Spla2δ gene for inducing haploid plants and use thereof

Abstract

The present invention relates to an sPLA2δ gene for inducing haploid plants and use thereof. The present invention demonstrates that haploid plants can be induced by inhibiting the expression of the sPLA2δ gene, and therefore, the gene of the present invention can be effectively used as a strategy for rapidly constructing breeding materials of a pure line with fixed traits.

Description

sPLA2δ gene for inducing haploid plants and its use

[0001] The present invention relates to an sPLA2δ gene for inducing haploid plants and its use.

[0002] A haploid is an organism that has half the number of chromosomes (2n) of a normal organism, that is, the karyotype (n) of the gamete. Haploids are produced through meiosis based on gametes with half the number of chromosomes, and are classified as originating from the paternal male nucleus or originating from the maternal egg cell. Depending on the method of producing haploids, they are divided into natural generation and artificial induction, and artificial induction is further divided into in vivo induction through mating and in vitro induction through tissue culture. Haploid plants are smaller than their parent plants, have lower vitality, and are unable to undergo normal meiosis, making generation progression impossible. On the other hand, when a haploid naturally or artificially forms a doubled haploid (DH), the homologous chromosomes are homozygous and develop stably and generation progression occur. This haploid breeding has the advantage of shortening the breeding time by enabling pure breeding in a short period of time rather than performing 5 to 7 rounds of repeated self-pollination, and also allowing immediate confirmation of the phenotype of the recessive trait.

[0003] The plant phospholipase A (PLA) family is a major lipid acyl hydrolase. A total of 31 PLAs have been identified in the rice genome, and they have been classified into phospholipase A1 (PLA1), patatin-like phospholipases (pPLA), and low-molecular-weight secretory phospholipase A2 (sPLA2) based on domain structure, conserved motifs, and phylogeny (Singh A. et al., PLoS One, 2012, 7(2):e30947).

[0004] In the present invention, it was confirmed that haploids were induced in vivo (in planta) as a result of inhibiting the expression of Arabidopsis sPLA2δ (At4g29470), thereby proving that the Arabidopsis sPLA2δ gene can be used as a haploid inducer.

[0005] Meanwhile, Korean Patent Registration No. 2516522 discloses 'pPLAⅡη gene for inducing haploid plants and its use', and Korean Publication Patent No. 2023-0139656 discloses 'pPLAⅡγ gene for inducing haploid plants and its use', but 'sPLA2δ gene for inducing haploid plants and its use' of the present invention are not described.

[0006] The present invention was derived from the above-mentioned needs, and the inventors of the present invention completed the present invention by confirming that a haploid plant was induced as a result of causing a loss of function of the sPLA2δ protein coding gene derived from Arabidopsis thaliana using the CRISPR / Cas9 system.

[0007] To solve the above problem, the present invention provides a composition for inducing haploid plants, which comprises an Arabidopsis thaliana-derived sPLA2δ protein coding gene as an active ingredient.

[0008] In addition, the present invention provides a method for producing a haploid plant, comprising: a step of inhibiting the expression of the sPLA2δ gene by transforming a plant cell with a recombinant vector containing an Arabidopsis thaliana-derived sPLA2δ protein coding gene; and a step of redifferentiating a transformed plant from the transformed plant cell.

[0009] In addition, the present invention provides a haploid plant and seeds thereof produced by the above method.

[0010] In addition, the present invention provides a method for producing a genome-edited plant derived from a haploid, comprising: (a) a step of editing a genome by introducing a guide RNA and an endonuclease protein specific for a target base sequence of an Arabidopsis-derived sPLA2δ protein coding gene into a plant cell; and (b) a step of redifferentiating a plant from the genome-edited plant cell.

[0011] In addition, the present invention provides a method for controlling the number of chromosomes in a plant, comprising a step of controlling the expression of an Arabidopsis thaliana-derived sPLA2δ protein coding gene in the plant.

[0012] The present invention demonstrates that haploid plants can be induced by inhibiting the expression of the sPLA2δ gene. Since plant genetic research and breeding programs aim to rapidly and accurately introduce useful traits from genetic resources into elite varieties, the method of the present invention can be effectively utilized as a strategy for rapidly establishing breeding stocks of pure lines with fixed traits.

[0013] Figure 1 is a schematic diagram of a vector construct for editing the Arabidopsis sPLA2δ gene.

[0014] Figure 2 shows the genomic DNA sequence information of the Arabidopsis sPLA2δ gene, showing the target site (indicated by a dotted box) of a single guide RNA for gene editing.

[0015] Figure 3 shows the genomic DNA structure of the Arabidopsis sPLA2δ gene, the target location of a single guide RNA, and the sequence analysis results of the target site of the gene editing entity.

[0016] Figure 4 shows changes in protein translation according to the editing type of the Arabidopsis sPLA2δ gene.

[0017] Figure 5 shows representative phenotypes and ploidy analysis results of diploid and haploid F1 plants obtained through crosses between male-sterile mutants (ms1-1) and sPLA2δ gene-edited plants. Scale bar = 1 cm.

[0018] Figure 6 shows the results of karyotype analysis using DAPI (4',6-diamidino-2-phenylindole) staining of diploid and haploid F1 plants obtained through crosses between male-sterile mutants and sPLA2δ gene-edited individuals. Scale bar = 10 ㎛.

[0019] Figure 7 shows the results of PCR using the UPSC (Umea Plant Science Centre) InDel marker to analyze the genomic origin of haploid F1 plant lines obtained through crossing a male sterile mutant and an sPLA2δ gene-edited individual.

[0020] In order to achieve the object of the present invention, the present invention provides a composition for inducing haploid plants, which comprises an Arabidopsis thaliana-derived sPLA2δ protein coding gene as an active ingredient. The composition of the present invention comprises an Arabidopsis thaliana-derived sPLA2δ protein coding gene as an active ingredient, and when the expression of the gene is inhibited, haploids can be induced in plants.

[0021] In a composition according to one embodiment of the present invention, the Arabidopsis-derived sPLA2δ protein may preferably be composed of an amino acid sequence of SEQ ID NO: 3, but is not limited thereto.

[0022] The scope of the Arabidopsis thaliana-derived sPLA2δ protein according to the present invention includes a protein having an amino acid sequence represented by SEQ ID NO: 3 and a functional equivalent of the protein. In the present invention, the term "functional equivalent" refers to a protein that has at least 70%, preferably 80%, more preferably 90%, and even more preferably 95% sequence homology with the amino acid sequence represented by SEQ ID NO: 3 as a result of addition, substitution, or deletion of amino acids, and exhibits substantially the same physiological activity as the protein represented by SEQ ID NO: 3. "Substantially the same physiological activity" refers to an inducing activity of a haploid plant.

[0023] In addition, the present invention provides a gene encoding the sPLA2δ protein derived from Arabidopsis thaliana. The gene of the present invention includes both genomic DNA (SEQ ID NO: 1) and cDNA (SEQ ID NO: 2) encoding the sPLA2δ protein derived from Arabidopsis thaliana. Preferably, the gene of the present invention may include a base sequence represented by SEQ ID NO: 2. In addition, a homolog of the base sequence is included within the scope of the present invention. Specifically, the gene may include a base sequence having a sequence identity of at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% with the base sequence of SEQ ID NO: 2. The "% of sequence homology" for a polynucleotide is determined by comparing a comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region may include additions or deletions (i.e., gaps) compared to a reference sequence for the optimal alignment of the two sequences (which does not include additions or deletions).

[0024] The present invention also provides a method for producing a haploid plant, comprising the steps of transforming a plant cell with a recombinant vector containing an Arabidopsis thaliana-derived sPLA2δ protein coding gene to inhibit the expression of the sPLA2δ gene; and redifferentiating a transformed plant from the transformed plant cell; a haploid plant produced by the method, and seeds thereof.

[0025] In the method for producing a haploid plant according to the present invention, the Arabidopsis-derived sPLA2δ protein and its coding gene are as described above.

[0026] As used herein, the term "recombinant" refers to a cell that replicates a heterologous nucleic acid, expresses said nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. A recombinant cell may express a gene or gene fragment not found in the cell's native form, either in sense or antisense form. A recombinant cell may also express a gene found in the cell's native form, but in a modified form that has been reintroduced into the cell by artificial means.

[0027] Additionally, the term "vector" is used to refer to a DNA fragment(s) or nucleic acid molecule that is delivered into a cell. A vector replicates DNA and can reproduce independently in a host cell. The term "transport vehicle" is often used interchangeably with "vector." The term "expression vector" refers to a recombinant DNA molecule containing a desired coding sequence and the appropriate nucleic acid sequences necessary for operably linking the coding sequence to express it in a particular host organism.

[0028] The vector of the present invention can typically be constructed as a vector for cloning or expression. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the vector of the present invention is an expression vector and uses a prokaryotic cell as a host, it generally includes a strong promoter capable of promoting transcription (e.g., pLλ promoter, Trp promoter, Lac promoter, T7 promoter, Tac promoter, etc.), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. When Escherichia coli is used as a host cell, the promoter and operator region of the E. coli tryptophan biosynthetic pathway, and the left-hand promoter of phage λ (pLλ promoter) can be used as regulatory regions.

[0029] In the recombinant vector of the present invention, the promoter is a promoter suitable for transformation, and may preferably be a Cauliflower mosaic virus (CaMV) 35S promoter, an actin promoter, a ubiquitin promoter, a pEMU promoter, a MAS promoter, or a histone promoter, and may preferably be a CaMV 35S promoter, but is not limited thereto.

[0030] In the present invention, the term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions, developmental states, or cell differentiation. A constitutive promoter may be preferred in the present invention because transformant selection can be performed in various tissues at various stages. Therefore, a constitutive promoter does not limit the possibilities of selection.

[0031] The recombinant vector may preferably include one or more selectable markers. These markers are typically nucleic acid sequences with properties that can be selected chemically. These markers include any gene that can distinguish transformed cells from non-transformed cells. These marker genes may include, but are not limited to, a dominant drug resistance gene.

[0032] The recombinant vector of the present invention can be constructed using methods well known to those skilled in the art. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombination techniques. The DNA sequence can be effectively linked to an appropriate promoter within an expression vector to drive mRNA synthesis. The vector may also include a ribosome binding site as a translation initiation site and a transcription terminator.

[0033] A preferred example of a plant expression vector is the Ti-plasmid vector, which, when present in a suitable host such as Agrobacterium tumefaciens, is capable of transferring part of itself, the so-called T-region, into plant cells. Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences into plant cells or protoplasts from which new plants can be produced, wherein the hybrid DNA is suitably integrated into the plant genome. A particularly preferred form of Ti-plasmid vector is the so-called binary vector, as claimed in EP 0 120 516 B1 and U.S. Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the present invention into a plant host include viral vectors, such as those derived from double-stranded plant viruses (e.g., CaMV) and single-stranded viruses, geminiviruses, etc., and non-complete plant viral vectors. The use of such vectors can be particularly advantageous when it is difficult to properly transform the plant host.

[0034] Preferred examples of the recombinant vector of the present invention are VIGS (Virus-induced gene silencing) vectors or RNAi (RNA interference) vectors. VIGS refers to a phenomenon in which, when a plant gene is introduced into a viral vector and then infected with a plant, the endogenous gene expression of the introduced gene is suppressed. This is a type of PTGS (post-transcriptional gene silencing) and has the characteristics of post-transcriptional, RNA turnover, and nucleotide sequence-specific. The VIGS vector can be used as a transient expression vector that can temporarily express a foreign gene in a plant into which a foreign gene has been introduced, and as a plant expression vector that can permanently express a foreign gene in a plant into which a foreign gene has been introduced.

[0035] Any host cell known in the art, including microalgae and microorganisms, can be used as the host cell for stably and continuously cloning and expressing the vector of the present invention, and examples thereof include Bacillus strains such as E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, Bacillus subtilis, Bacillus thuringiensis, and enteric bacteria and strains such as Salmonella typhimurium, Serratia marcescens, and various Pseudomonas species.

[0036] In addition, when transforming the vector of the present invention into a eukaryotic cell, yeast (e.g., Saccharomyces cerevisiae), insect cells, human cells (e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN, and MDCK cell lines), and plant cells can be used as host cells, and plant cells are preferred.

[0037] Plant transformation refers to any method for transferring DNA into plants. Such transformation methods do not necessarily require regeneration and / or tissue culture. Transformation of plant species is now commonplace, encompassing both dicotyledonous and monocotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA of the present invention into a suitable progenitor cell. Methods include calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., 1987, Plant Mol. Biol. 8, 363-373), electroporation of protoplasts (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microinjection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185), particle bombardment of various plant elements (DNA or RNA-coated) (Klein TM et al., 1987, Nature 327, 70), Agrobacterium tumefaciens-mediated gene transfer by infiltration of plants or transformation of mature pollen or microspores. (Incomplete) virus infection (EP 0 301 316), etc. A preferred method according to the present invention comprises Agrobacterium-mediated DNA transfer.

[0038] Additionally, in the manufacturing method of the present invention, any method known in the art can be used to regenerate transformed plants from the transformed plant cells. The transformed plant cells must be regenerated into whole plants. Techniques for regenerating mature plants from callus or protoplast cultures are well known in the art for numerous different species.

[0039] The "plant cell" used in plant transformation may be any plant cell. Plant cells include cultured cells, cultured tissues, cultured organs, and whole plants. "Plant tissue" includes differentiated or undifferentiated plant tissues, such as, but not limited to, roots, stems, leaves, pollen, seeds, and cancer tissues, and various types of cells used in culture, such as single cells, protoplasts, shoots, and callus tissues. Plant tissues may be in planta, organ culture, tissue culture, or cell culture.

[0040] In a method for producing a haploid plant according to one embodiment of the present invention, the transformed plant cell is characterized in that the expression of an Arabidopsis-derived sPLA2δ protein coding gene is inhibited.

[0041] The inhibition of expression of the sPLA2δ protein coding gene derived from Arabidopsis thaliana may be achieved by transforming plant cells with a recombinant vector containing sense or antisense DNA or microRNA for the Arabidopsis thaliana sPLA2δ gene, thereby inhibiting expression of the sPLA2δ protein coding gene, but is not limited thereto, and a gene expression inhibition technique known in the art may be used.

[0042] Haploid plants with half the number of chromosomes can be expected to have the following utility: i) Pure lines can be obtained in a short period of time by doubling the chromosomes of haploid plants. ii) Pure lines have strong vitality because lethal genes are selected. iii) In haploid plants, there is no interaction between alleles, so recessive traits are also expressed, making it easy to estimate genes. iv) They can be used in various chromosome engineering. v) Alloploid haploids can be utilized in cytogenetic experiments.

[0043] The present invention also provides a method for producing a haploid-induced genome-edited plant, comprising the steps of (a) introducing a guide RNA and an endonuclease protein specific for a target base sequence of an Arabidopsis-derived sPLA2δ protein-coding gene into a plant cell to edit the genome; and (b) re-differentiating a plant from the genome-edited plant cell. The present invention also provides a haploid-induced genome-edited plant produced by the method.

[0044] The term "genome / gene editing" as used herein refers to a technology capable of introducing targeted mutations into the genome sequence of plant and animal cells, including human cells, by knocking out or knocking in a specific gene through deletion, insertion, or substitution of one or more nucleic acid molecules by DNA cleavage, or by introducing mutations into non-coding DNA sequences that do not produce proteins. For the purposes of the present invention, the genome editing may be, in particular, introducing mutations into plants using an endonuclease, such as Cas9 (CRISPR associated protein 9) protein and a guide RNA. In addition, "gene editing" may be used interchangeably with "gene correction."

[0045] Additionally, the term "target gene" refers to a portion of DNA within the genome of a plant to be edited using the present invention. The type of gene is not limited, and may include both coding and non-coding regions. Those skilled in the art can select the target gene based on the desired mutation for the genome-edited plant to be produced, depending on the purpose.

[0046] In addition, the term "guide RNA" refers to a short single-stranded RNA, which is specific to a target DNA among the base sequences encoding a target gene, and refers to a ribonucleic acid that complementarily binds to all or part of the target DNA base sequence and guides an endonuclease protein to the target DNA base sequence. The guide RNA is a dual RNA comprising two RNAs, namely crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; Or, it refers to a single-stranded guide RNA (sgRNA) form that includes a first portion that includes a sequence that is completely or partially complementary to a base sequence in a target gene and a second portion that includes a sequence that interacts with an endonuclease (particularly, an RNA-guided nuclease). However, if the endonuclease is in a form that can be active in the target base sequence, it can be included in the scope of the present invention without limitation, and can be manufactured and used according to a technique known in the art, taking into account the type of endonuclease used together or the microorganism from which the endonuclease is derived.

[0047] Additionally, the guide RNA may be, but is not limited to, a guide RNA transcribed from a plasmid template, transcribed in vitro (e.g., an oligonucleotide double strand), or synthesized.

[0048] In the method for producing a genome-edited plant derived from a haploid according to the present invention, the endonuclease protein may be at least one selected from the group consisting of Cas9, Cpf1 (also known as Cas12a), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) or a functional analog thereof, preferably Cas9 or Cpf1, which is an RNA-guided nuclease, and more preferably Cas9 protein, but is not limited thereto.

[0049] In addition, the Cas9 protein may be at least one selected from the group consisting of a Cas9 protein derived from Streptococcus pyogenes, a Cas9 protein derived from Campylobacter jejuni, a Cas9 protein derived from S. thermophilus or S. aureus, a Cas9 protein derived from Neisseria meningitidis, a Cas9 protein derived from Pasteurella multocida, a Cas9 protein derived from Francisella novicida, and the like, but is not limited thereto. The Cas9 protein or its genetic information can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI). The above Cas9 gene information may use a known sequence as is, or may use a sequence optimized for the codon of the target (organism) to be transduced, but is not limited thereto.

[0050] The Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double-stranded DNA breaks. For the Cas9 protein to precisely bind to its target sequence and cleave the DNA strand, a short three-base sequence known as a Protospacer Adjacent Motif (PAM) must be present next to the target sequence. The Cas9 protein cleaves between the third and fourth base pairs from the PAM sequence (NGG).

[0051] In the method for producing a genome-edited plant derived from a haploid according to the present invention, the CRISPR / Cas9 system used is a gene editing method using a non-homologous end joining (NHEJ) mechanism that introduces a double-strand break at a specific position of a specific gene to be edited and induces an insertion-deletion (InDel) mutation due to incomplete repair induced during the DNA repair process.

[0052] In the method for producing a genome-edited plant derived from a haploid according to the present invention, the introduction of the guide RNA and the endonuclease protein of step (a) into the plant cell may be performed using, but is not limited to, a recombinant vector comprising a DNA encoding a guide RNA specific to the target base sequence of an Arabidopsis-derived sPLA2δ protein-coding gene and a nucleic acid sequence encoding an endonuclease protein; or a complex (ribonucleoprotein) of a guide RNA specific to the target base sequence of an Arabidopsis-derived sPLA2δ protein-coding gene and an endonuclease protein.

[0053] In one embodiment of the present invention, the target base sequence of the sPLA2δ protein coding gene derived from Arabidopsis thaliana may be composed of the base sequence of SEQ ID NO: 4, but is not limited thereto.

[0054] In the method for producing a genome-edited plant derived from a haploid according to the present invention, introducing a recombinant vector comprising a DNA encoding a guide RNA specific for the target base sequence and a nucleic acid sequence encoding an endonuclease protein into a plant cell refers to a transformation method. Transformation of plant species is now commonplace, including both dicotyledonous and monocotyledonous plants. In principle, any transformation method can be used to introduce the recombinant vector according to the present invention into a suitable progenitor cell. The method for transforming plant species is as described above.

[0055] The present invention also provides a method for controlling the number of chromosomes in a plant, comprising a step of controlling the expression of an Arabidopsis thaliana-derived sPLA2δ protein coding gene in the plant.

[0056] In a method for controlling the number of chromosomes in a plant according to one embodiment of the present invention, the regulation of expression of the sPLA2δ protein coding gene derived from Arabidopsis thaliana may be characterized by reducing the number of chromosomes in the plant by inhibiting the expression of the sPLA2δ protein coding gene derived from Arabidopsis thaliana, but is not limited thereto.

[0057] In one embodiment of the present invention, the inhibition of expression of the gene encoding the sPLA2δ protein derived from Arabidopsis may be accomplished by using a VIGS system, RNAi or antisense RNA, T-DNA insertion, endogenous transposon, mutagenesis through X-ray or γ-ray irradiation, or a CRISPR / Cas9 gene editing system to inhibit (suppress) the expression of the sPLA2δ protein encoding gene derived from Arabidopsis, but is not limited thereto, and any conventional method in the art for inhibiting the expression of a gene may be used.

[0058]

[0059] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0060]

[0061] Materials and Methods

[0062] 1. Arabidopsis thaliana growth conditions

[0063] In the present invention, the Columbia-0 ecotype Arabidopsis wild type (Col-0) was used to produce sPLA2δ gene-edited plants. Arabidopsis seeds were sown on 1 / 2 MS medium (1% sucrose, 0.5 g / L 2-[N-morpholino] ethanesulfonic acid (MES), 0.8% phytoagar, pH 5.7), and after vernalization at 4°C in the dark for 2 days, they were grown under long-day conditions (16 h light / 8 h dark) at 23°C. Arabidopsis seedlings grown on the medium for 10 days were transferred to sterilized soil containing a mixture of topsoil, vermiculite, and perlite in a ratio of 3:2:1 and grown.

[0064]

[0065] 2. Production of recombinant DNA constructs for gene editing

[0066] sPLA2δ (At4g29470) gene editing was performed using CRISPR-Cas9. As shown in Fig. 2, a single guide RNA (sgRNA) targeting the sPLA2δ sequence was selected using CRISPR RGEN Tools (http: / www.rgenome.net / ). A 20-bp synthesized sgRNA oligomer, excluding the PAM site, was linked to a complementary sequence and cloned into the AarI restriction site of the pHAtC vector (Fig. 1).

[0067]

[0068] Afterwards, the above construct was introduced into Agrobacterium tumefaciens C58C1 (pMP90) and transformed into wild-type (Col-0) Arabidopsis via floral dipping to obtain transformants. In the case of gene-edited individuals, the part including the DNA base sequence targeted by sgRNA was amplified and purified, and then the editing of the sPLA2δ gene was confirmed through targeted deep sequencing.

[0069]

[0070] 3. Pluripotency analysis using a flow cytometer

[0071] Sample preparation for flow cytometry analysis is done using CyStain TM The procedure was performed according to the instructions for PI Absolute P (05-5022, Sysmex, Germany). Arabidopsis leaf tissue (0.5 cm x 0.5 cm in size) was treated with 100 μl of nuclear extraction solution and finely disrupted using a razor blade. Afterwards, 400 μl of propidium iodide staining reagent was treated and the tissue was analyzed using a 30 μm CellTric TM Large leaf tissues were removed through a filter. After reacting for 20 minutes in the dark, DNA content analysis was performed using a flow cytometer (CytoFLEX, Beckman Coulter, Pasadena, CA, USA and Novocyte, Agilent, USA). The G1 peak that appeared when analyzing the DNA content of wild-type plants was set as the diploid (2n) peak, and the peak showing half the DNA content compared to the above standard was determined as the haploid (n) peak.

[0072]

[0073] 4. Karyotype analysis using DAPI staining

[0074] To verify the ploidy of Arabidopsis thaliana, karyotype analysis was performed using DAPI (4',6-diamidino-2-phenylindole) staining. Arabidopsis leaves were treated with Carnoy's fixative (ethanol:acetic acid, 3:1, v / v) and fixed at room temperature for 12 h. The fixed leaf tissues were washed twice each with distilled water and citric acid-sodium citrate buffer (0.04 M citric acid-monohydrate, 0.06 M trisodium citrate dihydrate, pH 4.8). For cell wall degradation, an enzyme solution consisting of 2% (w / v) cellulase R-10 (C80001; Duchefa Biocheme) and 3% (w / v) pectinase (P4716; Sigma-Aldrich) was treated, and the reaction was carried out at 37℃ for 2 hours, and then washed twice with citric acid-sodium citrate buffer. The sample was then placed on a slide glass, treated with 60% (v / v) acetic acid, finely ground using a syringe needle, and dried at room temperature so that the sample could be fixed to the slide glass. After drying, the sample was treated with 1 ㎍ / ㎖ DAPI solution, and the DAPI-stained cells and nuclei were observed using a fluorescence microscope (M165FC; Leica).

[0075]

[0076] 5. Genome-Derived Analysis Using UPSC InDel Markers

[0077] To analyze the genomic origin of haploid F1 plants obtained after crosses, the Arabidopsis UPSC InDel marker was utilized. Genomic DNA was extracted from the male (SgsPLA2δ-4#19-4;FAST-RED), the mother (ms1-1), and the diploid and haploid F1 plants obtained through crosses. PCR was performed using a Thermal Cycler (T100, Bio-Rad) with a total of five combinations of primers listed in Table 2. After electrophoresis on a 2% agarose gel at 100 V for 30 minutes, the genomic origin of the haploid F1 plants was determined by comparing the sizes of the amplified DNA.

[0078] UPSC InDel MarkerPrimer nameSequence used in PCR (5'-3') SEQ ID NO: UPSC_1-9203-FACAATCATGTGCGATGGAAA5UPSC_1-9203-RACCTCCACGAACATCTCCAG6UPSC_2-10705-FTCATGCAAATCAAATGCAGAAA7UPSC_2-10705-RGGATGGCTATTTCCATGCAG8UPSC_3-8894-FCCTTCGTTGGGTCAAACAG T9UPSC_3-8894-RCGGCAAAATGGTGAGAAGTT10UPSC_4-14602-FAAGCCCAGAGGAAGAAAGAGC11UPSC_4-14602-RTCCA AAGGCATACGATTTGAT12UPSC_5-18624-FAGCTGTGGATCTTTCCCCTTA13UPSC_5-18624-RTCTCACAAGTGCTCTCAAACG14

[0079]

[0080] Example 1. Analysis of sPLA2δ gene-edited plants

[0081] We attempted to edit the sPLA2δ gene using CRISPR-Cas9, and performed target-site sequence analysis on the gene-edited strains. As a result, premature translation termination mutations caused by 1 bp insertions or deletions at the target site were identified, and these strains were selected (Figs. 3 and 4).

[0082] In addition, the haploid induction rate (HIR) through selfing of sPLA2δ gene-edited plants (SgsPLA2δ-4#19-1, SgsPLA2δ-4#19-4) was analyzed. The haploid induction rate was determined through chromosome ploidy analysis. The analysis results showed that haploid plants were induced at an average rate of 0.83% in the sPLA2δ gene-edited lines (Table 3).

[0083] SelfingHIR (haploid plant / total analyzed plant) through selfing of sPLA2δ gene-edited lines. SgsPLA2δ-4#19 - 10.73% (1 / 137). SgsPLA2δ-4#19 - 40.89% (2 / 225). Average 0.83% (3 / 362).

[0084]

[0085] Example 2. Chromosome ploidy analysis of F1 plants obtained through crossing a male sterile mutant (ms1-1) and an sPLA2δ gene-edited individual.

[0086] The sPLA2δ gene-edited individual (SgsPLA2δ-4#19-4; Columbia-0 ecotype) obtained through Example 1 was crossed with the male sterile mutant ms1-1 (male sterile1-1; Landsberg erecta ecotype) to produce F1 plants. ms1-1 (CS75) was purchased from ABRC (Arabidopsis biological resource center). In addition, a FAST-RED cassette (PromoterOLEO1:OLEO1-RFP) was introduced into the Col-0 wild type and SgsPLA2δ-4#19-4 used in the cross. FAST-RED is a seed-specifically expressed RFP (Red fluorescent protein) marker, and the RFP fluorescence signal of the seeds after crossing was confirmed to select haploid candidate seeds.

[0087] The haploid induction rate (HIR) was confirmed to be 0.092% through chromosome ploidy analysis of F1 plants obtained through crossing a male sterile mutant and an sPLA2δ gene-edited individual, as shown in Table 4 below. It was confirmed that haploidy was not induced in F1 plants obtained by crossing the male sterile mutant ms1-1 and the Col-0 wild type.

[0088] Ploidy analysis results of the F1 generation obtained through crossesFemaleMaleHIRControlms1-1(Ler)FAST-RED (Col-0)0 / 1316 (0%)Testms1-1(Ler)SgsPLA2δ#19-4;FAST-RED (Col-0)6 / 6548 (0.092%)

[0089] In addition, the phenotypes of the diploid and haploid F1 plants obtained through the cross between the male sterile mutant and the sPLA2δ gene-edited plants were analyzed, and it was found that the haploid F1 plants were significantly dwarfed compared to the diploid F1 plants, and the haploidy was verified through ploidy analysis using a flow cytometer (Fig. 5). The karyotype analysis using DAPI (4',6-diamidino-2-phenylindole) staining of the diploid and haploid F1 plants obtained through the cross between the male sterile mutant and the sPLA2δ gene-edited plants confirmed that the diploid F1 plants had five pairs of chromosomes in a multiple of five (Fig. 6).

[0090]

[0091] Example 3. Analysis of the genome origin of F1 plants obtained through crossing a male sterile mutant (ms1-1) and an sPLA2δ gene-edited individual.

[0092] The present inventors performed PCR using the UPSC (Umea Plant Science Centre) InDel markers (Pacurar DI, et al., J Exp Bot. 2012, 63(7):2491-501) disclosed in Table 2 to analyze which parental genome of diploid and haploid F1 plants obtained by crossing the male sterile mutant ms1-1 and the sPLA2δ gene-edited individual (SgsPLA2δ-4#19-4) originated from. The analysis results confirmed that all haploid F1 plants had maternally derived genomes (Fig. 7).

Claims

1. A composition for inducing haploid plants, comprising an sPLA2δ protein coding gene derived from Arabidopsis thaliana as an active ingredient.

2. A composition according to claim 1, wherein the Arabidopsis-derived sPLA2δ protein is characterized by having an amino acid sequence of sequence number 3.

3. A step of inhibiting the expression of the sPLA2δ gene by transforming a plant cell with a recombinant vector containing an Arabidopsis-derived sPLA2δ protein coding gene; and A method for producing a haploid plant, comprising the step of redifferentiating a transformed plant from the transformed plant cell.

4. A haploid plant produced by the method of paragraph 3.

5. Seeds of plants according to Article 4. 6.(a) A step of editing the genome by introducing guide RNA and endonuclease protein specific to the target base sequence of the sPLA2δ protein coding gene derived from Arabidopsis thaliana into a plant cell; and (b) A method for producing a genome-edited plant derived from a haploid, comprising the step of re-differentiating the plant from the genome-edited plant cell.

7. A method for producing a genome-edited plant derived from a haploid, characterized in that in the 6th paragraph, the introduction of the guide RNA and the endonuclease protein of step (a) into the plant cell uses a recombinant vector comprising a DNA encoding a guide RNA specific to the target base sequence of an Arabidopsis-derived sPLA2δ protein-coding gene and a nucleic acid sequence encoding an endonuclease protein; or a complex (ribonucleoprotein) of a guide RNA specific to the target base sequence of an Arabidopsis-derived sPLA2δ protein-coding gene and an endonuclease protein.

8. A method for controlling the number of chromosomes in a plant, comprising a step of controlling the expression of an Arabidopsis thaliana-derived sPLA2δ protein coding gene in the plant.

9. A method according to claim 8, characterized in that the expression control of the Arabidopsis thaliana-derived sPLA2δ protein coding gene inhibits the expression of the Arabidopsis thaliana-derived sPLA2δ protein coding gene, thereby reducing the number of chromosomes in the plant.

10. In the 9th paragraph, the method is characterized in that the expression of the sPLA2δ protein coding gene derived from Arabidopsis is inhibited by using VIGS (Virus-induced gene silencing), RNAi (RNA interference), or mutagenesis through antisense RNA, T-DNA insertion, endogenous transposon, radiation exposure, or a gene editing system.

Images