METHOD OF SEPARATING RECOMBINANT ADENO-ASSOCIATED VIRUS (rAAV) PARTICLES
The combination of affinity and mixed-mode chromatography optimizes the separation of rAAV particles, particularly those with modified capsids, improving yield and purity through specific salt concentrations and pH gradients.
Patent Information
- Application Number
- PCT/CN2025/083656
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-20
- Filing Date
- 2025-03-20
- Publication Date
- 2025-09-25
AI Technical Summary
Existing methods for separating recombinant adeno-associated virus (rAAV) particles, particularly those with modified capsids, are inefficient, necessitating an optimized method for improved yield and purity.
A method involving affinity chromatography (AC) using a crosslinked poly [styrene divinylbenzene] substrate and mixed-mode chromatography (MMC) with a glycidyl methacrylate and ethylene glycol dimethacrylate copolymer, optimized with specific salt concentrations and pH gradients, is employed to separate rAAV particles.
The method significantly enhances the yield and purity of rAAV particles, ensuring high loading capacity and effective separation of rAAV particles with a genome of interest, as demonstrated by DLS analysis and SDS-PAGE.
Smart Images

Figure PCTCN2025083656-FTAPPB-I100001 
Figure PCTCN2025083656-FTAPPB-I100002 
Figure PCTCN2025083656-FTAPPB-I100003
Abstract
Description
Method of separating recombinant adeno-associated virus (rAAV) particlesTechnical field
[0001] The present invention is related to gene therapy. In particular, the present invention involves a method of separating recombinant adeno-associated virus (AAV) particles produced for the gene therapy.Background
[0002] Gene therapy has recently received increasing attention. The improved gene transfer technology gives great aid to the development of gene therapy.
[0003] Gene therapies initially relate to the introduction of a foreign gene into a patient's cell to correct for congenital genetic errors, such as loss-of-function mutations. Most of the currently approved gene therapy protocols have involved the introduction of functional copies of a gene, which is defective in a patient, into somatic cells of the patient. But recently, gene therapy has been broadly defined as the correction of disease phenotype by introducing new genetic information into an organism in need thereof.
[0004] In in vivo gene therapy, the transferred gene (transgene) is introduced in situ into the organs, tissues, and cells of the recipient organism, such as muscle, hematopoietic stem cells, arterial walls, the nervous system, the lungs, and the eyes.
[0005] The in vivo gene therapy by introducing a transgene in situ into the eyes has been used for the treatment of ocular diseases (such as those that cause blindness) . Examples of such diseases are retinitis pigmentosa, maculopathy, Leber's congenital amaurosis, Leber's hereditary optic neuropathy, early onset severe retinal dystrophy, full color blindness, retinal palpebral fissure Disease, ocular albinism, ocular albinism, glaucoma, Stargardt disease, choroid-free, age-related macular degeneration (AMD) including Wet-AMD, spinocerebellar ataxia type 7 (SCAT) , color blindness, and lysosomes Storage diseases affecting the cornea (such as mucopolysaccharidosis (MPS) IV and MPS VII) .
[0006] Adeno-associated virus (AAV) is a member of Parvoviridae family. It is a simple single-stranded DNA virus, and requires a helper virus (such as adenovirus) for replication. The genome of a wildtype AAV contains approximately 4.7 kilobases (kb) , comprising the cap and rep genes between two inverted terminal repeat (ITR) sequenceswith interrupted palindromic sequences that can fold into hairpin structures that function as primers during initiation of DNA replication. The cap gene encodes the viral capsid protein, and the rep gene is involved in the replication and integration of AAV. AAV can infect a variety of cells, and the viral DNA can be integrated into human chromosome 19 in the presence of the rep product.
[0007] A large percentage of rAAV gene therapy under clinical development is focused on the CNS, including the brain and eye. There are a dozen or so capsid serotypes that are currently used as vectors in clinical trials, the most numerous being AAV2-based platforms for ocular diseases. Notably, the first rAAV gene therapy drug approved by the US Food and Drug Administration (FDA) , Luxturna, treats patients with an inherited form of vision loss caused by RPE65 gene mutations using AAV2.
[0008] A number of modified AAV2 capsids have been developed to improve the gene therapy. It has been reported in WO 2023 / 155828 that a modified AAV2 capsid is superior for the gene therapy against ocular diseases.
[0009] The preparation and separation of rAAVs are common in the art, but the method of separation may be capsid-specific, and thus, the established method may be less efficient for the new modified capsid. However, there remains a need of an optimized method of separating rAAVs comprising the modified AAV2 capsid.Summary of the Invention
[0010] To meet the need, the present disclosure provides a method of separating recombinant adeno-associated virus (rAAV) particles comprising a genome of interest (GOI) , comprising the steps of i) an affinity chromatography (AC) and ii) a mixed-mode chromatography (MMC) , wherein the rAAV comprises a modified AAV2 capsid preferably comprising an amino acid sequence of SEQ ID NO: 1.
[0011] In some embodiments, the AC is conducted with a solid phase comprising a binding molecule linked to a substrate comprising crosslinked poly [styrene divinylbenzene] . In some embodiments, the elution in the AC is conducted with a solution comprising a mono-valent salt at a concentration of at least about 100mM. In some embodiments, the mono-valent salt is a sodium salt. In some embodiments, the sodium salt is sodium chloride. In some embodiments, the concentration is between about 100mM and about 1000mM. In some embodiments, the concentration is about 300mM.
[0012] In some embodiments, the elution in the AC is conducted at a pH gradient. In some embodiments, the pH gradient is a gradient from pH5.0 to pH2.0.
[0013] In some embodiments, the MMC is conducted with a solid phase comprising the copolymer of glycidyl methacrylate (GMA) and ethylene glycol dimethacrylate (EDMA) , i.e., poly (glycidylmethacrylate-co-ethyleneglycol dimethacrylate) . In some embodiments, the solid phase comprises a ligand of formula I
[0014] In some embodiments, the loading material for the MMC is loaded onto the solid phase in a solution having a conductivity of at least 2.0 mS / cm. In some embodiments, the conductivity is between about 2.0 mS / cm and about 2.5 mS / cm. In some embodiments, the conductivity is between about 2.0 mS / cm and about 2.3 mS / cm.
[0015] In some embodiments, the MMC is conducted with a loading capacity of at least about 2.0 ×1014 viral particles (Vps) / mL resin. In some embodiments, the loading capacity is between about 2.0 × 1014 and about 2.0 × 1015 Vps / mL resin, or is 2.0 × 1014, 3.0 × 1014, 4.0 × 1014, 5.0 × 1014, 6.0 × 1014, 7.0 × 1014, 8.0 × 1014, 9.0 × 1014, 1.0 × 1015, 2.0 × 1015, or more Vps / mL resin. In some embodiments, the loading capacity is between about 2.0 × 1014 and about 4.0 ×1014 Vps / mL resin.Brief Description of the Drawings
[0016] Fig. 1 shows the maps of the plasmids used in the production of rAAV, A: the helper plasmid, B: the packaging plasmid, and C: the transgene plasmid.
[0017] Fig. 2 shows the absorption at 280nm during the elution of Batches D21151 and D21191.
[0018] Fig. 3 shows the DLS analysis of the Batch D21151 before (left panel) and after (right panel) a filtration with a 0.22 μm filter.
[0019] Fig. 4 shows the absorption at 280nm during the elution of Batches D21191, D21193, and D21195.
[0020] Fig. 5 shows the absorption at 280nm during the elution of Batches D21204 and D21206.
[0021] Fig. 6 shows the absorptions at 260nm and 280nm, the conductivity (cond. ) and the percentage of elution buffer (conc B) during the loading (top) and the elution (bottom) of Batch D21252.
[0022] Fig. 7 shows the AUC test of the starting material and eluates of Batches D21237 and 21242.
[0023] Fig. 8 shows the absorptions at 260nm and 280nm, pH and the percentage of elution buffer during the elution of Batches D21237, 21242 and 21243 (from left to right) .
[0024] Fig. 9 shows the absorption at 280nm and conductivity during the elution of Batches D21237, 21242 and 21243.
[0025] Fig. 10 shows the DLS analysis of Batches D22002, D22003 and D22004 (from left to right) .
[0026] Fig. 11 shows the absorptions at 260nm and 280nm, pH and the percentage of elution buffer during the elution of Batches D22002, D22003 and D22004 (from left to right) .
[0027] Fig. 12 shows the absorption at 280nm and conductivity during the elution of Batches D22002, D22003 and D22004.
[0028] Fig. 13 shows the AUC test of the starting material and eluates of the Batch D21253.
[0029] Fig. 14 shows the absorptions at 260nm and 280nm, pH and the percentage of elution buffer during the elution of the Batch D21253.
[0030] Fig. 15 shows the SDS-PAGE of the elute.Detailed Description of the Invention
[0031] 1. Definition
[0032] Unless otherwise indicated, all terms used herein have the same meaning as they would to one skilled in the art, and the practice of the present invention will employ conventional techniques of microbiology and recombinant DNA technology, which are within the knowledge of those of skill in the art.
[0033] “AAV” is an abbreviation for adeno-associated virus, and may be used to refer to the virus itself or derivatives thereof. The term covers all subtypes and both naturally occurring and recombinant forms, except where required otherwise. The abbreviation “rAAV” refers to recombinant adeno-associated virus, also referred to as a recombinant AAV vector (or “rAAV vector” ) . The term “AAV” includes AAV type 1 (AAV-1) , AAV type 2 (AAV-2) , AAV type 3 (AAV-3) , AAV type 4 (AAV-4) , AAV type 5 (AAV-5) , AAV type 6 (AAV-6) , AAV type 7 (AAV-7) , AAV type 8 (AAV-8) , avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV. “Primate AAV” refers to AAV that infects primates, “non-primate AAV” refers to AAV that infects non-primate mammals, “bovine AAV” refers to AAV that infects bovine mammals, etc.
[0034] The genomic sequences of various serotypes of AAV, as well as the sequences of the native terminal repeats (TRs) , Rep proteins, and capsid subunits are known in the art. Such sequences may be found in public databases such as GenBank. See, e.g., GenBank Accession Numbers NC_002077 (AAV-1) , AF063497 (AAV-1) , NC_001401 (AAV-2) , AF043303 (AAV-2) , NC_001729 (AAV-3) , NC_001829 (AAV-4) , U89790 (AAV-4) , NC_006152 (AAV-5) , AF513851 (AAV-7) , AF513852 (AAV-8) , and NC_006261 (AAV-8) ; the disclosures of which are incorporated by reference herein for teaching AAV nucleic acid and amino acid sequences.
[0035] An “rAAV vector” as used herein refers to an AAV vector comprising a polynucleotide sequence not of AAV origin (i.e., a polynucleotide heterologous to AAV) , typically a sequence of interest for the genetic transformation of a cell. In general, the heterologous polynucleotide is flanked by at least one, and generally by two, AAV inverted terminal repeat sequences (ITRs) . The term rAAV vector encompasses both rAAV vector particles and rAAV vector plasmids (also referred to as transgene plasmid) . An rAAV vector may either be single-stranded (ssAAV) or self-complementary (scAAV) .
[0036] An “AAV virus” or “AAV viral particle” or “rAAV vector particle” refers to a viral particle composed of at least one AAV capsid protein (typically by all of the capsid proteins of a wild-type AAV) and an encapsidated polynucleotide rAAV vector. If the particle comprises a heterologous polynucleotide (i.e. a polynucleotide other than a wild-type AAV genome such as a transgene to be delivered to a mammalian cell) , it is typically referred to as an “rAAV vector particle” or simply an “rAAV vector” . Thus, production of rAAV particle necessarily includes production of rAAV vector, as such a vector is contained within an rAAV particle.
[0037] “Packaging” refers to a series of intracellular events that result in the assembly and encapsidation of an AAV particle.
[0038] AAV “rep” and “cap” genes refer to polynucleotide sequences encoding replication and encapsidation proteins of adeno-associated virus. AAV rep and cap are referred to herein as AAV “packaging genes” . A plasmid or other expression vector comprising rep and cap genes is referred herein to as “packaging plasmid” or “packaging vector” .
[0039] The cap gene encodes three structural proteins, VP1, VP2, and VP3, that self-assemble into a 60-mer icosahedral capsid at a ratio of approximately 1: 1: 10. These three proteins are transcribed from the same open reading frame and share a C-terminal domain but have different N-termini due to alternative start codons and alternative splicing (Esther J. Lee, et al., Adeno-Associated Virus (AAV) Vectors: Rational Design Strategies for Capsid Engineering, Curr Opin Biomed Eng. 2018; 7: 58–63) . For example, the wildtype AAV2 capsid may comprise VP1 of SEQ ID NO: 4, VP2 of amino acids 138-735 of SEQ ID NO: 4, and VP3 of amino acids 203-735 of SEQ ID NO: 4.
[0040] A “helper virus” for AAV refers to a virus that allows AAV (e.g. wild-type AAV) to be replicated and packaged by a mammalian cell. A variety of such helper viruses for AAV are known in the art, including adenoviruses, herpesviruses and poxviruses such as vaccinia. The adenoviruses encompass a number of different subgroups, although Adenovirus type 5 of subgroup C is most commonly used. Numerous adenoviruses of human, non-human mammalian and avian origin are known and available from depositories such as the ATCC. Viruses of the herpes family include, for example, herpes simplex viruses (HSV) and Epstein-Barr viruses (EBV) , as well as cytomegaloviruses (CMV) and pseudorabies viruses (PRV) ; which are also available from depositories such as ATCC.
[0041] “Helper virus function (s) ” refers to function (s) encoded in a helper virus genome which allow AAV replication and packaging (in conjunction with other requirements for replication and packaging described herein) . As described herein, “helper virus function” may be provided in a number of ways, including by providing helper virus or providing, for example, polynucleotide sequences encoding the requisite function (s) to a producer cell in trans. For example, a plasmid, which is referred herein to as “helper plasmid” , or other expression vector comprising nucleotide sequences encoding one or more adenoviral proteins is transfected into a producer cell along with an rAAV vector.
[0042] As used herein, the term “polynucleotide construct” refers to a single-stranded or double-stranded polynucleotide, which is isolated from a naturally occurring gene or modified to contain a nucleic acid segment that does not naturally occur. When the polynucleotide construct contains the control sequences required to express the coding sequence of the present invention, the polynucleotide construct comprises an “expression cassette” .
[0043] As used herein, the term “polynucleotide” usually refers to generally a nucleic acid molecule (e.g., 100 bases and up to 30 kilobases in length) and a sequence that is either complementary (antisense) or identical (sense) to the sequence of a messenger RNA (mRNA) or miRNA fragment or molecule. The term can also refer to DNA or RNA molecules that are either transcribed or non-transcribed.
[0044] The term “exogenous polynucleotide” refers to a nucleotide sequence that does not originate from the host in which it is placed. It may be identical to the host’s DNA or heterologous. An example is a sequence of interest inserted into a vector. Such exogenous DNA sequences may be derived from a variety of sources including DNA, cDNA, synthetic DNA, and RNA. Exogenous polynucleotides also encompass DNA sequences that encode antisense oligonucleotides.
[0045] “Heterologous” means derived from a genotypically distinct entity from that of the rest of the entity to which it is being compared. For example, a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence with which it is not naturally found linked is a heterologous promoter. Thus, for example, an rAAV that includes a heterologous nucleic acid encoding a heterologous gene product is an rAAV that includes a nucleic acid not normally included in a naturally-occurring, wild-type AAV, and the encoded heterologous gene product is a gene product not normally encoded by a naturally-occurring, wild-type AAV.
[0046] A polynucleotide or polypeptide has a certain percent “sequence identity” to another polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids are the same when comparing the two sequences. Sequence similarity can be determined in a number of different manners. To determine sequence identity, sequences can be aligned using the methods and computer programs, including BLAST, available over the world wide web at ncbi. nlm. nih. gov / BLAST / . Another alignment algorithm is FASTA, available in the Genetics Computing Group (GCG) package, from Madison, Wisconsin, USA, a wholly owned subsidiary of Oxford Molecular Group, Inc.
[0047] As used herein, the term “expression cassette” refers to a polynucleotide segment comprising a polynucleotide encoding a polypeptide operably linked to additional nucleotides provided for the expression of the polynucleotide, for example, control sequence.
[0048] As used herein, the term “expression” includes any step involved in the production of a polypeptide, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0049] A “control sequence” includes all elements necessary or beneficial for the expression of the polynucleotide encoding the polypeptide of the present invention. Each control sequence may be natural or foreign to the nucleotide sequence encoding the polypeptide, or natural or foreign to each other. Such control sequences include, but are not limited to, leader sequence, polyadenylation sequence, propeptide sequence, promoter, enhancer, signal peptide sequence, and transcription terminator. At a minimum, control sequences include a promoter and signals for the termination of transcription and translation.
[0050] For example, the control sequence may be a suitable promoter sequence, a nucleotide sequence recognized by the host cell to express the polynucleotide encoding the polypeptide of the present invention. The promoter sequence contains a transcription control sequence that mediates the expression of the polypeptide. The promoter may be any nucleotide sequence that exhibits transcriptional activity in the selected host cell, for example, lac operon of E. coli. The promoters also include mutant, truncated and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular polypeptides, which are homologous or heterologous to the host cell.
[0051] As used herein, the term “operably linked” herein refers to a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of the polynucleotide sequence, whereby the control sequence directs the expression of the polypeptide coding sequence.
[0052] A “gene” refers to a polynucleotide containing at least one open reading frame encoding a polynucleotide or a polypeptide.
[0053] A “gene product” is a molecule resulting from the expression of a particular gene. Gene products include, e.g., a polypeptide, an aptamer, an interfering RNA, an mRNA, and the like.
[0054] A “small interfering RNA” or “short interfering RNA” or siRNA is a RNA duplex of nucleotides that is targeted to a gene interest (a “target gene” ) . An “RNA duplex” refers to the structure formed by the complementary pairing between two regions of a RNA molecule. siRNA is “targeted” to a gene in that the nucleotide sequence of the duplex portion of the siRNA is complementary to a nucleotide sequence of the targeted gene. In some embodiments, the length of the duplex of siRNAs is less than 30 nucleotides. In some embodiments, the duplex can be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10 nucleotides in length. In some embodiments, the length of the duplex is 19-25 nucleotides in length. The RNA duplex portion of the siRNA can be part of a hairpin structure. In addition to the duplex portion, the hairpin structure may contain a loop portion positioned between the two sequences that form the duplex. The loop can vary in length. In some embodiments the loop is 5, 6, 7, 8, 9, 10, 11, 12 or 13 nucleotides in length. The hairpin structure can also contain 3' or 5' overhang portions. In some embodiments, the overhang is a 3' or a 5' overhang 0, 1, 2, 3, 4 or 5 nucleotides in length.
[0055] A “short hairpin RNA, ” or shRNA, is a polynucleotide construct that can be made to express an interfering RNA such as siRNA.
[0056] The term “recombinant” as used herein refers to nucleic acids, vectors, polypeptides, or proteins that have been generated using DNA recombination (cloning) methods and are distinguishable from native or wild-type nucleic acids, vectors, polypeptides, or proteins.
[0057] The terms “polypeptide” and “protein” are used interchangeably herein and refer to a polymer of amino acids and includes full-length proteins and fragments thereof.
[0058] As used herein, the term “host cell” refers to, for example microorganisms, yeast cells, insect cells, and mammalian cells, that can be, or have been, used as recipients of rAAV vectors. The term includes the progeny of the original cell which has been transduced. Thus, a “host cell” as used herein generally refers to a cell which has been transduced with an exogenous DNA sequence. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement to the original parent, due to natural, accidental, or deliberate mutation.
[0059] The term “pharmaceutically acceptable” as used herein refers to molecular entities and compositions that are physiologically tolerable and do not typically produce toxicity or an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
[0060] The term “subject” as used herein includes, but is not limited to, humans, nonhuman primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and the like. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered.
[0061] The terms “genetic alteration” and “genetic modification” (and grammatical variants thereof) , are used interchangeably herein to refer to a process wherein a genetic element (e.g., a polynucleotide) is introduced into a cell other than by mitosis or meiosis. The element may be heterologous to the cell, or it may be an additional copy or improved version of an element already present in the cell. Genetic alteration may be effected, for example, by transfecting a cell with a recombinant plasmid or other polynucleotide through any process known in the art, such as electroporation, calcium phosphate precipitation, or contacting with a polynucleotide-liposome complex. Genetic alteration may also be effected, for example, by transduction or infection with a DNA or RNA virus or viral vector. Generally, the genetic element is introduced into a chromosome or mini-chromosome in the cell; but any alteration that changes the phenotype and / or genotype of the cell and its progeny is included in this term.
[0062] A cell is said to be “stably” altered, transduced, genetically modified, or transformed with a genetic sequence if the sequence is available to perform its function during extended culture of the cell in vitro. Generally, such a cell is “heritably” altered (genetically modified) in that a genetic alteration is introduced which is also inheritable by progeny of the altered cell.
[0063] The terms “polypeptide, ” “peptide, ” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, phosphorylation, or conjugation with a labeling component. Polypeptides such as anti-angiogenic polypeptides, neuroprotective polypeptides, and the like, when discussed in the context of delivering a gene product to a mammalian subject, and compositions therefor, refer to the respective intact polypeptide, or any fragment or genetically engineered derivative thereof, which retains the desired biochemical function of the intact protein. Similarly, references to nucleic acids encoding anti-angiogenic polypeptides, nucleic acids encoding neuroprotective polypeptides, and other such nucleic acids for use in delivery of a gene product to a mammalian subject (which may be referred to as “transgenes” to be delivered to a recipient cell) , include polynucleotides encoding the intact polypeptide or any fragment or genetically engineered derivative possessing the desired biochemical function.
[0064] An “isolated” plasmid, nucleic acid, vector, virus, virion, host cell, or other substance refers to a preparation of the substance devoid of at least some of the other components that may also be present where the substance or a similar substance naturally occurs or is initially prepared from. Thus, for example, an isolated substance may be prepared by using a purification technique to enrich it from a source mixture. Enrichment can be measured on an absolute basis, such as weight per volume of solution, or it can be measured in relation to a second, potentially interfering substance present in the source mixture. Increasing enrichments of the embodiments of this disclosure are increasingly more isolated. An isolated plasmid, nucleic acid, vector, virus, host cell, or other substance is in some embodiments purified, e.g., from about 80%to about 90%pure, at least about 90%pure, at least about 95%pure, at least about 98%pure, or at least about 99%, or more, pure.
[0065] As used herein, the terms “treatment, ” “treating, ” and the like, refer to obtaining a desired pharmacologic and / or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or may be therapeutic in terms of a partial or complete cure for a disease and / or adverse effect attributable to the disease. “Treatment, ” as used herein, covers any treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease or at risk of acquiring the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease.
[0066] As used herein, the term “ED50” means median effective dose of an agent, i.e., the dose capable of resulting in 50%of max response. For delivering a transgene to be expressed into a cell with a recombinant virus (such as rAAV) , the ED50 can be expressed as the MOI, at which 50%of the max expression of the transgene is achieved.
[0067] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
[0068] It must be noted that as used herein and in the appended claims, the singular forms “a” , “an” , and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a modified AAV capsid” includes a plurality of such capsids. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely, ” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.
[0069] 2. Packaging of the rAAV
[0070] It is known in the art to package rAAV with a system comprising three plasmids, including i) a transgene plasmid comprising the genome of the rAAV encoding a desired gene product, ii) a packaging plasmid encoding the REP and / or CAP proteins, and iii) a helper plasmid (see, e.g., Crosson SM et al., Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Mol Ther Methods Clin Dev. 2018; 10: 1-7) . A method of producing rAAV is also described in, for example, U.S. Patent Publication No. 2005 / 0053922 and U.S. Patent Publication No. 2009 / 0202490.
[0071] In some embodiments, the rAAV to be separated by the method of the invention is produced by introducing a vector for packaging rAAV into a host cell.
[0072] In some embodiments, the vector comprises a nucleotide sequence encoding a modified AAV2 capsid polypeptide, which is operably linked to a promoter. In some embodiments, the modified AAV2 capsid polypeptide comprises, as compared to the parental AAV2 capsid polypeptide, a peptide inserted in loop IV, wherein the inserted peptide comprises an amino acid sequence of SEQ ID NO: 3. In some embodiments, the peptide is inserted between positions 587 and 588 with the numbering by reference to the wild-type AAV2 capsid, such as SEQ ID NO: 4. In some embodiments, the modified AAV2 capsid comprises an amino acid sequence of SEQ ID NO: 1.
[0073] In some embodiments, the vector further comprises a rep gene operably linked to a promoter.
[0074] In some embodiments, the host cell further comprises a helper plasmid, and / or a rAAV vector. When the host cell of the present invention is used to generate the rAAV of the present invention, it is referred to as a “packaging cell” .
[0075] The vector of the present invention can be introduced into the host cell stably or transiently using defined techniques including, but not limited to, electroporation, calcium phosphate precipitation, liposome-mediated transfection, and the like. For stable transformation, the subject nucleic acid will typically be operably linked to a selectable marker, such as neomycin resistance gene and the like.
[0076] The host cell is a variety of cells, such as mammalian cells, including, for example, murine cells and primate cells (e.g., human cells) . Suitable mammalian cells include, but are not limited to, primary cells and cell lines, wherein suitable cell lines include, but are not limited to, 293 cells, COS cells, HeLa cells, Vero cells, 3T3 mouse fibroblasts, C3H10T1 / 2 fibroblasts, CHO cells, etc. Non-limiting examples of suitable host cells include, for example, HeLa cells (e.g., American Type Culture Collection (ATCC) No. CCL-2) , CHO cells (e.g., ATCC No. CRL9618, CCL61, CRL9096) , 293 cells (e.g., ATCC No. CRL-1573) , Vero cells, NIH3T3 cells (eg, ATCC No. CRL-1658) , Huh-7 cells, BHK cells (e.g., ATCC No. CCL10) , PC12 cells (ATCC No. CRL1721) COS cells, COS-7 cells (ATCC No. CRL1651) , RAT1 cells, mouse L cells (ATCC No. CCLI. 3) , human embryonic kidney (HEK) cells (ATCC No. CRL1573) , HLHepG2 cells, and the like. Bacterial cells, such as Sf9 cells, which produce AAV, can also be used to prepare the host cell of the present invention (see, for example, U.S. Patent No. 7,271,002; U.S. Patent Publication No. 12 / 297,958) .
[0077] 3. Affinity Chromatography (AC)
[0078] The present invention provides a method of separating recombinant adeno-associated virus (rAAV) particles comprising a genome of interest (GOI) , comprising a step of an affinity chromatography (AC) . It will be understood that the AC step is performed to separate rAAV particles from the cell culture for packaging the rAAV.
[0079] In some embodiments, the AC is conducted with solid phase comprising a binding molecule linked to a substrate, e.g., a resin comprising crosslinked poly [styrene divinylbenzene] . In some embodiments, the binding molecule is an antibody against AAV capsid. In some embodiments, the AC is conducted with POROS GoPure AAVX column from Thermo Scientific.
[0080] In some embodiments, the loading material is loaded onto the solid phase in a solution comprising a buffer, such as Tris buffer, phosphate buffer, e.g., at a concentration between about 10 mM and about 100 mM or a concentration of about 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, 100 mM or more, with a pH between about 7.0 and about 8.0, or a pH of about 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9 or 8.0.
[0081] In some embodiments, the solution further comprises a sodium salt, such as NaCl and sodium citrate, e.g, with a concentration of sodium at about 50-600 mM, about 60-500 mM, about 70-450mM, about 80-400 mM, about 90-350mM, or about 100 mM-300 mM.
[0082] In some embodiments, the solution further comprises a saccharide, such as sucrose. In some embodiments, the loading buffer further comprises a surfactant, such as PF68.
[0083] In some embodiments, the loading material is loaded at a capacity of 1012-1015, e.g., at least 1012, 1013, 1014 viral particles (Vp) / ml resin.
[0084] The inventors surprisingly find that the iron strength of the solution for the elution is important for the yield of the AC purification. Therefore, in some embodiments, the elution in the AC is conducted with a solution comprising a salt at a concentration of at least about 100mM. In some embodiments, the salt is a sodium salt, such as sodium chloride, sodium citrate, sodium acetate, sodium phosphate, sodium sulfate and the like. In some embodiments, the sodium salt is sodium chloride. In some embodiments, the concentration is at least about 100mM, 200mM, 300mM, 400mM, 500mM, 600mM, 700mM, 800mM, 900mM, 1000mM or more. In some embodiments, the concentration is between about 100mM and about 1000mM. In some embodiments, the concentration is about 300mM.
[0085] In some embodiments, the solution for elution comprises a buffer, such as glycine buffer, at a concentration of at least about 50mM, 60mM, 70mM, 80mM, 90mM, 100mM, 110mM, 120mM, 130mM, 140mM, 150mM, 160mM, 170mM, 180mM, 190mM, 200mM or more.
[0086] In some embodiments, the elution in the AC is conducted at a pH gradient. In some embodiments, the pH gradient is a gradient from pH7.0 to pH2.0, from pH6.5 to pH2.0, from pH6.0 to pH2.0, from pH5.9 to pH2.0, from pH5.8 to pH2.0, from pH5.7 to pH2.0, from pH5.6 to pH2.0, from pH5.5 to pH2.0 from pH5.4 to pH2.0 from pH5.3 to pH2.0 from pH5.2 to pH2.0 from pH5.1 to pH2.0, or from pH5.0 to pH2.0.
[0087] 4. Mixed-Mode Chromatography (MMC)
[0088] The present invention provides a method of separating recombinant adeno-associated virus (rAAV) particles comprising a genome of interest (GOI) , comprising a step of a mixed-mode chromatography (MMC) . It will be understood that the MMC step is performed to separate rAAV particles comprising GOI from the GOI deficient rAAV particles.
[0089] In some embodiments, the MMC is conducted with a solid phase comprising the copolymer of glycidyl methacrylate (GMA) and ethylene glycol dimethacrylate (EDMA) , i.e., poly (glycidylmethacrylate-co-ethyleneglycol dimethacrylate) . In some embodiments, the solid phase comprises a ligand of formula I
[0090] In some embodiments, the loading material for the MMC is loaded onto the solid phase in a solution having a conductivity of at least about 2.0, 2.05, 2.10, 2.15, 2.20, 2.25, 2.30, 2.35, 2.40, 2.45, 2.50 mS / cm or more. In some embodiments, the conductivity is between about 2.0 mS / cm and about 2.5 mS / cm. In some embodiments, the conductivity is between about 2.0 mS / cm and about 2.3 mS / cm.
[0091] In some embodiments, the MMC is conducted with a loading capacity of at least about 2.0 ×1014 viral particles (Vps) / mL resin. In some embodiments, the loading capacity is between about 2.0 × 1014 and about 6.0 × 1014 Vps / mL resin. In some embodiments, the loading capacity is between about 2.0 × 1014 and about 4.0 × 1014 Vps / mL resin.
[0092] In some embodiments, the loading material is loaded onto the solid phase in a solution with a pH of about 8.0 comprising a buffer, a magnesium salt, and / or a surfactant. In some embodiments, the buffer is Tris / BTP, e.g., at a concentration of about 10mM. In some embodiments, the magnesium salt is magnesium chloride, e.g., at a concentration of about 2mM. In some embodiments, the surfactant is PF68, e.g., at a concentration of about 0.1% (w / w) .
[0093] In some embodiments, the elution of the MMC is conducted with a solution comprising a buffer, a magnesium salt, a sodium salt and / or a surfactant. In some embodiments, the buffer is Tris / BTP, e.g., at a concentration of about 10mM. In some embodiments, the magnesium salt is magnesium chloride, e.g., at a concentration of about 2mM. In some embodiments, the ium salt is sodium chloride, e.g., at a concentration of about 10mM. In some embodiments, the surfactant is PF68, e.g., at a concentration of about 0.1% (w / w) . In some embodiment, the elution is conducted at a pH gradient, e.g., from pH8.0 to pH10.0. In some embodiments, the elution is conducted with 100 column volumes (CVs) .
[0094] Advantage of the invention
[0095] The present invention provides a method for separating rAAV particles with optimized AC and MMC steps to improve the yield of the rAAV particles comprising GOI. Upon DLS analysis, SDS-PAGE, SEC-HPLC and analyses for host protein, host DNA, residual plasmid, nuclease, and the antibody on AAVX, it is shown that the method of the invention can be applied to the product from a large scale packaging progress with an acceptable product quality.
[0096] Examples
[0097] The following Examples are provided for illustration only, rather than for any limitation to the present application.
[0098] Example 1. Preparation of rAVV vector comprising a modified AAV capsid polypeptide
[0099] The rAAV vector was prepared as described in WO 2023 / 155828. Briefly, 3E6 cells / ml 293VPC cells (Thermo, Catalog A35347) in serum free virus production medium OPM-293 CD05 (Shanghai OPM Biosciences Co. Ltd. Catalog: 81075-001) were triple transfected, using polyethylenimine, with the helper plasmid (Fig. 1A) , the packaging plasmid encoding AVV2 Rep and modified AAV2 Cap of SEQ ID NO: 1 (Fig. 1B) , and the transgene plasmid comprising the rAAV genome of SEQ ID NO: 2 (Fig. 1C) . Following 72 h incubation at 37℃, cells were harvested, and viral particles were purified through an iodixanol gradient (see Crosson SM et al. ) . The rAAVs were tested for titers, which were all at the level of 1012-1013 viral genomes (vg) / mL, by ddPCR with primers and probe as follows.
[0100] qPCR-AMD-24-5-F GAGTGCGAGCTGGTGAG
[0101] qPCR-AMD-24-5-R GCGTAGTCCCTGCTGATG
[0102] qPCR-AMD-24-5-P CAAGGACGGCAGCACCTACTACAC
[0103] Example 2. Optimization of the affinity chromatography
[0104] This Example was carried out to obtain optimal conditions for the affinity chromatography (AC) .
[0105] 2.1. The elution buffer
[0106] Batches of the rAAVs prepared in Example 1 were loaded onto 1ml POROS GoPure AAVX column (Thermo) with a procedure according to the manufacturer’s instructions, and the loading EQ buffer and elution buffer for the AC are shown in Table 1.
[0107] Table 1. *Eluted Vps / Vps in loading sample × 100%
[0108] The AC was performed by AKTA (Cytiva) and the eluted viral particles (Vps) were detected by ELISA (Progen, Cat#: PRAAV2R) . The absorption at 280nm showed the elution of Vps (Fig. 2) . The Vp yield of the Batch D21151 was poor (9.02%) , while the Batch D21191 achieved a much higher yield (56.40%) with an elution buffer comprising sodium salt (Table 1) .
[0109] Fig. 3 showed the dynamic light scattering (DLS) analysis (Malvern Panalytical, ZSU5700) of the Batch D21151 before (left panel) and after (right panel) a filtration with a 0.22 μm filter, indicating that the eluate of the Batch D21151 comprised aggregated rAAV particles due to the lack of sodium salt in the elution buffer, which resulted in the loss of rAAV particles after the filtration. Few rAAV particles in the eluate of the Batch D21191, which was eluted with a buffer comprising sodium salt, were lost after the filtration.
[0110] The above results indicated that the elution with a buffer comprising a certain concentration of mono-valent salt reduced the aggregation of rAAV particles.
[0111] 2.2. The pH for elution
[0112] Batches of the rAAVs prepared in Example 1 were loaded onto 1ml POROS GoPure AAVX column (Thermo) with a procedure according to the manufacturer’s instructions, and the loading EQ buffer and elution buffer for the AC were the same with those for the Batch D21191 in Table 1 with the pH of the elution buffer varied (see Table 2) .
[0113] Table 2.
[0114] The Batch D21195, which was eluted with a pH gradient from pH5.0 to pH2.0, achieved a significantly higher Vp yield (73.54%vs. 56.40% / 52.36%, see Fig. 4 and Table 2) , indicating that the elution with a pH gradient is superior over the elution at a fixed pH.
[0115] 2.3. The salt comprised in the elution buffer
[0116] Batches of the rAAVs prepared in Example 1 were loaded onto 1ml POROS GoPure AAVX column (Thermo) with a procedure according to the manufacturer’s instructions, and the loading EQ buffer were the same with that for the Batch D21191 in Table 1. The elution was conducted with the buffers shown in Table 3 at a pH gradient as described in Example 2.2.
[0117] Table 3.
[0118] As shown in Fig. 5, the eluate of the Batch D21206, which was eluted with a buffer comprising sodium chloride, showed a higher and sharper peak for the rAAV particles than the Batch D21204, which was eluted with a buffer comprising sodium citrate. Further, a higher Vp yield was achieved in the Batch D21206 than the Batch D21204 (see Table 3) .
[0119] 2.4. Scale up test
[0120] A scale upseparation of the rAAV, which was prepared according to Example 1 in a 40L system, was conducted with 78ml POROS GoPure AAVX column (Thermo) with a procedure according to the manufacturer’s instructions. The product was concentrated for 10 times with Ultrafiltraion Dialfiltration-1 (UFDF-1) before loading. The parameters for the AC including the buffers and loading material were shown in Table 4.
[0121] Table 4.
[0122] As shown in Fig. 6, the eluate showed a peak of 280nm absorption for rAAV at about 4 min (retention time of 4 min) with a 260 / 280 ratio of 0.955. The Vps were separated at a yield of 78.58% (see Table 4) , which is comparable to the yield achieved in Example 2.3.
[0123] The above results indicated that the optimized conditions for AC separation of rAAV comprising modified AAV2 capsid, which was identified at a laboratory scale, can apply to large scale separation.
[0124] Example 3. Optimization of the mixed-mode chromatography
[0125] This Example was carried out to obtain optimal conditions for the mixed-mode chromatography (MMC) .
[0126] 3.1. Conductivity of the loading material
[0127] The rAAV eluates from Example 2 were loaded onto 1ml CIMmultus PrimaS column (BIA) for MMC with a procedure according to the manufacturer’s instructions. The parameters for the MMC were shown in Table 5.
[0128] Table 5.
[0129] The starting material (the eluate of the AC step) and the eluates were subjected to Analytical Ultracentrifugation (AUC) test (Beckman Coulter's Optima AUC) . As shown in Fig. 7, the Batches D21237 and D21242 achieved a much higher percentage of Vp comprising the GOI (Vg) than the starting material .
[0130] As shown in Fig. 8, the Batches D21237 and D21242 achieved a A260 / A280 of 1.393 and 1.387, while the Batch D21243 was poorly eluted.
[0131] The starting material and the eluates were further subjected to ddPCR (for Vg in Table 6) as described in Example 1 and ELISA (for Vp in Table 6) . As shown in Table 6, the Batches D21237 and D21242 achieved much higher purity for Vg than the starting material (85.61%and 86.02%vs. 15.95%) . When the starting material was loaded onto the column with a conductivity of 2.0 or 2.3mS / cm, about 40%~60%of the total viral particles (Vp) passed through the column during the loading, while only about 9%Vg passed through. The AUC result was around 85%. When the conductivity decreased to 1.7mS / cm, the percentages of Vg and Vp that passed through the column during the loading were about 40%and 80%, respectively (see Fig. 9) . This may be due to the structural change of AAV2 virus caused by the low conductivity, which weakened the binding to the PrimaS column. The Batch D21243 showed a poor eluation with significant absorption peaks even in regeneration and clean-in-place (CIP) steps, which may be the absorption by capsids with different structures and / or other impurities.
[0132] Table 6. *FT-flowthrough; NA-not applicable
[0133] 3.2. The loading capacity
[0134] The rAAV eluates from Example 2 were loaded onto 1ml CIMmultus PrimaS column (BIA) for MMC with a procedure according to the manufacturer’s instructions. The MMC was carried out with conditions similar to those described in Example 3.1 except a loading conductivity of 2.0 mS / cm, and the loading capacities shown in Table 7.
[0135] Table 7.
[0136] The eluates were subjected to AUC test. As shown in Fig. 10, the Batches D22002 and D22003, which were loaded with a capacity of 2.96E+14 and 3.99E+14 Vp / ml Resin, respectively, achieved a percentage of Vg in the eluate higher than 80% (81.85%for the Batch D22002, and 82.30%for the Batch 22003) , while the Vg percentage in the eluate was reduced with a loading capacity of 1.81E+14 Vp / ml Resin (77.42%for the Batch D22004) .
[0137] The eluates were further subjected to ddPCR (for Vg in Table 8) as described in Example 1 and ELISA (for Vp in Table 8) .
[0138] Table 8.
[0139] As shown in Fig. 11, Fig. 12 and Table 8, MMC (using, e.g., PrimaS) showed comparable effect on the separations of rAAVs with the modified AAV2 capsid (SEQ ID NO: 1) with various loading capacities.
[0140] 3.3. Scale up test
[0141] A scale up (40L) separation by MMC of the eluate obtained in Example 2 was conducted with 80ml PrimaS (BIA) column with the parameters shown in Table 9.
[0142] Table 9.
[0143] The eluate and starting material were subjected to the tests as described in Example 3.1. As shown in Table 10 and Fig. 13, the eluate showed a much higher purity of Vg than the starting material (86.84%vs. 18.18%) , indicating that the scale up test achieved the similar effect as compared to the laboratory scale experiments.
[0144] Table 10.
[0145] As shown in Fig. 14, the full rAAV particles were effectively eluted. The SDS-PAGE (3.8μL eluate, 200V, 40min) showed 5.4%VP1, 18.9%VP2 and 75.7%VP3, and a 100%purity of rAAV (see Fig. 15) .
[0146] The results above indicated that the method can work in the industrial production.
Claims
1.A method of separating recombinant adeno-associated virus (rAAV) particles comprising a genome of interest (GOI) , comprising the steps of i) an affinity chromatography (AC) and ii) a mixed-mode chromatography (MMC) ,wherein the rAAV comprises a modified AAV2 capsid preferably comprising an amino acid sequence of SEQ ID NO: 1.2.The method of claim 1, wherein the AC is conducted with a solid phase comprising a binding molecule linked to a substrate comprising crosslinked poly [styrene divinylbenzene] .3.The method of claim 1 or 2, wherein the elution in the AC is conducted with a solution comprising a mono-valent salt at a concentration of at least about 100mM.4.The method of claim 3, wherein the mono-valent salt is a sodium salt.5.The method of claim 4, wherein the sodium salt is sodium chloride.6.The method of any one of claims 3 to 5, wherein the concentration is between about 100mM and about 1000mM.7.The method of claim 6, wherein the concentration is about 300mM.8.The method of any one of claims 1 to 7, wherein the elution in the AC is conducted at a pH gradient.9.The method of claim 8, wherein the pH gradient is a gradient from pH5.0 to pH2.0.10.The method of any one of claims 1 to 9, wherein the MMC is conducted with a solid phase comprising the copolymer of glycidyl methacrylate (GMA) and ethylene glycol dimethacrylate (EDMA) , i.e., poly (glycidylmethacrylate-co-ethyleneglycol dimethacrylate) .11.The method of claim 10, wherein the solid phase comprises a ligand of formula I 12.The method of any one of claims 1 to 11, wherein the loading material for the MMC is loaded onto the solid phase in a solution having a conductivity of at least 2.0 mS / cm.13.The method of claim 12, wherein the conductivity is between about 2.0 mS / cm and about 2.5 mS / cm.14.The method of claim 12 or 13, wherein the conductivity is between about 2.0 mS / cm and about 2.3 mS / cm.15.The method of any of claims 10 to 14, wherein the MMC is conducted with a loading capacity of at least about 2.0 × 1014 viral particles (Vps) / mL resin.16.The method of claim 15, wherein the loading capacity is between about 2.0 × 1014 and about 6.0 × 1014 Vps / mL resin.17.The method of claim 16, wherein the loading capacity is between about 2.0 × 1014 and about 4.0 × 1014 Vps / mL resin.
Citation Information
Patent Citations
Mutant adeno-associated virus virions and methods of use thereof
US20050053922A1
Mutant adeno-associated virus virions and methods of use thereof
US20090202490A1
Three-dimensional adhesive device having a microelectronic system embedded therein
US20140288381A1
Production of adeno-associated virus in insect cells
US7271002B2
Recombinant adeno-associated virus with modified AAV capsid polypeptides
WO2023155828A1