split between correspondingAttorney Docket No.: JMPG-001WO positions, which can be identified based on sequence alignment of the intron and SEQ ID NO: 17, resulting in 5’ and 3’ fragments that can be incorporated into a circularization switch.

[0100] In certain embodiments, a chimeric intron derived from Cyanobaterium Anabaena sp. pre-tRNA-Leu gene and T4 phage Td gene is split between nucleotides 182 and 183 of SEQ ID NO: 78. In certain embodiments, the 5’ fragment comprises or consists of SEQ ID NO: 67 (i.e., nucleotides 1-182 of SEQ ID NO: 78), and the 3’ fragment comprises or consists of SEQ ID NO: 68 (i.e., nucleotides 183-313 of SEQ ID NO: 78). In certain embodiments, a Group I self-splicing intron derived from this chimeric intron (e.g., comprising a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 78) is split between corresponding positions, which can be identified based on sequence alignment of the intron and SEQ ID NO: 78, resulting in 5’ and 3’ fragments that can be incorporated into a circularization switch.

[0101] In certain embodiments, the self-splicing intron is a Group II self-splicing intron. Exemplary Group II self-splicing introns can be from genes including but not limited to Clostridium tetani, Oceanobacillus iheyensis, Pylaiella littoralis, Bacillus halodurans, and Thermoanerobacter italicus (see McNeil et al., NUCLEIC ACIDS RES. (2014) 42(3):1959-69; Toor et al., SCIENCE (2008) 320(5872): 77–82; Chan et al., NATURE COMMUNICATIONS (2018) 9:4676; Abebe et al., MOB. DNA (2013) 4(1):28; and Smathers et al., RNA (2020) 26(5): 664–73), with corresponding sequences provided in Table 3. In certain embodiments, the Group II self-splicing intron facilitates self-splicing in a eukaryotic cell (e.g., a mammalian cell, a human cell). Table 3. Exemplary Group II Self-splicing Introns Species and Nucleotide Sequence SEQ ID G n NOAttorney Docket No.: JMPG-001WO Species and Nucleotide Sequence SEQ ID Gene NO

[0102] Group II self-splicing introns generally comprise, from 5’ to 3’, a 5’ splice site, a Domain 1, a Domain 2, a Domain 3, a Domain 4, a Domain 5, a Domain 6, and a 3’ splice site (see, e.g., Costa, FRONT. MOL. BIOSCI. (2022) 9:916157). These structural componentsAttorney Docket No.: JMPG-001WO can be identified from a given Group I self-splicing intron based on its secondary structure. In silico methods of identifying group II introns begins often with BLAST search of GenBank using a set of representative group II intron-encoded proteins (IEPs) as queries, followed by classifications, and testing of splicing activity (see Abebe et al., MOB. DNA (2013) 4(1):28).

[0103] The Group II self-splicing intron can be split into two fragments that flank the tecrRNA, while retaining its enzymatic activity when the two fragments are brought into proximity. For example, in certain embodiments, the Group II self-splicing intron is split in the loop of Domain 4, resulting in a 5’ fragment comprising the 5’ splice site, the Domain 1, the Domain 2, and the Domain 3, and a 5’ portion of the Domain 4; and a 3’ fragment comprising a 3’ portion of the Domain 4, the Domain 5, the Domain 6, and the 3’ splice site.

[0104] The two fragments of the self-splicing intron can be brought into proximity when their nearby first and second target RNA binding sequences are brought into proximity via hybridization with the target RNA. In certain embodiments, the first target RNA sequence is within 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) from the second target RNA sequence in the target RNA. In certain embodiments, the first target RNA binding sequence is adjacent to the second target RNA sequence, i.e., these two sequences are linked by an internucleotide bond in the target RNA. To bring the 3’ end of the first target RNA binding sequence to the proximity of the 5’ end of the second target RNA binding sequence, the first target RNA sequence can be positioned 3’ to the second target RNA sequence in the target RNA.

[0105] In certain embodiments, the first target RNA binding sequence is 20 to 100 (e.g., 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 100, 25 to 90, 25 to 80, 25 to 70, 25 to 60, 25 to 50, 25 to 40, 25 to 30, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 100, 40 to 90, 40 to 80, 40 to 70, 40 to 60, 40 to 50, 50 to 100, 50 to 90, 50 to 80, 50 to 70, 50 to 60, 60 to 100, 60 to 90, 60 to 80, 60 to 70, 70 to 100, 70 to 90, 70 to 80, 80 to 100, 80 to 90, or 90 to 100) nucleotides in length. In certain embodiments, the second target RNA binding sequence is 20 to 100 (e.g., 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 100, 25 to 90, 25 to 80, 25 to 70, 25 to 60, 25 to 50, 25 to 40, 25 to 30, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 100, 40 to 90, 40 to 80, 40 to 70, 40 to 60, 40 to 50, 50 to 100, 50 to 90, 50 to 80, 50 to 70, 50 to 60, 60 to 100, 60 to 90, 60 to 80, 60 to 70, 70 to 100, 70 to 90, 70 to 80, 80 to 100, 80 to 90, or 90 to 100) nucleotides in length. In certain embodiments, the firstAttorney Docket No.: JMPG-001WO target RNA binding sequence and the second target RNA binding sequence are each 20 to 100 (e.g., 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 100, 25 to 90, 25 to 80, 25 to 70, 25 to 60, 25 to 50, 25 to 40, 25 to 30, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 100, 40 to 90, 40 to 80, 40 to 70, 40 to 60, 40 to 50, 50 to 100, 50 to 90, 50 to 80, 50 to 70, 50 to 60, 60 to 100, 60 to 90, 60 to 80, 60 to 70, 70 to 100, 70 to 90, 70 to 80, 80 to 100, 80 to 90, or 90 to 100) nucleotides in length.

[0106] The circularization switch turns on protein translation by using a unidirectional IRES. Such IRES can only drive expression of a protein when a gene encoding the protein is positioned 3’ to the IRES. Majority of IRES elements undergo unidirectional ribosome scanning, with some exceptions such as Halastavi arva virus IRES (see Abaeva et al., NUCLEIC ACIDS RESEARCH (2016) 44(5):2362–77). In certain embodiments, the unidirectional IRES is a CVB3 IRES. Upon circularization, the gene that located 5’ to the IRES in the linear RNA vector also becomes 3’ to the IRES.

[0107] In addition, sicrRNA switches can be included to suppress the 5’ and 3’ self- splicing intron fragments of a circularization switch. In certain embodiments, the present disclosure provides a linear RNA vector capable of circularization responsive to a target RNA, which when circularized can express a protein of interest, the linear RNA vector comprising, from 5’ to 3’: (a) a first sicrRNA switch comprising: (i) a first target RNA binding sequence complementary to a first target RNA sequence of the target RNA; (ii) a first sicrRNA capable of binding and suppressing element (b) below; and (iii) a second target RNA binding sequence complementary to a second target RNA sequence of the target RNA; (b) a 3’ fragment of a self-splicing intron; (c) a gene encoding the protein of interest having a 5’ end; (d) a unidirectional IRES having a 3’ end; (e) a 5’ fragment of the self-splicing intron; and (f) a second sicrRNA switch comprising: (i) a third target RNA binding sequence complementary to a third target RNA sequence of the target RNA; (ii) a second sicrRNA capable of binding and suppressing element (e) above; and (iii) a fourth target RNA binding sequence complementary to a fourth targetAttorney Docket No.: JMPG-001WO RNA sequence of the target RNA, wherein: in the absence of the target RNA, the first sicrRNA and the second sicrRNA bind element (b) and element (e), respectively, thereby suppressing the activity of the self- splicing intron and inhibiting circularization of the linear RNA, and in the presence of the target RNA, elements (a)(ii) and (f)(ii) become torsionally constrained and unable to bind elements (b) and (e), respectively, allowing (b) and (e) to form an active ribozyme that splices the 5’ end of the gene to the 3’ end of the unidirectional IRES, thereby to form a circular RNA.

[0108] In this design, circularization only occurs in the presence of the target RNA. Given that the unidirectional IRES is positioned 3’ to the gene encoding the protein of interest in the linear RNA, the protein of interest is translated from the IRES only after circularization, where the IRES is also 5’ to the gene as a result of splicing (FIGs.2A and 2C).

[0109] To bring the first target RNA binding sequence to the proximity of the second target RNA binding sequence in order to generate a torsional constraint, the first target RNA sequence is near the second target RNA sequence in the target RNA. In certain embodiments, the first target RNA sequence is within 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) from the second target RNA sequence in the target RNA. In certain embodiments, the first target RNA binding sequence is adjacent to the second target RNA sequence, i.e., these two sequences are linked by an internucleotide bond in the target RNA. In certain embodiments, the first target RNA sequence is positioned 3’ to the second target RNA sequence in the target RNA. In certain embodiments, the first sicrRNA is within 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) from the first target RNA binding sequence. In certain embodiments, the first sicrRNA is adjacent to the first target RNA binding sequence, i.e., these two sequences are linked by an internucleotide bond in the first sicrRNA switch. In certain embodiments, the first sicrRNA is within 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) from the second target RNA binding sequence. In certain embodiments, the first sicrRNA is adjacent to the second target RNA binding sequence, i.e., these two sequences are linked by an internucleotide bond in the first sicrRNA switch.

[0110] Similarly, to bring the third target RNA binding sequence to the proximity of the fourth target RNA binding sequence in order to generate a torsional constraint, the thirdAttorney Docket No.: JMPG-001WO target RNA sequence is near the fourth target RNA sequence in the target RNA. In certain embodiments, the third target RNA sequence is within 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) from the fourth target RNA sequence in the target RNA. In certain embodiments, the third target RNA binding sequence is adjacent to the fourth target RNA sequence, i.e., these two sequences are linked by an internucleotide bond in the target RNA. In certain embodiments, the third target RNA sequence is positioned 3’ to the fourth target RNA sequence in the target RNA. In certain embodiments, the second sicrRNA is within 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) from the third target RNA binding sequence. In certain embodiments, the second sicrRNA is adjacent to the third target RNA binding sequence, i.e., these two sequences are linked by an internucleotide bond in the second sicrRNA switch. In certain embodiments, the second sicrRNA is within 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) from the fourth target RNA binding sequence. In certain embodiments, the second sicrRNA is adjacent to the fourth target RNA binding sequence, i.e., these two sequences are linked by an internucleotide bond in the second sicrRNA switch.

[0111] The two fragments of the self-splicing intron can be brought into proximity when their nearby second and third target RNA binding sequences are brought into proximity via hybridization with the target RNA. In certain embodiments, the second target RNA sequence is within 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) from the third target RNA sequence in the target RNA. In certain embodiments, the second target RNA binding sequence is adjacent to the third target RNA sequence, i.e., these two sequences are linked by an internucleotide bond in the target RNA. To bring the 3’ end of the first target RNA binding sequence to the proximity of the 5’ end of the second target RNA binding sequence, the second target RNA sequence can be positioned 3’ to the third target RNA sequence in the target RNA.

[0112] In certain embodiments, to generate torsional constraint in both sicrRNAs and to facilitate self-splicing, the target RNA comprises, from 5’ to 3’, the fourth target RNA sequence, the third target RNA sequence, the second target RNA sequence, and the first target RNA sequence. In certain embodiments, the four target RNA sequences are adjacently linked, i.e., linked by an internucleotide bond between the first and second target RNA sequences, an internucleotide bond between the second and third target RNA sequences, and an internucleotide bond between the third and fourth target RNA sequences.Attorney Docket No.: JMPG-001WO

[0113] In certain embodiments, the first, second, third, and fourth target RNA binding sequences are each 20 to 100 (e.g., 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 100, 25 to 90, 25 to 80, 25 to 70, 25 to 60, 25 to 50, 25 to 40, 25 to 30, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 100, 40 to 90, 40 to 80, 40 to 70, 40 to 60, 40 to 50, 50 to 100, 50 to 90, 50 to 80, 50 to 70, 50 to 60, 60 to 100, 60 to 90, 60 to 80, 60 to 70, 70 to 100, 70 to 90, 70 to 80, 80 to 100, 80 to 90, or 90 to 100) nucleotides in length.

[0114] Due to the high secondary structure of IRES element and splice sites, some have incorporated spacers between the splice site and IRES element which led to increase in circularization efficiency. Exemplary spacers between the 3′ PIE splice site and the IRES element, which can significantly increase the circularization efficiency, are described in Wesselhoeft et al., NATURE COMMUNICATIONS (2018) 9:2629.

[0115] The linear RNA vector can further comprise a polyadenylation tail. Such a polyadenylation tail may stabilize the vector in vitro and in vivo.

[0116] It is contemplated, however, that in certain embodiments the linear RNA vector does not comprise a 5’ N7-methylated guanosine cap. The absence of the cap reduces undesired cap-mediated protein expression from the linear RNA vector, prior to circularization. Cleavable Switches

[0117] A cleavable switch of the present disclosure is an off-switch based on RNA self- cleavage in the presence of a target RNA. In this aspect, the present disclosure provides a cleavable RNA switch responsive to a target RNA, the cleavable RNA switch comprising, from 5’ to 3’: (a) a first target RNA binding sequence complementary to a first target RNA sequence of the target RNA; (b) a hammerhead ribozyme left (HHR-L) arm; (c) a loop forming region comprising a hammerhead ribozyme cleavage site comprising the nucleotide sequence of GUC; (d) a hammerhead ribozyme right (HHR-R) arm; (e) a second target RNA binding sequence complementary to a second target RNA sequence of the target RNA, wherein:Attorney Docket No.: JMPG-001WO in the presence of the target RNA, the HHR-L arm and the HHR-R arm together form a hammerhead ribozyme and the loop forming region forms a loop that is cleaved by the hammerhead ribozyme, and in the absence of the target RNA, the HHR-L arm and the HHR-R arm do not form a hammerhead ribozyme and the loop forming region is not cleaved.

[0118] A hammerhead ribozyme (HHR) includes a left arm (HHR-L) and a right arm (HHR-R). The two arms form a cavity for capturing a magnesium ion (Mg2+), which is required for HHR activity. One or both of the arms comprise a catalytic core, which can catalyze cleavage of an RNA in the presence of the Mg2+. Such catalytic core can comprise, for example, the nucleotide sequence of CUGAUGAGAG (SEQ ID NO: 22, see FIG.3A, lower right panel) or GAGAGUAGUC (SEQ ID NO: 23, see FIG.3A, upper right panel). In certain embodiments, the catalytic core is incorporated in one arm of the HHR, and the other arm of the HHR lacks catalytic activity. This inactive arm can comprise, for example, the nucleotide sequence of AAGCUA (SEQ ID NO: 24, see FIG.3A, upper right panel) or AUCGAA (SEQ ID NO: 25, see FIG.3A, lower right panel). In certain embodiments, the HHR-R comprises a catalytic core (e.g., comprising the nucleotide sequence of SEQ ID NO: 22), and the HHR-L lacks catalytic activity by itself (e.g., comprising the nucleotide sequence of SEQ ID NO: 25) (see FIG.3A, lower right panel). In certain embodiments, the HHR-L comprises a catalytic core (e.g., comprising the nucleotide sequence of SEQ ID NO: 23), and the HHR-R lacks catalytic activity by itself (e.g., comprising the nucleotide sequence of SEQ ID NO: 24) (see FIG.3A, upper right panel).

[0119] To bring the HHR-L and the HHR-R together, the first target RNA sequence is near the second target RNA sequence in the target RNA. In certain embodiments, the first target RNA sequence is within 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) from the second target RNA sequence in the target RNA. In certain embodiments, the first target RNA binding sequence is adjacent to the second target RNA sequence, i.e., these two sequences are linked by an internucleotide bond in the target RNA. To bring the 3’ end of the first target RNA binding sequence to the proximity of the 5’ end of the second target RNA binding sequence, the first target RNA sequence can be positioned 3’ to the second target RNA sequence in the target RNA.

[0120] In certain embodiments, the first target RNA binding sequence is 20 to 100 (e.g., 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 100, 25 to 90, 25 to 80, 25 to 70, 25 to 60, 25 to 50, 25 to 40, 25 to 30, 30 to 100, 30 to 90, 30 to 80, 30Attorney Docket No.: JMPG-001WO to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 100, 40 to 90, 40 to 80, 40 to 70, 40 to 60, 40 to 50, 50 to 100, 50 to 90, 50 to 80, 50 to 70, 50 to 60, 60 to 100, 60 to 90, 60 to 80, 60 to 70, 70 to 100, 70 to 90, 70 to 80, 80 to 100, 80 to 90, or 90 to 100) nucleotides in length. In certain embodiments, the second target RNA binding sequence is 20 to 100 (e.g., 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 100, 25 to 90, 25 to 80, 25 to 70, 25 to 60, 25 to 50, 25 to 40, 25 to 30, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 100, 40 to 90, 40 to 80, 40 to 70, 40 to 60, 40 to 50, 50 to 100, 50 to 90, 50 to 80, 50 to 70, 50 to 60, 60 to 100, 60 to 90, 60 to 80, 60 to 70, 70 to 100, 70 to 90, 70 to 80, 80 to 100, 80 to 90, or 90 to 100) nucleotides in length. In certain embodiments, the first target RNA binding sequence and the second target RNA binding sequence are each 20 to 100 (e.g., 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 100, 25 to 90, 25 to 80, 25 to 70, 25 to 60, 25 to 50, 25 to 40, 25 to 30, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60, 30 to 50, 30 to 40, 40 to 100, 40 to 90, 40 to 80, 40 to 70, 40 to 60, 40 to 50, 50 to 100, 50 to 90, 50 to 80, 50 to 70, 50 to 60, 60 to 100, 60 to 90, 60 to 80, 60 to 70, 70 to 100, 70 to 90, 70 to 80, 80 to 100, 80 to 90, or 90 to 100) nucleotides in length.

[0121] The HHR, when formed, is capable of cleaving a loop between the HHR-L and HHR-R comprising a hammerhead ribozyme cleavage site comprising the nucleotide sequence of GUC. The loop is cleaved adjacently 3’ to the GUC site. In certain embodiments, the loop further comprises a left polynucleotide linker having 15 to 50 (e.g., 15 to 40, 15 to 30, 15 to 25, 15 to 20, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 50, 25 to 40, 25 to 30, 30 to 50, 30 to 40, or 40 to 50) nucleotides between the HHR-L and the GUC site. In certain embodiments, the loop further comprises a right polynucleotide linker having 15 to 50 (e.g., 15 to 40, 15 to 30, 15 to 25, 15 to 20, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 50, 25 to 40, 25 to 30, 30 to 50, 30 to 40, or 40 to 50) nucleotides between the GUC site and the HHR-R. In certain embodiments, the loop comprises both the left polynucleotide linker and the right polynucleotide linker. In certain embodiments, the left and right polynucleotide linkers are similar in size, for example, differing by no more than 10%, 20%, 30%, 40%, or 50% in length.

[0122] In certain embodiments, the HHR-L arm comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to GAGAGTAGTCA (SEQ ID NO: 74). In certain embodiments, the HHR-R arm comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to CAAAGCTA (SEQ ID NO: 75). In certain embodiments, the HHR-LAttorney Docket No.: JMPG-001WO arm comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 74, and the HHR-R arm comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 75.

[0123] In certain embodiments, the HHR-L arm comprises the nucleotide sequence of SEQ ID NO: 74. In certain embodiments, the HHR-R arm comprises the nucleotide sequence of SEQ ID NO: 75. In certain embodiments, the HHR-L arm comprises the nucleotide sequence of SEQ ID NO: 74, and the HHR-R arm comprises the nucleotide sequence of SEQ ID NO: 75.

[0124] In certain embodiments, the hammerhead ribozyme and loop with cleavage site comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to GAGAGTAGTCACTGAACTAACGCGTTAGTTCAGTCTGGGTATTTGGCGCCAAATA CCCAAAGCTA (SEQ ID NO: 26). In certain embodiments, the hammerhead ribozyme and loop with cleavage site comprises the nucleotide sequence of SEQ ID NO: 26.

[0125] In certain embodiments, the HHR-L arm comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to ATCGAAAC (SEQ ID NO: 76). In certain embodiments, the HHR-R arm comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to ACTGATGAGAG (SEQ ID NO: 77). In certain embodiments, the HHR-L arm comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 76, and the HHR-R arm comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 77.

[0126] In certain embodiments, the HHR-L arm comprises the nucleotide sequence of SEQ ID NO: 76. In certain embodiments, the HHR-R arm comprises the nucleotide sequence of SEQ ID NO: 77. In certain embodiments, the HHR-L arm comprises the nucleotide sequence of SEQ ID NO: 76, and the HHR-R arm comprises the nucleotide sequence of SEQ ID NO: 77.

[0127] In certain embodiments, the hammerhead ribozyme and loop with cleavage site comprises a nucleotide sequence at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical toAttorney Docket No.: JMPG-001WO ATCGAAACCCTACTGAACTAACGCGTTAGTTCAGTAGGGTCTGAGGTATTTGGCG CCAAATACCTCACTGATGAGAG (SEQ ID NO: 63). In certain embodiments, the hammerhead ribozyme and loop with cleavage site comprises the nucleotide sequence of SEQ ID NO: 63.

[0128] The cleavable switch is useful for conditionally cleaving a linear or circular RNA vector, rendering it susceptible to degradation (e.g., by exonucleases) in a cell. Accordingly, the present disclosure also provides an RNA vector for expressing a protein of interest, the RNA vector comprising a translation initiation element, a gene encoding the protein of interest, and a cleavable RNA switch as disclosed herein, wherein: in the presence of the target RNA, cleavage of the loop permits degradation of the RNA vector, and in the absence of the target RNA, the RNA vector is not degraded as a result of cleavage of the loop and is translated to produce the protein of interest.

[0129] The RNA vector can be a linear RNA vector that further comprises a 5’ N7- methylated guanosine cap, a 5’ UTR positioned 5’ to the gene, a 3’ UTR positioned 3’ to the gene, and a polyadenylation tail. In this linear RNA vector, the cleavable RNA switch can be positioned 5’ to the 5’ UTR, within the 5’ UTR, between the 5’ UTR and the gene encoding the protein of interest, between the gene encoding the protein of interest and the 3’ UTR, within the 3’ UTR, or 3’ to the 3’ UTR (e.g., between the 3’ UTR and the polyadenylation tail) (FIG.3A).

[0130] The RNA vector can also be a circular RNA vector that further comprises an IRES operably linked to the gene of interest (FIG.3B). In certain embodiments, the cleavable switch is positioned 3’ to the gene and 5’ to the IRES. In certain embodiments, the cleavable switch is positioned 5’ to the gene and 3’ to the IRES.

[0131] The cleavable switch can be used as an ON switch, where the protein of interest suppresses a downstream event. For example, the protein of interest can suppresses expression of a downstream gene of interest, such that in the presence of the target RNA, the downstream gene of interest is expressed; and in the absence of the target RNA, expression of the downstream gene of interest is suppressed by the protein of interest.

[0132] In certain embodiments, the protein of interest suppresses translation of the downstream gene of interest. Exemplary translation suppressor proteins include but are not limited to a L7Ae repressor protein that binds a 4X K-turn, a Scd6 repressor protein fused toAttorney Docket No.: JMPG-001WO any RNA binding protein that binds a corresponding nucleotide sequence, etc. (see Tan et al., ACS Synth. Biol. (2023) 12(9):2516–23), as set forth in Table 4 below. Table 4. Exemplary Translation Suppressor Proteins and Binding Sites Species and Nucleotide Sequence SEQ ID Gene NO

[0133] In certain embodiments, the suppressor protein comprises an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 79, and a corresponding element responsive to the suppressor protein comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at leastAttorney Docket No.: JMPG-001WO 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 59.

[0134] In certain embodiments, the suppressor protein comprises an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 80. In certain embodiments, the suppressor protein comprises (a) an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 80 and (b) an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 81, and a corresponding element responsive to the suppressor protein comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 82. In certain embodiments, the suppressor protein comprises (a) an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 80 and (b) an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 83, and a corresponding element responsive to the suppressor protein comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 84.

[0135] Relatedly, the present disclosure also provides a cleavable ON switch system comprising (a) a cleavable switch disclosed herein, where the protein of interest is a translation or transcription suppressor protein, and (b) a corresponding translation or transcription element responsive to the suppressor protein, operably linked to a downstreamAttorney Docket No.: JMPG-001WO gene of interest. Such a system turns on expression of the downstream gene of interest in the presence of the target RNA. Logic Gates

[0136] The riboswitches of the three types above can be combined to create logic gates, such as AND gates, OR gates, NOT gates, and also logic gates containing three or more inputs. Exemplary logic gates are described in more detail below. AND Gates

[0137] An AND gate is turned on when receiving positive signals from both a first input and a second input (see the tables in FIG.4). An AND gate can utilize a plurality of torsionally modulated tecrRNA switches. The multiple tecrRNAs can bind and suppress the same translation element (e.g., translation initiation element). Accordingly, translation is turned on only when all the tecrRNAs are torsionally constrained or excised from the vector, in the presence of all the target RNAs corresponding to the multiple riboswitches. This type of switch can be used, for example, to provide greater specificity for initiating expression of a gene of interest in a specific cell or tissue type, as well as for discrimination between healthy and disease phenotypes, and exclusive expression of a gene or interest in a desired phenotype.

[0138] In certain embodiments of an AND gate utilizing a plurality of torsionally modulated tecrRNA switches, the present disclosure provides an RNA vector for expressing a protein of interest, the RNA vector comprising a translation initiation element, a gene encoding the protein of interest, a first torsionally modulated tecrRNA switch as disclosed herein responsive to a first target RNA, and a second torsionally modulated tecrRNA switch as disclosed herein responsive to a second, different target RNA, wherein: the tecrRNA in the first tecrRNA switch and the tecrRNA in the second tecrRNA switch are each capable of binding and suppressing the translation initiation element, in the absence of the first target RNA, the tecrRNA in the first tecrRNA switch binds the translation initiation element and suppresses translation of the protein of interest, in the absence of the second target RNA, the tecrRNA in the second tecrRNA switch binds the translation initiation element and suppresses translation of the protein of interest, and in the presence of both the first target RNA and the second target RNA, the tecrRNA in the first tecrRNA switch and the tecrRNA in the second tecrRNA switch bothAttorney Docket No.: JMPG-001WO become torsionally constrained and unable to bind the translation initiation element, thereby permitting translation of the protein of interest from the translation initiation element.

[0139] An RNA vector containing such an AND gate can be linear or circular (FIG.4). Where the vector is linear, the translation initiation element can be a 5’ N7-methylated guanosine cap or an IRES. Where the vector is circular, the translation initiation element can be an IRES. OR Gates

[0140] An OR gate is turned on when receiving a positive signal from either or both of a first input and a second input (see the table in FIG.5). An OR gate can utilize a plurality of torsionally modulated tecrRNA switches. The multiple tecrRNAs can bind and suppress separate translation elements (e.g., translation initiation elements) operably linked to genes encoding the same protein of interest. Accordingly, translation is turned on when at least one of the tecrRNAs is torsionally constrained or excised from the vector, in the presence of at least one of the target RNAs corresponding to the multiple riboswitches. This type of switch can be used, for example, to provide more options of marker genes that collectively cover a cell or tissue type, as well as for exclusive expression in presence of multiple disease phenotypic markers, such that expression occurs in presence of any of the specified markers.

[0141] In certain embodiments of an OR gate utilizing a plurality of torsionally modulated tecrRNA switches, the present disclosure provides an RNA vector for expressing a protein of interest, the RNA vector comprising a first translation initiation element operably linked to a first gene encoding the protein of interest, a second translation initiation element operably linked to a second gene encoding the protein of interest, a first torsionally modulated tecrRNA switch as disclosed herein responsive to a first target RNA, and a second torsionally modulated tecrRNA switch as disclosed herein responsive to a second, different target RNA, wherein: the tecrRNA in the first tecrRNA switch is capable of binding and suppressing the first translation initiation element, and the tecrRNA in the second tecrRNA switch is capable of binding and suppressing the second translation initiation element, in the absence of both the first target RNA and the second target RNA, the tecrRNA in the first tecrRNA switch binds and suppresses the first translation initiation element, and the tecrRNA in the second tecrRNA switch binds and suppresses the second translation initiation element, thereby suppressing translation of the protein of interest from either translation initiation element,Attorney Docket No.: JMPG-001WO in the presence of the first target RNA, the tecrRNA in the first tecrRNA switch becomes torsionally constrained and unable to bind the first translation initiation element, thereby permitting translation of the protein of interest from the first translation initiation element, and in the presence of the second target RNA, the tecrRNA in the second tecrRNA switch becomes torsionally constrained and unable to bind the second translation initiation element, thereby permitting translation of the protein of interest from the second translation initiation element.

[0142] An RNA vector containing such an OR gate can be linear or circular (FIG.5). Where the vector is linear, the first and second translation initiation elements can be a N7- methylated guanosine cap and an IRES, or two different IRES elements. Where the vector is circular, the first and second translation initiation elements can be two different IRES elements. The two different IRES elements can be from different species, or be derived from the same native IRES but include different synthetic sequences integrated between Domain V and Domain VI. NOT Gates

[0143] A NOT gate is turned on only when receiving a positive signal from a first input and a negative signal from a second input. A NOT gate can utilize a torsionally modulated tecrRNA switch for receiving the first input, combined with a cleavable switch for receiving the second input. The tecrRNA switch can bind and suppress the translation element (e.g., translation initiation element) and turns on protein expression in the presence of a corresponding target RNA (the first input). However, in the presence of a target RNA corresponding to the cleavable switch (the second input), the RNA vector is cleaved by the HHR of the cleavable switch, resulting in fragments susceptible to degradation in an intracellular environment. As a result, sustained translation of the protein of interest only occurs in the absence of a target RNA corresponding to the cleavable switch (the second input). This type of switch can be used, for example, to specifically target a cell or tissue type featured by a positive marker combined with a negative marker.

[0144] In certain embodiments of a NOT gate utilizing a torsionally modulated tecrRNA switch and a cleavable switch, the present disclosure provides an RNA vector for expressing a protein of interest. The RNA vector comprises a translation initiation element, a gene encoding the protein of interest, a torsionally modulated tecrRNA switch as disclosed herein responsive to a first target RNA, and a cleavable RNA switch as disclosed hereinAttorney Docket No.: JMPG-001WO responsive to a second, different target RNA, wherein: the tecrRNA in the tecrRNA switch is capable of binding and suppressing the translation initiation element, in the presence of the second target RNA, cleavage of the loop in the cleavable RNA switch permits degradation of the RNA vector, in the absence of the second target RNA and in the absence of the first target RNA, the tecrRNA in the tecrRNA switch binds the translation initiation element and suppresses translation of the protein of interest, and in the absence of the second target RNA but in the presence of the first target RNA, the tecrRNA in the tecrRNA switch becomes torsionally constrained and unable to bind the translation initiation element, thereby permitting translation of the protein of interest from the translation initiation element.

[0145] An RNA vector containing such an AND gate can be linear or circular. Where the vector is linear, the translation initiation element can be a N7-methylated guanosine cap or an IRES. Where the vector is circular, the translation initiation element can be an IRES. Complex Gates

[0146] The present disclosure also provides a complex gate that is turned on only when receiving a positive signal from a first input and negative signals both a second input and a third input. The complex gate can utilize a torsionally modulated tecrRNA switch as the first input, combined with two cleavable switches as the second and third inputs. The tecrRNA switch can bind and suppress the translation element (e.g., translation initiation element) and turns on protein expression in the presence of a corresponding target RNA (the first input). However, in the presence of a target RNA corresponding to either or both of the two cleavable switches (the second and third inputs), the RNA vector is cleaved by the HHR(s) of the cleavable switch(es), resulting in fragments susceptible to degradation in an intracellular environment. As a result, sustained translation of the protein of interest only occurs in the absence of a target RNA corresponding to either cleavable switch (the second or third input). This type of switch can be used, for example, to specifically target a cell or tissue type featured by a positive marker combined with two negative markers.

[0147] In certain embodiments of a complexgate utilizing a torsionally modulated tecrRNA switch and two cleavable switches, the present disclosure provides an RNA vector for expressing a protein of interest, the RNA vector comprising a translation initiation element, a gene encoding the protein of interest, a first cleavable RNA switch as disclosedAttorney Docket No.: JMPG-001WO herein responsive to a first target RNA, a second cleavable RNA switch as disclosed herein responsive to a second, different target RNA, and a torsionally modulated tecrRNA switch as disclosed herein responsive to a third, different target RNA, wherein: the tecrRNA in the tecrRNA switch is capable of binding and suppressing the translation initiation element, in the presence of either the first target RNA or the second target RNA, cleavage of the loop in the respective cleavable RNA switch permits degradation of the RNA vector, in the presence of neither the first target RNA nor the second target RNA, and in the absence of the third target RNA, the tecrRNA in the tecrRNA switch binds the translation initiation element and suppresses translation of the protein of interest, and in the presence of neither the first target RNA nor the second target RNA, but in the presence of the third target RNA, the tecrRNA in the tecrRNA switch becomes torsionally constrained and unable to bind the translation initiation element, thereby permitting translation of the protein of interest from the translation initiation element.

[0148] An RNA vector containing such a complex gate can be linear (FIG.6A) or circular (FIG.6B). Where the vector is linear, the translation initiation element can be a N7- methylated guanosine cap or an IRES. Where the vector is circular, the translation initiation element can be an IRES. Gene Therapy Vectors and Manufacturing Processes

[0149] The present disclosure also provides RNA vectors, DNA vectors, and their manufacturing processes. RNA Vectors

[0150] The RNA vectors disclosed herein are useful as gene therapy vectors. They can include naturally occurring ribonucleotides, chemically modified ribonucleotides, or a combination thereof. RNA modifications can be made in a ribose group, in a phosphate group, in a nucleobase, in a terminal group of a linear RNA, or a combination thereof. Exemplary modifications are disclosed in U.S. Patent Application Publication Nos. 2016 / 0289675, 2017 / 0355985, 2018 / 0119140, Watts et al. (2008) DRUG DISCOVER. TODAY 13: 842-55, and Hendel et al. (2015) NAT. BIOTECHNOL.33: 985. RNA modifications can in some cases have detrimental effects on translation. Some examples include, incorporation of 2’-O-methyl RNA nucleoside in the coding sequence, which have been reported to lead to ribosomal stalling (see Choi et al., NATURE STRUCTURAL & MOLECULAR BIOLOGY (2018)Attorney Docket No.: JMPG-001WO 25:208–16), or incorporation of 8-Dihydroguanosine (8-Oxo-G) which could lead to generation of truncated proteins and activation of the no-go decay (NGD) pathway (see Roy, METHODS MOL. BIOL. (2021) 2298:327-56).

[0151] Modifications in a ribose group include but are not limited to modifications at the 2′ position or modifications at the 4′ position. For example, in certain embodiments, the ribose comprises 2′-O-C1-4alkyl, such as 2′-O-methyl (2′-OMe). In certain embodiments, the ribose comprises 2′-O-C1-3alkyl-O-C1-3alkyl, such as 2′-methoxyethoxy (2′-O— CH2CH2OCH3) also known as 2′-O-(2-methoxyethyl) or 2′-MOE. In certain embodiments, the ribose comprises 2′-O-allyl. In certain embodiments, the ribose comprises 2′-O-2,4- Dinitrophenol (DNP). In certain embodiments, the ribose comprises 2′-halo, such as 2′-F, 2′- Br, 2′-Cl, or 2′-I. In certain embodiments, the ribose comprises 2′-NH2. In certain embodiments, the ribose comprises 2′-H (e.g., a deoxynucleotide). In certain embodiments, the ribose comprises 2′-arabino or 2′-F-arabino. In certain embodiments, the ribose comprises 2′-LNA or 2′-ULNA. In certain embodiments, the ribose comprises a 4′- thioribosyl.

[0152] Modifications in a phosphate group include but are not limited to a phosphorothioate internucleotide linkage, a chiral phosphorothioate internucleotide linkage, a phosphorodithioate internucleotide linkage, a boranophosphonate internucleotide linkage, a C1-4alkyl phosphonate internucleotide linkage such as a methylphosphonate internucleotide linkage, a boranophosphonate internucleotide linkage, a phosphonocarboxylate internucleotide linkage such as a phosphonoacetate internucleotide linkage, a phosphonocarboxylate ester internucleotide linkage such as a phosphonoacetate ester internucleotide linkage, an amide linkage, a thiophosphonocarboxylate internucleotide linkage such as a thiophosphonoacetate internucleotide linkage, a thiophosphonocarboxylate ester internucleotide linkage such as a thiophosphonoacetate ester internucleotide linkage, and a 2′,5′-linkage having a phosphodiester linker or any of the linkers above. Various salts, mixed salts and free acid forms are also included.

[0153] Modifications in a nucleobase include but are not limited to N1- Methylpseudouridine, 2-thiouracil, 2-thiocytosine, 4-thiouracil, 6-thioguanine, 2- aminoadenine, 2-aminopurine, pseudouracil, hypoxanthine, 7-deazaguanine, 7-deaza-8- azaguanine, 7-deazaadenine, 7-deaza-8-azaadenine, 5-methylcytosine, 5-methyluracil, 5- hydroxymethylcytosine, 5-hydroxymethyluracil, 5,6-dehydrouracil, 5-propynylcytosine, 5- propynyluracil, 5-ethynylcytosine, 5-ethynyluracil, 5-allyluracil, 5-allylcytosine, 5-Attorney Docket No.: JMPG-001WO aminoallyluracil, 5-aminoallyl-cytosine, 5-bromouracil, 5-iodouracil, diaminopurine, difluorotoluene, dihydrouracil, an abasic nucleotide, Z base, P base, Unstructured Nucleic Acid, isoguanine, isocytosine (see, Piccirilli et al. (1990) NATURE, 343: 33), 5-methyl-2- pyrimidine (see, Rappaport (1993) BIOCHEMISTRY, 32: 3047), x(A,G,C,T), and y(A,G,C,T).

[0154] Terminal modifications include but are not limited to polyethyleneglycol (PEG), hydrocarbon linkers (such as heteroatom (O,S,N)-substituted hydrocarbon spacers; halo- substituted hydrocarbon spacers; keto-, carboxyl-, amido-, thionyl-, carbamoyl-, thionocarbamaoyl-containing hydrocarbon spacers), spermine linkers, dyes such as fluorescent dyes (for example, fluoresceins, rhodamines, cyanines), quenchers (for example, dabcyl, BHQ), and other labels (for example biotin, digoxigenin, acridine, streptavidin, avidin, peptides and / or proteins). In certain embodiments, a terminal modification comprises a conjugation (or ligation) of the RNA to another molecule comprising an oligonucleotide (such as deoxyribonucleotides and / or ribonucleotides), a peptide, a protein, a sugar, an oligosaccharide, a steroid, a lipid, a folic acid, a vitamin and / or other molecule. In certain embodiments, a terminal modification incorporated into the RNA is located internally in the RNA sequence via a linker such as 2-(4-butylamidofluorescein)propane-1,3-diol bis(phosphodiester) linker, which is incorporated as a phosphodiester linkage and can be incorporated anywhere between two nucleotides in the RNA.

[0155] The modifications disclosed above can be combined in the RNA vectors disclosed herein. In certain embodiments, the modification in the RNA is selected from the group consisting of incorporation of 2'-O-methyl-3'phosphorothioate, 2′-O-methyl-3′- phosphonoacetate, 2′-O-methyl-3′-thiophosphonoacetate, 2′-halo-3′-phosphorothioate (e.g., 2′-fluoro-3′-phosphorothioate), 2′-halo-3′-phosphonoacetate (e.g., 2′-fluoro-3′- phosphonoacetate), and 2′-halo-3′-thiophosphonoacetate (e.g., 2′-fluoro-3′- thiophosphonoacetate).

[0156] In certain embodiments, the modification enhances the stability of the RNA vector, e.g., by increasing nuclease resistance of the RNA relative to a corresponding RNA without the modification. Stability-enhancing modifications include but are not limited to 2′- O-methyl, a 2′-O-C1-4alkyl, 2′-halo (e.g., 2′-F, 2′-Br, 2′-Cl, or 2′-I), 2′MOE, a 2′-O-C1-3alkyl- O-C1-3alkyl, 2′-NH2, 2′-H (or 2′-deoxy), 2′-arabino, 2′-F-arabino, 4′-thioribosyl sugar moiety, 3′-phosphorothioate, 3′-phosphonoacetate, 3′-thiophosphonoacetate, 3′-methylphosphonate, 3′-boranophosphate, 3′-phosphorodithioate, locked nucleic acid (“LNA”) nucleotide which comprises a methylene bridge between the 2' and 4' carbons of the ribose ring, and unlockedAttorney Docket No.: JMPG-001WO nucleic acid (“ULNA”) nucleotide. Such modifications are suitable for use as a protecting group to prevent or reduce degradation of the RNA vectors.

[0157] In certain embodiments, the modification reduces the immunogenicity of the RNA vector. Immunogenicity-reducing modifications include but are not limited to 5- methylcytidine (m5C), N6-methyladenosine (m6A), 5-methyluridine (m5U), 2-thiouridine (s2U), pseudouridine (ψ), and N(1)-methylpseudouridine. Such modifications are suitable for reducing immune reactions to the RNA vectors. DNA Vectors Encoding Linear RNAs

[0158] The present disclosure provides DNA vectors encoding any one of the linear RNAs disclosed herein. It is understood that the DNA vector comprises a nucleotide sequence corresponding to the linear RNA, but does not include a 5’ N7-methylated guanosine cap or polyadenylation tail. Rather, the DNA vector can include a polyadenylation signal which directs both the termination and polyadenylation of the nascent RNA transcript by RNA polymerase H. Examples of useful polyadenylation signals include but are not limited to AATAAA, ATTAAA AGTAAA, a bovine growth hormone polyadenylation sequence (BGHpA), a rabbit β-globin polyadenylation sequence (rβgpA), and other suitable heterologous or endogenous polyadenylation sequence known in the art.

[0159] In certain embodiments, the DNA vector further comprises one or more transcriptional control sequences, such as promoter or enhancer. Transcriptional control sequences can direct constitutive expression of an RNA in many types of host cell or direct expression of the RNA only in certain host cells. In certain embodiments, a DNA vector comprises a retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), a cytomegalovirus (CMV) promoter (optionally with the CMV enhancer), an SV40 promoter, a dihydrofolate reductase promoter, a β-actin promoter, a phosphoglycerol kinase (PGK) promoter, an EF1α promoter, a T7 virus promoter, a T6 virus promoter, an SP6 virus promoter, a T3 virus promoter, and a T4 virus promoter. A tissue-specific promoter or enhancer may direct transcription primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g., liver, pancreas), or particular cell types (e.g., lymphocytes), thereby to further increase the specificity of the gene therapy. Transcriptional control sequences may also direct transcription in a temporal-dependent manner, such as in a particular cell-cycle stage or developmental stage. It will be appreciated by those skilled in the art that the design of the expression vector can depend on factors such as the choice of the host cell to be transfected, the desired level of expression, etc.Attorney Docket No.: JMPG-001WO

[0160] A DNA vector disclosed here can be used to produce a linear RNA in vitro or in vivo. An in vitro method includes contacting a producer cell with the DNA vector under conditions to transcribe a linear RNA. The linear RNA can be purified generally through oligo dT columns for affinity capture of the linear RNA, followed by styrene-divinylbenzene (SDVB) columns to remove dsRNA contaminants (see Skok et al., CHEM. ING. TECH. (2022) 94(12): 1928–35; Mencin et al., SEPARATION AND PURIFICATION TECHNOLOGY (2023) 304(1): 122320). dsRNA can alternatively be removed using cellulose column purification methods (see Baiersdörfer et al., MOL. THER. NUCLEIC ACIDS (2019) 15: 26–35). An in vivo method includes delivering the DNA vector to a subject in need thereof, thereby to allow transcription of the DNA vector in a cell of the subject. DNA Vectors Encoding Circular RNAs

[0161] The present disclosure provides a precursor RNA of any one of the circular RNAs disclosed herein. The precursor RNA is a linear RNA that can be circularized by various methods in vitro or in vivo. Exemplary methods are described in Obi an Chen, METHODS (2021) 196:85–103, and International Applications WO2019236673A1, WO2022247943A1, and WO2022191642A1. In certain embodiments, the precursor RNA can be circularized in vivo by a permuted intron exon (PIE) approach using a Group I or Group II self-splicing intron, as described in more detail in the “Circularization Switches” subsection above.

[0162] The present disclosure also provides a DNA vector encoding the precursor RNA. The DNA vector can include one or more transcriptional control sequences, such as promoter or enhancer, similar to the DNA vectors described in the “DNA Vectors Encoding Linear RNAs” subsection above.

[0163] The DNA vector can be used to produce a circular RNA in vitro or in vivo, the method comprising contacting a producer cell with such a DNA vector under conditions to transcribe and circularize the precursor RNA. The circular RNA can be purified generally using size-exclusion high performance liquid chromatography (SEC-HPLC), as well as other methods such as enzymatic RNaseR treatment to remove linear RNAs (see Wesselhoeft et al., NATURE COMMUNICATIONS (2018) 9:2629; Chen et al., bioRxiv doi.org / 10.1101 / 2022.05.31.494115). An in vivo method includes delivering the DNA vector to a subject in need thereof, thereby to allow transcription of the DNA vector and circularization of the precursor RNA in a cell of the subject.Attorney Docket No.: JMPG-001WO

[0164] The nucleotide sequences disclosed herein are presented as DNA sequences by including thymidines (T) and / or RNA sequences including uridines (U). It is understood that corresponding DNA sequences, RNA sequences, and DNA / RNA chimeric sequences are also contemplated. For example, where a sequence is presented as a DNA sequence, a nucleic acid comprising this sequence as an RNA can be derived from the DNA sequence by replacing each T with U. As a result, for the purpose of describing a nucleotide sequence, T and U are used interchangeably herein. Medical Applications

[0165] The present disclosure provides methods of expressing a protein of interest in a target cell that has a specific molecular signature. Also provided are methods for treating a disease or condition associated with such target cells, the method comprising administering an effective amount of a vector disclosed herein, or a pharmaceutical composition containing the vector, to a subject in need thereof.

[0166] There are many examples of where single mRNAs can be used to identify a specific cell type, organ, or disease phenotype. The lung alveolar epithelial cells can be targeted by detecting Surfactant protein C (SFTPC) mRNA. Alternate cells that can be exclusively targeted in the lung include ciliated, club cells and ionocytes, though detection of Secretoglobin family 1A member 1 (SCGB1A1) mRNA. Pancreas (β cells) can be targeted by detecting Insulin (INS) mRNA. Heart (Cardiomyocytes) can be targeted through detection of Natriuretic peptide A (NPPA) mRNA. Skeletal muscle (Skeletal myocytes) can be targeted through detection of Myosin heavy chain 1 (MYH1) mRNA. Liver (Hepatocytes) can be targeted through detection of Apolipoprotein A2 (APOA2) mRNA. Testis (Late and Early spermatids) can be targeted through detection of Protamine 1 (PRM1) mRNA. Prostate (Prostatic glandular cells) can be targeted through detection of Kallikrein related peptidase 3 (KLK3) mRNA. Kidney (Distal tubular cells and Collecting duct cells) can be targeted through detection of Uromodulin (UMOD) mRNA. Fallopian tube (Secretory cells) can be targeted through detection of Oviductal glycoprotein 1 (OVGP1) mRNA. Pituitary gland (Thyrotropic cells) can be targeted through detection of Thyroid stimulating hormone subunit beta (TSHB) mRNA.

[0167] Single mRNAs can also be used to identify a disease phenotype, such as cancer. One example is that breast glandular cells express Lactalbumin alpha (LALBA) only during lactation, and LALBA mRNA is not present in normal non-lactating breast tissue. InAttorney Docket No.: JMPG-001WO contrast, α-Lactalbumin is expressed in a majority of human triple negative breast cancers. Accordingly, a vector expressing a suicide protein (e.g., an apoptotic protein, such as caspase-8 or caspase-9) responsive to LALBA mRNA is useful for treatment of triple negative breast cancer. Besides dysregulated expression, mutations in RNAs (e.g., as a result of mutations at the DNA level) can also be detected by the riboswitches disclosed herein, permitting specific killing of cancer cells.

[0168] Many other cell types or disease phenotypes require reading of multiple different mRNAs for cell identification. Examples include but are not limited to targeting of regulatory T cells through detection of CD3, CD4, and FoxP3, targeting cytotoxic T cells through detection of CD3 and CD8, or targeting helper T cells through detection of CD3 and CD4. In addition, hematopoietic stem cells can be targeted through detection of two markers: Gata2 and c-kit. The AND logic gate designs disclosed herein are useful for targeting these cell types.

[0169] Other logic gates can also be used according to the molecular signature of the target cells compared to other cells. For example, differential expression of non-coding mitochondrial RNAs (ncmtRNAs) can be recognized to differentiate between normal and cancer cells. Sense ncmtRNA is high in normal proliferating and cancer cells. Antisense ncmtRNA-1 and antisense ncmtRNA-2 are low or absent in cancer cells. Accordingly, a complex logic gate can be employed to specifically target the cells that express sense ncmtRNA, but not the two antisense ncmtRNAs, driving the expression of a suicide protein (e.g., an apoptotic protein) to specifically kill cancer cells.

[0170] Besides treating cancer, the riboswitches and logic-gated genetic medicines disclosed herein are useful in treating monogenetic disorders, autoimmune diseases, infectious diseases, neurodegeneration and neurological disorders, and obesity. To treat monogenetic disorders, detection of the mutant RNA can permit CRISPR / Cas9-mediated gene editing or heterologous expression of a functional gene only in the cells that express a substantial amount of the mutated gene. To treat autoimmune diseases, detection of B cell- specific mRNAs or, more specifically, CDR3 regions of immunoglobulins that bind particular antigens, can be utilized to silence or destroy the specific B cells. Anti- inflammatory M2 macrophages and / or regulatory T cells can also be targeted for generation of anti-inflammatory response. To treat infectious diseases, detection of viral RNA can be used to induce anti-viral response or destroy infected cells specifically. Neuron, neuroglial cell, or region-specific brain targeting can be used for treatment of neurodegenerativeAttorney Docket No.: JMPG-001WO diseases such as Alzheimer’s diseases, dementia, Parkinson’s disease, and others; as well as neurological disorders such as epilepsy, autism, cerebral palsy, and others. For obesity control, detection of adipocyte-specific cells can allow cell-specific conversion to brown fat or induction of thermogenesis.

[0171] The riboswitches and logic-gated genetic medicines disclosed herein are also useful in vaccination. Reports have been published showing Covid-19 mRNA LNP vaccine migrates in the blood to other sites in the body including liver, adrenals, spleen, and ovaries. Selective expression of the mRNA in antigen-presenting cells such as skin Langerhans cells may restrict antigen expression to the administration site. For generation of tolerogenic vaccine, anti-inflammatory M2 macrophages and / or regulatory T cells can be targeted to induce a tolerogenic immune response to the antigen.

[0172] Another use of the riboswitches and logic-gated genetic medicines disclosed herein is tissue regeneration, which can be used to treat aging and age-related conditions. For example, detection of senescent cells can be used for destruction or epigenetic reprogramming for rejuvenation. Permanently differentiated cells such as cardiomyocytes and neurons can be specifically targeted for epigenetic reprogramming.

[0173] Ex vivo delivery of the genetic medicines is useful for cell therapies. In certain embodiments, the present disclosure provides a host cell comprising any one of the RNA vectors or DNA vectors disclosed herein. The host cell can be a T cell engineered to express a chimeric antigen receptor (CAR). In certain embodiments, the vector expresses a suicide protein when detecting dysregulated proliferation of the T cells.

[0174] Dosage levels of the active ingredients in the pharmaceutical compositions of this disclosure may be selected by medical experts to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. The specific dose can be a uniform dose for each patient. Alternatively, a patient’s dose can be tailored to the approximate body weight or surface area of the patient. Other factors in determining the appropriate dosage can include the disease or condition to be treated or prevented, the severity of the disease, the route of administration, and the age, sex and medical condition of the patient. Further refinement of the calculations necessary to determine the appropriate dosage for treatment is routinely made by those skilled in the art, especially in light of the dosage information and assays disclosed herein. The dosage can also be determined through the use of known assays for determining dosages used inAttorney Docket No.: JMPG-001WO conjunction with appropriate dose-response data. An individual patient’s dosage can be adjusted as the progress of the disease is monitored. Blood levels of the targetable construct or complex in a patient can be measured to see if the dosage needs to be adjusted to reach or maintain an effective concentration. Pharmacogenomics may be used to determine which targetable constructs and / or complexes, and dosages thereof, are most likely to be effective for a given individual (Schmitz et al., CLINICA ACTA 308: 43-53, 2001; Steimer et al., CLINICA ACTA 308: 33-41, 2001). Doses may be given once or more times daily, once or more times weekly, once or more times monthly, and once or more times annually, or even once every 2 to 20 years. Persons of ordinary skill in the art can estimate repetition rates for dosing based on measured residence times and concentrations of the targetable construct or complex in bodily fluids or tissues.

[0175] Besides therapeutic uses, the RNA and DNA vectors disclosed herein are also suitable for diagnostic uses. These riboswitches and logic-gated systems can be used as cell- free biosensors or lateral flow assays for diagnostic purposes. When the RNA and DNA vectors are incorporated into a cell-free, in some cases freeze-dried cell-free systems, once hydrated in presence of the testing sample, the riboswitch or logic-gated systems could generate a colorimetric, fluorescence, or other biomolecular-based output for detection by eye or device-based systems such as fluorescence analyzers or spectrometers, for detection of the output (see Lu, NATURE BIOMEDICAL ENGINEERING (2022) 6(3):225–26).

[0176] Routes of administration can be intravenous, intraarterial, intraperitoneal, intramuscular, intratumoral, intranasal, subcutaneous, intrapleural, intrathecal, transdermal, transmucosal, intracavitary, rectal, by perfusion through a catheter, or by direct intralesional injection. Pharmaceutical Compositions

[0177] The present disclosure also provides pharmaceutical compositions that contain a DNA or RNA vector described herein. The pharmaceutical composition can be formulated for use in a variety of drug delivery systems. One or more pharmaceutically acceptable excipients or carriers can also be included in the composition for proper formulation. Suitable formulations for use in the present disclosure are found in Adeboye Adejare, Remington: The Science and Practice of Pharmacy (23d ed.2020).

[0178] In certain embodiments, a pharmaceutical composition may contain formulation materials for modifying, maintaining or preserving, for example, the pH, osmolarity,Attorney Docket No.: JMPG-001WO viscosity, clarity, color, isotonicity, odor, sterility, stability, rate of dissolution or release, adsorption or penetration of the composition. In such embodiments, suitable formulation materials include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine or lysine); antimicrobials; antioxidants (such as ascorbic acid, sodium sulfite or sodium hydrogen-sulfite); buffers (such as borate, bicarbonate, Tris-HCl, citrates, phosphates or other organic acids); bulking agents (such as mannitol or glycine); chelating agents (such as ethylenediamine tetraacetic acid (EDTA)); complexing agents (such as caffeine, polyvinylpyrrolidone, beta-cyclodextrin or hydroxypropyl-beta-cyclodextrin); fillers; monosaccharides; disaccharides; and other carbohydrates (such as glucose, mannose or dextrins); proteins (such as serum albumin, gelatin or immunoglobulins); coloring, flavoring and diluting agents; emulsifying agents; hydrophilic polymers (such as polyvinylpyrrolidone); low molecular weight polypeptides; salt-forming counterions (such as sodium); preservatives (such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid or hydrogen peroxide); solvents (such as glycerin, propylene glycol or polyethylene glycol); sugar alcohols (such as mannitol or sorbitol); suspending agents; surfactants or wetting agents (such as pluronics, PEG, sorbitan esters, polysorbates such as polysorbate 20, polysorbate, triton, tromethamine, lecithin, cholesterol, tyloxapal); stability enhancing agents (such as sucrose or sorbitol); tonicity enhancing agents (such as alkali metal halides, preferably sodium or potassium chloride, mannitol sorbitol); delivery vehicles; diluents; excipients and / or pharmaceutical adjuvants (see, Adeboye Adejare, Remington: The Science and Practice of Pharmacy (23d ed.2020)).

[0179] In certain embodiments, the pharmaceutical composition contains nanoparticles, e.g., polymeric nanoparticles, liposomes, or micelles (See Anselmo et al. (2016) BIOENG. TRANSL. MED.1: 10-29). For example, in certain embodiments, the RNA or DNA vector can be encapsulated in a lipid nanoparticle (LNP), e.g., as described in U.S. Patent Nos. 8,058,069, 9,006,417, 9,504,651, 9,737,619, 10,166,298, and 11,357,856. The LNP can be modified with a targeting moiety to further increase the specificity of the genetic medicine. Other systems can also be used, such as polymer, lipid-polymer, protein, or peptide-mediated nucleic acid delivery.

[0180] In certain embodiments, the nanoparticle comprises a targeting moiety to increase target cell binding or uptake of nanoparticles and liposomes. Exemplary targeting moieties include cell specific antigens, monoclonal antibodies, single chain antibodies,Attorney Docket No.: JMPG-001WO aptamers, polymers, sugars, and cell penetrating peptides. In certain embodiments, the pharmaceutical composition comprises a fusogenic or endosome-destabilizing peptide or polymer.

[0181] In certain embodiments, the composition does not comprise (or is substantially free of, for example, the composition comprises less than 5%, 4%, 3%, 2%, 1%, 0.5% or 0.1% of) a nanoparticle or an aminolipid delivery compound, e.g., as described in U.S. Patent Publication No.2017 / 0354672. In certain embodiments, the vector introduced into the cell or administered to the subject is not conjugated to or associated with another moiety, e.g., a carrier particle, e.g., an aminolipid particle.

[0182] A pharmaceutical composition should be formulated to be compatible with its intended route of administration. Examples of routes of administration are intravenous, intraarterial, intraperitoneal, intramuscular, intratumoral, subcutaneous, intrapleural, intrathecal, intranasal, transdermal, transmucosal, intracavitary, rectal, by perfusion through a catheter, or by direct intralesional injection. Formulation components suitable for parenteral administration include a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as EDTA; buffers such as acetates, citrates or phosphates; and agents for the adjustment of tonicity such as sodium chloride or dextrose.

[0183] For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). The carrier should be stable under the conditions of manufacture and storage, and should be preserved against microorganisms. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol), and suitable mixtures thereof. An intravenous drug delivery formulation of the present disclosure may be contained in a bag, a pen, or a syringe. In certain embodiments, the bag may be connected to a channel including a tube and / or a needle.

[0184] In certain embodiments, the formulation is a liquid formulation. In certain embodiments, an aqueous formulation is prepared including the vector of the present disclosure in a pH-buffered solution. The pH of the liquid formulation may be set by addition of a pharmaceutically acceptable acid and / or base. In certain embodiments, theAttorney Docket No.: JMPG-001WO pharmaceutically acceptable acid may be hydrochloric acid. In certain embodiments, the base may be sodium hydroxide. In certain embodiments, a salt or buffer components may be added in an amount of 10 mM to 200 mM. The salts and / or buffers are pharmaceutically acceptable and are derived from various known acids (inorganic and organic) with “base forming” metals or amines. In certain embodiments, the buffer may be phosphate buffer. In certain embodiments, the buffer may be glycinate, carbonate, citrate buffers, in which case, sodium, potassium or ammonium ions can serve as counterion. Intravenous formulations can be diluted with 0.9% Sodium Chloride solution before administration. In certain embodiments, the diluted drug product for injection is isotonic and suitable for administration by intravenous infusion.

[0185] In certain embodiments, the formulation is a lyophilized formulation including a vector disclosed herein and a lyoprotectant. The lyoprotectant may be sugar, e.g., disaccharides. In certain embodiments, the lyoprotectant may be sucrose or maltose. The vector can be encapsulated in an LNP and lyophilized using various buffers or lyoprotectants such as sucrose, trehalose, lactose, mannitol, and glucose. One example is lyophilization of LNP-mRNAs in 20% w / v sucrose, which had high colloidal stability, payload encapsulation and transfection efficiency (see Lamoot et al., BIOMATER. SCI. (2023) 11:4327-34). In some cases, a combination of lyoprotectants can be used, for example, 8.8% sucrose, 2% trehalose, and 0.04% mannitol (see Li et al., NPJ VACCINES (2023) 8(1):153). The lyophilized formulation may also include one or more of a buffering agent, a surfactant, a bulking agent, and / or a preservative. Before lyophilization, the pH of the solution containing the vector of the present disclosure may be adjusted between 7 to 9 (e.g., 7 to 8). In certain embodiments, a “bulking agent” may be added. A “bulking agent” is a compound which adds mass to a lyophilized mixture and contributes to the physical structure of the lyophilized cake (e.g., facilitates the production of an essentially uniform lyophilized cake which maintains an open pore structure). Illustrative bulking agents include mannitol, glycine, polyethylene glycol and sorbitol. The lyophilized formulations of the present disclosure may contain such bulking agents.

[0186] In certain embodiments, the lyophilized composition may be constituted with an aqueous carrier. The aqueous carrier of interest herein is one which is pharmaceutically acceptable (e.g., safe and non-toxic for administration to a human) and is useful for the preparation of a liquid formulation, after lyophilization. Illustrative diluents include sterile water for injection (SWFI), bacteriostatic water for injection (BWFI), a pH buffered solutionAttorney Docket No.: JMPG-001WO (e.g., phosphate-buffered saline), sterile saline solution, Ringer’s solution or dextrose solution. In certain embodiments, the lyophilized protein product of the instant disclosure is constituted to about 4.5 mL water for injection and diluted with 0.9% saline solution (sodium chloride solution).

[0187] The pharmaceutical compositions may be sterilized by conventional sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as-is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration. The pH of the preparations typically will be between 3 and 11, more preferably between 5 and 9 or between 6 and 8, and most preferably between 7 and 8, such as 7 to 7.5. The resulting compositions in solid form may be packaged in multiple single dose units, each containing a fixed amount of the above-mentioned agent or agents. The composition in solid form can also be packaged in a container for a flexible quantity.

[0188] A preservative may be optionally added to the formulations herein to reduce bacterial action. The addition of a preservative may, for example, facilitate the production of a multi-use (multiple-dose) formulation.

[0189] The description above describes multiple aspects and embodiments of the disclosure. The patent application specifically contemplates all combinations and permutations of the aspects and embodiments. EXAMPLES

[0190] The disclosure generally described herein will be more readily understood by reference to the following examples, which are included merely for purposes of illustration of certain aspects and embodiments of the present disclosure, and is not intended to limit the disclosure. Example 1: Cleavable Riboswitch Responsive to Surfactant Protein C (SFTPC) mRNA

[0191] This example describes a cleavable riboswitch that turns off or turns on expression of a gene in the presence of SFTPC mRNA.

[0192] Surfactant Protein C is a highly hydrophobic protein that increases alveolar stability by reducing the surface tension in the alveoli. This protein is critical to maintaining alveolar stability to make breathing easier and prevent lung collapse. Surfactant protein C is specifically expressed by alveolar type II epithelial cells. As such, detection of SFTPC mRNA can be used to selectively express therapeutics in alveolar type II epithelial cells, forAttorney Docket No.: JMPG-001WO example, for treatment of diseases such as idiopathic pulmonary fibrosis, pulmonary lymphangioleiomyomatosis, and surfactant dysfunction disorders (e.g., SP-B deficiency and ABCA3 deficiency).

[0193] Briefly, linear RNA vectors were designed to express ZsGreen reporter only in the absence of SFTPC mRNA. In the presence of SFTPC mRNA, the vectors underwent self-cleavage and suppressed the reporter gene expression. The linear vector included the genetic elements in Table 5. Cleavable switches were designed with 25 nt (JG15, JG16, and JG17) or 50 nt (JG18, JG19, and JG20) target RNA binding sensor arms positioned at either or both of the 5’ end (between the 5’ Cap and the Kozak sequence) and the 3’ end (between the 3’ UTR and the polyadenylation tail) of linear vector, to cleave the vector upon binding target murine surfactant protein C mRNA present only in pulmonary alveolar epithelial cells. Table 5. Genetic Elements in Linear SFTPC-responsive Reporter Cleavable Vectors Genetic Element Nucleotide Sequence SEQ ID NOAttorney Docket No.: JMPG-001WO Genetic Element Nucleotide Sequence SEQ ID NOAttorney Docket No.: JMPG-001WO Genetic Element Nucleotide Sequence SEQ ID NOp g p g genetic elements, except for the absence of the 5’ cap and the inclusion of a polyadenylation signal in lieu of a polyadenylation tail in the DNA encoding the linear RNA vector. The DNA vector further included a T7 promoter to drive in vitro transcription in the presence of T7 RNA polymerase. Both linear RNA and circular RNA versions of the SFTPC riboswitch were developed and purified as described previously using standard mRNA or circRNA purification techniques.

[0195] The linear RNA vectors were analyzed for ZsGreen expression by flow cytometric analysis. As shown in FIG.7 (left panel), at 24 hrs post-transfection of riboswitches, there was significant suppression of ZsGreen expression in MLE-15 pulmonary alveolar epithelial cells, compared to no suppression in control non-specific HeLa cells. The suppression was also observed at 48 hrs post-transfection, as shown in FIG.7 (right panel). At both timepoints, suppression was highest when cleavable switches were positions in either the 5’ end or both the 5’ and the 3’ ends, compared to at the 3’ end alone.

[0196] The cleavable switches were further modified in two ways. In vector JG153, a ribozyme in the flipped orientation (SEQ ID NO: 63) was substituted for the originally designed ribozyme (SEQ ID NO: 26). In vector JG20B3, the length of the target RNA binding sensor arms was increased to 95 nt in length. As shown in FIG.8 (left panel), at 24 hrs post-transfection of riboswitches, the cleavable switch with 95nt sensor arms positioned at both the 5’ and the 3’ ends demonstrated the greatest suppression of ZsGreen expression in MLE-15, performing superior to the vectors with shorter sensor arm lengths. The riboswitch with the flipped ribozyme was equally responsive to SFTPC mRNA as the riboswitch with the ribozyme in the original orientation. Fluorescence image analysis of optimized cleavable switches were performed in HeLa vs. MLE-15 cells at 24hrs post-transfection. As shown in FIG.8 (right panel), ZsGreen fluorescence signal was observed in HeLa but not MLE-15 cells.Attorney Docket No.: JMPG-001WO

[0197] JG17-L2, a linear cleavable switch vector for expressing Luciferase with 95nt SFTPC mRNA sensor arms, was evaluated in vivo using IVIS bioluminescence imaging in mice. JG17-S2, a vector with 95nt scrambled sensor arms, was used as negative control. Female CD-1 mice were intratracheally administered with 10 μg of either RNA vector formulated in in vivo-jetRNA®+ (lipid-based nanoparticle formulation). Whole body IVIS imaging was performed at 24 hrs post-treatment, followed by harvest of major organs. As shown in FIG.9 (left panel and right top panel), JG17-L2 cleavable riboswitch showed significantly decreased expression compared to JG17-S2 scrambled riboswitch control in the target lung, by luminescence imaging. Immunohistochemical staining of the harvested lung tissue was performed, using anti-luciferase HRP antibody staining. As shown in FIG.9 (right bottom panel), reduced browning was observed in the JG17-L2 group, indicative of decreased luciferase expression in the alveoli.

[0198] The cleavable OFF switch was converted to an ON switch (FIG.10A) through the use of dual RNA vectors, where RNA #1 contained the 95nt sensor arms for binding target SFTPC mRNA and a L7Ae repressor gene, and RNA #2 contained 4X K-turn (L7Ae binding site) driving translation of a luciferase gene. In the presence of target SFTPC mRNA, RNA #1 would be cleaved, preventing expression of L7Ae repressor protein, thereby allowing expression of the luciferase gene only in pulmonary alveolar epithelial cells. The dual linear vectors were generated to include the genetic elements in Table 5 above. The cleavable RNA switch was positioned in both the 5’ and the 3’ ends in RNA #1.

[0199] Specifically, RNA #1 vectors of the dual RNA cleavable ON switches were designed with 25 nt target RNA binding sensor arms positioned at either the 5’ and 3’ end of linear vector, to cleave upon binding target SFTPC mRNA present only in pulmonary alveolar epithelial cells. The JG160 vector included one cleavable switch on the 5’ end and one cleavable switch on the 3’ end, whereas the JG161 vector included two cleavable switches on the 5’ end and one cleavable switch on the 3’ end. These linear RNA #1 vectors contained L7Ae repressor gene, which repressed the RNA #2 construct containing 4X K-turn and luciferase gene. The RNA #1 and RNA #2 vectors were transfected to Hela vs. MLE-15 cells at 1:1 or 2:1 molar ratio. As shown in FIG.10B, luciferase assay measurement at 24 hrs post-transfection showed that all ON switches had increased expression in target MLE-15 cells, with top candidates being JG160 / JG157on and 2X-JG160 / JG157on (dashed boxes).Attorney Docket No.: JMPG-001WO Example 2: Circularization Riboswitch Responsive to SFTPC mRNA

[0200] This example describes a riboswitch that turns on expression of a gene in the presence of SFTPC mRNA.

[0201] Briefly, linear RNA vectors were designed to induce expression of ZsGreen reporter in response to SFTPC mRNA, undergoing self-splicing and circularization only in presence of target mRNA, leading to reporter gene expression. The linear vector included the genetic elements in Table 6. The JG5 vector included, from 5’ to 3’, a first target RNA binding sensor arm 50 nt in length, a first self-splicing intron element (a 3’ fragment of a self- splicing intron), a ZsGreen reporter gene, a CVB3 IRES element, a second self-splicing intron element (a 5’ fragment of a self-splicing intron), and a second target RNA binding sensor arm 50 nt in length. Upon circularization, the reporter gene would become downstream of the IRES element via the spliced sequences, thereby to enable translation of the reporter gene. Table 6. Genetic Elements in Linear SFTPC-responsive Reporter Cleavable Vectors Genetic Element Nucleotide Sequence SEQ ID NOAttorney Docket No.: JMPG-001WO

[0202] The RNA vectors were produced from DNA vectors containing corresponding genetic elements, except for the absence of the 5’ cap and the inclusion of a polyadenylation signal in lieu of a polyadenylation tail in the DNA encoding the linear RNA vector. The DNA vectors further included a T7 promoter to drive in vitro transcription in the presence of T7 RNA polymerase. The linear RNA vectors with the circularization switch were produced and purified as described previously using standard mRNA purification techniques.

[0203] Agarose gel analysis of JG5 circularization switch was performed by induced splicing in presence or absence of target mRNA. As shown in FIG.11 (left panel), significant increase in circularization (dashed box) and significant depletion of linear RNA (black arrow) were observed in the presence of target mRNA. As shown in FIG.11 (right panel), circularization efficiency was increased to 44.8% in the presence of target RNA, as compared to 28.5% with non-target RNA. The linear RNA vectors contained ZsGreen fluorescent reporter gene, and were further analyzed for ZsGreen expression by flow cytometric analysis. As shown in FIG.12, significant increase in ZsGreen expression was observed in MLE-15 pulmonary alveolar epithelial cells, compared to the control non- specific HeLa cells, at 24 hrs and 48 hrs post-transfection. Example 3: Anti-Cap Riboswitch Responsive to a Surfactant Protein C (SFTPC) mRNA

[0204] This example describes a riboswitch that turns on expression of a gene in the presence of SFTPC mRNA.

[0205] Briefly, a linear RNA vector called JG30F was designed to induce expression of a ZsGreen reporter in response to SFTPC mRNA, including a tecrRNA that silences the 5’ N7-methylated guanosine cap (the “Cap”) and the adjoining sequence in the 5’ region of the linear RNA. The tecrRNA was flanked by target RNA binding sensor arms to form a tecrRNA switch, positioned at the 3’ end (3’ to the 3’ UTR) of the vector. The linear RNA vector included the genetic elements in Table 7. In the presence of a target SFTPC mRNA, the target RNA binding sensor arms bound the target mRNA, leading to torsional constraint in the tecrRNA. As a result, the tecrRNA was removed from the Cap and the adjoining 5’ sequence, resulting in expression of the reporter gene from the Cap and the adjoining 5’ region.Attorney Docket No.: JMPG-001WO Table 7. Genetic Elements in Linear SFTPC-responsive Reporter Anti-Cap Vector Genetic Element Nucleotide Sequence SEQ ID NO

[0206] This RNA vector was produced from a DNA vector containing corresponding genetic elements, except for the absence of the 5’ cap and the inclusion of a polyadenylation signal in lieu of a polyadenylation tail in the DNA encoding the linear RNA vector. The DNA vector further included a T7 promoter to drive in vitro transcription in the presence of T7 RNA polymerase. The JG30F linear RNA vector was produced and purified as described previously using standard mRNA purification techniques.

[0207] The linear RNA vector was analyzed for ZsGreen expression by flow cytometric analysis. As shown in FIG.13, JG30F showed increased ZsGreen expression in MLE-15 pulmonary alveolar epithelial cells compared to the control Hela cells, at 24 hrs and 48 hrs post-transfection.Attorney Docket No.: JMPG-001WO Example 4: Anti-IRES Riboswitch Responsive to a Surfactant Protein C (SFTPC) mRNA

[0208] This example describes a riboswitch that turns on expression of a gene in the presence of SFTPC mRNA.

[0209] Briefly, circular RNA vectors were designed to induce expression of a ZsGreen reporter gene from a CVB3 IRES element in response to SFTPC mRNA. Specifically, tecrRNAs 15 nt (JG50 and JG51) or 25 nt (JG52 and JG53) in length were designed to silence the domains V region of the CVB3 IRES element responsible for eiF4G binding. Each tecrRNA was flanked by target RNA binding sensor arms that were 25 nt (JG50 and JG52) or 50 nt (JG51 and JG53) in length, to form a tecrRNA switch. The circular RNA vector includes the genetic elements in Table 8, except for those identified in the last four rows. In the presence of a target SFTPC mRNA, the target RNA binding sensor arms bound the target mRNA, leading to torsional constraint in the tecrRNA. As a result, the tecrRNA was removed from the IRES element, resulting in expression of the reporter gene from the IRES element. Table 8. Genetic Elements in Circular SFTPC-responsive Reporter Anti-IRES Vector Genetic Element Nucleotide Sequence SEQ ID NOAttorney Docket No.: JMPG-001WO Genetic Element Nucleotide Sequence SEQ ID NO

[0210] This RNA vector was produced from a DNA vector containing corresponding genetic elements, which further included a first self-binding arm, a first self-splicing intron element, a second self-splicing intron element, and a second self-binding arm, having the sequences set forth in Table 8, to facilitate circularization of the transcribed linear RNA vectors. The DNA vector further included a T7 promoter to drive in vitro transcription in the presence of T7 RNA polymerase. Linear RNA vectors were transcribed from the DNA vectors and circularized and purified as described previously using circRNA purification techniques, including gel purification.

[0211] The circular RNA vectors were analyzed for ZsGreen expression by flow cytometric analysis. As shown in FIG.14, JG50, JG51, JG52, and JG53, which had anti- IRES tecrRNAs ranging from 15-25 nt in length, showed increased ZsGreen expression in MLE-15 pulmonary alveolar epithelial cells, at 24 hr and 48 hr post-transfection. Example 5: Riboswitch Responsive to an Alpha-lactalbumin (LALBA) mRNA

[0212] This example describes a riboswitch that turns on expression of an apoptotic gene in the presence of LALBA mRNA.

[0213] α-Lactalbumin is a whey protein that makes up ~22% of the proteins in human milk. It is confined to the breast during late pregnancy and lactation, as well as expression inAttorney Docket No.: JMPG-001WO majority of human triple negative breast cancers (TNBC). Detection of LALBA mRNA can be used to selectively destroy triple negative breast cancer cells, without unwanted off-target based toxicity and side-effects.

[0214] Briefly, linear and circular RNA vectors that induce expression of Caspase-8 in response to LALBA mRNA are designed, including a torsionally modulated tecrRNA switch. The linear and circular vectors include the genetic elements in Table 9 and Table 10, respectively. In the linear RNA vector format, the tecrRNA sequence targets the 5’ N7- methylated guanosine cap plus adjoining sequence for silencing of the Cap. In the circular RNA vector format, the tecrRNA sequence targets the domains V region of CVB3 IRES element responsible for eiF4G binding, leading to silencing of the IRES. Table 9. Genetic Elements in Linear LALBA-responsive Suicide Vector Genetic Element Nucleotide Sequence SEQ ID NOAttorney Docket No.: JMPG-001WO Genetic Element Nucleotide Sequence SEQ ID NOTable 10. Genetic Elements in Circular LALBA-responsive Suicide Vector Genetic Element Nucleotide Sequence SEQ ID NOAttorney Docket No.: JMPG-001WO Genetic Element Nucleotide Sequence SEQ ID NO[ ] s vec or s pro uce rom a vec or cona n ng correspon ng genetic elements, except for the absence of the 5’ cap and the inclusion of a polyadenylation signal in lieu of a polyadenylation tail in the DNA encoding the linear RNA vector. The DNA vector further includes a promoter and / or an enhancer. For example, a T7 promoter can be used to drive in vitro transcription in the presence of T7 RNA polymerase. Both linear RNA and circRNA versions of the LALBA riboswitch can be developed, and purified as described previously using standard mRNA or circRNA purification techniques.

[0216] The vectors described above are expected to kill triple negative breast cancer cells but not in control cells HEK-293 and HeLa cells. Example 6: Riboswitch Responsive to Non-coding Mitochondrial RNAs

[0217] This example describes a riboswitch that turns on expression of an apoptotic gene in the presence of sense non-coding mitochondrial RNA (ncmtRNA) and in the absence of both antisense ncmtRNA-1 and antisense ncmtRNA-2.

[0218] Differential expression of ncmtRNAs can potentially be used differentiate normal and cancer cells. Sense ncmtRNA is high in normal proliferating and cancer cells. Antisense ncmtRNAs 1 and 2 are low or absent in cancer cells. Detection of the sense ncmtRNA but neither antisense ncmtRNA can be used to selectively kill cancer cells, without unwanted off-target based toxicity and side-effects. This approach is potentially useful in treating a variety of cancers.

[0219] Briefly, linear and circular RNA vectors that induce expression of Caspase-8 in response to ncmtRNAs are designed, including a complex logic gate utilizing a torsionally modulated tecrRNA switch and two cleavable switches. The linear and circular vectors include the genetic elements in Table 11 and Table 12, respectively. In the linear RNA vector format, the two cleavable switches and the anti-5’ Cap tecrRNA are placed directlyAttorney Docket No.: JMPG-001WO after the 3’ UTR. In the circular RNA vector format, the two cleavable switches tecrRNA and the anti-IRES tecrRNA are placed after the apoptosis-inducing gene. Table 11. Genetic Elements in Linear ncmtRNA-responsive Suicide Vector Genetic Element Nucleotide Sequence SEQ ID NOAttorney Docket No.: JMPG-001WO Genetic Element Nucleotide Sequence SEQ ID NO. - p Genetic Element Nucleotide Sequence SEQ ID NOAttorney Docket No.: JMPG-001WO Genetic Element Nucleotide Sequence SEQ ID NOp g p g genetic elements, except for the absence of the 5’ cap and the inclusion of a polyadenylation signal in the DNA encoding the linear RNA vector. The DNA vector further includes a T7 promoter, a Kanamycin resistance gene, and an origin of replication. The RNAs will be produced using in vitro transcription followed by purification using either double cellulose purification or oligo dT / SDVB purification techniques.

[0221] The vectors described above are expected to kill cancer (e.g., TNBC) cells but not primary cells from the same tissue. For example, kill HCC-1937 cancer cells, but not the control HEK-293 or HeLa cells. Example 7: Riboswitch Responsive to regulatory T cell mRNAs

[0222] This example describes a riboswitch that turns on expression of a gene in the presence of CD3, CD4, and Foxp3 mRNAs.

[0223] FOXP3+regulatory T (Treg) cells play a major role in maintaining immune tolerance, with anti-inflammatory and immunosuppressive properties. Transcriptional factor Foxp3 serves as a key lineage specification factor for regulatory T cells. CD3 and CD4 co- receptors are used for identification of T cells. CD3, CD4, and Foxp3 are the definitive markers used here for identification of regulatory T cells.

[0224] Briefly, linear and circular RNA vectors that induce expression of ZsGreen fluorescent reporter gene in response to CD3, CD4, and Foxp3 mRNAs are designed, including a torsionally modulated tecrRNA switch. The linear and circular vectors include the genetic elements in Table 13 and Table 14, respectively. In the linear RNA vector format, the three anti-5’ Cap tecrRNAs are placed directly after the 3’ UTR. In the circular RNA vector format, the three anti-IRES tecrRNAs are placed after the ZsGreen gene.Attorney Docket No.: JMPG-001WO Table 13. Genetic Elements in Linear Treg Cell mRNA-responsive Vector Genetic Element Nucleotide Sequence SEQ ID NOTable 14. Genetic Elements in Circular Treg Cell mRNA-responsive Vector Genetic Element Nucleotide Sequence SEQ ID NAttorney Docket No.: JMPG-001WO Genetic Element Nucleotide Sequence SEQ ID NO

[0225] This RNA vector is produced from a DNA vector containing corresponding genetic elements, except for the absence of the 5’ cap and the inclusion of a polyadenylation signal in lieu of a polyadenylation tail. Both linear RNA and circRNA versions of the regulatory T cell mRNA-responsive riboswitch can be developed, and purified as described previously using standard mRNA or circRNA purification techniques.

[0226] The vectors described above are expected to exhibit ZsGreen expression in CD3+CD4+Foxp3+ Tregs, but not in control CD3+CD4+Foxp3- T cells. The ZsGreen reporter gene is used herein for proof of concept. It is contemplated that the reporting gene can be replaced by therapeutic cargos, such as but not limited to, transcriptions factors for induction of Treg expansion; and chimeric antigen receptors to direct Tregs to the affected areas in autoimmune diseases, chronic inflammatory conditions, stem cell transplantation, and tolerization for organ transplants. Example 8: Riboswitch Responsive to Hematopoietic Stem Cell mRNAs

[0227] This example describes a riboswitch that turns on expression of a gene in the presence of GATA2 and c-Kit mRNAs.Attorney Docket No.: JMPG-001WO

[0228] GATA2 is a master transcription factor essential for hematopoietic stem cell (HSC) generation and survival. It is essential for HSC function and renewal. c-Kit (a.k.a. stem cell factor receptor or CD117) is a receptor tyrosine kinase expressed on HSCs that plays a major role in their proliferation, survival and differentiation. GATA2 and c-Kit are the definitive markers used here for identification of HSCs.

[0229] Briefly, linear and circular RNA vectors that induce expression of ZsGreen fluorescent reporter gene in response to GATA2 and c-kit mRNAs are designed, including a torsionally modulated tecrRNA switch. The linear and circular vectors include the genetic elements in Table 15 and Table 16. In the linear RNA vector format, the two anti-5’ Cap tecrRNAs are placed directly after the 3’ UTR. In the circular RNA vector, format where the two anti-IRES tecrRNAs are placed after the ZsGreen gene. Table 15. Genetic Elements in Linear HSC mRNA-responsive Vector Genetic Element Nucleotide Sequence SEQ ID NOAttorney Docket No.: JMPG-001WO Genetic Element Nucleotide Sequence SEQ ID NOa e . e e c e e s cua -espo s e eco Genetic Element Nucleotide Sequence SEQ ID NO

[0230] This RNA vector is produced from a DNA vector containing corresponding genetic elements, except for the absence of the 5’ cap and the inclusion of a polyadenylation signal in lieu of a polyadenylation tail. Both linear RNA and circRNA versions of the HSC mRNA-responsive riboswitch can be developed, and purified as described previously using standard mRNA or circRNA purification techniques.

[0231] The vectors described above are expected to exhibit ZsGreen expression in GATA2+c-Kit+ HSCs, but not in control HEK-293 or HeLa cells. The ZsGreen reporterAttorney Docket No.: JMPG-001WO gene is used herein for proof of concept. It is contemplated that the reporting gene can be replaced by therapeutic cargos, such as but not limited to, genomic editing tools such as CRISPR / Cas9 system for HSC-specific genomic editing for treatment of monogenic inherited disorders; targeted HSC expansion or ablation; or synthetic receptors to redirect HSCs to injured and / or inflamed areas. INCORPORATION BY REFERENCE

[0232] The entire disclosure of each of the patent documents and scientific articles referred to herein is incorporated by reference for all purposes. EQUIVALENTS

[0233] The disclosure may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting the disclosure described herein. Various structural elements of the different embodiments and various disclosed method steps may be utilized in various combinations and permutations, and all such variants are to be considered forms of the disclosure. The scope of the disclosure is thus indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.

Claims

Attorney Docket No.: JMPG-001WO WHAT IS CLAIMED IS:

1. A cleavable RNA switch responsive to a target RNA, the cleavable RNA switch comprising, from 5’ to 3’: (a) a first target RNA binding sequence complementary to a first target RNA sequence of the target RNA; (b) a hammerhead ribozyme left (HHR-L) arm; (c) a loop forming region comprising a hammerhead ribozyme cleavage site comprising the nucleotide sequence of GUC; (d) a hammerhead ribozyme right (HHR-R) arm; (e) a second target RNA binding sequence complementary to a second target RNA sequence of the target RNA, wherein: in the presence of the target RNA, the HHR-L arm and the HHR-R arm together form a hammerhead ribozyme and the loop forming region forms a loop that is cleaved by the hammerhead ribozyme, and in the absence of the target RNA, the HHR-L arm and the HHR-R arm do not form a hammerhead ribozyme and the loop forming region is not cleaved.

2. The cleavable RNA switch of claim 1, wherein the HHR-L arm comprises a nucleotide sequence at least 80% identical to SEQ ID NO: 74, and the HHR-R arm comprises a nucleotide sequence at least 80% identical to SEQ ID NO:

75.

3. The cleavable RNA switch of claim 2, wherein parts (b), (c), and (d) together comprise a nucleotide sequence at least 80% identical to SEQ ID NO:

26.

4. The cleavable RNA switch of claim 1, wherein the HHR-L arm comprises a nucleotide sequence at least 80% identical to SEQ ID NO: 76, and the HHR-R arm comprises a nucleotide sequence at least 80% identical to SEQ ID NO:

77.

5. The cleavable RNA switch of claim 4, wherein parts (b), (c), and (d) together comprise a nucleotide sequence at least 80% identical to SEQ ID NO:

63.

6. The cleavable RNA switch of any one of claims 1-5, wherein the first target RNA sequence is adjacent to the second target RNA sequence.Attorney Docket No.: JMPG-001WO 7. The cleavable RNA switch of any one of claims 1-6, wherein the first target RNA sequence is positioned 3’ to the second target RNA sequence in the target RNA.

8. The cleavable RNA switch of any one of claims 1-7, wherein the first target RNA binding sequence and the second target RNA binding sequence are each 20 to 100 nucleotides in length.

9. The cleavable RNA switch of claim 8, wherein the first target RNA binding sequence and the second target RNA binding sequence are each 50 to 100 nucleotides in length.

10. The cleavable RNA switch of claim 8 or 9, wherein the first target RNA binding sequence and the second target RNA binding sequence are each 80 to 100 nucleotides in length.

11. The cleavable RNA switch of any one of claims 1-10, wherein the target RNA is an mRNA.

12. The cleavable RNA switch of any one of claims 1-10, wherein the target RNA is a non-coding RNA.

13. The cleavable RNA switch of claim 12, wherein the non-coding RNA is an miRNA.

14. An RNA vector for expressing a protein of interest, the RNA vector comprising a translation initiation element, a gene encoding the protein of interest, and the cleavable RNA switch of any one of claims 1-13, wherein: in the presence of the target RNA, cleavage of the loop permits degradation of the RNA vector, and in the absence of the target RNA, the RNA vector is not degraded as a result of cleavage of the loop and is translated to produce the protein of interest.

15. The RNA vector of claim 14, wherein the protein of interest suppresses expression of a downstream gene of interest, such that: in the presence of the target RNA, the downstream gene of interest is expressed, and in the absence of the target RNA, expression of the downstream gene of interest is suppressed by the protein of interest.Attorney Docket No.: JMPG-001WO 16. The RNA vector of claim 15, wherein the protein of interest suppresses translation of the downstream gene of interest.

17. The RNA vector of any one of claims 14-16, wherein the RNA vector is a linear RNA vector that further comprises a 5’ N7-methylated guanosine cap, a 5’ UTR positioned 5’ to the gene, a 3’ UTR positioned 3’ to the gene, and a polyadenylation tail.

18. The linear RNA vector of claim 17, wherein the cleavable RNA switch is positioned between the 5’ UTR and the gene.

19. The linear RNA vector of claim 18, further comprising an additional cleavable RNA switch according to any one of claims 1-13 positioned between the 3’ UTR and the polyadenylation tail.

20. The RNA vector of any one of claims 14-16, wherein the RNA vector is a circular RNA vector that further comprises an IRES operably linked to the gene of interest.

21. A linear RNA vector capable of circularization responsive to a target RNA, which when circularized can express a protein of interest, the linear RNA vector comprising, from 5’ to 3’: (a) a first target RNA binding sequence complementary to a first target RNA sequence of the target RNA; (b) a 3’ fragment of a self-splicing intron; (c) a gene encoding the protein of interest having a 5’ end; (d) a unidirectional IRES having a 3’ end; (e) a 5’ fragment of the self-splicing intron; and (f) a second target RNA binding sequence complementary to a second target RNA sequence of the target RNA; wherein: in the presence of the target RNA, elements (b) and (e) form an active ribozyme that splices the 5’ end of the gene to the 3’ end of the unidirectional IRES, thereby to form a circular RNA, permitting translation of the protein of interest from the IRES; and in the absence of the target RNA, the protein of interest is not translated from the IRES.Attorney Docket No.: JMPG-001WO 22. The linear RNA vector of claim 21, wherein the self-splicing intron is a Group I self- splicing intron comprising, from 5’ to 3’, a 5’ splice site adjacent to a P1 sequence 5’ to the Group I self-splicing intron, an IGS, a P2 helix, a P3 helix, a P4 helix, a P5 helix, a P6 helix, a P7 helix, a P8 helix, a P9 helix, and a 3’ splice site adjacent to a P10 sequence 3’ to the Group I self-splicing intron.

23. The linear RNA vector of claim 22, wherein the 5’ fragment of the Group I self- splicing intron comprises the 5’ splice site, the IGS, the P2 helix, the P3 helix, the P4 helix, the P5 helix, and a 5’ portion of the P6 helix; and the 3’ fragment of the Group I self-splicing intron comprises a 3’ portion of the P6 helix, the P7 helix, the P8 helix, the P9 helix, and the 3’ splice site.

24. The linear RNA vector of claim 22, wherein the 5’ fragment of the Group I self- splicing intron comprises the 5’ splice site; and the 3’ fragment of the Group I self-splicing intron comprises the IGS, the P2 helix, the P3 helix, the P4 helix, the P5 helix, the P6 helix, the P7 helix, the P8 helix, the P9 helix, and the 3’ splice site.

25. The linear RNA vector of claim 21, wherein the self-splicing intron is a Group II self- splicing intron.

26. The linear RNA vector of claim 25, wherein the 5’ fragment of the Group II self- splicing intron comprises the 5’ splice site, the Domain 1, the Domain 2, and the Domain 3, and a 5’ portion of the Domain 4; and the 3’ fragment of the Group II self-splicing intron comprises a 3’ portion of the Domain 4, the Domain 5, the Domain 6, and the 3’ splice site.

27. The linear RNA vector of any one of claims 21-26, wherein the first target RNA sequence is adjacent to the second target RNA sequence.

28. The linear RNA vector of any one of claims 21-27, wherein the first target RNA sequence is positioned 3’ to the second target RNA sequence in the target RNA.

29. The linear RNA vector of any one of claims 21-28, wherein the first target RNA binding sequence and the second target RNA binding sequence are each 20 to 100 nucleotides in length.

30. The linear RNA vector of any one of claims 21-29, wherein the target RNA is an mRNA.Attorney Docket No.: JMPG-001WO 31. The linear RNA vector of any one of claims 21-29, wherein the target RNA is a non- coding RNA.

32. The linear RNA vector of claim 31, wherein the non-coding RNA is an miRNA.

33. The linear RNA vector of any one of claims 21-32, further comprising a polyadenylation tail.

34. The linear RNA vector of any one of claims 21-33, wherein the linear RNA vector does not comprise a 5’ N7-methylated guanosine cap.

35. A translation initiation element cis-repressive RNA (tecrRNA) switch responsive to a target RNA, the tecrRNA switch comprising, from 5’ to 3’: (a) a first target RNA binding sequence complementary to a first target RNA sequence of the target RNA; (b) a tecrRNA capable of binding and suppressing a translation initiation element; and (c) a second target RNA binding sequence complementary to a second target RNA sequence of the target RNA, wherein: in the absence of the target RNA, the tecrRNA binds the translation initiation element and suppresses its activity, and in the presence of the target RNA, the tecrRNA becomes torsionally constrained and unable to bind the translation initiation element.

36. The tecrRNA switch of claim 35, wherein the first target RNA sequence is adjacent to the second target RNA sequence.

37. The tecrRNA switch of claim 35 or 36, wherein the first target RNA sequence is positioned 5’ to the second target RNA sequence in the target RNA.

38. The tecrRNA switch of any one of claims 35-37, wherein the first target RNA binding sequence and the second target RNA binding sequence are each 20 to 100 nucleotides in length.

39. The tecrRNA switch of any one of claims 35-38, wherein the target RNA is a messenger RNA (mRNA).Attorney Docket No.: JMPG-001WO 40. The tecrRNA switch of any one of claims 35-38, wherein the target RNA is a non- coding RNA.

41. The tecrRNA switch of claim 40, wherein the non-coding RNA is a microRNA (miRNA).

42. The tecrRNA switch of any one of claims 35-41, wherein the tecrRNA is 5 to 100 nucleotides in length.

43. The tecrRNA switch of any one of claims 35-42, wherein the translation initiation element comprises a 5’ N7-methylated guanosine cap.

44. A linear RNA vector for expressing a protein of interest, the RNA vector comprising a 5’ N7-methylated guanosine cap, the tecrRNA switch of claim 43, and a gene encoding the protein of interest, wherein the tecrRNA comprises a nucleotide sequence complementary to a 5’ region of the linear RNA vector, wherein: in the absence of the target RNA, the tecrRNA suppresses translation of the protein of interest from the 5’ N7-methylated guanosine cap, and in the presence of the target RNA, the protein of interest is translated from the 5’ N7- methylated guanosine cap.

45. The linear RNA vector of claim 44, further comprising a 5’ untranslated region (5’ UTR) positioned 5’ to the gene, a 3’ untranslated region (3’ UTR) positioned 3’ to the gene, and a polyadenylation tail.

46. The linear RNA vector of claim 45, wherein the tecrRNA switch is positioned 3’ to the 3’ UTR.

47. The linear RNA vector of claim 46, wherein the 5’ region of the linear RNA vector complementary to the tecrRNA comprises a 5’ portion of the 5’ UTR.

48. The linear RNA vector of claim 47, wherein the 5’ portion of the 5’ UTR is 20 to 60 nucleotides in length.Attorney Docket No.: JMPG-001WO 49. The linear RNA vector of claim 47 or 48, wherein the 5’ portion of the 5’ UTR comprises a nucleotide sequence at least 80% identical to SEQ ID NO: 69, and the tecrRNA comprises a complementary sequence and one or more additional nucleotides 3’ thereto.

50. The linear RNA vector of any one of claims 44-49, wherein the first target RNA binding sequence and the second target RNA binding sequence are each 60 to 100 nucleotides in length.

51. The tecrRNA switch of any one of claims 35-42, wherein the translation initiation element comprises an internal ribosome entry site (IRES).

52. The tecrRNA switch of claim 51, wherein the tecrRNA is 10 to 30 nucleotides in length.

53. The tecrRNA switch of claim 52, wherein the tecrRNA is 15 to 20 nucleotides in length.

54. The tecrRNA switch of any one of claims 51-53, wherein the first target RNA binding sequence and the second target RNA binding sequence are each 20 to 60 nucleotides in length.

55. An RNA vector for expressing a protein of interest, the RNA vector comprising the tecrRNA switch of claim 51, an IRES that the tecrRNA is capable of binding and suppressing, and a gene encoding the protein of interest operably linked to the IRES, wherein the tecrRNA comprises a nucleotide sequence complementary to a nucleotide sequence in the IRES, wherein: in the absence of the target RNA, the tecrRNA suppresses translation of the protein of interest from the IRES, and in the presence of the target RNA, the protein of interest is translated from the IRES.

56. The RNA vector of claim 55, wherein the RNA vector is a circular RNA vector.

57. The RNA vector of claim 55, wherein the RNA vector is a linear RNA vector.

58. An RNA vector for expressing a protein of interest, the RNA vector comprising a translation initiation element, a gene encoding the protein of interest, a first tecrRNA switchAttorney Docket No.: JMPG-001WO of any one of claims 35-42 responsive to a first target RNA, and a second tecrRNA switch of any one of claims 35-42 responsive to a second, different target RNA, wherein: the tecrRNA in the first tecrRNA switch and the tecrRNA in the second tecrRNA switch are each capable of binding and suppressing the translation initiation element, in the absence of the first target RNA, the tecrRNA in the first tecrRNA switch binds the translation initiation element and suppresses translation of the protein of interest, in the absence of the second target RNA, the tecrRNA in the second tecrRNA switch binds the translation initiation element and suppresses translation of the protein of interest, and in the presence of both the first target RNA and the second target RNA, the tecrRNA in the first tecrRNA switch and the tecrRNA in the second tecrRNA switch both become torsionally constrained and unable to bind the translation initiation element, thereby permitting translation of the protein of interest from the translation initiation element.

59. An RNA vector for expressing a protein of interest, the RNA vector comprising a first translation initiation element operably linked to a first gene encoding the protein of interest, a second translation initiation element operably linked to a second gene encoding the protein of interest, a first tecrRNA switch of any one of claims 35-42 responsive to a first target RNA, and a second tecrRNA switch of any one of claims 35-42 responsive to a second, different target RNA, wherein: the tecrRNA in the first tecrRNA switch is capable of binding and suppressing the first translation initiation element, and the tecrRNA in the second tecrRNA switch is capable of binding and suppressing the second translation initiation element, in the absence of both the first target RNA and the second target RNA, the tecrRNA in the first tecrRNA switch binds and suppresses the first translation initiation element, and the tecrRNA in the second tecrRNA switch binds and suppresses the second translation initiation element, thereby suppressing translation of the protein of interest from either translation initiation element, in the presence of the first target RNA, the tecrRNA in the first tecrRNA switch becomes torsionally constrained and unable to bind the first translation initiation element, thereby permitting translation of the protein of interest from the first translation initiation element, and in the presence of the second target RNA, the tecrRNA in the second tecrRNA switch becomes torsionally constrained and unable to bind the second translation initiation element,Attorney Docket No.: JMPG-001WO thereby permitting translation of the protein of interest from the second translation initiation element.

60. An RNA vector for expressing a protein of interest, the RNA vector comprising a translation initiation element, a gene encoding the protein of interest, a tecrRNA switch of any one of claims 35-42 responsive to a first target RNA, and a cleavable RNA switch of any one of claims 1-13 responsive to a second, different target RNA, wherein: the tecrRNA in the tecrRNA switch is capable of binding and suppressing the translation initiation element, in the presence of the second target RNA, cleavage of the loop in the cleavable RNA switch permits degradation of the RNA vector, in the absence of the second target RNA and in the absence of the first target RNA, the tecrRNA in the tecrRNA switch binds the translation initiation element and suppresses translation of the protein of interest, and in the absence of the second target RNA but in the presence of the first target RNA, the tecrRNA in the tecrRNA switch becomes torsionally constrained and unable to bind the translation initiation element, thereby permitting translation of the protein of interest from the translation initiation element.

61. An RNA vector for expressing a protein of interest, the RNA vector comprising a translation initiation element, a gene encoding the protein of interest, a first cleavable RNA switch of any one of claims 1-13 responsive to a first target RNA, a second cleavable RNA switch of any one of claims 1-13 responsive to a second, different target RNA, and a tecrRNA switch of any one of claims 35-42 responsive to a third, different target RNA, wherein: the tecrRNA in the tecrRNA switch is capable of binding and suppressing the translation initiation element, in the presence of either the first target RNA or the second target RNA, cleavage of the loop in the respective cleavable RNA switch permits degradation of the RNA vector, in the presence of neither the first target RNA nor the second target RNA, and in the absence of the third target RNA, the tecrRNA in the tecrRNA switch binds the translation initiation element and suppresses translation of the protein of interest, and in the presence of neither the first target RNA nor the second target RNA, but in the presence of the third target RNA, the tecrRNA in the tecrRNA switch becomes torsionallyAttorney Docket No.: JMPG-001WO constrained and unable to bind the translation initiation element, thereby permitting translation of the protein of interest from the translation initiation element.

62. A DNA vector encoding the RNA vector of any one of claims 14-19, 21-34, 44-47, 55, and 57-61, wherein the RNA vector is a linear RNA vector.

63. A method of producing a linear RNA vector, the method comprising contacting a producer cell with the DNA vector of claim 62 under conditions to transcribe the RNA vector.

64. A precursor RNA of the RNA vector of any one of claims 14-20, 55-56, and 58-61, wherein the RNA vector is a circular RNA vector.

65. A DNA vector encoding the precursor RNA of claim 64.

66. A method of producing a circular RNA vector, the method comprising contacting a producer cell with the DNA vector of claim 65 under conditions to transcribe and circularize the precursor RNA.

67. A host cell comprising the RNA vector of any one of claims 14-34, 44-47, and 55-61 or the DNA vector of claim 62 or 65.

Images