Loss of function in GDSL lipases increases plant root biomass
By reducing GDSL lipase activity in plants using CRISPR/Cas9 or miRNA, the method enhances root and shoot biomass, addressing the need for increased carbon sequestration and soil retention, thus mitigating climate change.
Patent Information
- Application Number
- PCT/US2025/020186
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-19
- Filing Date
- 2025-03-17
- Publication Date
- 2025-09-25
AI Technical Summary
There is a need for developing plants with increased root biomass to enhance carbon sequestration, improve soil structure, and mitigate climate change, as existing methods are inadequate in achieving substantial increases in root biomass.
The method involves reducing the expression and activity of Gly-Asp-Ser-Leu (GDSL) lipases in plants through the introduction of exogenous nucleic acid molecules, such as CRISPR/Cas9-mediated loss-of-function mutations or miRNA sequences, to generate transgenic plants with enhanced root and shoot biomass.
The approach results in significantly increased root and shoot biomass in plants, providing improved carbon sequestration and soil retention capabilities, thereby stabilizing atmospheric CO2 levels and promoting sustainable crop yields.
Smart Images

Figure US2025020186_25092025_PF_FP_ABST
Abstract
Description
[0001] LOSS OF FUNCTION IN GDSL LIPASES INCREASES PLANT ROOT BIOMASS
[0002] CROSS REFERENCE TO RELATED APPLICATION
[0003] This application claims priority to U.S. Provisional Application No. 63 / 567,220, filed March 19, 2024, which is incorporated by reference in its entirety.
[0004] FIELD
[0005] The present disclosure generally relates to the field of increasing root biomass in plants. More particularly, the present disclosure relates to compositions and methods for generating plants that possess increased root biomass.
[0006] INCORPORATION OF ELECTRONIC SEQUENCE LISTING
[0007] The electronic sequence listing, submitted herewith as an XML file named 7158-111104- 02_Sequence Listing.xml (-1,591,181 bytes), created on March 14, 2025, is herein incorporated by reference in its entirety.
[0008] BACKGROUND
[0009] Soils are composed partly of decomposed plant matter, which contains a significant amount of carbon absorbed from the atmosphere during the plants' lifetime. Soils can act as long-term carbon storage, preventing the carbon from returning to the atmosphere as carbon dioxide (CO2), the primary greenhouse gas responsible for climate change.
[0010] Developing plants with increased root systems holds the potential to achieve multiple benefits, including improved soil structure, enhanced carbon, water, and nutrient retention, and sustainable crop yields. By increasing the root biomass in plants, it becomes possible to sequester more carbon in the soil over extended periods. Plants having increased root biomass could have a significantly positive impact on stabilizing atmospheric CO2 levels.
[0011] Thus, there is an urgent need in this field for producing and breeding plants with enhanced root systems and architectural traits. Such efforts could yield substantial benefits in mitigating climate change and promoting a more sustainable future. Also, there is a further need for making transgenic plants with increased root biomass to prevent widespread carbon losses from the soil and global warming. SEQUENCES
[0012] The nucleic and amino acid sequences listed herein are shown using standard letter abbreviations for nucleotide bases and amino acids. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. Corresponding RNA sequences to the DNA sequences provided, or corresponding DNA sequences to RNA sequences provided are also included.
[0013] I. Exemplary Protein and DNA Sequences of GDSL lipases
[0014] SEQ ID NOs: 1-7 and 346-350 are DNA sequences for exemplary GDSL lipase genes / coding sequences found in Arabidopsis thaliana.
[0015] SEQ ID NOs: 8-25 and 351-372 are DNA sequences for exemplary GDSL lipase genes / coding sequences found in Brassica napus (Canola).
[0016] SEQ ID NOs: 26-33 and 393-419 are DNA sequences for exemplary GDSL lipase genes / coding sequences found in Glycine max (Soybean).
[0017] SEQ ID NOs: 34-57 and 433-507 are DNA sequences for exemplary GDSL lipase genes / coding sequences found in Oryza sativa (Rice).
[0018] SEQ ID NOs: 58-79 and 535-599 are DNA sequences for exemplary GDSL lipase genes / coding sequences found in Sorghum bicolor (Great Millet).
[0019] SEQ ID NOs: 80-142 and 610 are DNA sequences for exemplary GDSL lipase genes / coding sequences found in Triticum aestivum (Wheat).
[0020] SEQ ID NOs: 143-164 and 611-633 are DNA sequences for exemplary GDSL lipase genes / coding sequences found in Zea mays (Com).
[0021] SEQ ID NOs: 165-167 and 600-609 are DNA sequences for exemplary GDSL lipase genes / coding sequences found in Thlaspi arvense (Penny cress).
[0022] SEQ ID NOs: 373-379 are DNA sequences for exemplary GDSL lipase genes / coding sequences found in Amborella trichopoda (Amborella).
[0023] SEQ ID NOs: 380-392 and 420-432 are DNA sequences for exemplary GDSL lipase genes / coding sequences found in Gossypium hirsulum (Upland Cotton).
[0024] SEQ ID NOs: 508-534 are DNA sequences for exemplary GDSL lipase genes / coding sequences found in Raphanus sativus (Radish).
[0025] SEQ ID NOs: 340-345 are genomic sequences with UTRs and introns for exemplary GDSL lipase genes found in Glycine max (Soybean) (SEQ ID NO: 340, 3690 bp; coding sequence - SEQ ID NO: 27; protein sequence = SEQ ID NO: 187) (SEQ ID NO: 341, 5643 bp; coding sequence = SEQ ID NO: 30; protein sequence = SEQ ID NO: 190) (SEQ ID NO: 342, 1547 bp; coding sequence = SEQ ID NO: 29; protein sequence = SEQ ID NO: 189) (SEQ ID NO: 343, 4425 bp; coding sequence = SEQ ID NO: 31 ; protein sequence = SEQ ID NO: 191) (SEQ ID NO: 344, 3757 bp; coding sequence = SEQ ID NO: 28; protein sequence = SEQ ID NO: 188) (SEQ ID NO: 345, 4343 bp; coding sequence = SEQ ID NO: 32; protein sequence = SEQ ID No: 192).
[0026] SEQ ID NOs: 168-185 and 639-660 are amino acid sequences for exemplary GDSL lipase proteins found in Brassica napus (Canola).
[0027] SEQ ID NOs: 186-193 and 681-707 are amino acid sequences for exemplary GDSL lipase proteins found in Glycine max (Soybean).
[0028] SEQ ID NOs: 194-217 and 721-795 are amino acid sequences for exemplary GDSL lipase proteins found in Oryza sativa (Rice).
[0029] SEQ ID NOs: 218-239 and 823-887 are amino acid sequences for exemplary GDSL lipase proteins found in Sorghum bicolor (Great Millet).
[0030] SEQ ID NOs: 240-302 and 898 are amino acid sequences for exemplary GDSL lipase proteins found in Triticum aestivum (Wheat).
[0031] SEQ ID NOs: 303-324 and 899-921 are amino acid sequences for exemplary GDSL lipase proteins found in Zea mays (Corn).
[0032] SEQ ID NOs: 325-327 and 888-897 are amino acid sequences for exemplary GDSL lipase proteins found in Thlaspi arvense (Pennycress).
[0033] SEQ ID NOs: 328-334 and 634-638 are amino acid sequences for exemplary GDSL lipase proteins found in Arabidopsis thaliana.
[0034] SEQ ID NOs: 661-667 are amino acid sequences for exemplary GDSL lipase proteins found in Amborella trichopoda (Amborella).
[0035] SEQ ID NOs: 668-680 and 708-720 are amino acid sequences for exemplary GDSL lipase proteins found in Gossypium hirsutum (Upland Cotton).
[0036] SEQ ID NOs: 796-822 are amino acid sequences for exemplary GDSL lipase proteins found in Raphamts sativus (Radish).
[0037] II. Exemplary Loss-of-Function GDSL Lipase Gene Variants
[0038] SEQ ID NOs: 335-336 are exemplary GDSL lipase genes in Arabidopsis thaliana modified by a loss-of-function mutation.
[0039] SEQ ID NOs: 1002-1013 are exemplary GDSL lipase genes in pennycress modified by a loss-of-function mutation. III. Exemplary Promoter Sequences
[0040] SEQ ID NO: 337 is a DNA sequence of an exemplary UBQ10 promoter from Arabidopsis thaliana.
[0041] SEQ ID NO: 338 is a DNA sequence of an exemplary Ubil promoter from maize.
[0042] SEQ ID NO: 339 is a DNA sequence of an exemplary 35S promoter.
[0043] IV. Exemplary Guide Sequences
[0044] SEQ ID NOs: 922-957 are exemplary guide nucleic acid sequences targeting GDSL lipase genes found in pennycress. SEQ ID NOs: 978-1001 are exemplary guide nucleic acid sequences targeting GDSL lipase genes found in soybean.
[0045] V. Exemplary miRNA Sequences
[0046] SEQ ID NOs: 958-977 are exemplary target mRNA sequences, miRNA sequences, and miRNA coding sequences for reducing GDSL lipase expression / activity in pennycress and soybean.
[0047] SUMMARY
[0048] Provided are methods for increasing root and / or shoot biomass in a plant, which can include reducing expression and / or activity of one or more Gly-Asp-Ser-Leu (GDSL)-lipases in the plant, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 different GDSL lipases, thereby increasing root and / or shoot biomass of the plant.
[0049] In some aspects, reducing expression and / or activity of one or more GDSL-lipases includes introducing one or more exogenous nucleic acid molecules into the plant, thereby generating a transformed plant, wherein the one or more exogenous nucleic acid molecules reduce expression of one or more GDSL-lipase genes and / or reduce activity of one or more proteins encoded by the one or more GDSL-lipase genes. In some aspects, reducing expression and / or activity of one or more GDSL-lipases includes introducing one or more exogenous nucleic acid molecules into a plant cell or plant part, thereby generating a gene-edited or transgenic plant cell or plant part; and growing the gene-edited or transgenic plant cell or plant part into a transformed plant, thereby generating a plant with increased root and / or shoot biomass, wherein the one or more exogenous nucleic acid molecules reduce expression of one or more GDSL-lipase genes and / or reduce activity of one or more proteins encoded by the one or more GDSL-lipase genes. In some examples, introducing the one or more exogenous nucleic acid molecules generates one or more deletions of, or one or more loss-of-function mutations in the one or more GDSL-lipase genes. Also provided are transformed, gene-edited, or transgenic plants, plant cells, plant tissues, plant parts, plant progenies, and plantlets generated by the methods provided herein, and have reduced expression and / or activity of one or more GDSL lipases.
[0050] Also provided are methods of producing a commodity plant product, comprising collecting or producing the commodity plant product from the transformed, gene-edited, or transgenic plants, plant cells, plant tissues, plant parts, plant progenies, and plantlets provided herein.
[0051] Also provided are methods of producing plant seed, comprising crossing a transformed, gene-edited, or transgenic plant, plant cell, plant tissue, plant part, plant progeny, and plantlet provided herein with itself or a second plant.
[0052] Also provided are methods for breeding a plant with increased root and / or shoot biomass, which can include crossing the transformed plant provided herein with a second plant; obtaining seed from the crossing; planting the seeds and growing the seeds to progeny plants; and selecting from the progeny plants those with increased root and / or shoot biomass when compared to a control plant.
[0053] Also provided are gene-edited plants, plant parts, or plant cells, and plant seeds including one or more deletions of, or one or more loss-of-function mutations in the one or more GDSL- lipase genes.
[0054] Also provided are isolated and / or recombinant nucleic acid molecules, comprising at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 922-1001.
[0055] The foregoing and other objects and features of the disclosure will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.
[0056] BRIEF DESCRIPTION OF THE DRAWINGS
[0057] Figure 1 shows frequency distribution of root dry weight biomass data obtained from 230 natural accessions of Arabidopsis. The raw dry weight data are log-normalized. The reference wildtype line is indicated as Col-0 on the graph.
[0058] Figure 2 is a Manhattan plot that depicts the genome-wide association (GWA) mapping results for the root dry weight biomass of 21 -day-old natural accessions of Arabidopsis grown under long day conditions. The horizontal dash-dot line represents a 5% false discovery rate threshold for two correction methods (Bonferroni and Benjamini-Hochberg). The rectangular box indicates proximity to the GDSL-Lipase gene clusters. Figure 3 shows divergence in root dry weight biomass between a wildtype Arabidopsis and T-DNA insertion Arabidopsis lines for four different GDSL-Lipases. The X-axis denotes the sample ID, and the Y-axis represents the dry weight biomass value in grams.
[0059] Figure 4 shows divergence in root dry weight biomass between a wildtype Arabidopsis and T-DNA insertion Arabidopsis lines for six different GDSL-Lipases. The X-axis denotes the sample ID, and the Y-axis represents the dry weight biomass value in grams. Multiple T-DNA insertion lines were used for each GDSL-Lipase gene. T-DNA insertion lines for the same GDSL-Lipase gene are grouped together.
[0060] Figure 5 shows divergence in root dry weight biomass between a wildtype Arabidopsis and T-DNA insertion Arabidopsis lines for six different GDSL-Lipases after a six-week period of hydroponic growth. The X-axis denotes the sample ID, and the Y-axis represents the dry weight biomass value in grams. A single representative T-DNA insertion line was used for each GDSL- Lipase gene.
[0061] Figures 6A and 6B show genetic edits generated by CRISPR / Cas9 that knockout GDSL lipase genes in Arabidopsis. Figure 6A shows a one-nucleotide insertion (T) in a GDSL lipase gene (SEQ ID NO: 335) produced by Crispr / Cas9 to knock out GDSL lipase, which is absent in the reference line (CoLO). Figure 6B shows a 27-nucleotide deletion in a GDSL lipase gene (SEQ ID NO: 336), produced by Crispr / Cas9 to knock out GDSL lipase gene, which is absent in the reference line (Col-O).
[0062] Figures 7A and 7B show the impact of knocking out GDSL lipase genes by CRISPR / Cas9 on root phenotypes. The roots of the 7 -gene knockout lines were longer after a 7 -day period of growth on plates under long day conditions, as compared to the reference lines (Figure 7A). The roots of the two 7-gene knockout lines (7-KD-l, 7-KD-2) were longer after a 10-day period of growth on plates under long day conditions, as compared to the reference line (Col-0), and lines with one GDSL lipase gene knocked out (GDSL-1, GDSL-2, GDSL-5, GDSL-6).
[0063] Figure 8: Image showing representative Arabidopsis plants from six GDSL lipase mutant lines (gdsl-1, gdsL2, gdsL3, gdsl-4, gdsl-5, and gdsl-6) and a wildtype line (CoLO), grown on Turface in the greenhouse and harvested after 8 weeks of growth. All plants from the mutant lines exhibited increased root and shoot growth compared to the wildtype plant.
[0064] Figures 9A and 9B: Bar graphs showing root (9A) and shoot (9B) dry biomass (g) for 8- week-old plants from the mutant and wildtype lines as described in Figure 8. All GDSL lipase mutant lines displayed significantly higher shoot and root biomass compared to the wildtype line.
[0065] Figures 10A-10C: Bar graphs showing that all GDSL lipase mutant lines (gdsl-1, gdsl-2, gdsl-3, gdsl-4, gdsl-5, and gdsl-6) demonstrated increased primary root length, and increased total suberized area, compared to the wildtype line (Col-0) after 7 days of growth under long-day conditions. 10A shows primary root length at day 7, where all mutant lines exhibited significantly longer primary roots compared to the wildtype. 10B shows the total suberized regions, where all mutant lines exhibited significantly increased total suberized regions compared to the wildtype. IOC shows the suberized regions relative to the root length, where the mutant lines did not show increased suberized regions relative to total root length as compared to the wildtype.
[0066] Figure 11: Images of representative Arabidopsis seedlings from a wildtype line (Col-0) and two GDSL lipase mutant lines that have seven GDSL lipase genes knocked out, demonstrating increased root and shoot biomass phenotypes of the GDSL lipase mutant lines. Two independent lines (K0-7-R1, and KO-7-R2), each carrying knockouts of seven GDSL lipase genes, were evaluated alongside the wildtype. Seedlings were germinated on V2 MS media under long day conditions and grown for 21 days.
[0067] Figures 12A and 12B: Bar graphs showing root (12A) and shoot (12B) dry biomass (g) for 21-day-old seedlings of Col-0, gdsl-1, gdsl-2, gdsl-3, gdsl-4, gdsl-5, gdsl-6, K0-7-R1, and KO-7- R2 lines. K0-7-R1, and KO-7-R2 lines accumulated significantly greater biomass in both root and shoot tissues compared to both the wildtype and the single mutant lines.
[0068] Figure 13 shows a vector for expressing a Cas protein and two gRNAs simultaneously targeting two regions of the same or different GDSL lipase genes to introduce loss-of-function mutations in, e.g., pennycress.
[0069] Figure 14 shows a vector for expressing a Cas protein and thirty-two gRNAs simultaneously targeting thirty-two regions of multiple different GDSL lipase genes to introduce loss-of-function mutations in, e.g., penny cress.
[0070] Figures 15A and 15B show comparison of coding sequences of loss-of-function GDSL lipase mutants generated using the vectors and gRNAs provided herein, and the corresponding wildtype GDSL lipase coding sequence.
[0071] Figure 16 shows the complementarity between the guide strand and target mRNA, and the stem loop structure of a-miRl,5,7,8,9.
[0072] Figure 17 shows the complementarity between the guide strand and target mRNA, and the stem loop structure of a-miR2_3.
[0073] Figure 18 shows the complementarity between the guide strand and target mRNA, and the stem loop structure of a-miR4.
[0074] Figure 19 shows the complementarity between the guide strand and target mRNA, and the stem loop structure of a-miR6. Figure 20 shows the complementarity between the guide strand and target mRNA, and the stem loop structure of a-miR-Gm.
[0075] Figure 21 illustrates exemplary designs of transgene cassettes capable of suppressing gene expression of specific GDSL lipases in pennycress or soybean. Each design includes one or multiple miRNA coding sequences, a strong constitutive or root-specific promoter, and a standard Pol II terminator of transcription.
[0076] Figure 22 shows a vector for expressing a Cas protein and two gRNAs simultaneously targeting two regions of the same or different GDSL lipase genes to introduce loss-of-function mutations in, e.g., soybean, using a Ruby screening marker.
[0077] Figure 23 shows a vector for expressing a Cas protein and two gRNAs simultaneously targeting two regions of the same or different GDSL lipase genes to introduce loss-of-function mutations in, e.g., soybean, using a dsRed screening marker.
[0078] Figure 24: Images showing rice plants grown in gel cylinder and Turface-filled pot system.
[0079] DETAILED DESCRIPTION
[0080] I. Summary of Terms
[0081] Unless otherwise noted, technical terms are used according to conventional usage. Definitions of many common terms in molecular biology may be found in Krebs et al. (eds.), Lewin’s genes XII, published by Jones & Bartlett Learning, 2017. As used herein, the singular forms “a,” “an,” and “the,” refer to both the singular as well as plural, unless the context clearly indicates otherwise. For example, the term “a cell” includes singular or plural cells and can be considered equivalent to the phrase “at least one cell.” As used herein, the term “comprises” means “includes.” For example, reference to “comprising a plant” includes one or a plurality of such plants. It is further to be understood that any and all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for descriptive purposes, unless otherwise indicated. Although many methods and materials similar or equivalent to those described herein can be used, particular suitable methods and materials are described herein. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
[0082] In some examples, the numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth, used to describe and claim certain embodiments are to be understood as being modified in some instances by the term “about” or “approximately.” For example, “about” or “approximately” can indicate + / - 10% variation of the value it describes. Accordingly, in some embodiments, the numerical parameters set forth herein are approximations that can vary depending upon the desired properties sought to be obtained by a particular embodiment. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some examples are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable. The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range.
[0083] To facilitate review of the various aspects, the following explanations of terms are provided: Backcross: The mating of a hybrid to one of its parents. For example hybrid progeny, for example a first generation hybrid (Fi), can be crossed back one or more times to one of its parents. Backcrossing can be used to introduce one or more single locus conversions (such as one or more desirable traits) from one genetic background into another.
[0084] Biomass: The organic matter derived from an organism, such as a plant or part thereof, for example the roots, or the shoots (referred to as root biomass, or shoot biomass, respectively). In some examples, shoot biomass is synonymous with above-ground biomass, which refers to all the above ground plant material at a particular point of time, thus including the leaves, stems and possibly flowers (at varying stages of development given the flowering period ranges over a period of time). Above-ground biomass can include all vegetative and reproductive material produced by the plant at time of harvest. Below-ground biomass refers to all plant material found below the soil surface, primarily roots and sometimes underground stems (including bulbs, corms, rhizomes, stolons, and tubers). Below-ground biomass is synonymous with root biomass when the plant only has roots below the soil surface. In some examples, root biomass refers to all the below ground plant material at a particular point of time.
[0085] Cell: Cell as used herein includes a plant cell, whether isolated, in tissue culture or incorporated in a plant or plant part. In some examples a cell is gene-edited, e.g., it has a nucleic acid and / or protein sequence not found in nature (e.g., a mutated GDSL sequence). In some examples a cell is recombinant / transformed / transgenic, e.g., it includes an exogenous nucleic acid molecule.
[0086] Codon optimization: When the codon usage of a DNA or RNA is adapted to that of a cell or organism of interest to improve the transcription rate of said recombinant nucleic acid in the cell or organism of interest. A target nucleic acid can be modified at one position due to the codon degeneracy, whereas this modification will still lead to the same amino acid sequence at that position after translation, which is achieved by codon optimization to take into consideration the species-specific codon usage of a target cell or organism. Complementarity: The ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick base pairing or other non- traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). "Perfectly complementary" means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. "Substantially complementary" as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
[0087] Control: Refers to a plant, plant part, or plant cell that has a similar (or the same) genetic makeup and / or phenotypic traits as a treated plant, plant part, or plant cell before receiving the treatment. The treatment, for example, can include gene editing resulting in one or more modifications in one or more genes, expression of an exogenous gene, or RNAi treatment that reduces targeted mRNA translation. In some aspects, the control plant, plant part, or plant cell is wild-type with respect to the gene(s) being modified by the treatment, or is wild-type.
[0088] Clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR associated (Cas) systems: CRISPR-Cas is an adaptive immune system existing in most bacteria and archaea, preventing them from being infected by phages, viruses and other foreign genetic elements. It comprises CRISPR repeat-spacer arrays, which upon transcription generates CRISPR RNA (crRNA) and optionally trans-activating CRISPR RNA (tracrRNA), and a set of Cas genes which encode Cas proteins with endonuclease activity. CRISPR-Cas systems can be classified into 2 classes (Class 1 and Class 2), 6 types (I to VI) and several subtypes, with multi-Cas protein effector complexes in Class 1 systems (Type I, III, and IV) and a single effector protein in Class 2 systems (Type II, V, and VI). CRISPR / Cas systems can be used for nucleic acid (DNA and RNA) targeting or editing, for example to detect a target nucleic acid, or cut or modify a target nucleic acid at any desired location (including adding, disrupting or changing the sequence of specific genes).
[0089] The CRISPR repeat-spacer array (or CRISPR array) is a defining feature of CRISPR-Cas systems. The term “CRISPR” refers to the architecture of the array which includes constant direct repeats (DRs) interspaced with the variable spacers. In some examples, a CRISPR array includes at least a DR-spacer-DR-spacer. Cas proteins provide the enzymatic machinery required for acquiring new spacers targeting invading elements and cleaving these elements upon subsequent encountering. Numerous Cas proteins such as Cas9, Cas 12 (Cpfl), and Cas 13 have been exploited to develop new tools for genome engineering.
[0090] Cas9 cleaves DNA and possesses two nuclease domain (HNH and RuvC), each cleaving one strand of the target double-stranded DNA. Catalytically inactive (deactivated) Cas9 (dCas9) is also encompassed by this disclosure. In some examples, a dCas9 includes one or more of the following point mutations: D10A, 5 H840A, and N863A. Cas proteins Cas9 nucleic acid and protein sequences are publicly available. For example, GenBank® Accession Nos. nucleotides 796693..800799 of CP012045.1 and nucleotides 1100046..1104152 of CP014139.1 disclose Cas9 nucleic acids, and GenBank® Accession Nos. AMA70685.1 and AKP81606.1 disclose Cas9 proteins. In some examples, the Cas9 is a deactivated form of Cas9 (dCas9), such as one that is nuclease deficient (e.g., those shown in GenBank® Accession Nos. AKA60242.1 and KR011748.1). In certain examples, Cas9 has at least 80% sequence identity, for example at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to such sequences, and retains the ability to cut DNA.
[0091] CRISPR RNA (crRNA): The RNA strand responsible for hybridizing with target DNA sequences, and recruiting CRISPR endonucleases and / or CRISPR-associated effectors. crRNAs may be naturally occurring, or may be artificially synthesized.
[0092] Cross: Synonymous with hybridize or crossbreed.; includes the mating of genetically different individual plants, such as the mating of two parent plants.
[0093] Cross-pollination: Fertilization by the union of two gametes from different plants.
[0094] Deletion: Elimination of a nucleic acid sequence from an organism's genome. Deletions can vary in size, ranging from small deletions involving a few nucleotides to large deletions encompassing one or more entire genes.
[0095] Endogenous: With reference to a nucleic acid and / or protein refers to the nucleic acid and / or protein in question as found in a plant in its natural form (i.e., without any human intervention). “Endogenous” is synonymous with “native” as used herein. An endogenous gene can include alleles of naturally occurring genes that have been mutated according to any of the methods of the present disclosure, i.e, an endogenous gene could have been modified at some point by traditional plant breeding methods and / or next generation plant breeding methods.
[0096] Exogenous: As used herein with reference to a nucleic acid molecule, protein, vector, or cell, refers to any such molecule / cell that does not originate from that particular cell or plant as found in nature. Thus, a non-naturally-occurring nucleic acid or vector is exogenous to a cell once introduced into the cell. An "exogenous" nucleic acid can either not occur in a plant in its natural form, be different from the nucleic acid in question as found in a plant in its natural form, or can be identical to a nucleic acid found in a plant in its natural form, but integrated not within their natural genetic environment. For example, a promoter may be endogenous to plant A, but exogenous to plant B. In one example, a recombinant plant / plant part / cell provided herein includes an exogenous nucleic acid specific for a GELP gene (e.g., a RNAi molecule, a guide RNA, or a coding sequence for a GELP gene repressor).
[0097] Expression: Refers to the production of a functional gene product, e.g., an mRNA or a protein (precursor or mature).
[0098] Fi hybrid: The first generation progeny of the cross of two stable parents that are nonisogenic or isogenic plants.
[0099] Fragment: The terms “at least a portion” or “fragment” of a nucleic acid or protein means a portion having the minimal size characteristics of such sequences, or any larger fragment of the full-length molecule, up to and including the full-length molecule. A fragment may be a C- terminal fragment, N-terminal fragment, or an internal fragment that lies anywhere between the C- terminal and N-terminal amino acids. In some aspects, a fragment of a GELP gene comprises no more than 1000, 950, 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 300, 250, 200, 150, 140, 130, 120, 110, or 100, and / or no less than 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 200, 250, or 300 contiguous nucleic acids of a full-length GELP gene, such as any of those set forth in SEQ ID NOs: 1-167 and 340-633. In some aspects, a fragment of a GELP gene is a N-terminal fragment including the N-terminal nucleic acid of a full-length GELP gene. In some aspects, a fragment of a GELP gene is a C-terminal fragment including the C-terminal nucleic acid of a full-length GELP gene. In some aspects, a fragment of a GELP gene is an internal fragment including neither the C-terminal nor N-terminal nucleic acid of a full-length GELP gene. In some aspects, a fragment of a GELP gene may encode a biologically active portion of a full-length GELP protein, such as any of those set forth in SEQ ID NOs: 168-334 and 634-921. In some aspects, a fragment of a GELP gene encodes no more than 350, 340, 330, 320, 310, 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, or 30 and / or no less than 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, or 80 contiguous amino acids of a full-length GELP protein. In some aspects, a biologically active portion of a full- length GELP protein encoded by a fragment of a GELP gene is a C-terminal, N-terminal, or internal fragment of the full-length GELP protein. A functional fragment is a fragment that retains one or more functions or activities of the corresponding full-length nucleic acid or protein at a desirable level (e.g., at least 60%, 70%, 80%, 90%, 95%, 99%, or 100% of the level provided by the full-length molecule).
[0100] Gene editing: Modifying a genome of an organism, including mutating one or more genomic nucleotides, deleting one or more genomic nucleotides, adding one or more nucleotides into the genome, replacing a genomic sequence with an exogenous sequence, inserting an exogenous sequence into the genome, and any combination thereof. Gene editing can be achieved, for example, by using engineered nucleases, which create site-specific double-strand breaks (DSBs) at desired locations in the genome, and whose improper repair by endogenous natural mechanisms results in an altered / non-native genomic sequence. The induced DSBs may be repaired through nonhomologous end-joining (NHEJ) or homologous recombination (HR), resulting in targeted mutations or deletions of a genomic sequence, or insertion of an exogenous sequence into the genome. Thus, the resulting genome is one that does not occur in nature. In some examples, gene editing results in the introduction of an exogenous transgene into the genome of a plant, plant part, or plant cell, such as a coding sequence for a GELP gene repressor, or a sequence that generates a RNAi molecule. Such gene editing can be achieved by, for example, Agrobacterium-mediated plant transformation. In other examples, a plant, plant part, or plant cell is edited using an exogenous nucleic acid molecule (e.g., a CRISPR / Cas vector) specific for an endogenous gene (such as a GELP gene), thereby altering the endogenous sequence of the gene, such as generating a loss-of-function mutation in the gene, but the exogenous nucleic acid molecule is not integrated into the genome of the gene-edited plant, plant part, or plant cell. In either case, such edited plants, plant parts, and plant cells are referred to as gene-edited plants, gene-edited plant parts, and gene- edited plant cells, respectively. In some examples, the gene-edited plants, plant parts or plant cells are transgene-free. Gene editing in a plant can be used, for example, to confer a desirable trait to the plant, such as drought resistance, flooding resistance, erosion resistance, resistance to pests, increased carbon sequestration, or increased root biomass.
[0101] Gene inactivation / down-regulation / silencing: When used in reference to the expression of a gene (e.g., GELP), refers to any process which results in a decrease in production of a gene product and / or a decrease in its biological activity, such as a decrease of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, or 85%. A gene product can be an RNA or a protein. A gene is silenced or knocked out when its expression is significantly reduced (e.g., a reduction of at least 90%, at least 95%, or at least 99%) or even prevented. A gene is knocked down when its expression is reduced but not completely eliminated.
[0102] Gene inactivation, down-regulation, or silencing includes processes that decrease transcription of a gene (mRNA level), stability or translation of mRNA (protein level), and / or activity of protein. In some examples, a mutation, such as a substitution, partial or complete deletion, insertion, or other variation, can be made to a gene sequence that significantly reduces (and in some cases eliminates) production of a gene product or renders a gene product substantially or completely non- functional.
[0103] In some examples, the target of gene inactivation, down-regulation, or silencing is genomic DNA, such as a coding DNA for a GELP protein or a GELP regulator such as an activator. CRISPR / Cas systems may be used to introduce the desired mutation or deletion to genomic DNA. For example, to generate a knockout line, CRISPR / Cas9 can be used to homozygously introduce double-strand breaks in target genomic regions. Non-homologous end-joining fixes these doublestrand breaks, but results in insertions and / or deletions (INDELs) during the process. INDELs in target exons generate a premature termination codon (PTC) in mRNA by changes in the readingframe, which induces degradation of nascent mRNAs with a PTC by the nonsense-mediated decay (NMD) system.
[0104] In some examples, the target of gene inactivation, down-regulation, or silencing is mRNA. Translation and / or stability of mRNA can be reduced to decrease the level of protein, for example, by RNAi technology.
[0105] In some examples, gene inactivation, down-regulation, or silencing leads to a decrease in a detectable level or activity of a mRNA or protein encoded by a target gene (e.g., a GELP gene) in a plant, plant part or plant cell of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% (such as a decrease of 40% to 90%, 40% to 80% or 50% to 95%) as compared to a control (such as a level or activity of mRNA or protein detected in a corresponding wild-type plant, plant part, or plant cell).
[0106] Genome: All genetic material of an organism (such as a plant), including nuclear genome and organelle genome and excluding artificially introduced nucleic acid molecules not integrated into a chromosome.
[0107] Genotype: The genetic constitution of a cell, an organism, or an individual (i.e., the specific allele makeup of the individual) usually with reference to a specific character under consideration.
[0108] Gly-Asp-Ser-Leu (GDSL) esterase / lipase (GELP; GDSL lipase):
[0109] GELPs (or GDSL lipases) as used herein includes both GELP genes and GELP proteins. GELP genes as used herein include one or more native GELP genes or fragments thereof, and / or one or more orthologous GELP genes or fragments thereof. GELP proteins as used herein includes one or more native GELP proteins or fragments thereof, and / or one or more orthologous GELP proteins or fragments thereof. Native GELP genes as used herein refer to GELP genes found in the genome of the present plant or other plants within the same species, without or before any artificial genetic modification to GELP genes; native GELP proteins refer to proteins encoded by these genes. Orthologous GELP genes as used herein refer to non-native GELP genes, which may be found in the genomes of plants not within the same species as the present plant, or may be artificial mutants or variants of naturally occurring GELP genes; orthologous GELP proteins refer to proteins encoded by these genes.
[0110] GELPs constitute a subfamily of lipases with a wide range of substrate specificities including thioesters, aryl esters, and phospholipids. GELPs contain a conserved GDS(L) motif such as GDS, GDSL, or GDSxxDxG that distinguish them from classic lipolytic enzymes that contain a conserved motif GxSxG. Different plants have different numbers of GELPs, for example, a total of 105 GELPs for Arabidopsis thaliana, 121 for Brassica rapa, 96 for Fragaria vesca, 194 for Glycine max, 150 for Malus domes tica, 114 for Oryza sativa, 70 for Primus avium, 90 for Prunus mume, 97 for Prunus persica, 94 for Pyrus bretschneideri, 83 for Vitis vinifera, 103 for Zea mays, according to whole genome studies (Shen, Gaodian et al. “Plant GDSL Esterases / Lipases: Evolutionary, Physiological and Molecular Functions in Plant Development.” Plants (Basel, Switzerland) vol. 11,4 468. 9 Feb. 2022, doi:10.3390 / plantsl 1040468).
[0111] GELP proteins include any protein that comprises at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence identity to any of the sequence set forth in SEQ ID NOs: 168-334 and 634-921, and in some examples retain GELP activity. In some aspects, the GELP proteins include a GDS, GDSL, or GDSxxDxG motif, wherein x is any naturally-occurring amino acid.
[0112] GELP genes include any nucleic acid sequence that encodes any of the above GELP proteins. In some aspects, GELP genes include any gene that comprises at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence identity to any sequence set forth in SEQ ID NOs: 1-167, 340-633, and in some examples encode a protein with GELP activity. Exemplary loss-of-function GELP nucleic acids that significantly reduce or inhibit GELP activity include that comprises at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence identity to SEQ ID NO: 335 or 336, which retain the mutations therein (e.g., addition of T or deletion of 27 nt). Exemplary loss-of-function GELP nucleic acids that significantly reduce or inhibit GELP activity include that comprises at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence identity to any one of SEQ ID NOs: 1002- 1013, which retain the mutations therein.
[0113] Growing or regeneration: Growing a whole, differentiated plant from a plant cell, a group of plant cells, a plant part (including seeds), or a plant piece (e.g., from a protoplast, callus, or tissue part).
[0114] Guide sequence / nucleic acid: A polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a nuclease (such as a DNA endonuclease, such as a Cas protein) to the target sequence (such as a GELP gene), and / or any polynucleotide sequence providing for such a polynucleotide sequence. Guide sequence / nucleic acid as used herein can refer to the final product (e.g., guide RNA or gRNA) that binds with a nuclease and hybridizes with a target sequence, optionally any nucleic acid intermediate / precursor that can be processed into the final product, and / or the DNA sequence from which the final product or the intermediate / precursor is transcribed. A guide sequence / nucleic acid may be a single nucleic acid molecule or comprise multiple nucleic acid molecules. In one aspect, a guide nucleic acid comprises two parts, one being or encoding for a CRISPR RNA (crRNA), a sequence complementary to the target DNA, the other being or encoding for a trans-activating CRISPR RNA (tracrRNA), serving as a binding scaffold for a Cas endonuclease (e.g., Cas9). In another aspect, the guide nucleic acid is a single RNA molecule, e.g., single guide RNA (sgRNA), a synthetic crRNA / tracrRNA hybrid. In yet another aspect, the guide nucleic acid is a single crRNA that functions together with a Cpfl endonuclease.
[0115] A guide nucleic acid can include modified bases or chemical modifications (e.g., see Latorre et al., Angewandte Chemie 55:3548-50, 2016).
[0116] In some aspects, the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, nonlimiting example of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows -Wheeler Transform e.g., the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). In some aspects, a guide sequence is about, or at least about, 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some aspects, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length. In some embodiments, a guide sequence is 15-25 nucleotides (such as 18-22 or 18 nucleotides). In some aspects, a guide sequence for targeting one or more GDSL lipase genes in pennycress comprises at least 85%, at least 90%, or at least 95% sequence identity to any one of SEQ ID NOs: 922-957. In some aspects, a guide sequence for targeting one or more GDSL lipase genes in pennycress comprises or consists of any one of SEQ ID NOs: 922-957. ). In some aspects, a guide sequence for targeting one or more GDSL lipase genes in soybean comprises at least 85%, at least 90%, or at least 95% sequence identity to any one of SEQ ID NOs: 978-1001. In some aspects, a guide sequence for targeting one or more GDSL lipase genes in soybean comprises or consists of any one of SEQ ID NOs: 978-1001.
[0117] The ability of a guide sequence to direct sequence- specific binding of a CRISPR complex to a target sequence may be assessed by a suitable assay. For example, the components of a CRISPR system sufficient to form a CRISPR complex, including the guide sequence to be tested, may be provided to a host cell having the corresponding target sequence, such as by transfection with vectors encoding the components of the CRISPR sequence, followed by an assessment of preferential cleavage within the target sequence, such as by Surveyor assay. Similarly, cleavage of a target polynucleotide sequence may be evaluated in a test tube by providing the target sequence, components of a CRISPR complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions.
[0118] Heterologous: A substance coming from some source or location other than its native source or location. A heterologous nucleic acid can refer to a nucleic acid sequence that is not naturally found in the particular organism. In one example, a “heterologous promoter” refers to a promoter that has been taken from one source organism and utilized in another organism, in which the promoter is not naturally found. In another example, a “heterologous promoter” refers to a promoter that is from within the same source organism, but has merely been moved to a novel location, in which said promoter is not normally located. Heterologous gene sequences can be introduced into a cell (such as a plant cell) by using an “expression vector,” which can be a eukaryotic expression vector, for example a plant expression vector. Methods used to construct vectors are known and described in various publications. In particular, techniques for constructing suitable vectors, including a description of the functional components such as promoters, enhancers, termination and polyadenylation signals, selection markers, origins of replication, and splicing signals, are known. Homologous sequences / homologs: With reference to a gene or gene products, nucleic acids and proteins thought, believed, or known to be functionally related. A functional relationship may be indicated by, for example (a) degree of sequence identity and / or (b) the same or similar biological function. Homology can be determined using software programs readily available in the art, such as those discussed in Current Protocols in Molecular Biology (F.M. Ausubel el al., eds., 1987) Supplement 30, section 7.718, Table 7.71. Some alignment programs are MacVector (Oxford Molecular Ltd, Oxford, U.K.) and ALIGN Plus (Scientific and Educational Software, Pennsylvania). Other non-limiting alignment programs include Sequencher (Gene Codes, Ann Arbor, Michigan), AlignX, and Vector NTI (Invitrogen, Carlsbad, CA).- Homologous genes / proteins become separated in evolution in two possible ways: separation of two populations with the ancestral gene into two species or gene duplication of the ancestral gene within a lineage. Genes / proteins separated by speciation are called orthologs. Genes / proteins separated by gene duplication events are called paralogs.
[0119] Increase or decrease: A statistically significant positive or negative change, respectively, in quantity from a control value, such as an increase in root biomass, shoot biomass, or suberized region. An increase is a positive change, such as an increase at least 50%, at least 100%, at least 200%, at least 300%, at least 400% or at least 500% as compared to the control value. A decrease is a negative change, such as a decrease of at least 20%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 100% decrease as compared to a control value. In some examples the decrease is less than 100%, such as a decrease of no more than 90%, no more than 95% or no more than 99%. In some examples, the control value is a value or range of values expected for the same plant that is not treated or gene-edited, e.g., a wild-type plant (e.g., if the test plant is a gene-edited canola plant, the control can be a native or wild-type canola plant of the same variety).
[0120] Isolated: An “isolated” biological component (such as a protein, nucleic acid, guide sequence, or cell) has been substantially separated, produced apart from, or purified away from other biological components in the cell or tissue of a plant in which the component occurs, such as other cells, chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic acids and proteins that have been “isolated” include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids and proteins. Isolated inhibitory nucleic acid molecules (such as guide nucleic acids or vector comprising such), or cells containing such, in some examples are at least 50% pure, such as at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100% pure. Loss-of-function mutation: A genetic mutation (including substitution, insertion, deletion, inversion, etc.) that leads to a reduction or complete loss of the normal function of the gene in which the mutation occurs. The normal function of a gene includes being transcribed into mRNAs which are translated into proteins with normal activity. In some examples, a loss-of-function mutation reduces or eliminates transcription of the gene, for example, by causing a loss of interaction between the gene and the transcriptional machinery. In some examples, a loss-of- function mutation results in the production of a completely nonfunctional protein, or a protein with a reduced function, compared to the protein encoded by the gene before the mutation.
[0121] Next generation plant breeding: Refers to a host of plant breeding tools and methodologies that are available to a plant breeder. One distinguishing feature of next generation plant breeding is that the breeder is no longer confined to relying upon observed phenotypic variation, in order to infer underlying genetic causes for a given trait. Rather, next generation plant breeding can include the utilization of molecular markers and marker assisted selection (MAS), such that the breeder can directly observe movement of alleles and genetic elements of interest from one plant in the breeding population to another, and is not confined to merely observing phenotype. Further, next generation plant breeding methods are not confined to utilizing natural genetic variation found within a plant population. Rather, the breeder utilizing next generation plant breeding methodology can access a host of modern genetic engineering tools that directly alter / change / edit the plant’s underlying genetic architecture in a targeted manner, in order to bring about a phenotypic trait of interest. In aspects, the plants bred with a next generation plant breeding methodology are indistinguishable from a plant that was bred in a traditional manner, as the resulting end product plant could theoretically be developed by either method. In particular aspects, a next generation plant breeding methodology may result in a plant that comprises: a genetic modification that is a deletion or insertion of any size; a genetic modification that is one or more base pair substitution; a genetic modification that is an introduction of nucleic acid sequences from within the plant’s natural gene pool (e.g. any plant that could be crossed or bred with a plant of interest) or from editing of nucleic acid sequences in a plant to correspond to a sequence known to occur in the plant’s natural gene pool; and offspring of said plants.
[0122] Naturally occurring: As applied to a nucleic acid, a polypeptide, a cell, or an organism, refers to a nucleic acid, polypeptide, cell, or organism that is found in nature. The term “naturally occurring” may refer to a gene or sequence derived from a naturally occurring source.
[0123] Non-naturally occurring or engineered: Terms used herein as interchangeably and indicate the involvement of the hand of man. The terms, when referring to nucleic acid molecules or polypeptides indicate that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature. In addition, the terms can indicate that the nucleic acid molecules or polypeptides have a sequence not found in nature. Thus, for the purposes of this disclosure, a “non-naturally occurring” sequence is a sequence that has been synthesized, mutated, engineered, edited, or otherwise modified to have a different sequence from known natural sequences. In some embodiments, the modification may be at the protein level (e.g., amino acid substitutions). In other embodiments, the modification may be at the DNA level (e.g., nucleotide substitutions).
[0124] Nucleotide change / nucleotide modification: Refers to, e.g., nucleotide substitution, deletion, and / or insertion, as is well understood in the art. For example, such nucleotide changes / modifications include mutations containing alterations that produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded protein or how the proteins are made. As another example, such nucleotide changes / modifications include mutations containing alterations that produce replacement substitutions, additions, or deletions, that alter the properties or activities of the encoded protein or how the proteins are made.
[0125] Offspring: Refers to any plant resulting as progeny from a vegetative or sexual reproduction from one or more parent plants or descendants thereof. For instance, an offspring plant may be obtained by cloning or selfing of a parent plant (or a plant of Fl, F2, or still further generations), or by crossing two parent plants (or a plant of Fl, F2, or still further generations). An offspring of Fl generation is a first- generation offspring produced from parents. Subsequent generations, denoted as F2, F3, and so forth, arise from selfing or crossing within the preceding generation. In some examples, an Fl may be (and usually is) a hybrid resulting from a cross between two true breeding parents (true breeding referring to homozygous for a trait), while an F2 may be (and usually is) an offspring resulting from self-pollination of the Fl hybrids.
[0126] Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. In some examples, a promoter is operably linked to a nucleic acid sequence (such as a guide nucleic acid sequence or a coding sequence) if the promoter controls the transcription or expression of the nucleic acid sequence. In some examples, operably linked DNA sequences are contiguous and, where necessary join two protein-coding regions in the same reading frame. In some examples, coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation.
[0127] Ortholog: Refers to genes in different species that evolved from a common ancestral gene by speciation. Normally, orthologs retain the same or similar function in the course of evolution. Identification of orthologs is useful for reliable prediction of gene function in newly sequenced genomes.
[0128] Plant: Includes reference to an immature or mature whole plant, including a plant from which seed, roots, or leaves have been removed. Seeds or embryos that will produce a plant is also considered to be the plant. In some examples, the plants (including seeds and embryos) can include one or more exogenous nucleic acid molecules encoding a repressor that reduces expression of one or more GELP genes. In some examples, the plants (including seeds and embryos) can include one or more loss-of-function mutations in one or more GELP genes or GELP gene activators. In some examples, the seeds can develop into plants with increased root biomass, as compared to a control plant, such as a wild-type plant.
[0129] Any commercially or scientifically valuable plant can be used in accordance with this disclosure. Exemplary plants include plants belonging to the super family Viridiplantae, such as monocotyledonous and dicotyledonous plants including a fodder or forage legume, ornamental plant, food crop, tree, or shrub, such as Acacia spp., Acer spp., Actinidia spp., Aesculus spp., Agathis australis, Albizia amara, Alsophila tricolor, Andropogon spp., Arachis spp, Areca catechu, Asteliafragrans, Astragalus cicer, Baikiaea plurijuga, Betula spp., Brassica spp., Bruguiera gymnorrhiza, Burkea africana, Buteafrondosa, Cadaba farinosa, Calliandra spp, Camellia sinensis, Canna indica, Capsicum spp., Cassia spp., Centroema pubescens, Chacoomeles spp., Cinnamomum cassia, Coffea arabica, Colophospermum mopane, Coronillia varia, Cotoneaster serotina, Crataegus spp., Cucumis spp., Cupressus spp., Cyathea dealbata, Cydonia oblonga, Cryptomeria japonica. Cymbopogon spp., Cynthea dealbata, Cydonia oblonga, Dalbergia monetaria, Davallia divaricata, Desmodium spp., Dicksonia squarosa, Dibeteropogon amplectens, Dioclea spp, Dolichos spp., Dorycnium rectum, Echinochloa pyramidalis, Ehraffia spp., Eleusine coracana, Eragrestis spp., Erythrina spp., Eucalyptus spp., Euclea schimperi, Eulalia vi / losa, Pagopyrum spp., F ijoa sellowlana, Fragaria spp., Flemingia spp, Freycinetia banksli, Geranium thunbergii, GinAgo biloba, Glycine javanica, Gliricidia spp, Gossypium hirsutum, Grevillea spp., Guibourtia coleosperma, Hedysarum spp., Hemaffhia altissima, Heteropogon contoffus, Hordeum vulgare, Hyparrhenia rufa, Hypericum erectum, Hypejf'helia dissolute, Indigo incamata, Iris spp., Leptarrhena pyrolifolia, Lespediza spp., Lettuca spp., Leucaena leucocephala, Loudetia simplex, Lo tonus bainesli, Lotus spp., Macro tyloma axillare, Malus spp., Manihot esculenta, Medicago saliva, Metasequoia glyptostroboides, Musa sapientum, Nicotianum spp., Onobrychis spp., Ornithopus spp., Oryza spp., Peltophorum africanum, Pennisetum spp., Per sea gratis sima, Petunia spp., Phaseolus spp., Phoenix canadensis, Phormium cookianum, Photinia spp., Picea glauca, Pinus spp., Pisum sativum, Podocarpus totara, Pogonarthria fleckii, Pogonaffhria squarrosa, Populus spp., Prosopis cineraria, Pseudotsuga menziesii, Pterolobium stellatum, Pyms communis, Quercus spp., Rhaphiolepsis umbellata, Rhopalostylis sapida, Rhus natalensis, Ribes grossularia, Ribes spp., Robinia pseudoacacia, Rosa spp., Rubus spp., Salix spp., Schyzachyrium sanguineum, Sciadopitys vefficillata, Sequoia sempervirens, Sequoiadendron giganteum, Sorghum bicolor, Spinacia spp., Sporobolus fimbriatus, Stiburus alopecuroides, Stylosanthos humilis, Tadehagi spp, Taxodium distichum, Themeda triandra, Trifolium spp., Triticum spp., Tsuga heterophylla, Vaccinium spp., Vicia spp., Vitis vinifera, Watsonia pyramidata, Zantedeschia aethiopica, Zea mays, amaranth, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, canola, carrot, cauliflower, celery, collard greens, flax, kale, lentil, oilseed rape, okra, onion, potato, rice, soybean, straw, sugar beet, sugar cane, sunflower, tomato, squash tea, maize, wheat, barley, rye, oat, peanut, pea, lentil and alfalfa, cotton, rapeseed, canola, pepper, sunflower, tobacco, eggplant, switchgrass, Miscanthus, Setaria, fescue, eucalyptus, a tree, an ornamental plant, a perennial grass and a forage crop. In a specific example the plant is a pennycress plant, such as Thlaspi arvense. In a specific example the plant is a soybean plant, such as Glycine max. In another example the plant is a canola plant, such as Brassica napus. In another example the plant is a rice plant, such as a plant of the genus Oryza, or such as Oryza sativa. In another example, the plant is a sorghum or great millet plant, such as Sorghum bicolor.
[0130] Plant cell: Includes a single plant cell or a plurality of plant cells; includes any cell that constitutes a plant; includes protoplasts, gamete producing cells, and cells that can regenerate into a whole plant, embryos, and callus tissue; includes cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores.
[0131] Plant part: Includes protoplasts, leaves, stems, roots, root tips, anthers, pistils, seeds, embryos, pollens, stamens, ovules, microspores, sporophytes, gametophytes, cotyledons, hypocotyls, flowers, shoots, fruits, tissues, petioles, cells, meristematic cells, and the like; includes differentiated and undifferentiated tissues (which may be in a plant, a plant organ, or a tissue or cell culture); includes plant cells of a tissue culture from which plants can be regenerated. In some examples, a plant part is one or more plant cells (e.g., single cells, protoplasts, embryos, and callus tissue).
[0132] Polynucleotide / nucleic acid molecule / nucleotide sequence: These terms are used interchangeably herein and refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, or analogs thereof. Refers to the primary structure of the molecule, and thus includes double- stranded (such as sense and antisense) and single-stranded (such as sense or antisense) DNA, as well as double- and single-stranded RNA. Includes, but is not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. Also includes modified nucleic acids such as methylated and / or capped nucleic acids, nucleic acids containing modified bases, backbone modifications, and the like. “Oligonucleotide” generally refers to polynucleotides of between about 5 and about 100 nucleotides of single- or double-stranded DNA. However, for the purposes of this disclosure, there is no upper limit to the length of an oligonucleotide. Oligonucleotides are also known as “oligomers” or “oligos” and may be isolated from genes, or chemically synthesized by methods known in the art.
[0133] Progeny: Offspring; descendants.
[0134] Promoter: A nucleic acid sequence, or an array of nucleic acid sequences, that direct or control transcription of a nucleic acid (e.g., a coding sequence). A promoter includes a necessary nucleic acid sequence near the start site of transcription. A promoter also optionally includes distal enhancer or repressor elements. A “constitutive promoter” is a promoter that is continuously active and is not subject to regulation by external signals or molecules. In contrast, the activity of an “inducible promoter” is regulated by an external signal or molecule (for example, a transcription factor). In some examples, a promoter used for recombinant expression of a nucleic acid molecule is not naturally occurring in the cell into which it is introduced, is not native to the nucleic acid molecule to which it is attached, or both. In some examples, a promoter used is not endogenous (i.e., is exogenous) to the plant in which it is introduced. Exemplary promoters that can be used include the CaMV 35S promoter and the ubiquitin promoter. Exemplary promoter sequences that can be used with the methods and compositions here are shown in SEQ ID NOS: 337-339.
[0135] Protein / peptide / polypeptide: These terms are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.
[0136] Protein modification: Refers to, e.g., amino acid substitution, amino acid modification, deletion, and / or insertion, as is well understood in the art.
[0137] Recombinant: Of or resulting from new combinations of genetic material.
[0138] A recombinant protein refers to a protein produced by the use of recombinant DNA technology, which involves the combination of genetic material from different sources to create a new (non-naturally occurring) DNA sequence, which is then introduced into a host organism (such as bacteria, yeast, or mammalian cells) to produce the desired protein. A recombinant nucleic acid or a recombinant construct refers to an artificial combination of nucleic acid sequences, e.g., regulatory and coding sequences that are not found together in nature. For example, a recombinant construct may include regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. Such a construct may be used by itself or may be incorporated into a vector or plasmid to form a recombinant vector or plasmid. Different independent transformation events of a recombinant construct or vector can result in different levels and patterns of expression (Jones et al., (1985) EMBO J. 4:241 1 -2418; De Almeida et al., (1989) Mol. Gen. Genetics 218:78-86). Lines displaying the desired expression level and pattern can be screened. Such screening may be accomplished, for example, by Southern analysis of DNA, Northern analysis of mRNA expression, immunoblotting analysis of protein expression, or phenotypic analysis, among others.
[0139] A recombinant or host cell refers to a cell that has been genetically altered, or is capable of being genetically altered, by introduction of an exogenous polynucleotide, such as a recombinant construct, plasmid or vector. In some examples, the exogenous polynucleotide may express a protein or RNAi molecule that leads to reduced expression of one or more GELP genes. Typically, a host cell is a cell in which a vector can be propagated and its nucleic acid expressed. In specific examples, such cells are plant cells, such as from a monocot or dicot. The term also includes any progeny of the subject host cell. It is understood that all progenies may not be identical to the parental cell since there may be mutations that occur during replication. However, such progenies are included when the term “host cell” is used.
[0140] Regeneration: The development of a plant from tissue culture. The cells may, or may, not have been genetically modified. Plant tissue culture relies on the fact that plant cells have the ability to generate a whole plant (totipotency). Single cells (protoplasts), pieces of leaves, or roots can often be used to generate a new plant on culture media given the required nutrients and plant hormones.
[0141] Ribonucleoprotein (RNP): A complex of ribonucleic acid and DNA-binding protein. In some examples, the RNP includes one or more, such as 2, 3, 4, or 5 different ribonucleic acids, such as gRNAs specific for different targets. In some examples, the DNA-binding protein is a Cas protein, such as a Cas9 native or mutant protein.
[0142] RNAi: RNA interference, a biological process in which RNA molecules suppress gene expression by subjecting mRNA to degradation or blocking its translation. Typically, two types of small RNA molecules, microRNA (miRNA) and small interfering RNA (siRNA), are involved in the RNAi pathway. miRNAs and siRNAs as used herein include both naturally occurring, and artificially designed or engineered miRNA and siRNAs. The phenomenon of RNAi in nature includes the endogenously induced gene silencing effects of miRNAs as well as silencing triggered by foreign dsRNA. Mature miRNAs are structurally similar to siRNAs produced from exogenous dsRNA, but before reaching maturity, miRNAs first undergo post-transcriptional modification. In nature, miRNA is generally expressed from a much longer RNA-coding gene as a primary transcript known as a pri-miRNA which is processed, in the cell nucleus, to an about 70- nucleotide stem- loop structure called a pre-miRNA by the microprocessor complex. This complex comprises an RNase TIT enzyme called Drosha and a dsRNA-binding protein DGCR8. The dsRNA portion of this pre-miRNA is bound and cleaved by Dicer to produce the mature miRNA molecule that can be integrated into the RNA-induced silencing complex (RISC). Artificial miRNA sequences are designed herein and introduced into a host plant or plant cell, which utilize the RNAi pathways in plants to reduce expression of specific genes.
[0143] In some aspects, mRNA sequences that can be targeted by miRNA in pennycress comprises at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, any of SEQ ID NOs: 958, 960, 962, and 964. In some aspects, the corresponding miRNA guide strand sequences comprise at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, any of SEQ ID NOs: 959, 961, 963, and 965. In some aspects, the miRNA comprises at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, any of SEQ ID NOs: 966, 968, 970, and 972. In some aspects, DNA encoding a primary transcript of the miRNA comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, any of SEQ ID NOs: 967, 969, 971, and 973.
[0144] In some aspects, mRNA sequences that can be targeted by miRNA in soybean comprises at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, SEQ ID NO: 974. In some aspects, the corresponding miRNA guide strand sequences comprise at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, SEQ ID NO: 975. In some aspects, the miRNA comprises at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, SEQ ID NO: 976. In some aspects, DNA encoding a primary transcript of the miRNA comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, SEQ ID NO: 977.
[0145] Self-pollination: The transfer of pollen from the anther to the stigma of the same plant.
[0146] Sequence identity / similarity: The similarity between proteins, or between nucleic acid molecules can be characterized by similarity between the amino acid sequences or nucleotide sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are.
[0147] Methods of alignment of sequences for comparison are well known. Various programs and alignment algorithms are described in: Smith and Waterman, Adv. Appl. Math. 2:482, 1981; Needleman and Wunsch, J. Mol. Biol. 48:443, 1970; Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85:2444, 1988; Higgins and Sharp, Gene 73:237, 1988; Higgins and Sharp, CABIOS 5:151, 1989; Corpet et al., Nucleic Acids Research 16:10881 , 1988; and Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85:2444, 1988. Altschul et al., Nature Genet. 6:119, 1994, presents a detailed consideration of sequence alignment methods and homology calculations.
[0148] The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. A description of how to determine sequence identity using this program is available on the NCBI website on the internet.
[0149] Variants of protein sequences known and disclosed herein are typically characterized by possession of at least about 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity counted over the full-length alignment with the amino acid sequence using the NCBI Blast 2.0, gapped blastp set to default parameters. For comparisons of amino acid sequences of greater than about 30 amino acids, the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). When aligning short peptides (fewer than around 30 amino acids), the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). Proteins with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least 95%, at least 98%, or at least 99% sequence identity. When less than the entire sequence is being compared for sequence identity, homologs and variants will typically possess at least 80% sequence identity over short windows of 10-20 amino acids, and may possess sequence identities of at least 85% or at least 90% or at least 95% depending on their similarity to the reference sequence. Methods for determining sequence identity over such short windows are available at the NCBI website on the internet. These sequence identity ranges are provided for guidance only; it is entirely possible that strongly significant homologs could be obtained that fall outside of the ranges provided. Variants of the disclosed nucleic acid sequences are typically characterized by possession of at least about 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity counted over the full-length alignment with the nucleic acid sequence using the NCBI Blast 2.0, gapped blastn set to default parameters. One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is possible that sequences coding for the disclosed proteins (e.g., GELP proteins) could be obtained that fall outside of the ranges provided.
[0150] Suberin: A cell-wall-associated hetero-polymer deposited in specific plant tissues, such as below-ground dermal tissues (epidermis, endodermis, periderm) and above-ground periderm (e.g., bark). A suberized region refers to a plant tissue area where cells have developed a suberin layer, which can be measured, for example, by utilizing a dye that stains suberin.
[0151] Tissue culture: A composition that includes isolated cells of the same or a different type or a collection of such cells organized into parts of a plant. In some examples, the tissue culture includes a homogenous population of plant cells. In some examples, the tissue culture includes a callus tissue. In some examples, the tissue culture includes an anther culture or apical stem tip meristem culture. In some examples, the tissue culture includes a hairy root culture.
[0152] Traditional plant breeding: Refers to the utilization of natural variation found within a plant population as a source for alleles and genetic variants that impart a trait of interest to a given plant. Traditional breeding methods make use of crossing procedures that rely largely upon observed phenotypic variation to infer causative allele association. That is, traditional plant breeding relies upon observations of expressed phenotype of a given plant to infer underlying genetic cause. These observations are utilized to inform the breeding procedure in order to move allelic variation into germplasm of interest. Further, traditional plant breeding has also been characterized as comprising random mutagenesis techniques, which can be used to introduce genetic variation into a given germplasm. These random mutagenesis techniques may include chemical and / or radiation-based mutagenesis procedures. Consequently, one feature of traditional plant breeding is that the breeder does not utilize a genetic engineering tool that directly alters / changes / edits the plant’s underlying genetic architecture in a targeted manner, in order to introduce genetic diversity and bring about a phenotypic trait of interest.
[0153] Transformation: The introduction of exogenous material e.g., guide nucleic acids or vectors providing for such, RNAi molecules or antisense RNAs or vectors providing for such, vectors comprising coding sequences, vectors comprising non-coding or random sequences intended for disrupting a coding genomic sequence) into cells, for example a plant cell. Exemplary mechanisms for introducing nucleic acids into plant cells include (but are not limited to) electroporation, microprojectile bombardment, Agrobacterium-mediated transformation, and direct DNA uptake by protoplasts.
[0154] Transformed: A transformed plant, plant part or plant cell is a plant, plant part or plant cell that has taken up an exogenous nucleic acid (including a linear or circular DNA, a vector, a plasmid, an RNAi molecule (e.g., siRNA and miRNA), a guide RNA molecule, etc.), regardless of whether the exogenous nucleic acid is integrated into the genome of the plant, plant part or plant cell, and regardless of whether the exogenous nucleic acid alters the genome of the plant, plant part or plant cell. Thus, transformed plants, plant parts or plant cells include transgenic plants, plant parts or plant cells; gene-edited plants, plant parts or plant cells; as well as plants, plant parts or plant cells that have taken up the exogenous nucleic acid but with an unaltered genome.
[0155] Transgene: An exogenous gene or other nucleic acid material (e.g., guide nucleic acids and vectors containing such, RNAi molecules or antisense RNAs and vectors providing for such, etc.) that has been integrated into the genome of a plant, plant part or plant cell, for example by transformation or genetic engineering methods. In some examples, a transgene describes a segment of DNA containing a gene sequence or a random non-coding sequence and is integrated into the genome of a plant, plant part or plant cell. This non-native segment of DNA may retain the ability to produce RNA or protein in the transgenic plant (such as a repressor for a GELP gene), or it may alter the normal function of the transgenic plant’s genetic code. In some examples, a transgene is incorporated into the plant’s germ line.
[0156] Transgene-free: Not containing any transgene. Many strategies have been developed to remove or prevent the integration of a transgene (such as a gene editing construct), thereby generating a transgene-free plant, plant part, plant cell, or plant seed. Such strategies include: elimination of a transgene via genetic segregation; transient expression by DNA vectors; and DNA- independent editor delivery, such as delivery RNA or preassembled Cas9 protein-gRNA ribonucleoproteins (Gu, Xiaoyong et al. “Transgene-free Genome Editing in Plants.” Frontiers in genome editing vol. 3 805317. 2 Dec. 2021, doi:10.3389 / fgeed.2021.805317).
[0157] Under conditions sufficient for: A phrase that is used to describe any environment that permits a desired activity. In some examples, the desired activity is expression of a nucleic acid that can specifically reduce or inhibit expression of one or more GELP genes in a plant, and in combination with other necessary elements, for example to increase root biomass, shoot biomass, and / or suberized region of the plant.
[0158] Vector: A nucleic acid molecule capable of carrying a nucleic acid molecule of interest and permitting its expression and / or integration in a host cell. A vector may also be capable of replicating in a host cell (e.g., along with or independent of the host genome replication during cell division), for example, by including a nucleic acid sequence (such as an origin of replication) that permits its replication. A vector may also include one or more selectable marker genes and other genetic elements known in the art. An integrating vector is capable of integrating itself or the nucleic acid molecule of interest it carries into a host nucleic acid. An expression vector is a vector that contains necessary regulatory sequences to allow transcription and translation of the nucleic acid molecule of interest (e.g., one or more genes encoding a protein), without integration with a host nucleic acid. Vectors include, but are not limited to, nucleic acid molecules that are singlestranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, or no free ends (e.g., circular); nucleic acid molecules that include DNA, RNA, other varieties of polynucleotides known in the art, or any combination thereof.
[0159] In some examples, a vector is not native to the cell into which it is introduced. In some examples, a vector includes a guide nucleic acid (e.g., specific for one or more GELP genes) operably linked to a promoter sequence, which can be non-native (e.g., promoter that does not occur naturally in the plant into which the vector is introduced) or native (e.g., a promoter of one or more GELP genes as found in the plant). In some examples, the vector further includes coding sequences for proteins participating in gene editing (e.g., an endonuclease). In some examples, a vector includes a nucleic acid that encodes a repressor (e.g., for one or more of GELP genes) operably linked to a promoter sequence, which can be non-native or native.
[0160] One type of vector is a "plasmid," which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.
[0161] Another type of vector is a viral vector, wherein virally derived DNA or RNA sequences are present in the vector for packaging into a virus e.g., retroviruses, replication defective retroviruses, adenoviruses, herpes simplex viruses, baculo viruses, replication defective adenoviruses, and adeno- associated viruses). Viral vectors also include recombinant plant viruses, such as TMV-mediated (transient) transfection into tobacco (Tuipe, T-H et al (1993), J. Virology Meth, 42: 227-239), ssDNA genomes viruses (e.g., family Geminiviridae), reverse transcribing viruses (e.g., families Caulimoviridae, Pseudoviridae, and Metaviridae), dsNRA viruses (e.g., families Reoviridae and Parti tiviridae), (-) ssRNA viruses (e.g., families Rhabdoviridae and Bunyaviridae), (+) ssRNA viruses (e.g., families Bromoviridae, Closteroviridae, Comoviridae, Luteoviridae, Potyviridae, Sequiviridae and Tombusviridae) and viroids (e.g., families Pospiviroldae and Avsunviroidae). Detailed classification information of plant viruses can be found in Fauquet et al. (2008, "Geminivirus strain demarcation and nomenclature". Archives of Virology 153:783-821, incorporated herein by reference in its entirety), and Khan et al. (Plant viruses as molecular pathogens; Publisher Routledge, 2002, ISBN 1560228954, 9781560228950). Examples of non-viral vectors include, but are not limited to, liposomes, polyamine derivatives of DNA, and the like. Vectors also include bphagemids, cosmids, artificial / mini- chromosomes (e.g., ACE), bacteriophages, pro-viruses, phagemids, transposons, artificial chromosomes, and the like, that replicate autonomously or can integrate into a chromosome of a host cell. A vector can also be a naked RNA polynucleotide, a naked DNA polynucleotide, a polynucleotide composed of both DNA and RNA within the same strand, a poly-lysine-conjugated DNA or RNA, a peptide-conjugated DNA or RNA, a liposome-conjugated DNA, or the like, that is not autonomously replicating.
[0162] Eukaryotic expression vectors in some examples also contain prokaryotic sequences that facilitate the propagation of the vector in bacteria such as an origin of replication and antibiotic resistance genes for selection in bacteria. A variety of eukaryotic expression vectors, containing a cloning site into which a polynucleotide can be operatively linked, are well known and some are commercially available from companies such as Stratagene, La Jolla, Calif.; Invitrogen, Carlsbad, Calif.; Promega, Madison, Wis. or BD Biosciences Clontech, Palo Alto, Calif.
[0163] II. Nucleic Acid Molecules and Proteins of GELP and GELP Regulators
[0164] In accordance with the present disclosure, decreasing expression of one or more GELP genes (such as any of SEQ ID NOs: 1-167 and SEQ ID NOs: 340-633 or those comprising at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of SEQ ID NOs: 1-167 and SEQ ID NOs: 340-633) or activity of proteins encoded by these genes, is useful for generating plants that have increased root biomass, shoot biomass, and / or suberized region when comparted to appropriate control plants. In some examples, expression of at least 2, at least 3, at least 4, at least 5, at least 6, or at least 7 different GELP genes (such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different GELP genes) is decreased in a plant, thereby generating plants that have increased root biomass, shoot biomass, and / or suberized region when comparted to appropriate control plants. The present disclosure provides nucleic acid and protein sequences of GELP and GELP regulators. Thus, the provided sequences can be used in breeding programs, for example by designing appropriate inhibitory RNA molecules, guide nucleic acid molecules, or other nucleic acid molecules that mutate a GELP or GELP regulator gene. See, for example, Gentzbittel et al. (1998, Theor. Appl. Genet. 96:519-523). The provided sequences can thus be used to modulate plant root biomass, shoot biomass, and / or suberized region. See, generally, Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.).
[0165] The disclosure also encompasses isolated or substantially purified nucleic acid or protein compositions. “Isolated” or “substantially purified” means substantially or essentially free from components that normally accompany or interact with the nucleic acid molecule or protein as found in its naturally occurring environment. Thus, an isolated or purified polynucleotide or polypeptide is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In one example, an isolated polynucleotide is free of sequences (especially protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5' and 3' ends of the polynucleotide) in the genomic DNA of the plant from which the polynucleotide was derived. Tn some embodiments, the isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequences that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide was derived. A polypeptide that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10%, 5%, (by dry weight) of contaminating protein. When a protein (including its functional fragments) of the disclosure is recombinantly produced, in some examples the culture medium suitably represents less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or non-protein-of- interest chemicals.
[0166] Exemplary GELP coding sequences are provided in SEQ ID NOs: 1-167 and 346-633. Exemplary GELP protein sequences are provided in SEQ ID NOs: 168-334 and 634-921. Exemplary full GELP genomic sequences are provided in SEQ ID NOs: 340-345. Guide nucleic acids (or vectors providing for such), RNAi molecules or antisense RNAs (or vectors providing for such), hybridization probes, PCR primers, etc. can be generated based on these sequences or any fragment thereof, or sequences upstream or downstream of these sequences (such as regulatory sequences). These sequences can also be used to study protein-protein interactions and protein- DNA interactions, thereby identifying GELP regulators. Exemplary gRNA sequences are provided in SEQ ID NOs: 922-957 and 978-1001. Exemplary target mRNA sequences and target miRNA sequences are provided in SEQ ID NOs: 958-977.
[0167] The disclosure also contemplates using variants of the disclosed nucleotide sequences. Nucleic acid variants can be naturally occurring, such as allelic variants (same locus), paralogous (different locus), and orthologues (different organism) or can be non-naturally occurring. Naturally occurring variants such as these can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques as known in the art. Non-naturally occurring variants can be made by mutagenesis techniques, including those applied to polynucleotides, cells, or organisms. The variants can contain nucleotide substitutions, deletions, inversions and insertions. Variation can occur in either or both the coding and non-coding regions. The variations can produce both conservative and non-conservative amino acid substitutions (as compared to the encoded product). For nucleotide sequences, conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of a GELP of the disclosure. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site- directed mutagenesis but which still encode a GELP polypeptide of the disclosure. Generally, variants of a particular nucleotide sequence of the disclosure have at least about 30%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to that particular nucleotide sequence as determined by sequence alignment programs described elsewhere herein using default parameters.
[0168] Variant nucleotide sequences also encompass sequences derived from mutagenic or recombinant procedures such as “DNA shuffling” which can be used for swapping domains in a polypeptide of interest with domains of other polypeptides. With DNA shuffling, one or more different GELP coding sequences can be manipulated to create a new GELP sequence possessing desired properties. In this procedure, libraries of recombinant polynucleotides are generated from a population of related polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. For example, using this approach, sequence motifs encoding a domain of interest may be shuffled between a GELP gene of the disclosure and other GELP genes to obtain a new gene coding for a protein with an altered or reduced property or function of interest, such increasing plant root biomass, shoot biomass, and / or suberized region. Strategies for DNA shuffling are known e.g., Stemmer (1994, Proc. Natl. Acad. Sci. USA 91 :10747-10751; 1994, Nature 370:389-391); Crameri et al. (1997, Nature Biotech. 15:436-438); Moore et al. (1997, J. Mol. Biol. 272:336-347); Zlang et al. (1997 Proc. Natl. Acad. Sci. USA 94:450-44509); Crameri et al. (1998, Nature 391:288-291); and U.S. Pat. Nos. 5,605,793 and 5,837,458.
[0169] The present disclosure provides nucleotide sequences for GELP genes or GELP protein coding sequences, and fragments and variants thereof.
[0170] In some embodiments, a GELP gene (or a nucleotide sequence encoding a GELP protein) or a variant or functional fragment thereof comprises a nucleotide sequence that shares at least about
[0171] 70%, about 75%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about
[0172] 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about
[0173] 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.1%, about 99.2%, about
[0174] 99.3%, about 99.4%, about 99.5%, about 99.6%, about 99.7%, about 99.8%, or about 99.9% sequence identity to any of SEQ ID NOs: 1-167 and SEQ ID NOs: 340-633 (for example prior to its mutation, functional deletion, or inactivation). In some embodiments, a GELP gene (or a nucleotide sequence encoding a GELP protein) or a variant or functional fragment thereof comprise a nucleotide sequence of any of SEQ ID NOs: 1-167 and SEQ ID NOs: 340-633 (for example prior to its mutation, functional deletion, or inactivation).
[0175] In some embodiments, nucleotide sequences for one or more GELP genes or GELP protein coding sequences (such as an endogenous GELP genomic sequence) are mutated or deleted to decrease gene expression and / or activity of proteins, thereby increasing root biomass, shoot biomass, and / or suberized region of a plant or plant part.
[0176] The present disclosure provides nucleotide sequences for GELP transcripts or mRNAs. These sequences are readily derivable from the GELP gene or GELP protein coding sequences provided by the present disclosure.
[0177] In some embodiments, GELP transcripts or mRNAs from one or more GELP genes are targeted for degradation or prevented from translation, thereby increasing root biomass, shoot biomass, and / or suberized region of a plant or plant part.
[0178] The present disclosure provides amino acid sequences for GELP proteins, and fragments and variants thereof.
[0179] In some embodiments, the present disclosure provides protein sequences encoded by the nucleotide sequences of GELP and functional fragments and variations thereof.
[0180] In some embodiments, a GELP protein or a variant or functional fragment thereof comprises an amino acid sequence that shares at least about 70%, about 75%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.1%, about 99.2%, about 99.3%, about 99.4%, about 99.5%, about 99.6%, about 99.7%, about 99.8%, or about 99.9% sequence identity to any of SEQ ID NOs: 168-334 and 634-921 (for example prior to its mutation, functional deletion, or inactivation). In some embodiments, a GELP protein or a variant or functional fragment thereof comprises an amino acid sequence of any of SEQ ID NOs: 168-334 and 634-921 (for example prior to its mutation, functional deletion, or inactivation).
[0181] Functional fragments and variants of a GELP protein include those fragments and variants that maintain one or more functions of the reference GELP protein. It is recognized that the gene or cDNA encoding a protein can be mutated without materially altering one or more of the protein’s functions. First, the genetic code is degenerate, and thus different codons encode the same amino acids. Second, even where an amino acid substitution is introduced, the mutation can be conservative and have no material impact on the essential function(s) of a protein. See, e.g., Stryer Biochemistry 3rd Ed., 1988. Third, part of a protein chain can be deleted without impairing or eliminating all of its functions. Fourth, insertions or additions can be made in the protein chain for example, adding epitope tags, without impairing or eliminating its functions (Ausubel et al. J. Immunol. 159(5): 2502-12, 1997). Other modifications that can be made without materially impairing one or more functions of a protein can include, for example, in vivo or in vitro chemical and biochemical modifications or the incorporation of unusual amino acids. Such modifications include, but are not limited to, for example, acetylation, carboxylation, phosphorylation, glycosylation, ubiquination, labelling, e.g., with radionucleotides, and various enzymatic modifications, as will be readily appreciated by those well skilled in the art. A variety of methods for labelling polypeptides, and labels useful for such purposes, are well known in the art, and include radioactive isotopes such as 32P, ligands which bind to or are bound by labelled specific binding partners (e.g., antibodies), fluorophores, chemiluminescent agents, enzymes, and antiligands. Functional fragments and variants can be of varying length. For example, some fragments have at least 10, 25, 50, 75, 100, 200, or even more amino acid residues.
[0182] Variants of GELP proteins can have “conservative” changes, or “nonconservative” changes as described above, such as an addition or deletion that does not alter a protein function significantly. Conservative amino acid substitutions are those substitutions that, when made, least interfere with the properties of the original protein, that is, the structure and especially the function of the protein is conserved and not significantly changed by such substitutions. Conservative substitutions generally maintain (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. Further information about conservative substitutions can be found, for instance, in Ben Bassat et al. (J. Bacteriol., 169:751 757, 1987), O’Regan et al. (Gene, 77:237 251, 1989), Sahin Toth et al. (Protein Sci., 3:240 247, 1994), Hochuli et al. (Bio / Technology, 6: 1321 1325, 1988) and in widely used textbooks of genetics and molecular biology. The Blosum matrices are commonly used for determining the relatedness of polypeptide sequences. The Blosum matrices were created using a large database of trusted alignments (the BLOCKS database), in which pairwise sequence alignments related by less than some threshold percentage identity were counted (Henikoff et al., Proc. Natl. Acad. Sci. USA, 89:10915-10919, 1992). A threshold of 90% identity was used for the highly conserved target frequencies of the BLOSUM90 matrix. A threshold of 65% identity was used for the BLOSUM65 matrix. Scores of zero and above in the Blosum matrices are considered “conservative substitutions” at the percentage identity selected. Table 1 shows exemplary conservative amino acid substitutions. Table 1. Exemplary conservative amino acid substitutions
[0183] In some examples, variants can have no more than 3, 5, 10, 15, 20, 25, 30, 40, 50, or 100 conservative amino acid changes (such as very highly conserved or highly conserved amino acid substitutions). In other examples, one or several hydrophobic residues (such as Leu, He, Vai, Met, Phe, or Trp) in a variant sequence can be replaced with a different hydrophobic residue (such as Leu, He, Vai, Met, Phe, or Trp) to create a variant functionally similar to the disclosed amino acid sequences.
[0184] In some embodiments, variants may differ from the disclosed sequences by alteration of the coding region to fit the codon usage bias of the particular organism into which the molecule is to be introduced. In other embodiments, the coding region may be altered by taking advantage of the degeneracy of the genetic code to alter the coding sequence such that, while the nucleotide sequence is substantially altered, it nevertheless encodes a protein having an amino acid sequence substantially similar to the disclosed amino acid sequences.
[0185] In some embodiments, functional fragments derived from GELP proteins of the present disclosure are provided. Reducing expression or activity of a functional fragment in a plant can still confer the ability to increase root biomass, shoot biomass, and / or suberized region. In some embodiments, the functional fragments contain one or more conserved region shared by two or more GELP (including homologs, including paralogs and orthologs), for example, shared by two or more orthologs in the same plant genus, shared by two or more dicot GELP orthologs, and / or shared by two or more monocot GELP orthologs. The conserved regions can be determined by any suitable computer program, such as NCBI protein BLAST program and NCBI Alignment program, or equivalent programs. In some embodiments, the functional fragments are 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more amino acids shorter compared to full-length GELP of the present disclosure. In some embodiments, the functional fragments are made by deleting one or more amino acids of full-length GELP of the present disclosure. In some embodiments, the functional fragments share at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more identity to full-length GELP of the present disclosure.
[0186] The present disclosure also provides conserved regions of GELP proteins or genes. The conserved regions can be determined by any suitable computer program, such as NCBI protein BLAST program and NCBI Alignment program, or equivalent programs. Sequences of conserved regions can be used to knock-down the level of one or more GELP (including homologs, including paralogs and orthologs). In some embodiments, sequences of conserved regions can be used to make gene silencing molecules to target one or more GELP genes or gene products (e.g., mRNA). In some embodiments, the gene silencing molecules are double- stranded polynucleotides, singlestranded polynucleotides or Mixed Duplex Oligonucleotides. In some embodiments, the gene silencing molecules comprise a DNA / RNA fragment of about 10 bp, 15 bp, 19 bp, 20 bp, 21 bp, 25 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 150 bp, 200 bp, 250 bp, 300 bp, 350 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp, or more polynucleotides, wherein the DNA / RNA fragment share at least 90%, 95%, 99%, or more identity to a conserved region of GELP sequences of the present disclosure, or complementary sequences thereof.
[0187] The present disclosure also provides loss-of-function GELP gene variants. Such variants can occur in nature or result from human intervention (such as mutagenesis, for example the geneediting methods provided herein or known in the art). In some examples, such variants are generated by CRISPR / Cas technologies to edit genomic DNA or RNA.
[0188] In some aspects, loss-of-function GELP gene variants have a transcription or expression level reduced by at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99%, compared to that of a corresponding functional or wild-type GELP gene. In some aspects, loss-of-function GELP gene variants encode a GELP protein that has an activity reduced by at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99%, compared to that of a corresponding functional or wild-type GELP protein.
[0189] In some examples, loss-of-function GELP gene variants have an insertion of one or more nucleotides, such as an insertion of at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 25, at least 50, or at least 100 nucleotides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,35, 36, 37, 38, 39, 40, 45, 50, 75, or 100 added nucleotides as compared to a corresponding functional or wild-type GELP gene. In some examples, loss-of-function GELP gene variants have an insertion of one nucleotide (such as a thymine (T) nucleotide) as compared to a corresponding functional or wild-type GELP gene. In some examples, loss-of-function GELP gene variants have a deletion of 5-40 nucleotides, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,35, 36, 37, 38, 39 or 40 nucleotides, as compared to a corresponding functional or wild-type GELP gene. In some examples, loss-of-function GELP gene variants have a combination of one or more nucleotide insertions, one or more nucleotide deletions, one or more nucleotide substitutions, or combinations thereof. In some examples, loss-of-function GELP gene variants includes a sequence as set forth in any of SEQ ID NOs: 335-336 and 1002-1013, or a sequence that includes at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity to any of SEQ ID NOs: 335-336 and 1002-1013. In some examples, a loss-of-function GELP gene variant comprises at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence identity to any of SEQ ID NOs: 335-336 and 1002- 1013, and retain the specific mutations therein (e.g., addition of T or deletion of 27 nt).
[0190] III. Constructs
[0191] The present disclosure provides constructs comprising expression cassettes comprising promoters operably-linked to a nucleic acid molecule, such as one that reduces GELP activity / expression (such as reduces endogenous GELP activity / expression), which can be operably linked to termination signals. Such a nucleic acid molecule includes one that encodes a guide RNA targeting a GELP gene or GELP gene activator, one that encodes a RNAi molecule targeting a mRNA transcribed from a GELP gene or GELP gene activator, or one that encodes a GELP repressor. The expression cassettes can also include sequences required for proper translation of the nucleotide sequence. When the expression cassettes are transformed into plants, they enable the plants to increase root biomass, shoot biomass, and / or suberized region without negatively impacting plant health.
[0192] In some embodiments, the expression cassette is chimeric so that at least one of its components is heterologous with respect to at least one of its other components.
[0193] In some embodiments, the expression cassette is naturally occurring but has been obtained in a recombinant form useful for heterologous expression. The expression of the nucleotide sequence in the expression cassette can be under the control of a constitutive promoter or of an inducible promoter which initiates transcription only when the host cell is exposed to some particular external stimulus. Also, the expression of the nucleotide sequence in the expression cassette can be under the control of a tissue-specific promoter, such as specific root tissues, including, but not limited to, the phellogen, pericycle or procambium. In addition, the promoter can also be specific to a particular stage of development in a plant. IV. Increasing Root Biomass, Shoot Biomass, and / or Suberized Region in Plants with Gene Editing
[0194] A gene editing system can be used to regulate expression / activity of genes in plants. For example, GELP expression / activity can be decreased or even eliminated, for example by mutagenesis methods, RNAi methods, or expressing a GELP repressor under control of a promoter.
[0195] In some examples a gene editing system is used that includes one or more nucleic acid (e.g., DNA or RNA)-binding domains or components and one or more nucleic acid (e.g., DNA or RNA)- modifying domains or components, or isolated nucleic acids, e.g., one or more vectors, encoding said nucleic acid (e.g., DNA or RNA)-binding and nucleic acid (e.g., DNA or RNA)-modifying domains or components. Gene editing systems can be used for modifying a coding sequence of a target gene and / or for modulating the expression of a target gene, e.g., by modifying a non- coding / regulatory sequence (e.g., operator or promoter) of the gene, or by modifying the coding sequence / expression of a regulator (e.g., repressor or activator) of the gene. In some examples, the one or more nucleic acid (e.g., DNA or RNA)-binding domains or components are associated with the one or more nucleic acid (e.g., DNA or RNA)-modifying domains or components, such that the one or more nucleic acid (e.g., DNA or RNA)-binding domains target the one or more nucleic acid (e.g., DNA or RNA)-modifying domains or components to a specific nucleic acid site. Methods and compositions for enhancing gene editing is known. See example, U.S. Patent Application Publication No. 2018 / 0245065. The one or more nucleic acid (e.g., DNA or RNA)-binding domains can be protein domains or nucleic acids that are engineered to recognize target sequences.
[0196] Exemplary gene editing systems include but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), CRISPR / Cas systems, meganuclease systems, Fokl restriction endonuclease systems, and viral vector-mediated gene editing. In some embodiments, CRISPR / Cas-based gene editing methods are used to genetically modify the genome of plant species of the present disclosure in order to increase root biomass, shoot biomass, and / or suberized region of plant cells, plant tissues, plant parts, or whole plants.
[0197] A. CRISPR / Cas Systems
[0198] CRISPR and Cas were originally discovered as adaptive immunity systems evolved by bacteria and archaea to protect against viral and plasmid invasion. Naturally occurring CRISPR / Cas systems in bacteria are composed of one or more Cas genes and one or more CRISPR arrays consisting of short palindromic repeats of base sequences separated by genome-targeting sequences acquired from previously encountered viruses and plasmids (called spacers) (Wiedenheft, B., et. al. Nature. 2012; 482:331; Bhaya, D., et. al., Annu. Rev. Genet. 2011 ; 45:231 ; and Terms, M.P. et. al., Curr. Opin. Microbiol. 2011; 14:321). Bacteria and archaea possessing one or more CRISPR loci respond to viral or plasmid challenge by integrating short fragments of foreign sequence (protospacers) into the host chromosome at the proximal end of the CRISPR array. Transcription of CRISPR loci generates a library of CRIS PR-derived RNAs (crRNAs) containing sequences complementary to previously encountered invading nucleic acids (Haurwitz, R.E., et. Al., Science. 2012:329; 1355 ; Gesner, E.M., et. Al., Nat. Struct. Mol. Biol. 2001, 18:688; Jinek, M., et. Al., Science. 2012:337; 816-21). Target recognition by crRNAs occurs through complementary base pairing with target DNA, which directs cleavage of foreign sequences by means of Cas proteins (Jinek et. Al. 2012 “A Programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.” Science. 2012:337; 816-821).
[0199] There are at least five main CRISPR system types (Type I, II, III, IV and V) and at least 16 distinct subtypes (Makarova, K.S., et al., Nat Rev Microbiol. 2015. Nat. Rev. Microbiol. 13, 722- 736). CRISPR systems are also classified based on their effector proteins. Class 1 systems possess multi-subunit crRNA-effector complexes, whereas in Class 2 systems all functions of the effector complex are carried out by a single protein (e.g., Cas9 or Cpfl). In some embodiments, the present disclosure provides using type II and / or type V single- subunit effector systems.
[0200] As these naturally occur in many different types of bacteria, the exact arrangements and structures of CRISPR, function and number of Cas genes and their product differ somewhat from species to species (Haft et al. (2005) PloS Comput. Biol. 1 : e60; Kunin et al. (2007) Genome Biol. 8: R61; Mojica et al. (2005) J. Mol. Evol. 60: 174-182; Bolotin et al. (2005) Microbiol. 151: 2551- 2561; Pourcel et al. (2005) Microbiol. 151 : 653-663; and Stern et al. (2010) Trends. Genet. 28: 335-340.) For example, the Cas (Cas subtype, E. coli) proteins (e.g., CasA) form a functional complex, Cascade, which processes CRISPR RNA transcripts into spacer-repeat units that Cascade retains (Brouns et al. (2008) Science 321: 960-964). In other prokaryotes, Cas6 processes the CRISPR transcript. The CRISPR-based phage inactivation in E. coli requires Cascade and Cas3, but not Casl or Cas2. The Cmr (Cas RAMP module) proteins in Pyrococcus furiosus and other prokaryotes form a functional complex with small CRISPR RNAs that recognizes and cleaves complementary target RNAs. A simpler CRISPR system relies on the protein Cas9, which is a nuclease with two active cutting sites, one for each strand of the double helix. Combining Cas9 and modified CRISPR locus RNA can be used in a system for gene editing (Pennisi (201 ) Science 341 : 833-836).
[0201] B. CRISPR / Cas9
[0202] Provided are methods of gene editing using a Type II CRISPR system. Type II systems rely on i) a single endonuclease protein, ii) a transactivating crRNA (tracrRNA), and iii) a crRNA wherein a ~20- nucleotide (nt) portion of the 5 ’ end of the crRNA is complementary to a target nucleic acid. The region of a CRISPR crRNA strand that is complementary to its target DNA protospacer is referred to as “guide sequence.”
[0203] In some embodiments, the tracrRNA and crRNA components of a Type II system can be replaced by a single guide RNA (sgRNA), also known as a guide RNA (gRNA). The sgRNA can include, for example, a nucleotide sequence that comprises an at least 12-20 nucleotide sequence complementary to the target DNA sequence (guide sequence) and can include a common scaffold RNA sequence at its 3' end. As used herein, “a common scaffold RNA” refers to any RNA sequence that mimics the tracrRNA sequence or any RNA sequences that function as a tracrRNA.
[0204] Cas9 endonucleases produce blunt end DNA breaks, and are recruited to target DNA by a combination of a crRNA oligo and a tracrRNA oligo, which tether the endonuclease via complementary hybridization of the RNA CRISPR complex.
[0205] In some embodiments, DNA recognition by the crRNA / endonuclease complex uses additional complementary base-pairing with a protospacer adjacent motif (PAM) (e.g., 5’-NGG-3’) located in a 3’ portion of the target DNA, downstream from the target protospacer (Jinek, M., et. AL, Science. 2012, 337:816-821). In some embodiments, the PAM motif recognized by a Cas9 varies for different Cas9 proteins.
[0206] In some embodiments, the Cas9 disclosed herein can be any variant derived or isolated from any source. In other embodiments, the Cas9 peptide of the present disclosure can include one or more of the mutations described in the literature, including but not limited to the functional mutations described in: Fonfara et al. Nucleic Acids Res. 2014 Feb;42(4):2577-90; Nishimasu H. et al. Cell. 2014 Feb 27,156(5):935-49; Jinek M. et al. Science. 2012 337:816-21; and Jinek M. et al. Science. 2014 Mar 14, 343(6176). See also U.S. Pat. App. No. 13 / 842,859, filed March 15, 2013, which is hereby incorporated by reference; further, see U.S. Pat. Nos. 8,697,359; 8,771,945; 8,795,965; 8,865,406; 8,871,445; 8,889,356; 8,895,308; 8,906,616; 8,932,814; 8,945,839; 8,993,233; and 8,999,641. Thus, in some embodiments, the systems and methods disclosed herein can be used with the wild type Cas9 protein having double- stranded nuclease activity, Cas9 mutants that act as single stranded nickases, or other mutants with modified nuclease activity.
[0207] Cas9 molecules of, derived from, or based on the Cas9 proteins of a variety of species can be used in the methods and compositions described herein. For example, Cas9 molecules of, derived from, or based on, e.g., S. pyogenes, S. thermophilus, Staphylococcus aureus and / or Neisseria meningitidis Cas9 molecules, can be used in the systems, methods and compositions described herein. Additional Cas9 species include those from: Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp., cycliphilus denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp., Blastopirellula marina, Bradyrhiz, obium sp., Brevibacillus latemsporus, Campylobacter coli, Campylobacter jejuni, Campylobacter lad, Candidatus Puniceispirillum, Clostridia cellulolyticum, Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dinoroseobacter sliibae, Eubacterium dolichum, gamma proteobacterium, Gluconacetobacler diazotrophicus , Haemophilus parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, llyobacler polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis sp., Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica, Neisseria sp., Neisseria wadsworthii, Nitrosomonas sp., Parvibaculum lavamentivorans, Pasteurella multocida, Phascolarctobacterium succinatutens, Ralstonia syzygii, Rhodopseudomonas palustris, Rhodovulum sp., Simonsiella muelleri, Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus lugdunensis, Streptococcus sp., Subdoligranulum sp., Tislrella mobilis, Treponema sp., or Verminephrobacter eiseniae.
[0208] In some embodiments, provided are tools for genome editing techniques in plants such as crops and methods of gene editing using Cas endonucleases including SpyCas9, SaCas9, and StlCas9. See example, Song et al. (2016), The Crop Journal 4:75-82, Mali et al. (2013) Science 339: 823-826; Ran et al. (2015) Nature 520: 186-191; Esvelt et al. (2013) Nature methods 10(11): 1116-1121.
[0209] C. CRISPR / Cpfl
[0210] In some embodiments, the present disclosure provides methods of gene editing using a Type V CRISPR system. In some embodiments, the present disclosure provides methods of gene editing using CRISPR from Prevotella, Francisella, Acidaminococcus, Lachnospiraceae, or Moraxella (Cpfl).
[0211] The Cpfl CRISPR systems of the present disclosure can include i) a single endonuclease protein, and ii) a crRNA, wherein a portion of the 3’ end of crRNA contains the guide sequence complementary to a target nucleic acid. In this system, the Cpfl nuclease is directly recruited to the target DNA by the crRNA. In some embodiments, guide sequences for Cpfl are at least 12 nt, 13 nt, 14 nt, 15 nt, or 16 nt in order to achieve detectable DNA cleavage, and a minimum of 14 nt, 1 5nt, 16 nt, 17 nt, or 18 nt to achieve efficient DNA cleavage.
[0212] The Cpfl systems differ from Cas9 in a variety of ways. First, unlike Cas9, Cpfl does not require a separate tracrRNA for cleavage. In some embodiments, Cpfl crRNAs can be as short as about 42-44 nt long — of which about 23-25 nt is guide sequence and about 19 nt is the constitutive direct repeat sequence. In contrast, the combined Cas9 tracrRNA and crRNA synthetic sequences can be about 100 nt long.
[0213] Second, certain Cpfl systems prefer a “TTN” PAM motif that is located 5' upstream of its target. This is in contrast to the “NGG” PAM motifs located on the 3’ of the target DNA for common Cas9 systems such as Streptococcus pyogenes Cas9. In some embodiments, the uracil base immediately preceding the guide sequence cannot be substituted (Zetsche, B. et al. 2015. “Cpfl Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System” Cell 163, 759- 771 , which is hereby incorporated by reference in its entirety for all purposes).
[0214] Third, the cut sites for Cpfl are staggered by about 3-5 nt, which create “sticky ends” (Kim et al., 2016. “Genome-wide analysis reveals specificities of Cpfl endonucleases in human cells” published online June 06, 2016). These sticky ends with 3-5 nt overhangs are thought to facilitate NHEJ-mediated-ligation, and improve gene editing of DNA fragments with matching ends. The cut sites are in the 3' end of the target DNA, distal to the 5' end where the PAM is. The cut positions usually follow the 18th nt on the non-hybridized strand and the corresponding 23rd nt on the complementary strand hybridized to the crRNA.
[0215] Fourth, in Cpfl complexes, the “seed” region is located within the first 5 nt of the guide sequence. Cpfl crRNA seed regions are highly sensitive to mutations, and even single base substitutions in this region can drastically reduce cleavage activity (see Zetsche B. et al. 2015 “Cpfl Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System” Cell 163, 759- 771). Critically, unlike the Cas9 CRISPR target, the cleavage sites and the seed region of Cpfl systems do not overlap. Additional guidance on designing Cpfl crRNA targeting oligos is available on Zetsche B. et al. 2015 (“Cpfl Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System” Cell 163, 759-771).
[0216] D. Guide nucleic acids
[0217] In some embodiments, a guide nucleic acid (e.g., RNA or DNA) of the present disclosure includes two coding regions, encoding for crRNA and tracrRNA, respectively. In other embodiments, the guide RNA is a single guide RNA (sgRNA) (a synthetic crRNA / tracrRNA hybrid). In other embodiments, the guide RNA is a crRNA for a Cpfl endonuclease.
[0218] Unless otherwise noted, all references to a single guide nucleic acid (e.g., sgRNA or sgDNA) in the present disclosure can be read as referring to a guide nucleic acid (e.g., gRNA or gDNA). Therefore, embodiments described in the present disclosure which refer to a single guide nucleic acid (e.g., sgRNA or sgDNA) will also be understood to refer to a guide nucleic acid (e.g., gRNA or gDNA). The guide is designed to recruit the CRISPR endonuclease to a target nucleic acid region. Such methods are known in the art. Software programs can be used to identify candidate CRISPR target sequences on both strands of an input DNA sequence based on desired guide sequence length and a CRISPR motif sequence (e.g., PAM) for a specified CRISPR enzyme. For example, target sites for Cpf 1 from Francisella novicida U 112, with PAM sequences TTN, may be identified by searching for 5'-TTN- 3' both on the input sequence and on the reverse-complement of the input. The target sites for Cpf 1 from Lachnospiraceae bacterium and Acidaminococcus sp. , with PAM sequences TTTN, may he identified by searching for 5’-TTTN-3’ both on the input sequence and on the reverse complement of the input. Likewise, target sites for Cas9 of S. thermophilus CRISPR, with PAM sequence NNAGAAW, may be identified by searching for 5'-Nx- NNAGAAW-3' both on the input sequence and on the reverse-complement of the input. The PAM sequence for Cas9 of S. pyogenes is 5’-NGG-3’.
[0219] Since multiple occurrences in the genome of the DNA or RNA target site may lead to nonspecific genome editing, after identifying all potential sites, sequences may be filtered out based on the number of times they appear in the relevant reference genome or modular CRISPR construct. For those CRISPR enzymes for which sequence specificity is determined by a “seed” sequence (such as the first 5 nt of the guide sequence for Cpf 1 -mediated cleavage) the filtering step may also account for any seed sequence limitations.
[0220] In some embodiments, algorithmic tools identify potential off target sites for a particular guide sequence. For example, in some embodiments Cas-Offinder can be used to identify potential off target sites for Cpfl (see Kim et al., 2016. Nature Biotechnology 34, 863-868). Any other publicly available CRISPR design / identification tool may also be used, including for example the Zhang lab crispr.mit.edu tool (see Hsu, et al. 2013 “DNA targeting specificity of RNA guided Cas9 nucleases” Nature Biotech 31, 827-832).
[0221] In some embodiments, the user can choose the length of the seed sequence. The user can specify the number of occurrences of the seed: PAM sequence in a genome for purposes of passing the filter. The default is to screen for unique sequences. Filtration level is altered by changing both the length of the seed sequence and the number of occurrences of the sequence in the genome. The program may in addition or alternatively provide the sequence of a guide sequence complementary to the reported target sequence(s) by providing the reverse complement of the identified target sequence(s).
[0222] In the guide RNA or DNA, the “spacer / guide sequence” is complementary to the “proto spacer” sequence in the nucleic acid target. The gRNA scaffold for a single stranded gRNA structure (or gDNA scaffold for a single stranded gDNA structure) is recognized by the Cas protein.
[0223] In some embodiments, the transgenic plant, plant part, plant cell, or plant tissue culture taught herein includes a recombinant construct, which includes at least one nucleic acid sequence encoding a guide RNA or guide DNA. In some embodiments, the nucleic acid is operably linked to a promoter. In other embodiments, a recombinant construct further comprises a nucleic acid sequence encoding a CRISPR endonuclease. In other embodiments, the guide RNA or DNA is capable of forming a complex with said CRISPR endonuclease, and said complex is capable of binding to and creating a double-strand break in a target nucleic acid sequence of said plant genome. In some embodiments, the CRISPR endonuclease is Cas9. In some embodiments, the CRISPR endonuclease is Cpfl. In some embodiments, the CRISPR endonuclease is Cas 13d.
[0224] In further embodiments, the target sequence is a GELP nucleic acid (including homologs (including orthologs and paralogs), and / or fragments and variations thereof). In some embodiments, the target sequence is a GELP gene activator. In some embodiments, the present disclosure teaches gene editing of GELP in plants using genetic engineering techniques.
[0225] In some embodiments, the modified plant cells include one or more modifications (e.g., insertions, deletions, or mutations of one or more nucleic acids) in the genomic DNA sequence of an endogenous target gene (or RNA of a target sequence) resulting in an altered or reduced function of the endogenous gene or gene product, thereby increasing root biomass, shoot biomass, and / or suberized region in plant cells, plant tissues, plant parts and whole plants. In some embodiments, the modified plant cells include a modified endogenous target gene, such as a mutation, or include additional nucleic acid sequences in an endogenous genome, for example to decrease GELP activity. In some embodiments, the modifications in the genomic DNA sequence cause mutation, thereby altering or reducing the function of a GELP protein. In some embodiments, the modifications in the genomic DNA sequence results in amino acid substitutions, thereby altering or reducing the normal function of the encoded protein. In some embodiments, the modifications in the genomic DNA sequence encode a modified endogenous protein with modulated, altered, stimulated, enhanced, or reduced function compared to the unmodified version of the endogenous protein. In some embodiments, the modifications in the genomic DNA sequence results in additional protein expression, for example of GELP gene repressor.
[0226] In some embodiments, modified plants, plant parts, or plant cells include one or more modified endogenous target genes, wherein the one or more modifications result in an enhanced expression of one or more of the target genes, and / or enhanced activity of one or more proteins encoded by the target genes (the target proteins), compared to the expression / activity of a corresponding gene / protein in an unmodified plant, plant part, or plant cell. For example, in some embodiments, a modified plant, plant part, or plant cell demonstrates enhanced expression of a target gene, and / or activity of a target protein. In some embodiments, the expression of the gene or activity of the protein (such as a GELP gene repressor) in a modified plant, plant part, or plant cell is enhanced by at least 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400% or higher compared to the expression of a corresponding gene / protein in an unmodified plant, plant part, or plant cell.
[0227] Tn some embodiments, the modified endogenous protein demonstrates enhanced binding affinity to another protein expressed by the modified plant cell or by another cell; enhanced signaling capacity; enhanced enzymatic activity; enhanced DNA-binding activity with respect to a specific DNA sequence; or enhanced ability to function as a scaffolding protein.
[0228] In some embodiments, modified plants, plant parts, or plant cells comprise one or more modified endogenous target genes, wherein the one or more modifications results in a reduced expression of one or more of the target genes, and / or reduced activity of one or more proteins encoded by the target genes (the target proteins), compared to the expression / activity of a corresponding gene / protein in an unmodified plant, plant part, plant cell (e.g., a “unmodified endogenous protein”). For example, in some embodiments, a modified plant, plant part, or plant cell demonstrates reduced expression of a target gene, and / or activity of a target protein. In some embodiments, the expression of the gene or activity of the protein (such as a GELP or GELP activator) in a modified plant, plant part, or plant cell is reduced by at least 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to the expression of a corresponding gene / protein in an unmodified plant, plant part, or plant cell.
[0229] In some embodiments, the modified plants and plant cells described herein comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120 or more modified endogenous target genes encoding 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120 or more modified endogenous proteins, such as those from the GELP family.
[0230] In some embodiments, the modified endogenous protein demonstrates reduced binding affinity for another protein expressed by the modified plant cell or by another cell; reduced signaling capacity; reduced enzymatic activity; reduced DNA-binding activity with respect to a specific DNA sequence; or reduced ability to function as a scaffolding protein.
[0231] The present disclosure also provides a transformed host cell comprising the modified gene as described above. In one embodiment, said host cell is a bacteria, yeast, filamentous fungi, algae, animal cell, or plant cell. E. Exemplary methods of GELP downregulation
[0232] The present disclosure provides gene editing methods of reducing the expression of one or more GELP genes, or activity of one or more GELP proteins, by, for example: i) creating a loss-of- function mutation in one or more endogenous GELP genes; ii) creating a loss-of-function mutation in one or more endogenous GELP activator genes; iii) mutating a promoter or regulatory region of one or more endogenous GELP gene, so that expression of the GELP genes cannot be initiated or is reduced; iv) mutating a promoter or regulatory region of one or more endogenous GELP activator gene, so that expression of the GELP genes cannot be initiated or is reduced; v) introducing one or more exogenous nucleic acid encoding a GELP repressor into a plant (e.g., the plant genome); vi) introducing one or more RNAi molecules or antisense RNAs (or nucleic acid molecules providing for such) targeting mRNA transcripts of one or more GELP genes or GELP activator genes into a plant (e.g., the plant genome).
[0233] The present disclosure also provides other methods that do not result in an altered plant genome, such as a RNAi method targeting mRNA transcripts of one or more GELP genes or GELP activator genes.
[0234] In some examples, gene edited plants are generated using gene editing technologies, for example using a guide nucleic acid molecule specific for a GELP gene, that can mutate the target, resulting in its decreased expression and / or activity of the protein encoded. In some examples, a CRISPR / Cas system is used.
[0235] In some examples, gene edited plants and plant cells provided herein include a mutated GELP sequence, that decreases or eliminates GELP expression and / or activity, and results in a plant with increased root biomass, shoot biomass, and / or suberized region. In some aspects, gene edited plants and plant cells do not include exogenous nucleic acid molecules.
[0236] In some examples, transformed / transgenic plants and plant cells provided herein include a mutated GELP sequence, that decreases or eliminates GELP expression and / or activity, and results in a plant with increased root biomass, shoot biomass, and / or suberized region. In some aspects, transformed / transgenic plants and plant cells include one or more exogenous nucleic acid molecules.
[0237] Unlinked transgenic sequences (including the gRNA, the Cas9 cassette and the KanRcassette) will naturally segregate away from any gene-edited site in of the Ti generation. Thus, it is possible for plants to segregate out the gRNA / Cas9 transgenes in subsequent generations, thus producing transgene-free, gene-mutated plants. In one example, the use of recombinant DNA in the construction of gene-edited plants is avoided, and instead plant leaf tissues are transformed using pre-assembled gRNA and Cas9 RNP complexes. In one example, polyethylene glycol (PEG)-transformation of protoplasts (e.g., see Woo et al., Nat. Biotechnol., 2015. 33(11): 1162-4) or gene gun bombardment of immature embryos with RNPs (e.g., see Zhang et al., Nat Commun, 2016. 7: 12617; Liang et al., Nat Commun, 2017. 8: 14261) is used. gRNAs can be produced using commercial kits, such as the Invitrogen GeneArt™ Precision gRNA Synthesis Kit. To produce more gRNAs, a DNA template can be assembled by PCR with forward and reverse overlapping oligonucleotides that contain the target DNA sequence, together with the T7 promoter and universal reverse primers supplied with the kit. In vitro transcripts can be produced by T7 RNA polymerase and purified by phenol / chloroform extraction and ethanol precipitation. The RNP complexes of 1-5 pg gRNA and 1 pg GeneArt™ Platinum™ Cas9 nuclease with nuclear- targeting signal (Invitrogen) can be assembled and incubated for 10 min at room temperature. The RNP complexes can be mixed with 1 mg 0.6 pm gold particles sterilized by 70% ethanol for gene gun bombardment. Seeds can be sterilized by 10% bleach for 15 min and rinsed three times with sterile water. Seeds can then be germinated. Leaf bases from the first true leaves of 3-week old young plants or callus generated from embryos can be used as explants for bombardment. The bombarded plant tissues can be cultured on MS medium supplemented with Gamborg vitamins, 3% sucrose and 16.8 pM thidiazuron (TDZ) until shoot formation. Regenerated shoots can be transferred onto MS medium without TDZ but containing 1 pg / 1 indole- 3-butyric acid (IB A) to induce root formation. Fully regenerated plantlets can be transferred to soil and allowed to produce seeds under isolated conditions.
[0238] Since CRISPR-mediated gene editing occurs in To plants, the integration of the gRNA / Cas cassettes into the plant genome can be examined by PCR on To plants. Cas9 expression can be validated using a 3X FLAG antibody to detect the epitope-tagged Cas9 protein in Western blot analysis.
[0239] In one example, the gene editing method is free of recombinant technology and does not involve T-DNA, Ti-plasmids (or other plasmids), Agrobacterium or other pathogenic microbes. Once the gRNA / Cas9 RNP complex is delivered into leaf tissue, it can be rapidly degraded and lost from cells. Gene edited plants without any transgene can be produced immediately from edited plant cells.
[0240] In one example, editing of more than one gene at a time (e.g., multiple homologs of GELP, a GELP gene and a GELP activator gene, or a GELP gene and an unrelated gene simultaneously) can be achieved by bombarding leaf tissues with two or more gRNA / Cas9 RNP complexes. Since there is no selectable marker delivered into leaf tissues, regenerated plantlets can be screened for gene-editing individually. In some examples, gene edited plants are generated using Agrobacterium-mediated transformation, which stably integrates a single copy of an exogenous nucleic acid into plant genomes (e.g., see Deschamps and Simon, Plant Cell Rep., 2002. 21:359-364; Phippen and Simon, Cell. Dev. Biol., 2000. 36: 250-4) to produce gene-edited plants. Seeds can be germinated and the leaf tissues taken as explant for Agrobacterium inoculation for 30 min. The EHA105 strain of Agrobacterium can be transformed with a CRISPR-editing vector. The infected plant tissues can be cultured on MS medium supplemented with Gamborg vitamins, 3% sucrose and 16.8 pM thidiazuron (TDZ) for 3 days, after which plant tissues can be transferred to the same medium containing 300 pg / ml cefotaxime to inhibit the further growth of Agrobacterium and 50 pg / ml kanamycin to select transformed tissues and regenerate transgenic shoots. Regenerated transgenic shoots can be transferred onto MS medium without TDZ but containing 25 pg / ml kanamycin and 1 pg / 1 indole-3 -butyric acid (IBA) to induce root formation. Fully regenerated transgenic plantlets can be transferred to soil and allowed to produce seeds. To transgenic plants can be examined for the integration of the transgenes by PCR analysis and the mutation of genes, such as a GELP gene or a GELP gene activator.
[0241] In one example, antisense or inhibitory RNA (RNAi) technology is used to reduce or eliminate the activity of one or more genes from the GELP family. For example, a plant or plant cell can be engineered to contain a DNA that encodes an antisense molecule that reduces or prevents one or more genes from the GELP family or GELP activators from being translated. The term “antisense molecule’- encompasses any nucleic acid molecule or nucleic acid analog (e.g., peptide nucleic acids) that contains a sequence that corresponds to the coding strand of an endogenous GELP gene or a GELP activator gene. An antisense molecule also can have flanking sequences (e.g., regulatory sequences). Thus, antisense molecules can be ribozymes or antisense oligonucleotides. A ribozyme can have any general structure including, without limitation, hairpin, hammerhead, or axehead structures, provided the molecule cleaves RNA. In some examples, the antisense molecule is complementary to an mRNA of GELP, e.g., to the coding region, or to a regulatory region, such as 3’ untranslated region (UTR) or 5’ UTR of the mRNA. In some examples, the antisense molecule comprises miRNA and siRNA.
[0242] The phenomenon of RNAi in nature includes the endogenously induced gene silencing effects of miRNAs as well as silencing triggered by foreign dsRNA. Mature miRNAs are structurally similar to siRNAs produced from exogenous dsRNA, but before reaching maturity, miRNAs first undergo post-transcriptional modification. In nature, miRNA is generally expressed from a much longer RNA-coding gene as a primary transcript known as a pri-miRNA which is processed, in the cell nucleus, to an about 70-nucleotide stem-loop structure called a pre-miRNA by the microprocessor complex. This complex comprises an RNase III enzyme called Drosha and a dsRNA-binding protein DGCR8. The dsRNA portion of this pre-miRNA is bound and cleaved by Dicer to produce the mature miRNA molecule that can be integrated into the RISC complex. Artificial miRNA sequences are designed herein and introduced into a host plant or plant cell, which utilize the RNAi pathways in plants to reduce expression of specific genes.
[0243] In some aspects, mRNA sequences that can be targeted by miRNA in pennycress comprises at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, any of SEQ ID NOs: 958, 960, 962, and 964. In some aspects, the corresponding miRNA guide strand sequences comprise at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, any of SEQ ID NOs: 959, 961, 963, and 965. In some aspects, the miRNA comprises at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, any of SEQ ID NOs: 966, 968, 970, and 972. In some aspects, DNA encoding a primary transcript of the miRNA comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, any of SEQ ID NOs: 967, 969, 971, and 973.
[0244] In some aspects, mRNA sequences that can be targeted by miRNA in soybean comprises at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, SEQ ID NO: 974. In some aspects, the corresponding miRNA guide strand sequences comprise at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, SEQ ID NO: 975. In some aspects, the miRNA comprises at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, SEQ ID NO: 976. In some aspects, DNA encoding a primary transcript of the miRNA comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprises or consists of, SEQ ID NO: 977.
[0245] F. Exemplary methods of screening gene edited and transgenic plants
[0246] Gene-edited and transgenic plants generated using the provided methods, such as those generated to contain a non-native GELP gene sequence, can be screened to identify or confirm the presence of a mutation introduced. Similarly, transformed or gene-edited plants generated using the provided methods, such as those generated to contain additional or non-native GELP repressor sequences (or a fragment thereof), can be screened to identify or confirm the presence of a nucleic acid molecule introduced.
[0247] PCR primers can be used to amplify all or a portion of a GELP or GELP regulator sequence (or a fragment thereof), such as genomic DNA fragments spanning the selected gene target sites. Restriction enzyme digestion can be carried out on the PCR products. In some examples, restriction enzyme sites are included at the target sites (before editing occurs), and undigested PCR products in the presence of the restriction enzyme can thus indicate a gene-edited plant. The undigested PCR fragments can also be sequenced to confirm the presence and nature of any mutations or added sequences. RFLP methods can be used to screening large numbers of candidate mutant plants.
[0248] A T7E1 assay can be used to screen regenerated mutant plants. This assay allows mutated, edited sites to be detected based on their incomplete hybridization to the WT sequence (due to a mismatch between the WT and edited hybridized DNA strands at the edited site). PCR fragments spanning the mutation sites can be denatured at 95 °C and cooled down to 22 °C slowly using a thermal cycler. Annealed PCR products can be incubated with T7 endonuclease 1 (NEB) at 37°C for 20 min and analyzed by electrophoresis in a 1-2% agarose gel.
[0249] A TaqMan probe-based qPCR analysis can be used. TaqMan probes can be designed for each of the WT target sites and synthesized with fluorescence labeling on the 5’ end and minor groove binder-nonfluorescent quencher (e.g., MGB-NFQ) on the 3' end. In qPCR analysis, the biallelic mutant will not produce any fluorescent signal, while the WT plant will produce double the signal compared to the monoallelic mutant (e.g., see Li et al., Plant Physiol., 2015. 169(2): 960- 70). This TaqMan-qPCR method in the 96-well format used by the StepOnePlus qPCR System (Applied Biosystems) can be used to screen a large number of regenerated plants, produced by the gene gun bombardment with RNP complexes. This method generates gene edited plants that do not carry selectable marker genes.
[0250] Mutations from biallelic To mutants are expected to be inherited in the next generations. For transgenic mutant plants produced by Agrobacterium-mediated transformation, gene-specific PCR assays can be used to screen for Ti plants that have segregated out the Cas9 and KanRgenes. The monoallelic To mutants are expected to segregate according to the Mendelian law with a 1 :2:1 ratio.
[0251] V. Exemplary Promoters
[0252] Nucleic acid molecules (such as coding sequences or guide sequences) included in expression vectors are typically driven by a nucleotide sequence comprising a regulatory element, for example, a promoter. Thus, promoter sequences can be operably linked to a nucleic acid molecule that reduces GELP activity (such as an RNAi or guide nucleic acid). Examples include a plant promoter, such as one from Arabidopsis or other plant (e.g., constitutive promoter from the Arabidopsis serine carboxypeptidase-like gene AtSCPL30, PD1 from Arabidopsis, HVA22E, PLDdelta, AtSl , and AtS3). In some examples, the promoter is heterologous to the plant into which it is introduced. In some examples, the promoter is heterologous to the sequence to which it is operably linked. Exemplary promoters that can be used with the disclosure include those shown in SEQ ID NOs: 337-339, as well as sequences with at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NOs: 337-339.
[0253] Promoter includes reference to a region of DNA upstream from the start of transcription and involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. A “plant promoter” is a promoter capable of initiating transcription in plant cells. Examples of promoters under developmental control include promoters that preferentially initiate transcription in certain tissues, such as leaves, roots, seeds, fibers, xylem vessels, tracheids, or sclerenchyma. Such promoters are referred to as “tissue-preferred.” Promoters that initiate transcription only in a certain tissue are referred to as “tissue- specific”. A “cell-type” specific promoter primarily drives expression in certain cell types in one or more organs, for example, vascular cells in roots or leaves. An “inducible” promoter is a promoter that is under environmental control. Examples of environmental conditions that may affect transcription by inducible promoters include anaerobic conditions or the presence of light. Tissue-specific, tissue-preferred, cell type specific, and inducible promoters constitute the class of “non-constitutive” promoters. A “constitutive” promoter is a promoter that is active under most environmental conditions, and cell types.
[0254] A. Inducible Promoters
[0255] In some examples, an inducible promoter is operably linked to a gene or coding sequence (or other sequences, such as one that can generate a guide RNA, antisense RNA, or RNAi) for expression in a plant. In another example, an inducible promoter is operably linked to a nucleotide sequence encoding a signal sequence which is operably linked to a gene or coding sequence (or other sequences) for expression in a plant. With an inducible promoter the rate of transcription increases in response to an inducing agent.
[0256] Any inducible promoter can be used in the instant disclosure. See Ward et al., Plant Mol. Biol. 22:361-366 (1993). Exemplary inducible promoters include, but are not limited to, that from the ACEI system which responds to copper (Mett et al., PNAS 90:4567-4571 (1993)); In2 gene from maize which responds to benzenesulfonamide herbicide safeners (Hershey et al., Mol. Gen Genetics 227:229-237 (1991) and Gatz et al., Mol. Gen. Genetics 243:32-38 (1994)) or Tet repressor from TnlO (Gatz et al., Mol. Gen. Genetics 227:229-237 (1991)). One exemplary inducible promoter is a promoter that responds to an inducing agent to which plants do not normally respond. An exemplary inducible promoter is the inducible promoter from a steroid hormone gene, the transcriptional activity of which is induced by a glucocorticosteroid hormone. Schena et al., Proc. Natl. Acad. Sci. USA 88:0421 (1991). B. Constitutive Promoters
[0257] In some examples, a constitutive promoter is operably linked to a gene or coding sequence (or other sequences, such as one that can generate a guide RNA, antisense RNA, or RNAi) for expression in a plant. In another example, a constitutive promoter is operably linked to a nucleotide sequence encoding a signal sequence which is operably linked to a gene or coding sequence (or other sequences) for expression in a plant.
[0258] Many different constitutive promoters can be utilized in the instant disclosure. Exemplary constitutive promoters include, but are not limited to, the promoters from plant viruses such as the 35S promoter from CaMV (Odell et al., Nature 313:810-812 (1985)) and the promoters from such genes as rice actin (McElroy et al., Plant Cell 2: 163-171 (1990)); ubiquitin (Christensen et al., Plant Mol. Biol. 12:619-632 (1989) and Christensen et al., Plant Mol. Biol. 18:675-689 (1992)); pEMU (Last et al., Theor. Appl. Genet. 81 :581-588 (1991)); MAS (Velten et al., EMBO J. 3:2723- 2730 (1984)) and maize H3 histone (Lepetit et al., Mol. Gen. Genetics 231:276-285 (1992) and Atanassova et al., Plant Journal 2 (3): 291-300 (1992)).
[0259] The ALS promoter, Xbal / Ncol fragment 5' to the Brassica napus ALS3 structural gene (or a nucleotide sequence similarity to said Xbal / Ncol fragment), represents a particularly useful constitutive promoter. See WO 96 / 30530.
[0260] In a specific example the constitutive promoter is CaMV-35S, CaMV-35Somega, UBQ10 from Arabidopsi, Ubil from maize / rice, or barley leaf thionin BTH6 promoter).
[0261] C. Tissue-Specific or Tissue-Preferred Promoters
[0262] In some examples, a tissue-specific promoter is operably linked to a gene or coding sequence (or other sequences, such as one that can generate a guide RNA, antisense RNA, or RNAi) for expression in a plant. In another example, a tissue- specific promoter is operably linked to a nucleotide sequence encoding a signal sequence which is operably linked to a gene or coding sequence (or other sequences) for expression in a plant. A tissue-specific promoter can be operably linked to a gene for expression in a plant. Optionally, the tissue-specific promoter is operably linked to a nucleotide sequence encoding a signal sequence which is operably linked to a gene for expression in a plant. Plants transformed with a gene or coding sequence (or other sequences) operably linked to a tissue-specific promoter produce the product of the gene or coding sequence (or other sequences) exclusively, or preferentially, in a specific tissue.
[0263] Any tissue- specific or tissue-preferred promoter can be utilized in the instant disclosure. Exemplary tissue-specific or tissue-preferred promoters include, but are not limited to, a rootpreferred promoter-such as that from the phaseolin gene (Murai et al., Science 23:476-482 (1983) and Sengupta-Gopalan et al., Proc. Natl. Acad. Sci. USA 82:3320-3324 (1985)); a leaf-specific and light-induced promoter such as that from cab or rubisco (Simpson et al., EMBO J. 4(1 l):2723-2729 (1985) and Timko et al., Nature 318:579-582 (1985)); an anther-specific promoter such as that from LAT52 (Twell et al., Mol. Gen. Genetics 217:240-245 (1989)); a pollen-specific promoter such as that from Zml3 (Guerrero et al., Mol. Gen. Genetics 244: 161-168 (1993)) or a microsporepreferred promoter such as that from apg (Twell et al., Sex. Plant Reprod. 6:217-224 (1993)).
[0264] In some examples, a tissue-specific or tissue-preferred promoter is a native promoter of FACT gene, HORST gene, ASFT gene, GPAT5 gene, RALPH gene, and / or MYB84 gene.
[0265] VI. Methods for Plant Transformation
[0266] The disclosed polynucleotides for reducing GELP activity / expression, or combinations thereof, of the present disclosure can be transformed into plant cells, plant tissues, plant parts and whole plants.
[0267] Methods of producing transgenic plants are known. Transgenic plants can now be produced by a variety of transformation methods including, but not limited to, electroporation; microinjection; microprojectile bombardment, also known as particle acceleration or biolistic bombardment; viral-mediated transformation; and Agrobacterium-mediated transformation. See, for example, U.S. Patent Nos. 5,405,765; 5,472,869; 5,538,877; 5,538,880; 5,550,318; 5,641,664; 5,736,369 and 5,736,369; International Patent Application Publication Nos. W02002 / 038779 and WO / 2009 / 117555; Lu et al., (Plant Cell Reports, 2008, 27:273-278); Watson et al., Recombinant DNA, Scientific American Books (1992); Hinchee et al., Bio / Tech. 6:915-922 (1988); McCabe et al., Bio / Tech. 6:923-926 (1988); Toriyama et al., Bio / Tech. 6: 1072-1074 (1988); Fromm et al., Bio / Tech. 8:833-839 (1990); Mullins et al., Bio / Tech. 8:833-839 (1990); Hiei et al., Plant Molecular Biology 35:205-218 (1997); Ishida et al., Nature Biotechnology 14:745-750 (1996); Zhang et al., Molecular Biotechnology 8:223-231 (1997); Ku et al., Nature Biotechnology 17:76-80 (1999); and, Raineri et al., Bio / Tech. 8:33-38 (1990)).
[0268] Exemplary methods include Agrobacterium-mediated nucleic acid transfer (e.g., see US4536475, EP0265556, EP0270822, WO8504899, WO8603516, US5591616, EP0604662, EP0672752, WO8603776, WO9209696, WO9419930, WO9967357, US4399216, WO8303259, US5731179, US 7,250,554, EP068730, WO9516031, US5693512, US6051757 and EP904362A1), microprojectile bombardment, injection into plant cells or tissues, direct incubation of an exogenous nucleic acid molecule with germinating pollen, and electroporation.
[0269] A transgenic plant formed using Agrobacterium transformation methods typically contains a single gene on one chromosome, although multiple copies are possible. Such transgenic plants can be referred to as being hemizygous for the added gene. A more accurate name for such a plant is an independent segregant, because each transformed plant represents a unique T-DNA integration event (U.S. Patent No. 6,156,953). A transgene locus is generally characterized by the presence and / or absence of the transgene. A heterozygous genotype in which one allele corresponds to the absence of the transgene is also designated hemizygous (U.S. Patent No. 6,008,437).
[0270] For efficient plant transformation, a selection method is used such that whole plants are regenerated from a single transformed cell and every cell of the transformed plant carries the nucleic acid of interest. These methods can employ positive selection, whereby a foreign nucleic acid is supplied to a plant cell that allows it to utilize a substrate present in the medium that it otherwise could not use, such as mannose or xylose (for example, refer US 5767378; US 5994629). Negative selection can be used, utilizing selective agents such as herbicides or antibiotics that either kill or inhibit the growth of non-transformed plant cells and reducing the possibility of chimeras. Resistance genes that are effective against negative selective agents are provided on the introduced foreign nucleic acid used for the plant transformation. For example, kanamycin, together with the resistance gene neomycin phosphotransferase (nptll), which confers resistance to kanamycin and related antibiotics (see, for example, Messing & Vierra, Gene 19: 259-268 (1982); Bevan et al., Nature 304:184-187 (1983)) can be used. However, many different antibiotics and antibiotic resistance genes can be used for transformation purposes (refer US 5034322, US 6174724 and US 6255560). In addition, several herbicides and herbicide resistance genes have been used for transformation purposes, including the bar gene, which confers resistance to the herbicide phosphinothricin (White et al., Nucl Acids Res 18: 1062 (1990), Spencer et al., Theor Appl Genet 79: 625-631(1990), US 4795855, US 5378824 and US 6107549). In addition, the dhfr gene, which confers resistance to the anticancer agent methotrexate, has been used for selection (Bourouis et al., EMBO J. 2(7): 1099-1104 (1983).
[0271] The expression control elements used to regulate the expression of a given nucleic acid can either be the expression control element that is normally found associated with the coding sequence (homologous expression element) or can be a heterologous expression control element. A variety of homologous and heterologous expression control elements are known and can readily be used to make expression units for use in the present disclosure. Transcription initiation regions, for example, can include any of the various opine initiation regions, such as octopine, mannopine, nopaline and the like that are found in the Ti plasmids of Agrobacterium tumefaciens. Alternatively, plant viral promoters can also be used, such as the cauliflower mosaic virus 19S and 35S promoters (CaMV 19S and CaMV 35S promoters, respectively) to control gene expression in a plant (U.S. Patent Nos. 5,352,605; 5,530,196 and 5,858,742 for example). Enhancer sequences derived from the CaMV can also be utilized (U.S. Patent Nos. 5,164,316; 5,196,525; 5,322,938; 5,530,196; 5,352,605; 5,359,142; and 5,858,742 for example). Plant promoters such as prolifera promoter, fruit specific promoters, Ap3 promoter, heat shock promoters, seed specific promoters, etc. can also be used.
[0272] A gamete- specific promoter, a constitutive promoter (such as the CaMV or Nos promoter), an organ specific promoter (such as the E8 promoter from tomato), or an inducible promoter can be ligated to the nucleic acid to be expressed. The expression unit may be further optimized by employing supplemental elements such as transcription terminators and / or enhancer elements.
[0273] Thus, for expression in plants, the expression units typically contain, in addition to the nucleic acid to be expressed, a plant promoter region, a transcription initiation site and a transcription termination sequence. Unique restriction enzyme sites at the 5’ and 3' ends of the expression unit are typically included to allow for easy insertion into a pre-existing vector.
[0274] In some examples, the promoter is positioned about the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. However, some variation in this distance can be accommodated without loss of promoter function.
[0275] In addition to a promoter sequence, the expression cassette can also contain a transcription termination region downstream of the nucleic acid to be expressed to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes. If the mRNA encoded by the nucleic acid to be expressed is to be efficiently processed, DNA sequences which direct poly adenylation of the RNA are also commonly added to the vector construct. Polyadenylation sequences include, but are not limited to the Agrobacterium octopine synthase signal (Gielen et al., EMBO J 3:835 846 (1984)) or the nopaline synthase signal (Depicker et al., Mol. and Appl. Genet. 1 :561 573 (1982)). The resulting expression unit is ligated into or otherwise constructed to be included in a vector that is appropriate for higher plant transformation. One or more expression units may be included in the same vector. The vector typically contains a selectable marker gene expression unit by which transformed plant cells can be identified in culture. Usually, the marker gene will encode resistance to an antibiotic, such as G418, hygromycin, bleomycin, kanamycin, or gentamicin or to an herbicide, such as glyphosate (Round-Up) or glufosinate (BASTA) or atrazine. Replication sequences, of bacterial or viral origin, can be included to allow the vector to be cloned in a bacterial or phage host; in one example a broad host range for prokaryotic origin of replication is included. A selectable marker for bacteria may also be included to allow selection of bacterial cells bearing the desired construct. Suitable prokaryotic selectable markers include resistance to antibiotics such as ampicillin, kanamycin or tetracycline. Other DNA sequences encoding additional functions may also be present in the vector. For instance, in the case of Agrobacterium transformations, T DNA sequences can be included for subsequent transfer to plant chromosomes.
[0276] To introduce a nucleic acid to be expressed by conventional methods requires a sexual cross between two lines, and then repeated back-crossing between hybrid offspring and one of the parents until a plant with the desired characteristics is obtained. This process, however, is restricted to plants that can sexually hybridize, and genes in addition to the desired gene will be transferred.
[0277] Recombinant DNA techniques circumvent these limitations by enabling introduction of specific genes for desirable traits, such as improved fatty acid composition, and to introduce these genes into already useful varieties of plants. Once the foreign genes have been introduced into a plant (such as a GELP repressor), that plant can then be used in imp plant breeding schemes (e.g., pedigree breeding, single-seed-descent breeding schemes, reciprocal recurrent selection) to produce progeny which also contain the gene of interest.
[0278] Genes can be introduced in a site directed fashion using homologous recombination. Homologous recombination permits site-specific modifications in endogenous genes and thus inherited or acquired mutations may be corrected, and / or novel alterations may be engineered into the genome. Homologous recombination and site-directed integration in plants are discussed in, for example, U.S. Patent Nos. 5,451,513; 5,501,967 and 5,527,695.
[0279] An expression construct which includes nucleotide sequences that reduce expression / activity of GELP can be introduced into embryogenic callus of any plant genus or species and the resulting transformed cells can be regenerated into plants. The transgenic plants are expected to have expression of the exogenous nucleic acid molecule.
[0280] The phrase “embryogenic callus cell” used herein refers to an embryogenic cell contained in a cell mass produced in vitro.
[0281] Several approaches can be utilized to transform and co-express these polynucleotides in plant cells.
[0282] Each nucleic acid molecule to be expressed (e.g., those that decrease expression / activity of GELP) can be separately introduced into a plant cell by using separate nucleic-acid constructs. In some embodiments, two or more nucleic acid molecules to be expressed sequences can be cointroduced and co-expressed in the plant cell using a single nucleic acid construct. Such a construct can be designed with a single promoter sequence, which can transcribe a polycistronic message RNA including the nucleic acid molecules to be expressed. To enable co-translation of multiple nucleic-acid constructs, the polynucleotide sequences can be inter-linked via an internal ribosome entry site (IRES) sequence which facilitates translation of polynucleotide sequences positioned downstream of the IRES sequence. In this case, a transcribed polycistronic RNA molecule encoding the individual nucleic-acid constructs can be translated from both the capped 5' end and the two internal IRES sequences of the polycistronic RNA molecule to thereby express each nucleic acid molecule to be expressed.
[0283] In some examples, the two or more nucleic acid molecules to be expressed are translationally fused via a protease recognition site cleavable by a protease expressed by the cell to be transformed with the nucleic acid construct. In this case, a chimeric polypeptide translated will be cleaved by a cell-expressed protease to thereby generate the plurality of polypeptides.
[0284] In other embodiments, a nucleic acid construct includes multiple promoter sequences each capable of directing transcription of a specific polynucleotide sequence.
[0285] Suitable promoters which can be used include constitutive, inducible, or tissue- specific promoters.
[0286] Exemplary constitutive promoters include, for example, CaMV 35S promoter (Odell et al., Nature 313:810-812, 1985); maize Ubi 1 (Christensen et al., Plant Sol. Biol. 18:675-689, 1992); rice actin (McElroy et al., Plant Cell 2:163-171, 1990); pEMU (Last et al., Theor. Appl. Genet. 81:581-588, 1991); and Synthetic Super MAS (Ni et al., The Plant Journal 7: 661-76, 1995). Other constitutive promoters include those in U.S. Pat. Nos. 5,659,026, 5,608,149; 5,608,144; 5,604,121 ; 5,569,597: 5,466,785; 5,399,680; 5,268,463; and 5,608,142.
[0287] Suitable inducible promoters can be pathogen-inducible promoters such as, for example, the alfalfa PR10 promoter (Coutos-Thevenot et al., Journal of Experimental Botany 52: 901-910, 2001 and the promoters described by Marineau et al., Plant Mol. Biol. 9:335-342, 1987; Matton et al. Molecular Plant-Microbe Interactions 2:325-331, 1989; Somsisch et al., Proc. Natl. Acad. Sci. USA 83:2427-2430, 1986: Somsisch et al., Mol. Gen. Genet. 2:93-98, 1988; and Yang, Proc. Natl. Acad. Sci. USA 93:14972-14977, 1996.
[0288] Suitable tissue-specific promoters include, but not limited to, leaf-specific promoters such as described, for example, by Yamamoto et al., Plant J. 12:255-265, 1997; Kwon et al., Plant Physiol. 105:357-67, 1994; Yamamoto et al., Plant Cell Physiol. 35:773-778, 1994; Gotor et al., Plant J. 3:509-18, 1993; Orozco et al., Plant Mol. Biol. 23:1129-1138, 1993; and Matsuoka et al., Proc. Natl. Acad. Sci. USA 90:9586-9590, 1993.
[0289] A nucleic acid construct can also include at least one selectable marker such as nptll. In one example, the nucleic acid construct is a shuttle vector, which can propagate both in E. coli (wherein the construct comprises an appropriate selectable marker and origin of replication) and be compatible for propagation in cells. In some examples, a construct can be, for example, a plasmid, a bacmid, a phagemid, a cosmid, a phage, a virus or an artificial chromosome. Following transformation, the transformed cells can be micropropagated to provide a rapid, consistent reproduction of the transformed material. Micropropagation is a process of growing new generation plants from a single piece of tissue that has been excised from a selected parent plant or cultivar. This process permits the mass reproduction of plants having the preferred tissue expressing the fusion protein. The new generation plants which are produced are genetically identical to, and have all of the characteristics of, the original plant. Micropropagation allows mass production of quality plant material in a short period of time and offers a rapid multiplication of selected cultivars in the preservation of the characteristics of the original transgenic or transformed plant. The advantages of cloning plants are the speed of plant multiplication and the quality and uniformity of plants produced.
[0290] Micropropagation is a multi-stage procedure that utilizes alteration of culture medium or growth conditions between stages. The micropropagation process involves four basic stages: stage one, initial tissue culturing; stage two, tissue culture multiplication; stage three, differentiation and plant formation; and stage four, greenhouse culturing and hardening. During stage one, initial tissue culturing, the tissue culture is established and certified contaminant-free. During stage two, the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production goals. During stage three, the tissue samples grown in stage two are divided and grown into individual plantlets. At stage four, the transformed plantlets are transferred to a greenhouse for hardening where the plants’ tolerance to light is gradually increased so that it can be grown in the natural environment.
[0291] Integration of an exogenous nucleic acid molecule in the genome of the transformed plants can be determined using standard molecular biology techniques, such as PCR and Southern blot hybridization.
[0292] In some examples the transformation is stable. In some examples the transformation is transient.
[0293] In one example, transformation is by viral infection. Viruses that have been shown to be useful for the transformation of plant hosts include CaMV, TMV and BV. Transformation of plants using plant viruses is described in U.S. Pat. No. 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Published Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman et al. (Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189, 1988). Pseudovirus particles for use in expressing an exogenous nucleic acid molecule in many hosts, including plants, is described in WO 87 / 06261.
[0294] Suitable modifications can be made to a DNA virus. Alternatively, the virus can first be cloned into a bacterial plasmid for ease of constructing the desired viral vector with the exogenous nucleic acid molecule. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. Transcription and translation of this DNA will produce the coat protein which will encapsidate the viral DNA.
[0295] If the virus is an RNA virus, the virus is generally cloned as a cDNA and inserted into a plasmid. The plasmid is then used to make all of the constructions. The RNA virus is then produced by transcribing the viral sequence of the plasmid and translation of the viral genes to produce the coat protein(s) which encapsidate the viral RNA.
[0296] In one embodiment, a plant viral nucleic acid is provided in which the native coat protein coding sequence has been deleted from a viral nucleic acid, a non-native plant viral coat protein coding sequence and a non-native promoter, such as the subgenomic promoter of the non-native coat protein coding sequence, capable of expression in the plant host, packaging of the recombinant plant viral nucleic acid, and ensuring a systemic infection of the host by the recombinant plant viral nucleic acid, has been inserted. Alternatively, the coat protein gene may be inactivated by insertion of the exogenous nucleic acid molecule within it, such that a product is produced. The recombinant plant viral nucleic acid may contain one or more additional non-native subgenomic promoters. Each non-native subgenomic promoter can transcribe or express adjacent genes or nucleic acid sequences in the plant host and incapable of recombination with each other and with native subgenomic promoters. Exogenous nucleic acid molecules can be inserted adjacent the native plant viral subgenomic promoter or the native and a non-native plant viral subgenomic promoters if more than one nucleic acid sequence is included. The exogenous nucleic acid sequences are transcribed or expressed in the host plant under control of the subgenomic promoter to produce the desired products.
[0297] In some examples, the native coat protein coding sequence is placed adjacent one of the non-native coat protein subgenomic promoters instead of a non-native coat protein coding sequence.
[0298] In some examples, a recombinant plant viral nucleic acid is provided in which the native coat protein gene is adjacent its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral nucleic acid. The inserted non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a plant host and are incapable of recombination with each other and with native subgenomic promoters. Exogenous nucleic acid molecules can be inserted adjacent the non-native subgenomic plant viral promoters such that the sequences are transcribed or expressed in the host plant under control of the subgenomic promoters to produce the desired product. In some examples, a recombinant plant viral nucleic acid is provided in which the native coat protein coding sequence is replaced by a non-native coat protein coding sequence.
[0299] The viral vectors can be encapsidated by the coat proteins encoded by the recombinant plant viral nucleic acid to produce a recombinant plant virus. The recombinant plant viral nucleic acid or recombinant plant virus can be used to infect appropriate host plants. The recombinant plant viral nucleic acid can be capable of replication in the host, systemic spread in the host, and transcription or expression of foreign gene(s) (isolated nucleic acid) in the host to produce the desired product.
[0300] Tn some examples, the exogenous nucleic acid sequences can also be introduced into a chloroplast genome thereby enabling chloroplast expression.
[0301] VII. Exemplary Breeding Methods
[0302] In one example, open-pollinated methods are used for crops such as rye, many maizes and sugar beets, herbage grasses, legumes such as alfalfa and clover, and tropical tree crops such as cacao, coconuts, oil palm and some rubber.
[0303] Population improvement methods fall into two groups, those based on purely phenotypic selection, normally called mass selection, and those based on selection with progeny testing. Interpopulation improvement utilizes the concept of open breeding populations; allowing genes for flow from one population to another. Plants in one population (cultivar, strain, ecotype, or any germplasm source) are crossed either naturally (e.g., by wind) or by hand or by bees (commonly Apis mellifera L. or Megachile rotundata F.) with plants from other populations. Selection is applied to improve one (or sometimes both) population(s) by isolating plants with desirable traits from both sources.
[0304] In one example, a population is changed en masse using a selection procedure. The outcome is an improved population that is indefinitely propagable by random-mating within itself in isolation. Second, the synthetic variety attains the same end result as population improvement but is not itself propagable as such; it has to be reconstructed from parental lines or clones These plant breeding procedures for improving open-pollinated populations are known and comprehensive reviews of breeding procedures routinely used for improving cross-pollinated plants are provided in numerous texts and articles, including: Allard, Principles of Plant Breeding, John Wiley & Sons, Inc. (1960); Simmonds, Principles of Crop Improvement, Longman Group Limited (1979); Hallauer and Miranda, Quantitative Genetics in Maize Breeding, Iowa State University Press (1981); and, Jensen, Plant Breeding Methodology, John Wiley & Sons, Inc. (1988). For population improvement methods specific for soybean see, e.g., J.R. Wilcox, editor (1987) SOYBEANS: Improvement, Production, and Uses, Second Edition, American Society of Agronomy, Inc., Crop Science Society of America, Inc., and Soil Science Society of America, Inc., publishers, 888 pages.
[0305] In one example, mass selection methods are used. In mass selection, desirable individual plants are chosen, harvested, and the seed composited without progeny testing to produce the following generation. Since selection is based on the maternal parent only, and there is no control over pollination, mass selection amounts to a form of random mating with selection. The purpose of mass selection is to increase the proportion of superior genotypes in the population.
[0306] In one example, a synthetic variety is produced by crossing inter se a number of genotypes selected for good combining ability in all possible hybrid combinations, with subsequent maintenance of the variety by open pollination. Whether parents are (more or less inbred) seed- propagated lines, as in some sugar beet and beans (Vicia) or clones, as in herbage grasses, clovers and alfalfa, makes no difference in principle. Parents are selected on general combining ability, sometimes by test crosses or topcrosses, more generally by polycrosses. Parental seed lines may be deliberately inbred (e.g. by selfing or sib crossing). However, even if the parents are not deliberately inbred, selection within lines during line maintenance ensure that some inbreeding occurs. Clonal parents will, of course, remain unchanged and highly heterozygous.
[0307] Whether a synthetic can go straight from the parental seed production plot to the farmer or first undergoes one or two cycles of multiplication depends on seed production and the scale of demand for seed. Generally, grasses and clovers are generally multiplied once or twice and are thus considerably removed from the original synthetic.
[0308] In some examples, progeny testing is used for polycrosses, because of their operational simplicity and relevance to the objective, namely exploitation of general combining ability in a synthetic.
[0309] The number of parental lines or clones that enters a synthetic can vary. In some examples, numbers of parental lines range from 10 to several hundred, with 100-200 being the average. Broad based synthetics formed from 100 or more clones can be more stable during seed multiplication than narrow based synthetics.
[0310] In some examples, hybrids are generated. A hybrid is an individual plant resulting from a cross between parents of differing genotypes. Commercial hybrids are used in many crops, including com (maize), sorghum, sugar beet, sunflower and broccoli. Hybrids can be formed, for example by crossing two parents directly (single cross hybrids), by crossing a single cross hybrid with another parent (three-way or triple cross hybrids), or by crossing two different hybrids (fourway or double cross hybrids). Most individuals in an out breeding (i.e., open-pollinated) population are hybrids, but the term is usually reserved for cases in which the parents are individuals whose genomes are sufficiently distinct for them to be recognized as different species or subspecies. Hybrids may be fertile or sterile depending on qualitative and / or quantitative differences in the genomes of the two parents. Heterosis, or hybrid vigor, is usually associated with increased heterozygosity that results in increased vigor of growth, survival, and fertility of hybrids as compared with the parental lines that were used to form the hybrid. Maximum heterosis is usually achieved by crossing two genetically different, highly inbred lines.
[0311] The production of hybrids can include the isolated production of both the parental lines and the hybrids which result from crossing those lines. For a detailed discussion of the hybrid production process, see, e.g., Wright, Commercial Hybrid Seed Production 8: 161-176, In Hybridization of Crop Plants.
[0312] In some examples, bulk segregation analysis (BSA) is used. BSA, a.k.a. bulked segregation analysis, or bulk segregant analysis, is described by Michelmore et al. (Michelmore et al., 1991, Proceedings of the National Academy of Sciences, USA, 99:9828-9832) and Quarrie et al. (Quarrie et al., 1999, Journal of Experimental Botany, 50(337) : 1299- 1306). For BSA of a trait of interest, parental lines with certain different phenotypes are chosen and crossed to generate F2, doubled haploid or recombinant inbred populations with QTL analysis. The population is then phenotyped to identify individual plants or lines having high or low expression of the trait. Two DNA bulks are prepared, one from the individuals having one phenotype (e.g., increased root biomass, shoot biomass, and / or suberized region), and the other from the individuals having reversed phenotype (e.g., average or decreased root biomass, shoot biomass, and / or suberized region), and analyzed for allele frequency with molecular markers. Only a few individuals are required in each bulk (e.g., 10 plants each) if the markers are dominant (e.g., RAPDs). More individuals are needed when markers are co-dominant (e.g., RFLPs). Markers linked to the phenotype can be identified and used for breeding or QTL mapping.
[0313] In some examples, gene pyramiding is used to combine into a single genotype a series of target genes identified in different parents. The first part of a gene pyramiding breeding is called a pedigree and is aimed at cumulating one copy of all target genes in a single genotype (called root genotype). The second part is called the fixation steps and is aimed at fixing the target genes into a homozygous state, that is, to derive the ideal genotype (ideotype) from the root genotype. Gene pyramiding can be combined with marker assisted selection (MAS) or marker based recurrent selection (MBRS). VIII. Exemplary plants for use with the disclosed methods
[0314] The present disclosure teaches plants transformed with a plant transformation construct or vector. The methods for targeted gene-editing as described herein can be used to confer desired traits on essentially any plant. A wide variety of plants and plant cell systems may be engineered for the desired physiological and agronomic characteristics described herein using the nucleic acid constructs of the present disclosure and the various transformation methods. In some embodiments, the plant for the transformation is a monocotyledonous plant (monocot) or a dicotyledonous plant (di cot).
[0315] Monocots are flowering plants having embryos with one cotyledon or seed leaf, parallel leaf veins, and flower parts in multiples of three. Examples of monocots that can be used for transformation, genetic engineering or gene-editing include, but are not limited to turfgrass, com / maize, rice, oat, annual ryegrass, wheat, barley, sorghum, orchid, iris, lily, onion, and palm. Examples of turfgrass include, but are not limited to Agrostis spp. (bentgrass species including colonial bentgrass and creeping bentgrasses), Poa pratensis (Kentucky bluegrass), Lolium spp. (ryegrass species including annual ryegrass and perennial ryegrass), Festuca arundinacea (tall fescue) Festuca rubra commutata (Chewings fescue), Cynodon dactylon (bermudagrass, Pennisetum clandestinum (kikuyu grass), Stenotaphrum secundatum (St. Augustine grass), Zoysia japonica (zoysia grass), and Dichondra micrantha.
[0316] Other exemplary plants that can be used for transformation, genetic engineering or geneediting include, but are not limited to angiosperm and gymnosperm plants such as acacia, alfalfa, amaranth, apple, apricot, artichoke, ash tree, asparagus, avocado, banana, barley, beans, beet, birch, beech, blackberry, black raspberry, blueberry, broccoli, Brussel's sprouts, cabbage, cane berry, canola, cantaloupe, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, Clementine, clover, coffee, com, cotton, cowpea, cucumber, cypress, eggplant, elm, endive, eucalyptus, fennel, figs, fir, geranium, grape, grapefruit, groundnuts, ground cherry, gum hemlock, hickory, kale, kiwifruit, kohlrabi, larch, lettuce, leek, lemon, lime, locust, pine, maidenhair, maize, mango, maple, melon, millet, mushroom, mustard, nuts, oak, oats, oil palm, okra, onion, orange, an ornamental plant or flower or tree, papaya, palm, parsley, parsnip, pea, peach, peanut, pear, peat, pepper, persimmon, pigeon pea, peach, pine, pineapple, plantain, plum, pomegranate, potato, pumpkin, radicchio, radish, rapeseed, raspberry, rice, rye, sorghum, safflower, sallow, soybean, spinach, spruce, squash, strawberry, sugar beet, sugarcane, sunflower, sweet potato, sweet com, tangerine, tea, tobacco, tomato, trees, triticale, turf grasses, turnips, vine, walnut, watercress, watermelon, wheat, wild strawberry, yams, yew, and zucchini. In some embodiments, plants and plant cells for transformation, genetic engineering or gene-editing include, but are not limited to, those monocotyledonous and dicotyledonous plants, such as crops including grain crops (e.g., wheat, maize, rice, millet, barley), fruit crops (e.g., tomato, apple, grape, peach, pear, plum, raspberry, black raspberry, blackberry, cane berry, cherry, avocado, strawberry, wild strawberry, orange), forage crops (e.g., alfalfa), root vegetable crops (e.g., carrot, potato, sugar beets, yam), leafy vegetable crops (e.g., lettuce, spinach); flowering plants (e.g., petunia, rose, chrysanthemum), conifers and pine trees (e.g., pine fir, spruce); plants used in phytoremediation (e.g., heavy metal accumulating plants); oil crops (e.g., sunflower, rape seed) and plants used for experimental purposes (e.g., Arabidopsis). In some embodiments, fruit crops such as tomato, apple, peach, pear, plum, raspberry, black raspberry, blackberry, cane berry, cherry, avocado, strawberry, wild strawberry, grape and orange.
[0317] In some embodiments, plants and plant cells for transformation, genetic engineering or gene-editing include, but are not limited to, Canola (Brassica napus), Soybean (Glycine max), Cotton (Gossypium hirsutum), Rice (Oryza sativa), Lotus (Lotus japonicus), Radish (Raphanus sativus), Setaria (Setaria italica), Sorghum (Sorghum bicolor), Pennycress (Thlaspi arvense), Southern cattail (Typha domingensis), Wheat (Triticum aestivum), and Maize (Zea mays).
[0318] In some embodiments, the plant for transformation, genetic engineering or gene-editing is a dicot. In some embodiments, the plant, plant part, or plant cell is a species selected from Abrabidopsis genus, Brassica genus, Glycine genus, Gossypium genus, Oryza genus, Raphanus genus, Setaria genus, Sorghum genus, Thlaspi genus, Typha genus, Triticum genus, and Zea genus.
[0319] In some embodiments, the plant, plant part, or plant cell is from Abrabidopsis thaliana.
[0320] In some embodiments, the plant, plant part, or plant cell is from the Brassica genus, such as Brassica balearica (Mallorca cabbage), Brassica carinata (Abyssinian mustard or Abyssinian cabbage), Brassica elongata (elongated mustard), Brassica fruticulosa (Mediterranean cabbage), Brassica hilarionis (St. Hilarion cabbage), Brassica juncea (Indian mustard, brown and leaf mustards, Sarepta mustard), Brassica napus (rapeseed, canola, rutabaga, Siberian kale), Brassica narinosa (broadbeaked mustard), Brassica nigra (black mustard), Brassica oleracea (kale, cabbage, collard greens, broccoli, cauliflower, kai-lan, brussels sprouts, kohlrabi), Brassica perviridis (tender green, mustard spinach), Brassica rapa (Chinese cabbage, turnip, rapini, komatsuna), Brassica rupestris, Brassica spinescens, or Brassica toumefortii (Asian mustard).
[0321] In some embodiments, the plant, plant part, or plant cell is from the Thlaspi genus and is Thlaspi alliaceum (roadside penny-cress), Thlaspi arcticum (arctic penny-cress), Thlaspi arvense (field penny-cress), Thlaspi caerulescens (alpine penny-cress), Thlaspi californicum (Kneeland Prairie penny-cress), Thlaspi cyprium (Cyprus penny-cress), Thlaspi fendleri (Fendler's penny- cress), Thlaspi idahoense (Idaho penny -cress), Thlaspi jankae (Slovak penny-cress), Thlaspi montanum (alpine penny-cress), Thlaspi parviflorum (meadow penny-cress), Thlaspi perfoliatum (Cotswold penny-cress), Thlaspi praecox (early penny-cress), or Thlaspi rotundifolium (roundleaved penny-cress).
[0322] In some embodiments, the plant, plant part, or plant cell is from the Glycine genus and is Glycine albicans, Glycine aphyonota, Glycine arenaria, Glycine argyria, Glycine canescens, Glycine clandestine, Glycine curvata, Glycine cyrtoloba, Glycine falcata, Glycine gracei, Glycine hirticaulis, Glycine hirticaulis subsp., Glycine lactovirens, Glycine latifoli a, Glycine latroheana, Glycine microphylla, Glycine montis-douglas, Glycine peratosa, Glycine pescadrensis, Glycine pindanica, Glycine pullenii, Glycine remota, Glycine rubiginosa, Glycine stenophita, Glycine syndetika, Glycine tabacina, Glycine tomentella, Glycine soja, or Glycine max.
[0323] The present disclosure provides a plant, plant part, or plant cell disclosed above, which is transformed with plant transformation vectors comprising a nucleic acid that reduces expression / activity of one or more GELP; and ii) one or more promoter operably linked to the nucleic acid(s). In some embodiments, the promoter is an inducible promoter, a constitutive promoter, or a cell-type specific promoter.
[0324] In some embodiments, the plant, plant part, or plant cell thereof has increased root biomass, shoot biomass, and / or suberized region as compared to an untransformed control plant. In some embodiments, a transformed plant tissue is produced from the transformed plant cell. In some embodiments, a transformed plantlet is produced from the transformed plant tissue and wherein the transformed plantlet has increased root biomass, shoot biomass, and / or suberized region as compared to an untransformed control plantlet. In some embodiments, a progeny of the transformed plantlet is produced and wherein the progeny has increased plant root biomass, shoot biomass, and / or suberized region as compared to an untransformed control plantlet. In some embodiments, the transformed plantlet or the progeny of the transformed plantlet is grown into a mature transformed plant, and wherein the mature transformed plant has increased root biomass, shoot biomass, and / or suberized region as compared to a mature untransformed control plant. In some embodiments, the mature transformed plant or clone of the mature transformed plant is used in a breeding method taught herein.
[0325] In some embodiments, the plant, plant part, or plant cell of the present disclosure has at least about 5% more, about 10% more, about 15% more, about 20% more, about 25% more, about 30% more, about 35% more, about 40% more, about 45% more, about 50% more, about 60% more, about 70% more, about 80% more, about 90% more, about 100% more, about 200% more, root biomass, shoot biomass, and / or suberized region as compared to an untransformed control plant. In some embodiments, the plant, plant part, or plant cell is a genetically-modified, genetically- engineered, or gene-edited one.
[0326] In some embodiments, the disclosure teaches a method of producing a plant having increased root biomass, shoot biomass, and / or suberized region, comprising crossing the genetically-modified or gene-edited plant of the disclosure with itself or another plant; and selecting a progeny plant having increased root biomass, shoot biomass, and / or suberized region.
[0327] In other embodiments, the method further comprises using the selected progeny in a breeding method taught herein.
[0328] In some embodiments, the disclosure teaches a method for increasing plant root biomass, shoot biomass, and / or suberized region comprising growing a transformed or gene-edited plant of the disclosure, or a progeny thereof, for example in soil or other growth media.
[0329] The present disclosure provides a solution for increasing plant root biomass, shoot biomass, and / or suberized region. The present disclosure provides methods of identifying genetic materials that can increase plant root biomass, shoot biomass, and / or suberized region. Also, the present disclosure provides methods of transferring genetic materials to plants in order to give rise to traits that significantly increase plant root biomass, shoot biomass, and / or suberized region. Furthermore, the present disclosure teaches newly identified genetic components and methods of generating genetically modified plants, plant cells, tissues, and seeds with altered root system architecture for increasing plant root biomass, shoot biomass, and / or suberized region.
[0330] XI. Exemplary Additional Genes
[0331] Herbicide Resistance
[0332] One or more herbicide resistance genes can be used with the methods and plants provided herein. In particular examples, a herbicide resistance gene confers tolerance to an herbicide, such as glyphosate, sulfonylurea, imidazalinone, dicamba, glufosinate, phenoxy proprionic acid, cyclohexone, triazine, benzonitrile, broxynil, L-phosphinothricin, cyclohexanedione, chlorophenoxy acetic acid, or combinations thereof.
[0333] In one example the herbicide resistance gene is a gene that confers resistance to an herbicide that inhibits the growing point or meristem, such as an imidazalinone or a sulfonylurea. Exemplary genes in this category code for mutant ALS and AHAS enzyme as described, for example, by Lee et al. (1988. Embryo J. 7:1241-8) and Miki et al. (1990. Theoret. Appl. Genet. 80:449-458).
[0334] Resistance genes for glyphosate (resistance conferred by mutant 5-enolpyruvl-3 phosphikimate synthase (EPSP) and aroA genes, respectively) and other phosphono compounds such as glufosinate (phosphinothricin acetyl transferase (PAT) and Streptomyces hygroscopicus phosphinothricin-acetyl transferase (bar) genes) can be used (e.g., see U.S. Pat. No. 4,940,835). Examples of specific EPSPS transformation events conferring glyphosate resistance are described, for example, in U.S. Pat. No. 6,040,497.
[0335] DNA molecules encoding a mutant aroA gene are known (e.g., ATCC accession number 39256 and U.S. Pat. No. 4,769,061), as are sequences for glutamine synthetase genes, which confer resistance to herbicides such as L-phosphinothricin (e.g., U.S. Pat. No. 4,975,374), phosphinothricin-acetyltransferase (e.g., U.S. Pat. No. 5,879,903). DeGreef et al. (1989. Bio / Technology 61-64) describe the production of gene-edited plants that express chimeric bar genes coding for phosphinothricin acetyl transferase activity. Exemplary genes conferring resistance to phenoxy propionic acids and cyclohexones, such as sethoxydim and haloxyfop are the Acct-Sl, Accl-S2 and Acct-S3 genes described by Marshall et al. (1992. Theor Appl Genet. 83:435-442).
[0336] Exemplary genes conferring resistance to an herbicide that inhibits photosynthesis include triazine (psbA and gs+genes) and benzonitrile (nitrilase gene) (see Przibilla el al., 1991. Plant Cell. 3:169-174). Nucleotide sequences for nitrilase genes are disclosed in U.S. Pat. No. 4,810,648, and DNA molecules containing these genes are available under ATCC Accession Nos. 53435, 67441, and 67442. Cloning and expression of DNA coding for a glutathione S-transferase is described by Hayes et al. (1992. Biochem. J. 285:173).
[0337] U.S. Patent Publication No: 20030135879 describes dicamba monooxygenase (DM0) from Pseuodmonas maltophilia, which is involved in the conversion of a herbicidal form of the herbicide dicamba to a non-toxic 3,6-dichlorosalicylic acid and thus can be used for producing plants tolerant to this herbicide.
[0338] The metabolism of chlorophenoxyacetic acids, such as, for example 2,4-D herbicide, is well known. Genes or plasmids that contribute to the metabolism of such compounds are described, for example, by Muller et al. (2006. Appl. Environ. Microbiol. 72(7):4853-4861), Don and Pemberton (1981. J Bacteriol 145(2):681-686), Don et al. (1985. J Bacteriol 161(l):85-90) and Evans et al. (1971. Biochem J 122(4):543-551).
[0339] EXAMPLE 1
[0340] Functional deletion of GDSL lipase increases root biomass
[0341] The discovery of the GDSL lipase genes' role in enhancing root biomass originated from an extensive genome-wide association study (GWAS). In this initial GWAS, 230 natural accessions of the model plant Arabidopsis were grown in a growth chamber. For each accession, approximately 150 seeds were spread on a plate and germinated and grown for 7 days in a growth chamber. The seeds were grown on MS plates (0.25%) and subjected to long-day conditions (16 hours light / 8 hours dark).
[0342] Following the week in the growth chamber, five seedlings were randomly selected from each plate and transplanted on a separate plate for an additional two weeks under identical conditions. This process was performed at least three times, resulting in the transfer of at least 15 seedlings to at least three separate plates. Subsequently, root and shoot samples were harvested from each plate, transferred into 1 .5 ml Eppendorf tubes, and then subjected to a 72-hour drying period in an oven set at 50 °C. The dried samples were weighed, with the dry mass calculated after subtracting the weight of the empty tubes. Each accession was replicated four times to get the mean root dry weight data. The distribution pattern of the collected root dry weight biomass trait is shown in Figure 1.
[0343] Figure 1 displays the distribution of root dry weight biomass data derived from 230 natural Arabidopsis accessions. Each accession was grown on MS plates at a 25% strength under long day conditions. Initially, the plants germinated on MS plates for 7 days. Subsequently, five seedlings were randomly selected and transplanted to new MS plates at a 25% strength. These transplanted plates underwent an additional 14 days of growth under long day conditions. After a total of 21 days (7 days on the germination plate + 14 days on the transplanted plate), the root and shoot tissues were carefully separated using a razor blade and placed into 1.5 ml Eppendorf tubes. These tubes were then placed in an oven at 50 °C for 72 hours to eliminate moisture before being weighed to determine the dry weight biomass data. The calculated root dry weight data was obtained by subtracting the weight of the empty tube. The mean values from four replications per natural accession were used to determine the phenotypic frequency. The raw dry weight data has been log- normalized, with the reference wildtype line indicated as Col-0 on the graph.
[0344] Utilizing the phenotype data, single nucleotide polymorphism (SNP) information was extracted for all the natural accessions used in this study from the 1001 Arabidopsis database (https: / / 1001genomes.org / ) and performed a genome-wide scan to identify significant hits. Genome-Wide Association Study (GWAS) analysis using a custom script was used to investigate the genetic variants associated with root biomass. The script utilized various options to configure the GWAS analysis (emmax model implemented in pyGWAS), including the choice of genotype dataset (full_imputed of Arabidopsis), transformation method (non), and thresholds for Minor Allele Count (MAC) (lOkb) and p-values. This analysis was applied to multiple samples, each represented by a separate CSV file containing phenotypic data.
[0345] For the GWAS analysis, a step-by-step process was used: 1. Data Preparation: The input phenotype data from each sample was organized into a standardized format and converted line terminators to ensure compatibility with our analysis pipeline.
[0346] 2. GWAS Processing: The GW AS analysis was executed for each sample using the PyGWAS tool. The transformation method, MAC threshold, and other relevant parameters were specified. The output from this step included GWAS results files, Manhattan plots, and Q-Q plots for each trait.
[0347] 3. Gene Hunter: In addition to GWAS, the GeneHunter tool was employed to identify candidate genes associated with the genetic variants detected in the GWAS analysis. GeneHunter used a specified database gtf file (dependent on the species) and considered various parameters, such as distance thresholds, p-value thresholds, and Minor Allele Count (MAC) thresholds.
[0348] The combined results from GWAS and GeneHunter provided insights into the genetic factors underlying the root biomass. Further analysis and interpretation of these results were conducted to identify genes associated with the traits. These findings contributed to understanding the genetic basis of the studied phenotypes.
[0349] The analysis revealed multiple chromosomal locations exhibiting noteworthy associations with the collected phenotypes, indicative of the polygenic nature of the dry weight biomass trait (Figure 2).
[0350] Figure 2 is a Manhattan plot that depicts the genome-wide association (GW A) mapping results for the root dry weight biomass of 21 -day-old natural accessions of Arabidopsis grown under long day conditions. The horizontal dash-dot line represents a 5% false discovery rate threshold for two correction methods (Bonferroni and Benjamini-Hochberg). Notably, SNPs significantly associated with root dry weight biomass are located in proximity to the GDSL lipase gene clusters, as highlighted by the rectangular box on the graph.
[0351] Genes identified by GWAS were characterized, focusing on those with high-confidence p- values. To date, approximately 100 genes have been characterized along with their T-DNA insertion lines, with the assumption that the random insertion of T-DNA into the gene would result in a loss of gene function.
[0352] During a 21-day phenotyping period on MS plates (25%), several GDSL lipase T-DNA lines manifesting an augmented root biomass phenotype in comparison to the wildtype were identified (Col-0) (Figure 3). Divergence in root dry weight biomass between the wildtype and T- DNA insertion lines of GDSL lipase was assessed for four distinct genes. The seedlings were grown under long day conditions for 21 days. The X-axis in Figure 3 denotes the sample ID, while the Y-axis represents the biomass value in grams. Notably, all four GDSL lipase genes exhibited significantly higher root dry weight biomass compared to the wildtype (Figure 3).
[0353] Subsequently, the stability of these phenotypes and their response variations were determined under diverse conditions, including different media strengths, sowing versus transplanting, and growth in media devoid of sucrose. Notably, four GDSL lipase T-DNA lines consistently exhibited increased biomass compared to the wildtype.
[0354] It was determined that the GDSL lipase genes are tandemly positioned on the chromosome, with an additional three GDSL lipase genes interspersed among them. Notably, their positioning gives rise to two distinct clusters, with one cluster comprising four GDSL lipase genes, and the other cluster comprising three GDSL lipase genes. There are two genes situated in between that do not belong to the GDSL lipase family.
[0355] Phenotyping on six of the GDSL lipases was conducted utilizing homozygous T-DNA insertion lines to assess their root biomass traits (Figure 4). Homozygous T-DNA lines with loss- of-function mutations in GDSL1 (SEQ ID NO: 2), GDSL2 (SEQ ID NO: 3), GDSL3 (SEQ ID NO: 4), GDSL4 (SEQ ID NO: 5), GDSL5 (SEQ ID NO: 6), or GDSL6 (SEQ ID NO: 7) were generated. The phenotyping was conducted on MS plates (25%) under long day conditions within a growth chamber. The X-axis of Figure 4 denotes the sample ID, while the Y -axis represents the biomass weight in grams. T-DNA insertion lines for the same GDSL lipase gene are grouped together. This phenotypic data revealed that all GDSL lipase T-DNA lines exhibited increased root dry weight biomass compared to the wildtype (Figure 4).
[0356] All the T-DNA lines were phenotyped at a later stage to evaluate any phenotypic differences after growing them hydroponically for six weeks. In this setting, the same growth conditions described above were used. However, black cups capable of holding up to 300 ml of nutrient solution were employed for the hydroponic growth. The nutrient medium was changed twice a week to ensure a consistent and adequate nutrient supply to the plants. The method was based on B. A. Krathy, Vegetable Crops, 2010. Rockwool was shaped into 1.5 cm x 1 cm x 1 cm cubes. Then, a lid featuring a 1 cm circumference circle at its center, surrounded by several 0.5 cm circumference circles, was created. Afterward, a condiment cup containing hydroponic solution was positioned the rockwool in the lid's center. Securing the lid onto the cup followed. Subsequently, the cup was filled with germination solution, thoroughly saturating the rockwool. Directly placing seeds onto the rockwool, they were covered to aid germination and later thinned out excess seedlings, retaining only one near the center. Throughout, a consistent solution level was maintained to submerge the roots and adjusted it as the roots grew. After 2-3 weeks, a new nutrient solution was used, adjusting its level accordingly. The phenotyping of the GDSL-lipase T- DNA insertion lines was conducted after six weeks of growth, revealing an increased production of root biomass compared to wildtype plants. The differences in root growth in the hydroponic system after six weeks are illustrated in Figure 5. The X-axis of Figure 5 denotes the sample ID, while the Y-axis represents the biomass weight in grams. Notably, all the T-DNA lines exhibited a substantial and statistically significant increase in root dry weight biomass, with a significance level of P < 0.01.
[0357] EXAMPLE 2
[0358] Biomass phenotyping of GDSL lipase mutant lines generated by CRISPR / Cas9
[0359] As phenotypes of increased root biomass were observed in all T-DNA insertion lines for individual GDSL lipase genes, experiments were conducted to determine whether multiple GDSL lipase genes are redundant or contribute additively in generating the phenotype of increased root biomass. CRISPR / Cas9 technology was used to produce Arabidopsis thaliana lines that have one or more of the seven GDSL lipase genes identified above knocked out.
[0360] To create knockout mutants using the CRISPR / Cas9 system, gRNA sequences were designed, for example by using the tool available at the CRISPRdirect website (https: / / crispr.dbcls.jp / ). For multiplex knockout, a multiplex vector was then generated following the processes disclosed in Stuttman et al. (Stuttmann, Johannes et al. “Highly efficient multiplex editing: one-shot generation of 8x Nicotiana benthamiana and 12x Arabidopsis mutants.’* The Plant journal : far cell and molecular biology vol. 106,1 (2021): 8-22. doi: 10. I l l 1 / tpj.15197). A vector encoding a minimum of 3 gRNAs per gene was generated to facilitate the knockout of all 7 GDSL lipase genes concurrently.
[0361] 275 CRISPR / Cas9 knockout lines at the T3 stage were screened. There were several lines where all seven targeted GDSL lipases were successfully knocked out. Various edits were generated by the designed guide RNAs, for example, an insertion of a single nucleotide (Figure 6A), and a 27-nucleotide deletion (Figure 6B).
[0362] Phenotype assessment was performed on the edited lines. The 7-gene knockout lines exhibited accelerated root growth compared to the reference lines and the lines with one GDSL lipase gene knocked out (Figures 7A and 7B). Figure 7B shows that the roots of the 7-gene knockout lines were growing at least three times faster than those of the reference line, based on a 10-day period of growth on plates. These findings demonstrate an additive effect of multiple GDSL lipase genes on the root phenotype.
[0363] EXAMPLE 3 Biomass phenotyping of 8-week-old GDSL lipase mutant lines
[0364] To assess whether GDSL lipase single mutant lines demonstrate increased biomass after 8 weeks, a controlled experiment was conducted in the greenhouse. The study used six single mutant Arabidopsis thaliana lines, each having a loss-of-function mutation in a different GDSL lipase gene (gdsl-1, gdsl-2, gdsl-3, gdsl-4, gdsl-5, and gdsl-6), and the wildtype (Col-0), each replicated 20 times. Seeds were initially sown in one-gallon pots filled with Turface, and after germination, excess seedlings were thinned to maintain just one seedling per pot throughout the experiment.
[0365] Following an 8-week growth period on Turface, both shoot and root biomasses were harvested for measurement. Visual observations revealed that all mutant lines exhibited increased shoot and root growth compared to the wildtype (Figure 8). The shoot and root tissues were subsequently separated, dried at 50 °C for four days, and weighed. Statistical analysis verified significant increases in both shoot and root biomasses of the 8-week-old mutant lines as compared to the wildtype (Figures 9 A and 9B).
[0366] EXAMPLE 4
[0367] Suberin accumulation in 7-day-old GDSL lipase mutant lines
[0368] Whether the Arabidopsis GDSL lipase mutant lines also exhibit increased suberin accumulation was studied. Seedlings of gdsl-1, gdsl-2, gdsl-3, gdsl-4, gdsl-5, gdsl-6, and Col-0 were grown under long-day conditions (16 hours light, 8 hours dark) in growth chambers for 7 days, with each line replicated 10 times. After 7 days, growth plates were scanned to measure the primary root length of each line, revealing that all GDSL lipase mutant lines exhibited faster primary root growth compared to the wildtype (Figure 10A). Subsequently, 10 roots per line were stained with Fluorol Yellow according to standard protocols and imaged under a microscope. The lengths of suberized and unsuberized regions were quantified using ImageJ software. All GDSL lipase mutant lines showed increased suberized regions compared to the wildtipe (Figure 10B), but the increase relative to root growth was not greater than that observed in the wildtype (Figure 10C).
[0369] EXAMPLE 5
[0370] Biomass phenotyping of multiple GDSL lipases knockout lines
[0371] Arabidopsis lines were engineered by simultaneously knocking out 7 GDSL lipase genes located in tandem using CRIRPR / Cas9. Following confirmation of these knockouts, two distinct knockout lines, R1 and R2 (Figure 11), were analyzed for both root and shoot traits. These lines were grown on (A strength MS media under long-day conditions (16 hours light, 8 hours dark) for 21 days. After this growth period, root and shoot tissues were harvested, dried at 50 °C for four days, and then weighed. The measurements showed that the biomass accumulations for both root and shoot in these multiple mutant lines were greater than that observed in the single mutant lines (Figures 12A and 12B). The results also showed that while knocking out individual GDSL lipase genes contribute to biomass traits, the collective effect is not a simple sum of the individual effects, indicating potential epistatic interactions or compensatory biological mechanisms that modulate overall plant growth and development.
[0372] EXAMPLE 6
[0373] Reducing GDSL lipase expression / activity in Thlaspi arvense
[0374] Expression and / or activity of one or more GDSL lipases can be reduced or eliminated in Thlaspi arvense (pennycress) by knocking down or knocking out one or more GDSL lipase genes using microRNA (miRNA) and / or CRISPR / Cas technologies. The reduction of GDSL lipase expression / activity is expected to increase root biomass, shoot biomass, and / or suberized region in penny cress.
[0375] Table 2 provides the guide sequences for targeting nine different GDSL lipase genes in penny cress. The 3' end of these sequences can be fused to a common scaffold sequence that serves to bind Cas9 or other nucleases. Figure 13 shows a vector for expressing a Cas protein and two gRNAs simultaneously targeting two regions of the same or different GDSL lipase genes. Figure 14 shows a vector for expressing a Cas protein and thirty-two gRNAs simultaneously targeting thirty-two regions of multiple different GDSL lipase genes. Figures 15A and 15B show comparison of coding sequences of loss-of-function GDSL lipase mutants generated using the vectors and gRNAs provided herein, and the corresponding wildtype GDSL lipase coding sequence.
[0376] Table 2
[0377] Edited or transgenic pennycress plants are grown under controlled conditions, and phenotypic assessments for root biomass, shoot biomass, suberin production, etc. will be conducted. It is expected that pennycress plants with loss-of-function mutations in one or more GDSL lipase genes will display increased root biomass, shoot biomass, and / or suberized region or suberin production compared to a wildtype plant. microRNAs (miRNAs) are designed to target one or more GDSL lipase mRNAs in pennycress. miRNAs or vectors encoding miRNAs are introduced into pennycress plants. The miRNAs can be combined or used individually. Figure 21 provides an exemplary design of transgene cassette for expressing four miRNAs together under a promoter. The expression cassettes can be mono- or polycistronic. Treated or transgenic pennycress plants are grown under controlled conditions, and phenotypic assessments for root biomass, shoot biomass, suberin production, etc. will be conducted. It is expected that pennycress plants treated with or expressing such miRNAs will display increased root biomass, shoot biomass, and / or suberized region or suberin production compared to a wildtype plant. Table 3 provides sequences of exemplary target mRNA regions and the corresponding miRNA guide strand sequences.
[0378] Table 3
[0379] SEQ ID NO: 966 is a sequence of a-miRl,5,7,8,9 (5' to 3'):
[0380] UCGGUGAGUCCAUCGCCGUUCACAGGUCGUGAUAUGAUUCAAUUAGCUUCCG ACUCAUUCAUCCAAAUACCGAGUCGCCAAAAUUCAAACUAGACUCGUUAAAUGAAU GAAUGAUGCGGUAGACAAAUUGGAUCAUUGAUUCUCUUUGAUCGGCGAUGGAAUCA CCGAAG (SEQ ID NO: 966)
[0381] SEQ ID NO: 967 is a DNA sequence encoding a primary transcript of a-miRl,5,7,8,9, including the flanking regions encoding the lower stem of Ath-miR319a (5' to 3'):
[0382] GATGTTTTAGGAATATATATGTAGAGTCGGTGAGTCCATCGCCGTTCACAGGTC GTGATATGATTCAATTAGCTTCCGACTCATTCATCCAAATACCGAGTCGCCAAAATTCA AACTAGACTCGTTAAATGAATGAATGATGCGGTAGACAAATTGGATCATTGATTCTCT TTGATCGGCGATGGAATCACCGAAGCTCTCTTTTGTATTCCAATTTTCTTG (SEQ ID NO: 967)
[0383] Figure 16 shows the complementarity between the guide strand and target mRNA, and the stem loop structure of a-miRl,5,7,8,9.
[0384] SEQ ID NO: 968 is a sequence of a-miR2_3 (5’ to 3'):
[0385] UUGAUAACCGACACCGGGUUCACAGGUCGUGAUAUGAUUCAAUUAGCUUCCG ACUCAUUCAUCCAAAUACCGAGUCGCCAAAAUUCAAACUAGACUCGUUAAAUGAAU GAAUGAUGCGGUAGACAAAUUGGAUCAUUGAUUCUCUUUGAUCCCGGUGUCGGUUA UCGAAU (SEQ ID NO: 968)
[0386] SEQ ID NO: 969 is a DNA sequence encoding a primary transcript of a-miR2_3, including the flanking regions encoding the lower stem of Ath-miR319a (5' to 3'):
[0387] GATGTTTTAGGAATATATATGTAGAGTTGATAACCGACACCGGGTTCACAGGTC GTGATATGATTCAATTAGCTTCCGACTCATTCATCCAAATACCGAGTCGCCAAAATTCA AACTAGACTCGTTAAATGAATGAATGATGCGGTAGACAAATTGGATCATTGATTCTCT TTGATCCCGGTGTCGGTTATCGAATCTCTCTTTTGTATTCCAATTTTCTTG (SEQ ID NO: 969)
[0388] Figure 17 shows the complementarity between the guide strand and target mRNA, and the stem loop structure of a-miR2_3.
[0389] SEQ ID NO: 970 is a sequence of a-miR4 (5' to 3'):
[0390] GCCGAUUCGAUUGCCGACUUCACAGGUCGUGAUAUGAUUCAAUUAGCUUCCG ACUCAUUCAUCCAAAUACCGAGUCGCCAAAAUUCAAACUAGACUCGUUAAAUGAAU GAAUGAUGCGGUAGACAAAUUGGAUCAUUGAUUCUCUUUGAUGUCGGCAAUCGAAU CGCCGA (SEQ ID NO: 970)
[0391] SEQ ID NO: 971 is a DNA sequence encoding a primary transcript of a-miR4, including the flanking regions encoding the lower stem of Ath-miR319a (5' to 3'):
[0392] GATGTTTTAGGAATATATATGTAGAGGCCGATTCGATTGCCGACTTCACAGGTC GTGATATGATTCAATTAGCTTCCGACTCATTCATCCAAATACCGAGTCGCCAAAATTCA AACTAGACTCGTTAAATGAATGAATGATGCGGTAGACAAATTGGATCATTGATTCTCT TTGATGTCGGCAATCGAATCGCCGACTCTCTTTTGTATTCCAATTTTCTTG (SEQ ID NO: 971)
[0393] Figure 18 shows the complementarity between the guide strand and target mRNA, and the stem loop structure of a-miR4.
[0394] SEQ ID NO: 972 is a sequence of a-miR6 (5' to 3'):
[0395] UUCUACUCCGACACUGGCUUCACAGGUCGUGAUAUGAUUCAAUUAGCUUCCG ACUCAUUCAUCCAAAUACCGAGUCGCCAAAAUUCAAACUAGACUCGUUAAAUGAAU GAAUGAUGCGGUAGACAAAUUGGAUCAUUGAUUCUCUUUGAUGCCAGUGUCGGAGU AGGAAU (SEQ ID NO: 972)
[0396] SEQ ID NO: 973 is a DNA sequence encoding a primary transcript of a-miR6, including the flanking regions encoding the lower stem of Ath-miR319a (5' to 3'):
[0397] GATGTTTTAGGAATATATATGTAGAGTTCTACTCCGACACTGGCTTCACAGGTC GTGATATGATTCAATTAGCTTCCGACTCATTCATCCAAATACCGAGTCGCCAAAATTCA AACTAGACTCGTTAAATGAATGAATGATGCGGTAGACAAATTGGATCATTGATTCTCT TTGATGCCAGTGTCGGAGTAGGAATCTCTCTTTTGTATTCCAATTTTCTTG (SEQ ID NO: 973)
[0398] Figure 19 shows the complementarity between the guide strand and target mRNA, and the stem loop structure of a-miR6.
[0399] EXAMPLE 7 Reducing GDSL lipase expression / activity in Glycine max
[0400] Expression and / or activity of one or more GDSL lipases can be reduced or eliminated in Glycine max (soybean) by knocking down or knocking out one or more GDSL lipase genes using microRNA (miRNA) and / or CRISPR / Cas technologies. The reduction of GDSL lipase expression / activity is expected to increase root biomass, shoot biomass, and / or suberized region in soybean.
[0401] Table 3 provides the guide sequences for targeting six different GDSL lipase genes in soybean. The 3' end of these sequences can he fused to a common scaffold sequence that serves to bind Cas9 or other nucleases. Figure 22 shows a vector for expressing a Cas protein and two gRNAs simultaneously targeting two regions of the same or different GDSL lipase genes with a Ruby screening marker. Figure 23 shows a vector for expressing a Cas protein and thirty-two gRNAs simultaneously targeting thirty-two regions of multiple different GDSL lipase genes with a dsRed screening marker. Table 4 Edited or transgenic soybean plants are grown under controlled conditions, and phenotypic assessments for root biomass, shoot biomass, suberin production, etc. will be conducted. It is expected that soybean plants with loss-of-function mutations in one or more GDSL lipase genes will display increased root biomass, shoot biomass, and / or suberized region or suberin production compared to a wildtype plant. miRNAs are designed to target one or more GDSL lipase mRNAs in soybean. miRNAs or vectors encoding miRNAs are introduced into soybean plants. Treated or transgenic soybean plants are grown under controlled conditions, and phenotypic assessments for root biomass, shoot biomass, suberin production, etc. will be conducted. It is expected that soybean plants treated with or expressing such miRNAs will display increased root biomass, shoot biomass, and / or suberized region or suberin production compared to a wildtype plant.
[0402] Table 5 provides a sequence of an exemplary target mRNA region and the corresponding miRNA guide strand sequence.
[0403] Table 5
[0404] SEQ ID NO: 976 is a sequence of a-miR-Gm (5' to 3’):
[0405] ACAUUUAUGCUGAUUAUAUCACAGGUCGUGAUAUGAUUCAAUUAGCUUCCG ACUCAUUCAUCCAAAUACCGAGUCGCCAAAAUUCAAACUAGACUCGUUAAAUGAAU GAAUGAUGCGGUAGACAAAUUGGAUCAUUGAUUCUCUUUGAAAUAAUCAGCAUAA AUGAUAU (SEQ ID NO: 976)
[0406] SEQ ID NO: 977 is a DNA sequence encoding a primary transcript of a-miR-Gm, including the flanking regions encoding the lower stem of Ath-miR319a (5' to 3’):
[0407] GATGTTTTAGGAATATATATGTAGAGACATTTATGCTGATTATATCACAGGTCG TGATATGATTCAATTAGCTTCCGACTCATTCATCCAAATACCGAGTCGCCAAAATTCAA ACTAGACTCGTTAAATGAATGAATGATGCGGTAGACAAATTGGATCATTGATTCTCTTT GAAATAATCAGCATAAATGATATCTCTCTTTTGTATTCCAATTTTCTTG (SEQ ID NO: 977)
[0408] Figure 20 shows the complementarity between the guide strand and target mRNA, and the stem loop structure of a-miR-Gm. Figure 21 provides an exemplary design of transgene cassette for expressing the miRNA. EXAMPLE 8 Reducing GDSL lipase expression / activity in Oryza sativa
[0409] The expression and / or activity of one or more GDSL lipases in Oryza sativa (rice) can be reduced or eliminated by knocking down or knocking out these lipases using the fast-neutron (FN) irradiation process. Reducing the expression or activity of GDSL lipases is expected to enhance the root system architecture, root biomass, shoot biomass, and / or suberized regions in rice.
[0410] Loss-of-function GDSL lipase mutant lines were generated and sequenced from a FN- induced mutant population of the model rice cultivar Kitaake (Oryza sativa L. ssp. Japonica) (Li et al., “Genome-wide sequencing of 41 rice (Oryza sativa L.) mutated lines reveals diverse mutations induced by fast-neutron irradiation”; Molecular plant 9.7 (2016): 1078-1081). Fast-neutron- induced (FN) mutant lines provided by P. Ronald at the University of California, Davis (https: / / www.cell.eom / molecular-plant / fulltext / S 1674-2052(16)30004-1) were utilized. These mutant lines were cultivated in gel cylinders and pots fdled with Turface under controlled greenhouse conditions. Figure 24 shows rice plants grown in gel cylinder and Turf ace -filled pot system.
[0411] Phenotypic assessments to evaluate root architectural traits, root biomass, shoot biomass, suberin production, and other traits will be conducted. It is expected that the FN mutant lines will exhibit increased root biomass and shoot biomass and / or enhanced suberized regions or suberin production compared to wild-type plants.
[0412] In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are only examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.
Claims
We claim:
1. A method for increasing root and / or shoot biomass in a plant, comprising: reducing expression and / or activity of one or more Gly-Asp-Ser-Leu (GDSL)-lipases in the plant, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 different GDSL lipases, thereby increasing root and / or shoot biomass of the plant.
2. The method of claim 1 , wherein reducing expression and / or activity of one or more GDSL- lipases comprises introducing one or more exogenous nucleic acid molecules into the plant, thereby generating a transformed plant, wherein the one or more exogenous nucleic acid molecules reduce expression of one or more GDSL-lipase genes and / or reduce activity of one or more proteins encoded by the one or more GDSL-lipase genes.
3. The method of claim 1, wherein reducing expression and / or activity of one or more GDSL- lipases comprises: introducing one or more exogenous nucleic acid molecules into a plant cell or plant part, thereby generating a gene-edited or transgenic plant cell or plant part; and growing the gene-edited or transgenic plant cell or plant part into a transformed plant, thereby generating a plant with increased root and / or shoot biomass, wherein the one or more exogenous nucleic acid molecules reduce expression of one or more GDSL-lipase genes and / or reduce activity of one or more proteins encoded by the one or more GDSL-lipase genes.
4. The method of claim 2 or 3, wherein introducing the one or more exogenous nucleic acid molecules generates one or more deletions of, or one or more loss-of-function mutations in the one or more GDSL-lipase genes.
5. The method of any one of claims 2-4, wherein the one or more exogenous nucleic acid molecules comprise one or more guide nucleic acid molecules that can delete or mutate the one or more GDSL-lipase genes.
6. The method of any one of claims 2-5, wherein the method further comprises introducing one or more Cas proteins or one or more nucleic acid molecules encoding a Cas protein into the plant or plant cell.
7. The method of any one of claims 2-6, wherein the transformed plant, or gene-edited or transgenic plant cell or plant part comprises one or more deletions of, or one or more loss-of- function mutations, in the one or more GDSL-lipase genes.
8. The method of claim 7, wherein the transformed plant, or gene-edited or transgenic plant cell or plant part comprises one or more loss-of-function GDSL-lipase genes, which comprise at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 335, 336, and 1002-1013 and retain the mutation(s) therein.
9. The method of any one of claims 2-8, wherein the one or more exogenous nucleic acid molecules are one or more RNAi molecules or one or more exogenous nucleic acid molecules that generate one or more RNAi molecules, wherein the one or more RNAi molecules target the mRNAs transcribed from the one or more GDSL-lipase genes.
10. The method of any one of claims 2-9, wherein the one or more GDSL-lipase genes comprise at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-167 and SEQ ID NOs: 340- 633; and / or the one or more GDSL-lipase genes encode a GDSL-lipase protein that comprises at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 168-334 and 634-921.
11. The method of any one of the prior claims, wherein the expression and / or activity of the one or more GDSL-lipases is reduced as compared to a control plant or plant cell.
12. The method of any one of the prior claims, wherein the expression and / or activity of the one or more GDSL-lipases is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% as compared to a control plant or plant cell.
13. The method of any one of the prior claims, wherein the one or more exogenous nucleic acid molecules are operably linked to a heterologous promoter.
14. The method of claim 13, wherein the heterologous promoter drives expression of the one or more exogenous nucleic acid molecules in a root tissue.
15. The method of claim 14, wherein the root tissue is exodermis, peridermis, phellogen, pericycle, or procambium.
16. The method of any of the prior claims, wherein the plant is a pennycress, soybean, canola, rice, wheat, corn, or sorghum plant; and / or the plant cell or plant part is from a pennycress, soybean, canola, rice, wheat, com, or sorghum plant.
17. The method of any of the prior claims, wherein root and / or shoot biomass is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 90%, at least 100%, at least 200%, or at least 400% as compared to a control plant.
18. The method of any one of the prior claims, further comprising measuring mean root and / or shoot biomass in the plant, as compared to a control plant.
19. The method of any one of claims 3-18, further comprising producing a transformed plant tissue from the gene-edited or transgenic plant cell or plant part.
20. The method of claim 19, further comprising producing a transformed plantlet from the transformed plant tissue, wherein the transformed plantlet produces increased root and / or shoot biomass when compared to an untransformed plantlet control.
21. The method of claim 20, further comprising producing a transformed progeny from the transformed plantlet, wherein the transformed progeny produces increased root and / or shoot biomass when compared to an untransformed plantlet control.
22. The method of claim 20 or 21 , further comprising growing the transformed plantlet or the transformed progeny into the transformed plant, wherein the transformed plant produces increased root and / or shoot biomass when compared to an untransformed plant control.
23. The method of any of claims 2-22, further comprising using the transformed plant or a clone of the transformed plant in a breeding method.
24. The method of claim 23, wherein the breeding method comprises selfing or crossing the transformed plant or clone of the transformed plant.
25. A transformed plant, or gene-edited or transgenic plant cell or plant part made by the method of any one of claims 1-18, or a transformed plant tissue made by the method of claim 19, or a transformed plantlet made by the method of claim 20, or a transformed progeny of a transformed plantlet made by the method of claim 21 .
26. The method of any one of claims 1 -24, or the transformed plant, , gene-edited or transgenic plant cell or plant part, transformed plant tissue, transformed plantlet, or transformed progeny of claim 25, wherein the transformed plant, gene-edited or transgenic plant cell or plant part, transformed plant tissue, transformed plantlet, or transformed progeny further comprises one or more additional exogenous nucleic acid(s) encoding a protein(s) that confers upon the transformed plant, gene-edited or transgenic plant cell or plant part, transformed plant tissue, transformed plantlet, or transformed progeny a desired trait, wherein the desired trait is one or more of herbicide tolerance, drought tolerance, heat tolerance, low or high soil pH level tolerance, salt tolerance, resistance to an insect, resistance to a bacterial disease, resistance to a viral disease, resistance to a fungal disease, resistance to a nematode, resistance to a pest, male sterility, sitespecific recombination; abiotic stress tolerance, modified phosphorus characteristics, modified antioxidant characteristics; modified essential seed amino acid characteristics, decreased phytate, modified fatty acid metabolism, and modified carbohydrate metabolism.
27. A method of producing a commodity plant product, comprising collecting or producing the commodity plant product from the transformed plant, gene-edited or transgenic plant cell or plant part, transformed plant tissue, transformed plantlet, or transformed progeny of any one of the prior claims; optionally, wherein the commodity plant product comprises a non-native nucleic acid molecule or protein from the transformed plant, gene-edited or transgenic plant cell or plant part, transformed plant tissue, transformed plantlet, or transformed progeny; and optionally, wherein the commodity product comprises a protein concentrate, protein isolate, leaves, extract, oil, bean, and / or seed.
28. A method of producing plant seed, comprising crossing the transformed plant, gene- edited or transgenic plant cell or plant part, transformed plant tissue, transformed plantlet, or transformed progeny of any one of the prior claims with itself or a second plant.
29. The method or the gene-edited or transgenic plant part of any of claims 3-28, wherein the plant part is a protoplast, leaf, stem, root, root tips, anther, pistil, stamen, seed, embryo, pollen, ovule, microspore, sporophyte, gametophyte, cotyledon, hypocotyl, flower, shoot, tissue, petiole, or meristematic cell.
30. A method for breeding a plant with increased root and / or shoot biomass, comprising crossing the transformed plant of any one of the prior claims with a second plant; obtaining seed from the crossing; planting the seeds and growing the seeds to progeny plants; and selecting from the progeny plants those with increased root and / or shoot biomass when compared to a control plant.
31. The method of claim 30, further comprising producing clones of the progeny plants, wherein the clones are selected based on increased root and / or shoot biomass when compared to a control plant.
32. A seed that produces or is produced by the transformed plant of any one of claims 2- 30, wherein said seed comprises the one or more deletions of, or one or more loss-of-function mutations in the one or more GDSL-lipase genes.
33. A gene-edited plant, plant part, or plant cell, comprising one or more deletions of, or one or more loss-of-function mutations in the one or more GDSL-lipase genes.
34. The gene-edited plant, plant part, or plant cell of claim 33, which does not comprise a trans gene used to generate the one or more deletions or loss-of-function mutations.
35. The gene-edited plant, plant part, or plant cell of claim 33 or 34, which is transgene- free.
36. The gene-edited plant, plant part, or plant cell of claim 33, which comprises one or more transgenes.
37. The gene-edited plant, plant part, or plant cell of claim 36, wherein the one or more transgenes comprise an exogenous vector, an inhibitory RNA molecule, a guide nucleic acid, a Cas protein, or combinations thereof.
38. The gene-edited plant, plant part, or plant cell of any one of claims 33-37, wherein the one or more GDSL-lipase genes comprise at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-167 and SEQ ID NOs: 340- 633, for example prior to the one or more deletions or one or more loss-of-function mutations; and / or the one or more GDSL-lipase genes encode a GDSL-lipase protein that comprises at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 168-334 and 634-921, for example prior to the one or more deletions or one or more loss-of- function mutations.
39. The gene-edited plant, plant part, or plant cell of any one of claims 33-38, wherein the plant is a pennycress, soybean, canola, rice, wheat, corn, or sorghum plant; and / or the plant cell or plant part is from a pennycress, soybean, canola, rice, wheat, corn, or sorghum plant.
40. The gene-edited plant, plant part, or plant cell of any one of claims 33-39, wherein root and / or shoot biomass is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 90%, at least 100%, at least 200%, or at least 400% as compared to a control plant.
41. The gene-edited plant, plant part, or plant cell of any one of claims 33-40, wherein the one or more loss-of-function mutations in the one or more GDSL-lipase genes comprise an insertion of at least one nucleotide, a deletion of 5-40 nucleotides, or a combination thereof.
42. A gene-edited plant, plant part, or plant cell, comprising a GDSL-lipase gene, which comprises at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any of SEQ ID NOs: 335, 336, and 1002-1013 and retains the mutation(s) therein.
43. A recombinant nucleic acid molecule, comprising at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 922-1001.
44. The method any of claims 9-31, wherein the one or more RNAi molecules or nucleic acid molecules that generate one or more RNAi molecules comprises at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 959, 961, 963, and 965-973, and wherein the plant is pennycress.
45. The method any of claims 9-31, wherein the one or more RNAi molecules or nucleic acid molecules that generate one or more RNAi molecules comprises at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 975-977, and wherein the plant is soybean.
46. The method any of claims 5-31, wherein the one or more guide nucleic acid molecules comprises at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 922-957, and the plant is pennycress.
47. The method of method any of claims 5-31, wherein the one or more guide nucleic acid molecules comprises at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 978-1001, and the plant is soybean.
48. The method of claim 46, wherein the one or more GDSL-lipase genes comprise at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 601-609.
49. The method of claim 47, wherein the one or more GDSL-lipase genes comprise at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 27-32.
Citation Information
Patent Citations
Chimonanthus praecox GDSL lipase gene CpGLIP1 and application thereof
CN112941050A