Conditional splicing system for tight control of viral overlapping genes

Abstract

Provided is a novel conditional splicing strategy to precisely control the expression of overlapping genes through recombinase-mediated conditional splicing. A site-specific recombinase(SSR) conditional splicing system is refined. The system has exceptional inducibility(116,700-fold increase) with negligible background expression, facilitating the conditional expression of overlapping genes in adenovirus-associated virus(AAV) and human immunodeficiency virus type 1(HIV-1). This approach can establish a stable AAV producer cell lines, encapsulating all necessary packaging genes.

Description

CONDITIONAL SPLICING SYSTEM FOR TIGHT CONTROL OF VIRAL OVERLAPPING GENESField of the Invention:

[0001] The present invention relates genetic engineering technology regarding viral vectors. More specifically, the present invention relates to an improved by refined site-specific recombinase conditional splicing system to genetic engineer viral vectors with high splicing efficiency to facilitate conditional overlapping gene expression and stable cell line establishment.Background:

[0002] Overlapping genes, defined by their shared nucleotides across two or more coding sequences, are prevalent in both viral and eukaryotic genomes [1] . Studies suggest that approximately 26%of human protein-coding genes and over half of viruses feature overlapping genes [2-4] . Historically understudied, the significance of these genes is now being rigorously explored due to their potential in vaccine and viral vector development [5-8] . However, the intrinsic complexity of overlapping genes introduces challenges, particularly in their application to gene therapy and vaccine production.

[0003] One primary challenge is the potential cytotoxicity of overlapping genes, which complicates the development of stable packaging cell lines. Traditional methods, such as incorporating these genes into viral vectors or plasmid transfection, are limited by reduced vector capacity, compromised genome stability, and possible immune responses against the gene products [9] . These limitations not only impact the efficacy of gene therapies and vaccines but also escalate production costs, especially for vectors like adenovirus-associated virus (AAV) and lentivirus [10-12] .

[0004] Current gene regulation systems, heavily reliant on engineered inducible promoters, fall short in managing overlapping genes due to the difficulty in integrating additional regulatory elements within their coding sequences. While RNA riboswitches and site-specific recombinase (SSR) systems present alternative solutions, they have their drawbacks. RNA riboswitches, though innovative, tend to exhibit leaky expression 13-15, undermining their regulatory precision. The SSR systems, notably the "loxP-stop-loxP" strategy introduced in the early 1990s [13-15] , utilize artificial intron harboring a stop cassette to block gene expression, which is lifted by recombinase action to restore gene function. Despite its promise, this system's efficiency is compromised by limitations such as ineffective transcription termination and potential for DNA recombination [16, 17] , as observed in strategies like the "dual splicing switch" [18, 19] . The present invention addresses this need.Summary of the Invention:

[0005] Addressing these shortcomings, the present invention introduces a refined approach to regulate overlapping genes using SSR-mediated conditional splicing. This method significantly reduces leaky expression compared to existing SSR strategies and allows for precise control over the expression of multiple overlapping genes. By tackling the inherent challenges of overlapping gene regulation, this novel strategy aims to enhance the development and scalability of gene therapies and vaccine production, marking a significant advancement in the field.

[0006] The disclosure herein provided an artificial intron comprising the following elements:

[0007] i) a splicing donor SD and two splicing acceptors SA1 and SA2; ii) an SV40 poly A sequence; and iii) a first and a second recombination site located in the same orientation at both ends of the artificial intron;

[0008] In another embodiment, the artificial intron further comprises a retroviral TAR sequence.

[0009] In some embodiments, the retroviral TAR sequence is derived from HIV-1. Optionally, the retroviral TAR comprises a nucleic sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%sequence identity to SEQ ID NO: 1.

[0010] In some embodiments, the SV40 poly A is derived from the transcription termination sequence of the SV40 virus genome. Optionally, the SV40 poly A comprises a nucleic sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%sequence identity to SEQ ID NO: 2.

[0011] In some embodiments, the artificial intron is derived from a natural or chimeric intron comprising the splicing donor SD and the splicing acceptor SA2. Optionally, the natural or chimeric intron comprises a conserved intron motif of GURAGN…YNYURAY (Y) NYAG; wherein GURAGN represents the splicing donor SD, YNYURAY (Y) NYAG represents the splicing acceptor SA2; wherein R is A or G; N is selected from A, G, C, or U; Y is C or U; (Y) N represents polypyrimidine tract.

[0012] In a specific embodiment, the natural or chimeric intron comprises a nucleic sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%sequence identity to SEQ ID NO: 7.

[0013] In some embodiments, the splicing acceptor SA1 and the splicing acceptor SA2 are derived from the same natural or chimeric intron. Optionally, the splicing acceptor SA1 comprises a nucleic sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%sequence identity to SEQ ID NO: 3.

[0014] In a specific embodiment, the artificial intron comprises from 5’ to 3’ direction:

[0015] 5’ -SD-first recombination site-SV40 ploy A-SA1-second recombination site-SA2-3’ ; or 5’ -SD-first recombination site-SV40 ploy A-SA1-TAR-second recombination site-SA2-3’ . Optionally, the artificial intron comprises a nucleic sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%sequence identity to SEQ ID NO: 4 or SEQ ID NO: 5.

[0016] The disclosure herein also provided an expression cassette comprising:

[0017] a nucleic acid sequence encoding a target gene comprising any one of the above-mentioned artificial introns; wherein the target gene expression is silenced in the absence of site-specific recombinase and activated in the presence of the site-specific recombinase.

[0018] In some embodiments, the first and second recombination sites are loxP sites or a derivative, analog, or homologue thereof, and the site-specific recombinase is Cre recombinase.

[0019] In some embodiments, the target gene is an overlapping gene and / or a viral gene. In some preferable embodiments, the target gene is selected from Gluc, AAV rep, AAV cap, or HIV genes.

[0020] The disclosure herein described a vector comprising any one of the above-mentioned expression cassettes.

[0021] In some embodiments, the vector is a viral vector or non-viral vector.

[0022] In some preferable embodiments, the viral vector is selected from a retroviral vector, an adeno-associated viral (AAV) vector, and a lentiviral vector. In one embodiment, the viral vector is an adeno-associated viral (AAV) vector.

[0023] In another preferable embodiment, the non-viral vector is a plasmid.

[0024] The disclosure herein also provided a cell comprising any one of the above-mentioned expression cassettes or vectors.

[0025] In some embodiments, the target gene is a viral gene, and the cell comprises a genome of the virus. In one embodiment, the genome of the virus is AAV viral genome.

[0026] In some embodiments, the cell further comprises a nucleic acid sequence encoding the site-specific recombinase. Preferably, the expression of the site-specific recombinase is controlled by an inducible expression system.

[0027] In some embodiments, the inducible expression system is a Tet-on inducible expression system comprising a TRE promoter, an inducing agent, and a reverse tetracycline controlled transactivator (rtTA) . Optionally, the inducing agent is selected from Doxycycline (DOX) , tetracycline (TCN) , or an analog thereof; and / or the reverse tetracycline controlled transactivator is Tet3G protein.

[0028] In some embodiments, the cell is selected from HEK293T, HEK293F, or HeLa cells.

[0029] In a preferable embodiment, the nucleic acid sequence encoding the site-specific recombinase and the expression cassette are on the same vector.

[0030] In some embodiments, the cell is stably transformed with any one of the above-mentioned vectors.

[0031] The disclosure herein also provided an improved site-specific recombinase conditional splicing system for precisely controlling the expression of overlapping genes in viral vectors comprising a synthetic intron enhanced with intronic splicing enhancers is provided, wherein the splicing efficiency of the system is at least 99%, and the system has an inducibility increased by at least 100, 000-fold.

[0032] In an embodiment, the intron of the improved site-specific recombinase conditional splicing system comprises a single SV40 poly A sequence.

[0033] In a further embodiment, the intron of the improved site-specific recombinase conditional splicing system comprises a splicing acceptor SA1.

[0034] In a yet further embodiment, the intron of the improved site-specific recombinase conditional splicing system comprises a single HIV TAR sequence.Brief Description of the Drawings

[0035] FIG. 1: Development and validation of a conditional splicing intron for gene regulation. (A) Illustration of a synthetic intron engineered with various regulatory elements. This intron includes an SV40 poly A sequence, the HIV TAR sequence, and a splicing trap sequence. The diagram identifies the locations of primers "F" , "R1" , and "R2" used in RT-PCR to verify spliced RNA products. Alternative splicing acceptor sites within the PS and PST introns are marked as “SA1” and “SA2. ” (B) Assessment of introns engineered for conditional expression of the reporter gene Gluc. Equal quantities of plasmids were transfected independently or in combination with a Cre overexpression plasmid into HEK293T cells, and the secretion of Gluc into the cell culture medium was measured 48 hours later. (C) Quantitative analysis of RNA splicing. The proportion of spliced versus unspliced RNA products was determined through RT-qPCR, targeting the regions spanning the splice donor site or the reconstituted region post-splicing. Labels “SD-SA1” and “SD-SA2 splice” refer to mRNA spliced at SA1 or SA2, respectively. (D) Gel electrophoresis analysis of RNA from PS and PST introns. Following total RNA extraction and cDNA synthesis, PCR was conducted over 25 or 30 thermal cycles to amplify either unspliced RNA or the SD-SA2 spliced product using primer pairs “F+R1” or “F+R2” . (E) Schematic overview of RNA splicing across four introns, with numerical annotations indicating the expected PCR product sizes.

[0036] FIG. 2: Examining the cis-acting effect of HIV TAR on RNA splicing. (Aand B) Detailed examination of the proportion and quantification of SD-SA2 spliced mRNA products. RT-qPCR utilized a primer pair specific to the reconstituted region post-splicing between SD and SA2. (C) Diagrammatic representation of Gluc reporter genes featuring TAR in either the sense (TAR intron) or complementary strand (R-TAR intron) . (D) Assessment of Gluc expression from plasmids embedded with TAR or R-TAR introns. (E-F) Quantitative analysis of spliced RNA products from TAR and R-TAR introns, with primer pairs targeting the intron region or encoding region. Data represent mean ± SD from three biological replicates, analyzed via unpaired t-tests. (G) Sanger sequencing analysis of RNA splicing within the PST intron, following transfection of HEK293T cells with the Gluc-PST plasmid, with or without pcDNA4-Cre.

[0037] FIG. 3: Conditional expression of AAV2 Cap and HIV genes through conditional splicing. (A) Structural depiction of the AAV2 cap gene, which employs two alternative splicing sites to produce a minimum of five proteins. The PST intron was inserted into specified VPi-1 to VPi-3 sites. Three His tags were inserted into different coding frames to label different proteins simultaneously. (B) RNA splicing analysis for VPi-1A, involving co-transfection in HEK293T cells with various helper plasmids and pcDNA4-Cre, followed by Sanger sequencing to determine the RNA splicing pattern. (C) Western blot assessment of Cap protein expression from VPi-1A and VPi-1B plasmids, with a positive control (PC without PST intron) included for comparison. Detection was performed using anti-His antibody. (D) Quantification of DNase I-resistant particles from VPi-1 to VPi-3 plasmids, co-transfected with helper and pAAV vectors, analyzed by qPCR. The gray columns are negative control (no AAV2 plasmid) and the blue columns are VPi plasmids in the absence of Cre co-expression. (E) Overview of the HIV genome's splicing pattern, facilitating the production of over ten viral proteins via alternative splicing. (F) Conditional HIV protein expression analysis via Western blot by comparing plasmid HIVLAI. 2 and HIVLAI. 2-PST, with serum from chronically infected HIV patients serving as the primary antibody.

[0038] FIG. 4: Conditional expression of AAV Rep through conditional splicing. (A) Gene map of AAV rep, with NPST1 to PST8 indicating PST intron insertion sites. (B) Western blot analysis of AAV Rep expression, following transfection of HEK293T cells with pcDNA4-Cre and / or NPST plasmids. (C) Conditional AAV particle production measured post-transfection of NPST plasmids, phelper, and pAAV vectors, with or without pcDNA4-Cre. (D) Induction of AAV2 production via doxycycline in cells transfected with NPST-4, pHelper, pAAV, and a Cre-inducible plasmid, demonstrating the system's inducibility and effectiveness.

[0039] FIG. 5: Establishing inducible AAV packaging cell lines with complete packaging genes. (A) Design of the HCN2 shuttle plasmid for inducible AAV packaging cells, featuring regulatory proteins, selection markers, and the PST-inserted gene cassette. (B-D) Evaluation of AAV replication induced by Dox in HEK293T-HCN2 cells, comparison of AAV yields at different cell passages, and analysis of AAV production efficiency in HEK293F-derived packaging cells. (E) GFP expression assessment across various AAV packaging cell lines at the 18th passage via flow cytometry, highlighting the system's stable expression capabilities.

[0040] FIG. 6: Conceptual framework of the conditional splicing system for overlapping genes. (A) Basic architecture of the conditional splicing system, incorporating artificial introns with recombinase recognition sites to facilitate precise gene regulation. (B) Depiction of a small molecule-inducible regulatory system for overlapping genes, leveraging conditional splicing and Tet-ON inducible mechanisms to control gene expression dynamically, exemplified by the induction of Cre recombinase with doxycycline. The black lines represent the condition without Dox, while the dashed lines represent the condition treated with Dox.

[0041] FIG. 7: Design characterization of synthetic intron with poly A trap sequences. (A) Schematic representation of the designed synthetic introns, containing intronic splicing enhancer (ISE) elements, SV40 poly A sequences flanked by loxP sites. (B) Luminescence of Gluc expressed from reporter plasmids was used to compare the splicing efficiency of introns with ISE. (C) Quantitative PCR (qPCR) was performed to detect the splicing efficiency. The unspliced form of Gluc mRNA was detected using primers binding to the flank sequences of the splice acceptor. (D) Assessment of the position effect of synthetic introns. Gluc reporter plasmids were inserted with the synthetic intron at 200 nt, 322 nt, and 406 nt of the Gluc coding region.

[0042] FIG. 8: Assessment of splicing intron using poly A stop cassette. (A) Representation of poly A stop cassette. The cassette contains either one or three SV40 poly A sequences to assess transcription termination efficiency. (B) Quantitative PCR (qPCR) detection of successfully transcribed RNA using primers binding to the 3’ Gluc region. (C) Analysis of transcription termination efficiency of the poly A stop cassette at the protein expression level. The same amount of reporter plasmids was transfected into HEK293T cells, and secreted Gluc reporter protein was detected at 48 hours post-transfection. The labels "No poly A" , "1x poly A" , and "3x poly A" indicate the presence of 0, 1, or 3 SV40 poly A sequences, respectively.Detailed Description

[0043] DEFINITIONS

[0044] The term "intron" is broadly defined as a sequence of nucleotides, typically in an expressed sequence of a gene, that is removable by RNA splicing. “RNA splicing” means the excision of an intron from a pre-mRNA to form a mature mRNA. Insertion of DNA containing (encoding) an intron into an expressed sequence can be accomplished by any method known in the art.

[0045] As used herein, “artificial intron” and “synthetic intron” can be used interchangeably. The term “artificial intron” or “synthetic intron” is a synthetically designed non-coding sequence that is inserted into a target gene to mimic the properties of a natural intron, including the ability to be spliced out during RNA processing.

[0046] The “natural or chimeric intron” usually comprises a splicing donor at the 5’ end and a splicing acceptor at the 3’ end. In some embodiments, the “natural or chimeric intron” comprises a conserved intron motif of GURAGN…YNYURAY (Y) NYAG

[0033] ; wherein GURAGN represents the splicing donor, YNYURAY (Y) NYAG represents the splicing acceptor; wherein R is A or G; N is selected from A, G, C, or U; Y is C or U; (Y) N represents polypyrimidine tract. In some embodiments, the “natural or chimeric intron” can be a chimeric intron from human β-globin and immunoglobulin heavy chain genes, with the following sequence:

[0047]

[0048] In some embodiments, the artificial intron used herein may comprise the following structure:

[0049] 5’ -SD-first recombination site-SV40 ploy A-SA1-second recombination site-SA2-3’ ; or 5’ -SD-first recombination site-SV40 ploy A-SA1-TAR-second recombination site-SA2-3’ .

[0050] Where the element "SV40 Poly A" is the polyadenylation signal derived from the transcription termination sequence of the SV40 virus genome, which is used to ensure proper termination and polyadenylation of the 3'end of mRNA transcripts in eukaryotic expression systems.

[0051] Where the element "TAR" (Trans-Activation Response element) is an RNA sequence found in the HIV-1 genome that is essential for the trans-activation of viral transcription by the Tat protein, forming a stem-loop structure that interacts with Tat and other cellular factors.

[0052] Where the element splicing donor (SD) refers to a conserved sequence at the 5'end of an intron, typically characterized by the ‘GU’ dinucleotide (such as GURAGN) , which is recognized by the spliceosome to initiate the splicing reaction.

[0053] Where the elements “SA1” and “SA2” are the splicing acceptors. The splicing acceptor (SA) refers to a conserved sequence at the 3'end of an intron, typically characterized by the ‘AG’ dinucleotide (such as YNYURAY (Y) NYAG) , which is recognized by the spliceosome to conduct the splicing. The SA1 and SA2 herein can be derived from the same gene.

[0054] Where the element “recombination site” is a nucleotide sequence that permits disruption of the transcription termination sequence by a recombination event when a site-specific recombinase is provided. Non-limiting examples of recombination sites are loxP and FRT. The recombination sites are inserted into the intron flanking a transcription termination sequence, or a portion thereof, to be excised by a recombination event. The target gene is activated by the addition of a site-specific recombinase (Cre or FLP in the case of loxP and FRT, respectively) .

[0055] A number of methods are known in the art for introducing the site-specific recombinase into a cell containing the target gene. In an exemplary method, a nucleic acid containing a gene encoding a recombinase is transferred into the cell. Any gene transfer method is applicable, such as, without limitation, viral-mediated (for example, Adenovirus-mediated transduction) or non-viral-mediated (liposome, Calcium phosphate-mediated, electroporation, etc. ) gene transfer methods.

[0056] The target gene containing the artificial intron may be constructed or obtained by any manner. As described below, as with any cloning process, various combinations of restriction digestions, ligations, selective PCR amplifications, and other nucleic acid manipulations, as are well known to those of skill in the field of the present invention, may be employed to prepare a desired nucleic acid construct.

[0057] The term “silence gene expression” refers to the suppression or reduction of the transcriptional or translational activity of a specific target gene, thereby diminishing or abolishing the production of its functional protein product.

[0058] The term a “vector” refers to any vehicle for the cloning of and / or transfer of a nucleic acid molecule or expression cassette comprising the nucleic acid molecule into a host cell, for example for expressing the nucleic acid molecule. A vector can be a replicon to which another nucleic acid segment can be attached so as to bring about the replication of the attached segment. A “vector” includes both viral and non-viral vehicles for introducing a nucleic acid molecule or expression cassette into a cell in vitro, ex vivo or in vivo. A large number of vectors are known and used in the art including, for example, plasmids, modified eukaryotic viruses, or modified bacterial viruses. Insertion of a polynucleotide such as an expression cassette into a suitable vector can be accomplished by ligating the appropriate polynucleotide fragments into a chosen vector that has complementary cohesive termini. The vector comprising the nucleic acid molecule, or the expression cassette can be referred to as a vector construct or construct herein. An expression cassette can refer to a coding sequence also referred to as an open reading frame (e.g. a nucleic acid molecule encoding an AAV Rep) and an additional sequence optionally to facilitate cloning or expression, such as untranslated sequence, flanking restriction endonuclease site (s) (optionally cut) , promoter and / or an integration element.

[0059] In one embodiment, the artificial intron is employed in a packaging cell line for the production of AAV transducing units. In this embodiment, a cell line containing an AAV gene (such as Rep, Cap) under the control of an artificial intron is propagated. The artificial intron could be positioned in the AAV gene in a reading frame shared by all the transcripts of the gene. For example, the artificial intron is positioned in the Rep gene in a reading frame shared by all four Rep proteins, Rep 40, Rep 52, Rep 68, and Rep 78. Due to the robust and ubiquitous nature of RNA splicing and termination and that transcription termination is well-studied, there is no explicit requirement to position the artificial intron at a specific nucleotide position in the AAV gene.

[0060] In one embodiment, the inducible expression system is used to control the transcription and expression of the site-specific recombinase (such as Cre recombinase) gene in the vector introduced into the cell. Examples of inducible expression systems that may be used in the present disclosure include but are not limited to, a Tet-On inducible expression system in a tetracycline-inducible system. In the Tet-On inducible expression system, only in the presence of an inducing agent such as doxycycline (Dox) , tetracycline (TCN) , or an analog thereof, a reverse tetracycline controlled transactivator (rtTA) (such as Tet3G) can bind to a TRE response element of Tet-On inducible expression system to initiate the transcription of a regulated nucleic acid fragment linked downstream.

[0061] EXAMPLES

[0062] Example 1 -Development of conditional splicing systems

[0063] In the exploration of regulating viral overlapping genes through cis-acting element-mediated alternative splicing, it was posited that introducing a highly efficient splicing site within an intron could disrupt standard splicing processes, enabling the selective expression of these genes. The initial step involved crafting a synthetic intron that mimicked the fundamental attributes of human introns. This intron was enhanced with several intronic splicing enhancers (ISEs) to boost its splicing efficiency [20, 21] , assessed through luciferase Gluc reporter assays. The enhancements observed with ISE groups A&C and B&D were significant, amplifying Gluc expression by 41 and 45 times, respectively, achieving a splicing efficiency near 99.9% (FIG. 7) .

[0064] Further testing of the "dual splicing switch" concept involved integrating a "loxP-poly A-loxP" cassette within the synthetic intron of the present invention. Interestingly, the inclusion of one to three tandem SV40 poly A sequences modestly affected Gluc expression (FIG. 8) . Detailed mRNA abundance analyses revealed that a single copy of the SV40 poly A sequence marginally decreased Gluc mRNA levels by approximately 1.5-fold (FIG. 8B) .

[0065] Advancing the system, three intron variants were delineated, namely PT, PS, and PST which all derived from the same intron comprising a splicing donor SD and a splice acceptor (SA2) . In addition, each incorporates a single SV40 poly A sequence. Distinctively, a single copy of the HIV TAR sequence was embedded into the PT and PST introns to explore its potential in inducing transcription stalling, given its known capacity to significantly impede RNA transcription. Furthermore, to facilitate conditional splicing, a splicing acceptor (SA1) was inserted into the PS and PST introns (FIG. 1A) . The sequences of PT, PS, and PST introns used herein are as follows:

[0066] PT intron:

[0067]

[0068] PS intron:

[0069]

[0070] PST intron:

[0071]

[0072] Wherein the SV40 poly A sequence used herein is:

[0073] gttaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttc actgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggaat (SEQ ID NO: 2) ;

[0074] the HIV-1 TAR sequence used herein is:

[0075] the SD sequence used herein is: Gtaagt;

[0076] the SA1 and SA2 sequence used herein is:

[0077] ctattggtcttactgacatccactttgcctttctctccacag (SEQ ID NO: 3) .

[0078] Upon transfecting these constructs into HEK293T cells for Gluc expression analysis, nuanced effects were observed. Without Cre recombinase, both the PT intron and the "1x poly A" intron led to a slight reduction in Gluc expression when compared to the control (FIG. 1B) . In stark contrast, the PS intron drastically lowered Gluc expression by 3146-fold, and the inclusion of TAR in the PST intron further diminished expression by 50-fold (FIG. 1B) . Crucially, the simultaneous expression of Cre recombinase reversed this suppression, fully restoring Gluc expression (FIG. 1B) .

[0079] RT-qPCR analysis of the spliced products post-Cre co-expression indicated the elimination of RNA products spliced between SD and SA1, with a notable increase in RNA spliced between SD and SA2 in the PST intron (FIG. 1C) . This finding, coupled with a 2-fold enhancement in Gluc expression from the PST intron compared to the PT intron post-Cre-mediated loxP recombination, underscored the TAR sequence's dual role in enforcing specific splicing events and augmenting Cre-mediated DNA recombination.

[0080] Electrophoresis analysis of RNA splicing patterns, conducted after 25 or 30 thermal cycles of RT-PCR with designated primer pairs, corroborated the designs of the present invention (FIG. 1E) . Specifically, RNA from the PS and PST introns underwent specific splicing at SA1 (992bp) in the absence of Cre, while Cre co-expression redirected splicing to SA2 (481bp) , demonstrating the precision and efficiency of this conditional splicing system (FIG. 1D) .

[0081] Example 2 -Dual splicing and transcription stalling induced by HIV TAR in PST intron

[0082] The present exploration into the TAR element's role within the PST intron focused on its potential to either inhibit or enhance specific RNA splicing events. The PST intron, when compared to the PS intron, presented a decreased proportion of RNA spliced between the second splicing donor (SD) and the second splicing acceptor (SA2) (FIGs. 2A and 2B) . This suggested that TAR might act as an intronic splicing silencer (ISS) or RNA hairpin to diminish splicing between SD and SA2 or as an exonic splicing enhancer (ESE) , promoting splicing between SD and SA1. The distinction between these roles was investigated by orienting TAR on the complementary strand within the intron (FIG. 2C) . Analyses showed that the insertion of TAR did not result in a significant alteration in the efficiency or pattern of splicing. This suggests its negligible influence when included separately, as illustrated in FIGs. 2D-2F.

[0083] Interestingly, the formation of TAR-induced hairpin structures, regardless of their orientations, had a minimal effect on splicing efficiency (FIG. 2E) . However, a significant transcriptional slowdown was observed with the TAR and reverse-TAR (R-TAR) introns, reducing Gluc expression approximately twofold (FIG. 2D) . This reduction alone could not fully account for the substantial TAR impact noted in the PST intron. Sequencing of the RNA from the PST intron unveiled unexpected splicing between TAR and SA2, leading to a notable ～200nt truncation, revealing TAR's role as a splice donor site and significantly reducing the likelihood of undesired splicing events between SD and SA2 (FIG. 2G) .

[0084] Example 3 -Conditional expression of AAV cap and HIV genes

[0085] For the conditional expression of overlapping genes, the PST intron was strategically integrated into the AAV cap gene at 128nt, 577nt and 1320nt of cap encoding sequence (FIG. 3A) . Independent of the helper vector, the absence of Cre led to dual splicing at the PST intron, effectively silencing gene expression (FIG. 3B) . Cre's co-expression not only removed this blockage but also reinstated capsid protein production from various plasmids, emphasizing the controlled expression's efficiency (FIGs. 3B & 3C) . This precise regulation was crucial for generating DNase I-resistant rAAV particles, which relied entirely on Cre's presence (FIG. 3D) .

[0086] Extending the approach to the HIV genome, integrating the PST intron upstream of splice donor 1 (SD1) drastically altered the HIV protein expression landscape (140nt before HIV gag, FIG. 3E) . Utilizing sera from chronically infected HIV patients for detection, a complete suppression of HIV protein expression is observed in the absence of Cre, which was reversed upon Cre's co-expression, illustrating the intron's potential to finely control gene expression in complex viral contexts (FIG. 3F) .

[0087] Example 4 -Conditional expression of AAV Rep

[0088] Diverging from the AAV cap and HIV genes, the AAV rep gene's expression is governed by multiple promoters and alternative splicing sites. The insertion of the PST intron into the rep gene at specific sequences (CAG / N or AAG / N) validated the effectiveness of the conditional splicing system of the present invention through both Western blot and qPCR analyses (Insertion site of rep encoding sequence: 38nt, 180nt, 413nt and 664nt, FIG. 4B) . Notably, the NPST plasmids yielded AAV levels comparable to the wild-type AAV2 plasmid upon Cre activation (FIG. 4C) . The inducible expression of Cre, triggered by doxycycline, further exemplified the system's utility in controlled AAV packaging, showcasing a scalable and efficient approach to viral vector production (FIG. 4D) .

[0089] Example 5 -Establishment of rAAV packaging cell lines utilizing the PST intron.

[0090] The establishment of efficient and reliable recombinant adeno-associated virus (rAAV) packaging cell lines presents significant challenges, largely due to the need to incorporate multiple AAV packaging genes and the cytotoxic effects associated with the overlapping gene rep and the adenoviral E1 gene. To address these obstacles, an integrated rAAV packaging system named HCN2 is designed, detailed in FIG. 5A and FIG. 6. The HCN2 system integrates essential components for cell line development, including constitutively expressed selection markers (GFP and puromycin) and regulatory proteins (Tet3G and tTR-KRAB) . The expression of Cre recombinase is controlled by the inducible promoter TRE, which is regulated by tTR-KRAB but can be activated in the presence of Tet3G and doxycycline (Dox) . Furthermore, the adenovirus helper genes E2A and E4 are also under the control of Tet3G and tTR-KRAB, mediated through TetO7 operon sequences, with Dox acting to release tTR-KRAB's inhibitory effects. This elaborate expression cassette is flanked by PiggyBac ITRs, enabling genome integration via transposase [22, 23] .

[0091] To establish stable cell lines, HEK293T, 293F, and HeLa cells were co-transfected with the HCN2 plasmid and a transposase expression vector, followed by selection using puromycin. The effectiveness of these cell lines as AAV producers was gauged by assessing AAV replication following the administration of Dox and supplemental AAV. The findings indicated a direct correlation between Dox concentration and AAV titers in the culture supernatant (FIG. 5B) . Notably, AAV production significantly increased when Dox concentrations surpassed 0.1 μg / ml, highlighting the inducible system's efficacy in boosting AAV production over time (FIG. 5C) .

[0092] However, a comparative analysis between cell lines revealed a decline in AAV yield in HEK293T-HCN2 cells after 16 passages, suggesting a potential loss of packaging gene integrity over prolonged culture periods (FIG. 5D) . Flow cytometry analysis of GFP expression further supported these observations, with a majority of HeLa-HCN2 cells retaining GFP positivity, whereas a reduced percentage of 293F-HCN2 and HEK293T-HCN2 cells maintained GFP expression (FIG. 5E) . This reduction implicates the detrimental effects of adenovirus E1 overexpression on the stability of integrated HCN2 constructs within HEK293 cells. Hence, in order to augment the durability and efficacy of AAV packaging cell lines, it is proposed that the concurrent regulation of the adenoviral E1 gene and rep through the PST intron.

[0093] Example 6 -Discussion

[0094] In the research, a pioneering regulatory system is specifically designed for the control of overlapping genes through RNA conditional splicing. This system was rigorously tested for its efficacy in selectively expressing various genes, including Gluc, AAV rep, AAV cap, and HIV genes. Moreover, utilized this system is successfully utilized to create highly stable and productive all-in-one AAV packaging cell lines, demonstrating its substantial utility in scenarios requiring the conditional expression of overlapping or cytotoxic genes.

[0095] The system underwent thorough optimization and characterization, leading to several key insights that could inform future development of conditional splicing systems. A pivotal finding was the critical role of a highly efficient splicing site within the PST intron, which dramatically reduced the background expression. The inclusion of 12 bp ISE elements in intron significantly augmented splicing efficiency by over 40-fold, leading to a 99.9%spliced RNA fraction (FIG. 7) . Efficient splicing between SD and SA1 leads to the consumption of SA1; failure to do so may result in leaky splicing between SD and SA2, leading to inadvertent and incomplete expression.

[0096] Another significant advancement was the use of the HIV TAR element, which not only facilitated transcription stalling (FIG. 2D &2F) but also unexpectedly enhanced Cre-mediated DNA recombination and induced specific RNA splicing patterns (FIG. 1B &1C) . This marks the first observation that a specific DNA sequence near the loxP sites could enhance Cre-mediated recombination, leading to nearly complete DNA recombination within the PST intron (FIG. 1C) . The exact mechanisms behind this phenomenon warrant further investigation, potentially offering insights to refine recombinase-mediated recombination strategies across various applications.

[0097] Furthermore, the findings underscore the utility of TAR as a splice donor site, showcasing its ability to fine-tune transcription termination and RNA splicing [24, 25] . By strategically removing SD and SA2 from RNA through SA1-and TAR-mediated dual splicing, the conditional splicing system's performance was significantly enhanced. This strategy mirrors the Flexon system's approach

[0026] , which similarly utilizes a recombinase-controlled dual splicing intron. The elegance of this approach resides in its ability to transform the linear induction expression mechanism into a problem of gene expression characterized by two states within a probability distribution framework. Such a transformation substantially mitigates the issue of leaky expression within regulation systems.

[0098] Looking ahead, this study lays the groundwork for further enhancements to the conditional splicing system. By integrating concise cis-acting splicing regulatory elements (SREs) and optimizing their placement

[0021] , gene expression levels can be tailored more precisely to meet specific research or therapeutic needs.

[0099] This innovative system proves invaluable in situations where the presence of overlapping genes complicates vector design. For example, adenoviral vectors have restricted packaging capacity, and the elimination of structural overlapping genes from the adenoviral vector genome generates helper-dependent adenovirus (HDAd) , allowing for a larger cloning capacity of up to 37kb [27-29] . A similar constraint applies to other viral vectors such as AAV and lentivirus [30, 31] . However, the production of these vectors typically involves the use of helper viruses or helper plasmids, presenting a significant obstacle to vector production and hindering their application in preclinical and clinical studies. By facilitating the establishment of producer cells, this approach holds the promise of overcoming these challenges.

[0100] To advance the utility and applicability of conditional splicing systems, future research must focus on elucidating the dynamics between cis-acting elements and trans-acting factors across cell types. The development of chemical-induced conditional splicing systems, independent of external inducible systems, and the design of more refined introns with specific splicing elements, will enhance the precision and efficacy of gene regulation. These advancements promise to broaden the scope of genetic engineering, offering new possibilities for gene therapy and beyond.

[0101] Example 7 -Materials and methods

[0102] Experimental design

[0103] The primary objective of this research was to design a sophisticated conditional splicing system that leverages synthetic introns for the targeted expression of viral overlapping genes. This entailed a meticulous evaluation of various regulatory cis-acting elements within synthetic introns to assess their impact on the conditional expression of the reporter gene Gluc. Following these assessments, the synthetic intron demonstrating the highest efficiency was chosen for further applications in the conditional expression of overlapping genes.

[0104] Reagents

[0105] For this study, key components such as the Gluc reporter gene, synthetic introns, the tetracycline response element (TRE) promoter, T3G, and Cre recombinase were synthesized by BGI. Essential reagents like DNase I and doxycycline were sourced from Sigma Aldrich. Viral vectors, including AAV2 / 2, AAV2 / 8, and the helper vectors were procured from Addgene. Transfection reagents were provided by Promega, with FuGENE HD used for cell transfection, and the luminescent substrate coelenterazine obtained from GeneCopoeia and Promega. The plasmid vector pB513 and the transposase expression vector, critical for these experiments, were kindly provided by Huibin Lv. It's noteworthy that E. coli harboring the PST plasmid required cultivation at a controlled temperature less than 30℃ to ensure optimal conditions for plasmid stability.

[0106] Transfection and Gluc expression detection

[0107] HEK293T cells underwent transfection using the FuGENE HD reagent and plasmid DNA at a 3: 1 ratio, with a total DNA concentration of 1 μg / mL of cell culture media. The plasmid DNA was initially diluted in OptiMEM to a specific concentration before being mixed with the FuGENE HD reagent. After a brief incubation, the mixture was evenly distributed across the cell culture media. Gluc expression was monitored 48 hours post-transfection by transferring a small volume of the cell culture to a luminescent assay plate, followed by the addition of coelenterazine substrate. Luminescence readings were captured using a Varioskan LUX Multimode Microplate Reader from Thermo Fisher.

[0108] Western Blot analysis for AAV Rep and Cap proteins

[0109] 2 days post transfection, HEK293T cells, seeded in 6-well plates, were processed for Western blot analysis. Cells were lysed, and proteins were extracted, quantified, and subjected to SDS-PAGE, followed by transfer to PVDF membranes. These membranes were then probed with specific antibodies against AAV Rep (anti-Rep 303.9 mouse monoclonal antibody) , Cap proteins (anti-VP B1 mouse monoclonal antibody from Progen) and mouse anti-His tag primary antibody. Primary antibody was diluted in 5%BSA-PBST at a dilution factor of 1: 200. Following incubation with HRP-conjugated secondary antibodies, protein bands were visualized using the Pierce ECL Western Blotting substrate.

[0110] AAV packaging and quantification

[0111] For AAV packaging, the cell culture medium was replaced with a specialized DMEM formulation prior to transfection. Three days post-transfection, the media was treated with DNase I (100 U / ml) for 30 min to remove any unencapsulated DNA, followed by heat inactivation at 70℃ for 10 min. AAV titers were quantified by qPCR, employing a primer pair specific to the Gluc gene (Gluc-qF4: 5’ -GGAGCCCATGGAGCAGTTCA-3’ and Gluc-qR4: 5’ -AGGCAAAGGTGGCACATCTCTG-3’ ) . A standard curve, generated from dilutions of a known plasmid, facilitated the accurate determination of AAV genome copy numbers in the sample.

[0112] Analysis of RNA splicing

[0113] For RNA splicing analysis, HEK293T cells transfected with the relevant plasmids underwent total RNA extraction using the RNeasy Mini Kit (Qiagen) , complemented by DNA and residual plasmid digestion using the RNase-Free DNase Set (Qiagen, Cat. 79254) as per manufacturer protocols. The purified RNA was then reverse transcribed into cDNA using the PrimeScriptTM RT Reagent Kit (Takara) , setting the stage for quantitative PCR (qPCR) and gel-based analyses to quantify and visualize spliced versus unspliced mRNA forms.

[0114] qPCR was conducted to discern the proportions and absolute quantities of spliced and unspliced mRNA variants, utilizing primer pairs designed for specific detection against a GAPDH reference. The primer sequences employed are as follows: · (Reference Gene) : Forward: ACGAATTTGGCTACAGCAACAGGG, Reverse:  TCTACATGGCAACTGTGAGGAGG ·Total Gluc mRNA: Forward: GGAGCCCATGGAGCAGTTCA, Reverse:  AGGCAAAGGTGGCACATCTCTG ·Unspliced mRNA (SD-SA1) : Forward: GGAGGCCAATGCCAGGAAATGACC,  Reverse: GGGCGCCTTTGGTGCTCT ·Spliced mRNA (SD-SA2) : Forward: GGAGGCCAATGCCAGGAAGGCT,  Reverse: CTCGCCAATGCCGCCCTG

[0115] For gel-based RNA splicing visualization, PCR amplification was performed using the specified primer pairs, with the resulting products subjected to electrophoresis on TAE gels to confirm the predicted sizes of spliced and unspliced RNA fragments.

[0116] Establishment of rAAV packaging cell lines and single-cell cloning

[0117] The development of rAAV packaging cell lines entailed co-transfecting HEK293T, 293F, or HeLa cells with the HCN2 and transposase expression vectors. Post-transfection, cells were selected and maintained in DMEM supplemented with FBS, penicillin / streptomycin, GlutaMax, and puromycin. Single-cell cloning was executed by diluting the cells to a specific concentration, followed by seeding in 96-well plates to isolate individual clones, which were further expanded and characterized.

[0118] Statistical analysis

[0119] Data comparisons were conducted using unpaired t-tests, setting significance thresholds at *p<0.05, **p<0.01, and ****p<0.0001.

[0120] References: 1. Wright, B.W., M.P. Molloy, and P.R. Jaschke, Overlapping genes in natural and  engineered genomes. Nat Rev Genet, 2022. 23 (3) : p. 154-168. 2. Chen, J., et al., Pervasive functional translation of noncanonical human open reading  frames. Science, 2020. 367 (6482) : p. 1140-1146. 3. Consortium, F., et al., A promoter-level mammalian expression atlas. Nature, 2014.  507 (7493) : p. 462-70. 4. Schlub, T.E. and E.C. Holmes, Properties and abundance of overlapping genes in  viruses. Virus Evol, 2020. 6 (1) : p. veaa009. 5. Mudge, J.M., et al., A community-driven roadmap to advance research on translated  open reading frames detected by Ribo-seq. bioRxiv, 2021: p. 2021.06.10.447896. 6. Prensner, J.R., et al., Noncanonical open reading frames encode functional proteins  essential for cancer cell survival. Nat Biotechnol, 2021. 39 (6) : p. 697-704. 7. Jackson, R., et al., The translation of non-canonical open reading frames controls  mucosal immunity. Nature, 2018. 564 (7736) : p. 434-438. 8. Sun, J., et al., Generation of a Broadly Useful Model for COVID-19 Pathogenesis,  Vaccination, and Treatment. Cell, 2020. 182 (3) : p. 734-743 e5. 9. Lasaro, M.O. and H.C. Ertl, New insights on adenovirus as vaccine vectors. Mol  Ther, 2009. 17 (8) : p. 1333-9. 10. Penaud-Budloo, M., et al., Pharmacology of Recombinant Adeno-associated Virus  Production. Mol Ther Methods Clin Dev, 2018. 8: p. 166-180. 11. Joshi, P.R.H., et al., Advancements in molecular design and bioprocessing of  recombinant adeno-associated virus gene delivery vectors using the insect-cell baculovirus expression platform. Biotechnol J, 2021. 16 (4) : p. e2000021. 12. Robert, M.A., et al., Manufacturing of recombinant adeno-associated viruses using  mammalian expression platforms. Biotechnol J, 2017. 12 (3) . 13. Sauer, B. and N. Henderson, Cre-stimulated recombination at loxP-containing DNA  sequences placed into the mammalian genome. Nucleic Acids Res, 1989. 17 (1) : p. 147-61. 14. Struhl, G. and K. Basler, Organizing activity of wingless protein in Drosophila. Cell,  1993. 72 (4) : p. 527-40. 15. O'Gorman, S., D.T. Fox, and G.M. Wahl, Recombinase-mediated gene activation and  site-specific integration in mammalian cells. Science, 1991. 251 (4999) : p. 1351-5. 16. Bapst, A.M., et al., Cre-mediated, loxP independent sequential recombination of a  tripartite transcriptional stop cassette allows for partial read-through transcription. Biochim Biophys Acta Gene Regul Mech, 2020. 1863 (8) : p. 194568. 17. Lemay, J.F. and F. Bachand, Fail-safe transcription termination: Because one is  never enough. RNA Biol, 2015. 12 (9) : p. 927-32. 18. Qiao, C., et al., A novel gene expression control system and its use in stable, high-titer  293 cell-based adeno-associated virus packaging cell lines. J Virol, 2002. 76 (24) : p. 13015-27. 19. Yuan, Z., et al., A versatile adeno-associated virus vector producer cell line method  for scalable vector production of different serotypes. Hum Gene Ther, 2011. 22 (5) : p. 613-24. 20. Fairbrother, W.G., et al., Predictive identification of exonic splicing enhancers in  human genes. Science, 2002. 297 (5583) : p. 1007-13. 21. Wang, Y., et al., Intronic splicing enhancers, cognate splicing factors and context- dependent regulation rules. Nat Struct Mol Biol, 2012. 19 (10) : p. 1044-52. 22. Berg, K., et al., Rapid establishment of stable retroviral packaging cells and  recombinant susceptible target cell lines employing novel transposon vectors derived from Sleeping Beauty. Virology, 2019. 531: p. 40-47. 23. Li, X., et al., piggyBac transposase tools for genome engineering. Proc Natl Acad Sci  U S A, 2013. 110 (25) : p. E2279-87. 24. Richter, S.N., et al., Dynamics of nascent mRNA folding and RNA-protein  interactions: an alternative TAR RNA structure is involved in the control of HIV-1 mRNA transcription. Nucleic Acids Res, 2006. 34 (15) : p. 4278-92. 25. Paz, S., A.R. Krainer, and M. Caputi, HIV-1 transcription is regulated by splicing  factor SRSF1. Nucleic Acids Res, 2014. 42 (22) : p. 13812-23. 26. Shaffer, J.M. and I. Greenwald, Floxed exon (Flexon) : A flexibly positioned stop  cassette for recombinase-mediated conditional gene expression. Proc Natl Acad Sci U S A, 2022. 119 (3) . 27. Palmer, D. and P. Ng, Improved system for helper-dependent adenoviral vector  production. Mol Ther, 2003. 8 (5) : p. 846-52. 28. Harui, A., et al., Vaccination with helper-dependent adenovirus enhances the  generation of transgene-specific CTL. Gene Ther, 2004. 11 (22) : p. 1617-26. 29. Vetrini, F. and P. Ng, Gene therapy with helper-dependent adenoviral vectors:  current advances and future perspectives. Viruses, 2010. 2 (9) : p. 1886-917. 30. Qiao, C., et al., Feasibility of generating adeno-associated virus packaging cell lines  containing inducible adenovirus helper genes. J Virol, 2002. 76 (4) : p. 1904-13. 31. Yang, Q., F. Chen, and J.P. Trempe, Characterization of cell lines that inducibly  express the adeno-associated virus Rep proteins. J Virol, 1994. 68 (8) : p. 4847-56. 32. Jaganathan, K., et al., Predicting Splicing from Primary Sequence with Deep  Learning. Cell, 2019. 176 (3) : p. 535-548 e24. 33. Wilkinson, M.E., C. Charenton and K. Nagai, RNA Splicing by the Spliceosome.  Annu Rev Biochem, 2020. 89: p. 359-388.

Claims

1.An artificial intron comprises the following elements:i) a splicing donor SD and two splicing acceptors SA1 and SA2; ii) an SV40 poly A sequence; and iii) a first and a second recombination site located in the same orientation at both ends of the artificial intron.2.The artificial intron according to claim 1, further comprises a retroviral TAR sequence.3.The artificial intron according to claim 2, the retroviral TAR sequence is derived from HIV-1.4.The artificial intron according to claims 2 or 3, wherein the retroviral TAR comprises a nucleic sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%sequence identity to SEQ ID NO: 1.5.The artificial intron according to any of claims 1-4, wherein the SV40 poly A comprises a nucleic sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%sequence identity to SEQ ID NO: 2.6.The artificial intron according to any of claims 1-5, wherein the artificial intron is derived from a natural or chimeric intron comprising the splicing donor SD and the splicing acceptor SA2.7.The artificial intron according to any one of claims 1-6, wherein the natural or chimeric intron comprises a conserved intron motif of GURAGN…YNYURAY (Y) NYAG; wherein GURAGN represents the splicing donor SD, YNYURAY (Y) NYAG represents the splicing acceptor SA2; wherein R is A or G; N is selected from A, G, C, or U; Y is C or U; (Y) N represents polypyrimidine tract.8.The artificial intron according to any one of claims 1-7, wherein the splicing acceptor SA1 and the splicing acceptor SA2 are derived from the same splicing acceptor.9.The artificial intron according to any one of claims 1-8, wherein the splicing acceptor SA1 comprises a nucleic sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%sequence identity to SEQ ID NO: 3.10.The artificial intron according to any one of claims 1-9, wherein the artificial intron comprises from 5’ to 3’ direction:5’-SD-first recombination site-SV40 ploy A-SA1-second recombination site-SA2-3’; or5’-SD-first recombination site-SV40 ploy A-SA1-TAR-second recombination site-SA2-3’.11.The artificial intron according to any one of claims 1-10, wherein the artificial intron comprises a nucleic sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%sequence identity to SEQ ID NO: 4 or SEQ ID NO: 5.12.An expression cassette comprising:a nucleic acid sequence encoding a target gene comprising the artificial intron according to any one of claims 1-11; wherein the target gene expression is silenced in the absence of site-specific recombinase and activated in the presence of the site-specific recombinase.13.The expression cassette according to claim 12, wherein the first and second recombination sites are loxP sites or a derivative, analog, or homologue thereof, and the site-specific recombinase is Cre recombinase.14.The expression cassette according to claim 12 or 13, wherein the target gene is an overlapping gene.15.The expression cassette according to any one of claims 12-14, wherein the target gene is a viral gene.16.The expression cassette according to any one of claims 12-15, wherein the target gene is selected from Gluc, AAV rep, AAV cap, or HIV genes.17.A vector comprising the expression cassette according to any one of claims 12-16.18.The vector according to claim 17, wherein the vector is a viral vector or non-viral vector.19.The vector according to claim 18, wherein the viral vector is selected from a retroviral vector, an adeno-associated viral (AAV) vector, and a lentiviral vector.20.The vector according to claim 19, wherein the viral vector is an adeno-associated viral (AAV) vector.21.The vector according to claim 18, wherein the non-viral vector is a plasmid.22.A cell comprising the expression cassette according to any one of claims 12-16 or the vector of any one according to claims 17-21.23.The cell according to claim 22, wherein the target gene is a viral gene, and the cell comprises a genome of the virus.24.The cell according to claim 23, wherein the genome of the virus is AAV viral genome.25.The cell according to any one of claims 22-24, wherein the cell further comprises a nucleic acid sequence encoding the site-specific recombinase.26.The cell according to claim 25, wherein the expression of the site-specific recombinase is controlled by an inducible expression system.27.The cell according to claim 26, wherein the inducible expression system is a Tet-on inducible expression system comprising a TRE promoter, an inducing agent, and a reverse tetracycline controlled transactivator (rtTA) .28.The cell according to claim 27, wherein the inducing agent is selected from Doxycycline (DOX) , tetracycline (TCN) , or an analog thereof; and / or the reverse tetracycline controlled transactivator is Tet3G protein.29.The cell according to any one of claims 22-28, wherein the cell is selected from HEK293T, HEK293F, or HeLa cells.30.The cell according to any one of claims 25-29, wherein the nucleic acid sequence encoding the site-specific recombinase and the expression cassette are on the same vector.31.The cell according to any one of claims 22-30, wherein the cell is stably transformed with the vector according to any one of claims 17-21.32.An improved site-specific recombinase conditional splicing system for precisely controlling expression of overlapping genes in viral vectors comprising a synthetic intron enhanced with intronic splicing enhancers, wherein the splicing efficiency of the system is at least 99%, and wherein the inducibility of the system is increased by at least 100,000-fold.33.The improved site-specific recombinase conditional splicing system of claim 32, wherein the intron comprises a single SV40 poly A sequence.34.The improved site-specific recombinase conditional splicing system of claim 33, wherein the intron further comprises a splicing acceptor SA1.35.The improved site-specific recombinase conditional splicing system of claim 34, wherein the intron further comprises a single retroviral TAR sequence.

Images