Regulatory sequences

Novel promoters and UTRs optimize gene expression and RNA stability, addressing limitations in current therapies by enhancing expression, targeting specificity, and vector capacity, thereby improving therapeutic outcomes.

WO2025221850A1PCT designated stage Publication Date: 2025-10-23GINKGO BIOWORKS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/024902
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-16
Filing Date
2025-04-16
Publication Date
2025-10-23

AI Technical Summary

Technical Problem

Existing nucleic acid-based therapies face challenges in optimizing gene expression and RNA stability due to the limitations of current regulatory sequences, leading to insufficient expression levels, off-target effects, immunogenicity, and space constraints in delivery vectors.

Method used

Development of novel promoters and UTRs that enhance gene expression and RNA stability, including core promoter sequences and UTR sequences with high identity to specific SEQ IDs, which are operably linked to enhance targeting, reduce immunogenicity, and fit within limited vector space.

Benefits of technology

The new regulatory elements improve therapeutic efficacy by increasing expression levels, ensuring targeted gene delivery, reducing immune responses, and maximizing therapeutic payload in delivery vectors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000066_0001
    Figure IMGF000066_0001
  • Figure IMGF000026_0001
    Figure IMGF000026_0001
  • Figure IMGF000027_0001
    Figure IMGF000027_0001
Patent Text Reader

Abstract

The present disclosure provides modular regulatory elements useful for transcription and gene expression.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]Attorney Docket: GBB-01125 REGULATORY SEQUENCES CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application Ser. No. 63 / 634,790, filed April 16, 2024, the contents of which are hereby incorporated by reference. BACKGROUND Many therapeutic approaches involve the administration and / or expression of nucleic acids to patients. The choice of appropriate nucleic acid regulatory sequences can greatly influence the efficacy of such therapeutic approaches. For example, the nucleic acid regulatory sequences used in nucleic acid-based therapies can have a significant effect on both gene expression and RNA stability. For instance, in many gene therapies, selection of appropriate promoter sequences can be critical to ensuring that the therapeutic gene is expressed in the correct cells and at a therapeutically effective level. Likewise, choice of appropriate RNA untranslated regions (UTRs) can increase the in vivo stability of therapeutic RNAs, whether they are expressed in vivo (e.g., as a result of gene therapy) or directly administered to a patient (e.g., as an mRNA therapeutic). Accordingly, there is a great need for new regulatory sequences, such as promoters and UTRs, that can be used to optimize gene expression and / or RNA stability in various therapeutic approaches. SUMMARY In certain aspects, provided herein are promoters (e.g., RNA polymerase II promotersand RNA polymerase III promoters) that facilitate gene expression, as well as UTRs (e.g., 5UTRs and 3 UTRs) that enhance RNA stability and protein expression. In certain aspects,provided herein are components of promoters such as core promoters, enhancers and promoter constant regions. In certain aspects, provided herein are components of UTRs such as core UTR sequences and UTR constant regions. In certain embodiments, such regulatory sequences, such as promoters and UTRs, can be used in a wide range of therapeutic approaches, including, but not limited to, gene therapy, gene editing, and / or mRNA therapeutic technologies. In certain aspects, the disclosure provides a polynucleotide comprising an untranslated region (UTR), wherein the UTR comprises a core UTR sequence that is at least Attorney Docket: GBB-01125 90% identical to any of SEQ ID NOs: 1-8, 96, 98-106, or 108-118, wherein the UTR is a 5' UTR or a 3' UTR. In some embodiments, the core UTR sequence is at least 95% identical to any of SEQ ID NOs: 1-8, 96, 98-106, or 108-118. In some embodiments, the core UTR sequence is or comprises any of SEQ ID NOs: 1-8, 96, 98-106, or 108-118. In some embodiments, the UTR further comprises a 3 constant region positioned 3 tothe core UTR sequence. In some embodiments, the 3 constant region is at least 80% identicalto SEQ ID NO: 9. In some embodiments, the 3 constant region is at least 90% identical toSEQ ID NO: 9. In some embodiments, the 3 constant region is or comprises SEQ ID NO: 9.In some embodiments, the UTR further comprises a first adapter sequence positioned3 to the core UTR sequence. In some embodiments, the first adapter sequence is at least 80%identical to SEQ ID NO: 11. In some embodiments, the first adapter sequence is at least 90% identical to SEQ ID NO: 11. In some embodiments, the first adapter sequence is or comprises SEQ ID NO: 11. In some embodiments, the UTR further comprises a linker sequence positioned between the first adapter sequence and the 3' constant region. In some embodiments, the linker sequence is or comprises SEQ ID NO: 12. In some embodiments, the UTR further comprises a second adapter sequencepositioned 5 to the core UTR sequence. In some embodiments, the second adapter sequenceis at least 80% identical to SEQ ID NO: 10. In some embodiments, the second adapter sequence is at least 90% identical to SEQ ID NO: 10. In some embodiments, the second adapter sequence is or comprises SEQ ID NO: 10. In some embodiments, the polynucleotide further comprises a polyadenylation(polyA) sequence positioned 3 to the core UTR sequence.In some embodiments, the polynucleotide does not comprise a translated region (e.g., a coding sequence). In some embodiments, the polynucleotide further comprises a translated region. In some embodiments, the UTR is a 3 UTR that is positioned 3 to the translatedregion. In some embodiments, the translated region encodes a therapeutic protein. In some embodiments, the polynucleotide is an RNA. In some embodiments, the polynucleotide is an mRNA, circRNA or saRNA. In some embodiments, the polynucleotide comprises or encodes a gRNA, a sgRNA, an RNAi, a tRNA, an rRNA, a snRNA or a snoRNA. Attorney Docket: GBB-01125 In certain aspects, the present disclosure provides a polynucleotide comprising an untranslated region (UTR), wherein the UTR comprises a core UTR sequence that is at least 90% identical to any of SEQ ID NOs: 21-25, or 143-162. In some embodiments, the core UTR sequence is at least 95% identical to any of SEQ ID NOs: 21-25, or 143-162. In some embodiments, the core UTR sequence is or comprises any of SEQ ID NOs: 21-25, or 143-162. In some embodiments, the UTR further comprises a 5 constant region sequencepositioned 5' to the core UTR sequence, wherein the 5' constant region sequence is or comprises SEQ ID NO: 26. In some embodiments, the UTR further comprises a Kozak constant region sequence positioned 3' to the core UTR sequence, wherein the Kozak constant region sequence is or comprises SEQ ID NO: 27. In some embodiments, the UTR further comprises at least two guanine nucleotides between the core UTR sequence and the Kozak constant region sequence. In some embodiments, the polynucleotide does not comprise a translated region. In some embodiments, the polynucleotide further comprises a translated region. Insome embodiments, the UTR is a 5 UTR that is positioned 5 to the translated region. Insome embodiments, the translated region encodes a therapeutic protein. In some embodiments, the polynucleotide is an RNA. In some embodiments, the polynucleotide is an mRNA, circRNA, or a saRNA. In some embodiments, the polynucleotide encodes or comprises a gRNA, a sgRNA, an RNAi, a tRNA, an rRNA, a snRNA, or a snoRNA. In some embodiments, the polynucleotide further comprises an additional UTR, wherein the additional UTR comprises a second core UTR sequence that is at least 90% identical to any of SEQ ID NOs: 21-25, or 143-162. In some embodiments, the second core UTR sequence is at least 95% identical to any of SEQ ID NOs: 21-25, or 143-162. In some embodiments, the second core UTR sequence is or comprises any of SEQ ID NOs: 21-25, or 143-162. In some embodiments, the additional UTR further comprises a 5 constant regionsequence, wherein the 5' constant region sequence is or comprises SEQ ID NO: 26. In some embodiments, the additional UTR further comprises a Kozak constant region sequence, wherein the Kozak constant region sequence is or comprises SEQ ID NO: 27. Attorney Docket: GBB-01125 In some embodiments, the additional UTR further comprises at least two guanine nucleotides between the second core UTR sequence and the Kozak constant region sequence. In some embodiments, the polynucleotide further comprises a translated region. In some embodiments, the additional UTR is positioned 3 to the translated region.In some embodiments, the additional UTR is positioned 5 to the translated region.In certain aspects, the present disclosure provides a polynucleotide comprising: a polynucleotide as herein disclosed and an additional polynucleotide. In some embodiments, the polynucleotide is an expression vector. In certain aspects, the present disclosure provides a lipid nanoparticle comprising any of the polynucleotides herein disclosed. In certain aspects, the present disclosure provides a polynucleotide comprising a core promoter sequence that is at least 90% identical to SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37, and a heterologous polynucleotide. In some embodiments, the core promoter sequence is at least 95% identical to SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37. In some embodiments, the core promoter sequence is or comprises the sequence of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37. In some embodiments, the polynucleotide further comprises a 3 constant regionsequence, wherein the 3' constant region sequence is or comprises SEQ ID NO: 38. In some embodiments, the polynucleotide further comprises one or more motif cluster sequences. In some embodiments, any of the one or more motif cluster sequences are at least 90% identical to SEQ ID NO 49-78. In some embodiments, any of the one or more motif cluster sequences is or comprises one or more of SEQ ID NO 49-78. In some embodiments, the polynucleotide further comprises a first enhancer sequence. In some embodiments, the first enhancer sequence is positioned 5 to the corepromoter sequence. In some embodiments, the first enhancer sequence is positioned 3 to thecore promoter sequence. In some embodiments, the first enhancer sequence is at least 90% identical to SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. In some embodiments, the first enhancer sequence is or comprises one of SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. Attorney Docket: GBB-01125 In some embodiments, the polynucleotide further comprises a linker sequence between the first enhancer sequence and the core promoter sequence. In some embodiments, the linker sequence is or comprises SEQ ID NO: 43. In some embodiments, the polynucleotide further comprises a second enhancer sequence, wherein the sequence of the first and the second enhancer sequences are the sameor different. In some embodiments, the second enhancer sequence is positioned 5 to the corepromoter sequence. In some embodiments, the second enhancer sequence is positioned 3 tothe core promoter sequence. In some embodiments, the second enhancer sequence is at least 90% identical to SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. In some embodiments, the second enhancer sequence is or comprises one of SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. In some embodiments, the first enhancer sequence comprises SEQ ID NO: 39 and the second enhancer sequence comprises SEQ ID NO: 40. In some embodiments, the first enhancer sequence comprises SEQ ID NO: 39 and the second enhancer sequence comprises SEQ ID NO: 42. In some embodiments, the first enhancer sequence comprises SEQ ID NO: 39 and the second enhancer sequence comprises SEQ ID NO: 41. In some embodiments, the first enhancer sequence comprises SEQ ID NO: 40 and the second enhancer sequence comprises SEQ ID NO: 39. In some embodiments, the first enhancer sequence comprises SEQ ID NO: 40 and the second enhancer sequence comprises SEQ ID NO: 42. In some embodiments, the first enhancer sequence comprises SEQ ID NO: 40 and the second enhancer sequence comprises SEQ ID NO: 41. In some embodiments, the first enhancer sequence comprises SEQ ID NO: 42 and the second enhancer sequence comprises SEQ ID NO: 39. In some embodiments, the first enhancer sequence comprises SEQ ID NO: 42 and the second enhancer sequence comprises SEQ ID NO: 40. In some embodiments, the first enhancer sequence comprises SEQ ID NO: 42 and the second enhancer sequence comprises SEQ ID NO: 41. In some embodiments, the first enhancer sequence comprises SEQ ID NO: 41 and the second enhancer sequence comprises SEQ ID NO: 39. In some embodiments, the first enhancer sequence comprises SEQ ID NO: 41 and the second enhancer sequence comprises SEQ ID NO: 40. In some embodiments, the first enhancer sequence comprises SEQ ID NO: 41 and the second enhancer sequence comprises SEQ ID NO: 42. Attorney Docket: GBB-01125 In some embodiments, the first and the second enhancer sequences are the same or different from each other. In some embodiments, the first enhancer sequence is positioned 5 to the secondenhancer sequence. In some embodiments, the polynucleotide comprises an RNA polymerase II (Pol2) promoter. In some embodiments, the polynucleotide further comprises a coding sequence. In some embodiments, the coding sequence encodes a therapeutic protein. In certain aspects, the present disclosure provides a polynucleotide comprising a promoter sequence that is at least 90% identical to SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, or SEQ ID NO: 48. In some embodiments, the promoter sequence is at least 95% identical to SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, or SEQ ID NO: 48. In some embodiments, the promoter sequence is or comprises SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, or SEQ ID NO: 48. In certain aspects, the present disclosure provides a polynucleotide comprising an enhancer sequence that is at least 90% identical to SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. In certain aspects, the present disclosure provides a polynucleotide comprising at least one enhancer sequence selected from any one of the sequences set forth in SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. In certain aspects, the present disclosure provides a polynucleotide comprising at least two of any one of the enhancer sequences set forth in SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. In some embodiments, the polynucleotide further comprises a core promoter sequence, wherein the core promoter sequence is or comprises any of SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37. In some embodiments, the at least one enhancer is operably linked to the core promoter sequence. In some embodiments, the core promoter sequence is or comprises any of SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 or SEQ ID NO: 37. In some embodiments, the core promoter sequence is SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 or SEQ ID NO: 37. In some embodiments, the core promoter sequence is SEQ ID NO: 36 or SEQ ID NO: 37. Attorney Docket: GBB-01125 In some embodiments, the core promoter sequence is or comprises SEQ ID NO: 36. In some embodiments, the core promoter sequence is or comprises SEQ ID NO: 37. In some embodiments, the polynucleotide comprises a cis-regulatory element. In certain aspects, the present disclosure provides a polynucleotide comprising at least one of the motif cluster sequences listed in SEQ ID NOs: 49-78. In certain aspects, the present disclosure provides a polynucleotide comprising at least two of the motif cluster sequences listed in SEQ ID NOs: 49-78, wherein the two motif cluster sequences are different. In some embodiments, the motif cluster sequence(s) comprise or are comprised within a cis-regulatory element. In some embodiments, the polynucleotide further comprises a coding sequence. In some embodiments, the coding sequence encodes a therapeutic protein. In certain aspects, the present disclosure provides a polynucleotide comprising a core promoter sequence that is at least 90% identical to SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, or SEQ ID NO: 86. In some embodiments, the core promoter sequence is at least 95% identical to SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, or SEQ ID NO: 86. In some embodiments, the core promoter sequence is or comprises SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, or SEQ ID NO: 86. In some embodiments, the polynucleotide further comprises a constant region sequence, wherein the constant region sequence is or comprises SEQ ID NO: 87, and theconstant region sequence is positioned 3 to the core promoter sequence.In certain aspects, the present disclosure provides a polynucleotide comprising a promoter sequence that is at least 90% identical to SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, or SEQ ID NO: 95. In some embodiments, the promoter sequence is at least 95% identity to SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, or SEQ ID NO: 95. Attorney Docket: GBB-01125 In some embodiments, the promoter sequence is or comprises SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, or SEQ ID NO: 95. In some embodiments, the promoter sequence comprises or is comprised within an RNA polymerase III (Pol3) promoter. In some embodiments, the polynucleotide encodes or comprises a gRNA, a sgRNA, or an RNAi agent. In some embodiments, any of the polynucleotides herein disclosed is operably linked to any of the other polynucleotides herein disclosed. In some embodiments, the polynucleotide encodes a therapeutic protein. In some embodiments, the polynucleotide encodes a Cas nuclease. In some embodiments, the core promoter sequence is operably linked to a sequence encoding a guide RNA. In some embodiments, the core promoter sequence is operably linked to a sequence encoding a short interfering RNA. In some embodiments, the core promoter sequence is operably linked to a sequence encoding an antisense RNA. In some embodiments, the promoter sequence is operably linked to a sequence encoding a guide RNA. In some embodiments, the promoter sequence is operably linked to a sequence encoding a short interfering RNA. In some embodiments, the promoter sequence is operably linked to a sequence encoding an antisense RNA. In certain aspects, the present disclosure provides an adeno-associated virus (AAV) vector comprising a DNA sequence encoding any of the polynucleotides herein disclosed, wherein the polynucleotide is an RNA. In certain aspects, the present disclosure provides an AAV vector comprising a polynucleotide herein disclosed, wherein the polynucleotide is a DNA; another polynucleotide herein disclosed, wherein the polynucleotide is a DNA; and / or yet another polynucleotide herein disclosed, wherein the polynucleotide is a DNA. In certain aspects, the present disclosure provides an AAV vector comprising a first polynucleotide herein disclosed, wherein the polynucleotide is a DNA; a second polynucleotide of herein disclosed, wherein the polynucleotide is a DNA; and a third polynucleotide herein disclosed, wherein the polynucleotide is a DNA. Attorney Docket: GBB-01125 In some embodiments, the translated region of the polynucleotide encodes a Cas nuclease. In some embodiments, a polynucleotide herein disclosed encodes or comprises a gRNA or a sgRNA. In certain aspects, the present disclosure provides a cell comprising a first polynucleotide herein disclosed, a second polynucleotide herein disclosed, a third polynucleotide herein disclosed, a fourth polynucleotide herein disclosed, and / or a fifth polynucleotide herein disclosed. In some embodiments, the cell is a muscle cell. In certain aspects, the present disclosure provides a method of expressing a polypeptide in a cell, wherein the method comprises the step of contacting the cell with any of the polynucleotides herein disclosed or any of the AAV vectors herein disclosed. In certain aspects, the present disclosure provides a method of expressing a polypeptide in a subject, wherein the method comprises the step of administering to the subject any of the polynucleotides herein disclosed, any of the AAV vectors herein disclosed, or any of the cells herein disclosed. In certain aspects, the present disclosures provides a polynucleotide comprising (a) a3 untranslated region (3 UTR) sequence comprising a core UTR sequence that is at least90% identical to any of SEQ ID NOs: 97 or 107 and (b) a heterologous polynucleotide. In certain aspects, the present disclosure provides a polynucleotide comprising (a) aPol2 core promoter sequence which is or comprises the sequence of any one of SEQ ID NOs: 33, 34, 35, 36, or 37 and (b) a heterologous polynucleotide. In certain aspects, the present disclosure provides a polynucleotide comprising (a) a Pol2 core promoter sequence which has a sequence at least 90% identical to the sequence of any one of SEQ ID NO: 33, 34, or 35 and (b) a heterologous polynucleotide. BRIEF DESCRIPTION OF THE DRAWINGS The set of drawings included herein, which is composed of the following Figures, is for illustration purposes only and not for limitation. FIG. 1 is a series of graphs showing in vivo ventral flux measurements by time for candidates (TC9, TC10, and TC11) vs. human hemoglobin subunit B (hHBB) 3' UTR; this is in vivo LNP-delivered protein validation data in C57BL / 6J mice. The top row depicts total ventral flux per animal per timepoint as calculated by Biomere, a contract research Attorney Docket: GBB-01125 organization, Worcester, MA. The bottom row depicts fold change of flux vs. first measurement (hour 6), compared to hHBB fold change vs first measurement. In this and various other figures, the designation “TC#” is short-hand for “PB-TC-#”. Thus, TC9 is PB- TC-0009, TC10 is PB-TC-0010, and TC11 is PB-TC-0011. FIG. 2 is a graph showing in vivo ventral flux measurements by time for CA52(hexagons) vs. AAVs with various promoters and SV403 UTR; this is in vivo AAV-delivered protein validation data in C57BL / 6J mice. MHCK7 is a comparator muscle promoter, Salva et al. 2007 Mol. Ther. 15: 320-329. TC4 is PB-TC-0004, TC6 is PB-TC- 0006, and TC4-CA52 is PB-TC-0004 (promoter) and PB-CA-0052 (3' UTR core sequence). FIG. 3A is a graph showing estimated half-life of 3' UTRs from four stability MPRAs (massively parallel reporter assays). Industry 3' UTRs are included as hHBB, TNFa-CDE37- 150-M16, and TP53I3, and candidate 3' UTRs are labeled as CAs. In this and various other figures, the designation “CA#” is short-hand for “PB-CA-#”. Thus, CA67 is PB-CA-0067, CA68 is PB-CA-0068, etc. Stability MPRAs are identified on the x-axis. TNFa-CDE37-150- M16 is a control 3' UTR which was described in Leppek et al. 2013 Cell 153(4): 869-81, and designated as “TNFa” in FIGs. 3B and 3C, etc. TP53I3 human short is a natural 3' UTR from the TB53I3 gene. FIG. 3B is a graph showing estimated half-life of 3 UTRs from three stabilityMPRAs (massively parallel reporter assays). Industry 3 UTRs are included as hHBB, TNFa,and TP53I3, and candidate 3 UTRs are labeled as CAs. Stability MPRAs are identified at thetop of each column. CA# is shorthand for PB-CA-#, with the leading zero removed. For example, CA183 equates to PB-CA-0183. FIG. 3C is a graph showing estimated half-life of 3 UTRs from two stability MPRAsrun with N1-methylpseudo-uridine in place of uridine. Industry 3 UTRs are included ashHBB, TNFa-CDE37-150-M16, and TP53I3, and candidate 3 UTRs are labeled as CAs.Stability MPRAs are identified at the top of each column. CA# is shorthand for PB-CA-#, with the leading zero removed. For example, CA183 equates to PB-CA-0183. FIG. 4A is a graph showing protein expression estimates (measured in average fluorescence intensity of fluorescent payload) from two sort-seq MPRAs. Stability andprotein expression measurements of 5 UTR candidates are shown. Library of testedsequences in gray and candidate sequences as other shapes (legend top right). Assay IDs are labeled as PB-RA-XXXX. PB-RA-0551, PB-RA-0554, PB-RA-0552, and PB-RA-0555 are thus different experiment numbers. Attorney Docket: GBB-01125 FIG. 4B is a graph showing half-life estimates in hours from two stability MPRAs. Library of tested sequences in gray and candidate sequences as other shapes (legend top right). Assay IDs are labeled as PB-RA-XXXX. FIG. 4C is a pair of graphs showing half-life vs. expression level of two stability MPRAs and two sort-seq MPRAs. Library of tested sequences in gray and candidate sequences as other shapes (legend right side). Assay IDs are labeled as PB-RA-XXXX. CA# is shorthand for PB-CA-#, with the leading zero removed. For example, CA183 equates to PB-CA-0183. FIG. 4D is a pair of graphs showing half-life from two stability MPRAs vs predicted ribosome load from a machine learning model. Library of tested sequences in circles and candidate sequences as other shapes (legend right side). Assay IDs are labeled as PB-RA- XXXX. CA# is shorthand for PB-CA-#, with the leading zero removed. For example, CA183 equates to PB-CA-0183. FIG. 4E is a graph showing translation strength from a polysome profiling MPRA. Translation strength is calculated as the fold enrichment between the high and low polysome fractions for each sequence. Library of tested sequences are at the first position on the x-axis, industry control human hemoglobin subunit B 5' UTR (Globin) at the second position on the x-axis, and candidate sequences along the remainder of the x-axis. FIG. 4F is a graph showing protein expression measurements from an arrayed AlphaLISA protein experiment. Protein expression is calculated as the fold change of each sample's protein expression to an mRNA molecule with the hHBB 5' UTR. Assays are labeled at the top of each column. FIG. 5A is a graph showing in vivo protein measurements from an IVIS imaging experiment. FIGs. 5A to 5D show in vivo protein single clone validation data (AAV- packaged, IV delivery, muscle expression) in C57BL / 6J mice. Total flux measurements from hind legs for each promoter candidate by days post-injection is shown. Each dot is a single animal measurement for the candidate at the timepoint. MHCK7 industry standard is depicted as upward triangles, and candidates as other shapes. “TC4 [PB-TC-0004] low dose” indicates a 10X lower dose of the virus. TC4, TC5, and TC6 indicate PB-CA-0004, PB-TC-0005 and PB-TC-0006, respectively. TC4-CA52 has the same meaning as in Fig. 2, above. FIG. 5B is a graph showing in vivo protein measurements from an IVIS imaging experiment. Total flux measurements from ventral abdominal area for each promoter candidate by days post-injection is shown. Each dot is a single animal measurement for the Attorney Docket: GBB-01125 candidate at the timepoint. MHCK7 industry standard is depicted as upward triangles, and candidates as other shapes. Abbreviated names have the same meaning as in Fig. 5A, above. FIG. 5C is a graph showing Day 7 fold change of total flux vs average MHCK7 in hind legs. Each dot is a single animal measurement for the candidate at the timepoint. MHCK7 industry standard is depicted as upward triangles, and candidates as other shapes. Abbreviated names have the same meaning as in Fig. 5A, above. FIG. 5D is a graph showing Day 7 fold change of total flux vs average MHCK7 in ventral abdominal area. Each dot is a single animal measurement for the candidate at the timepoint. MHCK7 industry standard is depicted as upward triangles, and candidates as other shapes. Abbreviated names have the same meaning as in Fig. 5A, above. FIG. 6 is a graph showing that short motif clusters lead to high expression in MPRA in muscle in C57BL / 6J mice. Enhancer sequences containing multiple short motif clusters (Hybrid Short Clusters) resulted in up to 6.3x RNA as compared to MHCK7 industry standard. FIG. 7 is a gel image showing DNA cutting results. U6 Pol3 promoter and GG172 (which is the same as TC34 or PB-TC-0034) samples show two bands, indicating that both Pol3 promoters express functional gRNA, resulting in two cuts and a deletion of 100 bases in the target DNA. The sequence of the U6 Pol3 promoter is provided as SEQ ID NO: 184. FIG. 8A is a graph showing luciferase expression results. Firefly luminescence is reduced when Candidate (TC34) and U6 express gRNA targeting the firefly luciferase gene. Renilla luminescence serves as a control for each sample. FIG. 8B is a graph showing luciferase expression results on Day 4. Firefly luminescence is reduced when Candidate EH94 (TC30 or PB-TC-0030), Candidate EH95 (TC31 or PB-TC-0031), U6, and U6 mini express gRNA targeting the firefly luciferase gene. Renilla luminescence serves as a control for each sample. The mini U6 Pol3 promoter is described in Preece et al. 2020 Gene Ther. 27(9): 451-458. FIG. 8C is a graph showing the ratio of targeted firefly luminescence vs control renilla luminescence per Pol3 promoter. The candidate tested is TC34. FIG. 8D is a graph showing the ratio of Luciferase luminescence vs. control renilla luminescence. Candidate EH94 is also known as TC30 or PB-TC-0030, Candidate EH95 is also known as TC31 or PB-TC-0031. All Pol3 promoters tested reduced luciferase activity from non-targeted levels (No guides / No guide control). Attorney Docket: GBB-01125 FIG. 9 is a graph showing RNA expression measurements from total MPRA in HEK293 cells. Fold change vs U6 RNA expression of library and candidates (CAs) in two different assays (x-axis). CA# is shorthand for PB-CA-#, with leading zeros removed. For example, CA8 is PB-CA-0008. DETAILED DESCRIPTION The present disclosure provides novel polynucleotide regulatory elements that, in certain embodiments, can be used in, for example, molecular biology, gene therapy, gene editing, and / or mRNA therapeutic technologies. In some embodiments, elements provided herein showed surprising characteristics including, but not limited to, increased translation and / or stability of mRNA into which they are incorporated, leading to prolonged and increased protein expression. In some embodiments, a regulatory element is a promoter, enhancer, UTR (untranslated region) or a component thereof. In recent years, the fields of gene therapy, gene editing, and mRNA therapeutics have emerged as groundbreaking approaches in the realm of medical science, offering promising solutions to a wide array of diseases and disorders. Each of these innovative technologies harnesses the power of genetics and our understanding of gene regulation to address health challenges. However, these therapies often use “out-of-the-box” regulatory elements, taken from nature and pasted into therapies. This approach limits the specificity, effectiveness, and safety of these therapeutics and holds back their potential to treat, prevent, and cure disease. In some embodiments, regulatory elements provided herein demonstrated increased expression levels (of genes to which they are operably linked), enhanced targeting, reduced immunogenicity, and / or reduced space requirements (thus addressing concerns of space limitation in vectors and other polynucleotides). Increased Expression Levels: Insufficient expression levels of therapeutic genes or proteins can limit the effectiveness of these therapies. By optimizing promoters, enhancers, and UTRs, we boost expression levels, potentially improving the therapeutic outcomes, especially in cases where high expression is crucial. Enhanced Targeting: Currently used regulatory elements often lack specificity, leading to expression in off-target tissues and potentially harmful side effects. Improving the specificity ensures that therapeutic genes or proteins are expressed only in the intended cells or tissues, improving the precision and safety of these therapies. Attorney Docket: GBB-01125 Reduced Immunogenicity: mRNA therapeutics can be immunogenic, leading to safety concerns and reduced efficacy. Improving UTRs could help reduce immunogenicity, making these therapeutics more stable and less likely to trigger immune responses, thereby improving their safety and effectiveness. Space Limitation: Adeno-associated virus (AAV) vectors, commonly used in gene therapy, have limited cargo capacity. Current regulatory elements, which can be large, may not fit within these constraints, limiting the amount of therapeutic genetic material that can be delivered. Developing shorter regulatory elements would allow more of the therapeutic gene or mRNA to be packaged into these vectors, maximizing the therapeutic potential of gene therapy and mRNA therapeutics. Accordingly, in aspects provided herein are regulatory elements with improved properties useful, for example, in molecular biology, gene therapy, gene editing, and mRNA therapeutics In some embodiments, the disclosure provides a polynucleotide comprising a UTR sequence disclosed herein. In some embodiments, a UTR sequence is a core UTR sequence, a constant region sequence, or any other UTR sequence disclosed herein. In some embodiments, a polynucleotide is a RNA or a DNA. In some aspects, the disclosure providesa polynucleotide (e.g., an RNA) comprising a 3 untranslated region (3 UTR) comprising acore UTR sequence that is at least 90% identical (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or 100% identical) to any of SEQ ID NOs: 1-8, 96, 98-106, or 108-118. In some aspects, the disclosure providesa polynucleotide (e.g., an RNA) comprising a 5 untranslated region (5 UTR) comprising acore UTR sequence that is at least 90% identical (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or 100% identical) to any of SEQ ID NOs: 21-25, or 143-162. In some aspects, the disclosure provides apolynucleotide (e.g., an RNA) comprising: (a) a 3 UTR comprising a core UTR sequencethat is at least 90% identical (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or 100% identical) to any of SEQ IDNOs: 1-8, 96, 98-106, or 108-118; and (b) a 5 UTR comprising a core UTR sequence that isat least 90% identical (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or 100% identical) to any of SEQ ID NOs: 21- 25, or 143-162. Also provided herein are polynucleotides (e.g., DNA polynucleotides, such as DNA vectors) encoding any of the RNAs provided herein. In some aspects, provided herein Attorney Docket: GBB-01125 are lipid nanoparticles comprising any RNA disclosed herein or any DNA encoding any RNA disclosed herein. In some aspects, the disclosure provides a polynucleotide comprising a promoter sequence. In some aspects, the disclosure provides a polynucleotide comprising a promoter sequence disclosed herein. In some aspects, the disclosure provides a polynucleotide comprising a promoter sequence disclosed herein, wherein the promoter sequence is a core promoter sequence or an enhancer sequence. In some embodiments, a promoter sequence is a core promoter sequence. In some embodiments, a polynucleotide is a RNA or DNA. In some aspects, the disclosure provides a polynucleotide comprising a core promoter sequence that is at least 90% identical (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or 100% identical) to any of SEQ ID NOs: 33-37. In some aspects, the disclosure provides a polynucleotide comprising at least one sequence selected from SEQ ID NOs: 39-42. In some aspects, the present disclosure provides a polynucleotide comprising a core promoter sequence that is at least 90% identical (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or 100% identical) to any of SEQ ID NOs: 79-86. Also provided herein are polynucleotides operably linked to a sequence encoding any RNA disclosed herein. In some aspects, provided herein are AAV vectors comprising a DNA sequence encoding an RNA disclosed herein. Also provided herein is a method of expressing a polypeptide in a cell, wherein the method comprises the step of contacting the cell with a polynucleotide disclosed herein, or an AAV vector disclosed herein. Also provided herein is a method of expressing a polypeptide in a subject, wherein the method comprises the step of administering to the subject a polynucleotide disclosed herein, an AAV vector disclosed herein, or a cell disclosed herein. In some aspects, the disclosure provides a polynucleotide comprising: (a) a 3' untranslated region (3' UTR) sequence comprising a sequence (a core UTR sequence) that is at least 90% identical to any of SEQ ID NOs: 97 or 107; and (b) a heterologous polynucleotide. In some aspects, the disclosure provides a polynucleotide comprising: (a) a sequence (a Pol2 core promoter sequence) which is or comprises the sequence of any one of: SEQ ID NOs: 33, 34, 35, 36, or 37; and (b) a heterologous polynucleotide. Attorney Docket: GBB-01125 In some aspects, the disclosure provides a polynucleotide comprising: (a) a sequence (a Pol2 core promoter sequence) which has a sequence at least 90% identical to the sequence of any one of: SEQ ID NOs: 33, 34, or 35; and (b) a heterologous polynucleotide. Definitions For convenience, certain terms employed in the specification, examples, and appended claims are collected here. In this application, unless otherwise clear from context, (i) the term “or” may be understood to mean “and / or”; (ii) the terms “comprising” and “including" may be understood to encompass itemized components or steps whether presented by themselves or together with one or more additional components or steps; and (iv) where ranges are provided, endpoints are included. The term “amino acid” is intended to embrace molecules, whether natural or synthetic, which include both an amino functionality and an acid functionality and capable of being included in a polymer of amino acids. The terms “polynucleotide” and “nucleic acid” are used interchangeably. They refer to a polymeric form of nucleotides, either deoxyribonucleotides or ribonucleotides, or analogs thereof. The terms include single-stranded or double-stranded molecules comprised of nucleic acid bases. Polynucleotides may have any three-dimensional structure. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), circular RNA (circRNA), self-amplifying RNA (saRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. A polynucleotide may be further modified, such as by conjugation with a labeling component. While a provided nucleic acid sequence may be presented herein as a DNA or an RNA sequence, the disclosure is meant to encompass an RNA corresponding to a provided DNA sequence, and a DNA corresponding to a provided RNA sequence; and an RNA corresponding to a provided DNA, and a DNA corresponding to a provided RNA. Attorney Docket: GBB-01125 An “RNA polymerase III promoter” is a promoter that is recognized by an RNA polymerase III. RNA polymerase III initiates transcription of a polynucleotide within or downstream of an RNA polymerase III promoter. An “RNA polymerase II promoter” is a promoter that is recognized by an RNA polymerase II. RNA polymerase II initiates transcription of a polynucleotide within or downstream of an RNA polymerase II promoter. A “UTR” is an untranslated region of an RNA, wherein the RNA may or may not further comprise a translated region. If the UTR is positioned 3' to a translated region (or other untranslated region), it may be designated a “3' UTR” (or “3'-UTR”). If the UTR is positioned 5' to a translated region (or other untranslated region), it may be designated a “5' UTR” (or “5'-UTR”). In some embodiments, a 5' UTR is at the 5' end of a polynucleotide, and a 3' UTR is at the 3' end of a polynucleotide. A“5 UTR” is a 5 untranslated region of an RNA (e.g., an mRNA) that is positionedat the 5' end of the RNA and / or is directly upstream from (e.g., 5' to) an initiation codon, ifpresent. A 5 UTR typically begins at the transcription start site and ends with the nucleotide(nt) just before (e.g., 5' to) the initiation sequence (usually AUG) of a coding region. Incertain embodiments, the 5 UTRs provided herein can be present in non-coding RNAs to, forexample, increase their stability or alter their interactions with RNA binding proteins. A“3 UTR” is a 3 untranslated region of an RNA (e.g., an mRNA) that is positionedat the 3' end of the RNA and / or is directly downstream from (e.g., 3' to) a coding sequence (e.g., a coding segment), if present. In some embodiments, a 3' UTR can play a role in one ormore RNA-based processes, such as mRNA localization, mRNA stability, and translation. 3UTRs often immediately follow the translation termination codon in mRNA, if present. Inaddition, in some embodiments, 3 UTRs can establish 3 UTR-mediated protein–proteininteractions (PPIs), and thus can transmit genetic information encoded in 3 UTRs to proteins.In certain embodiments, the 3 UTRs provided herein can be present in non-coding RNAs to,for example, increase their stability. In addition, in some cases, a UTR does not need to be in its normal 3' or 5' position to retain some or all of a desired function. In some embodiments, a 3' UTR (e.g., a UTR shown to be functional when positioned at the 3' end of an RNA) may retain some or all of its function even if positioned at the 5' end or in the middle of the RNA. Similarly: In some embodiments, a 5' UTR (e.g., a UTR shown to be functional when positioned at the 5' end of Attorney Docket: GBB-01125 an RNA) may retain some or all of its function even if positioned at the 3' end or in the middle of the RNA. Sequences are “substantially identical” or “variants thereof” if they have a specified percentage of nucleic acid residues or amino acid residues that are the same (i.e., at least 60% identity, e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to a reference sequence over a specified region (or the whole reference sequence when not specified)), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using any sequence comparison algorithm known in the art (GAP, BESTFIT, BLAST, Align, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.), Karlin and Altschul Proc. Natl. Acad. Sci. (U.S.A.) 87:2264-2268 (1990) set to default settings, or by manual alignment and visual inspection (see, e.g., Ausubel et al., Current Protocols in Molecular Biology (1995-2014). Optionally, the identity exists over a region that is at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 200, 300, 400, 500, 600, 800, 1000, or more, nucleic acids in length, or any value there between, or over the full- length of the sequence. The term “therapeutic protein” or “therapeutic polypeptide” are interchangeable, and refer to a protein, a peptide, a polypeptide, or any fragment thereof that can provide a positive or advantageous effect on a condition or disease state of a subject when provided to the subject. For example, a therapeutic protein or polypeptide may have curative or palliative properties and may be administered to ameliorate, relieve, alleviate, reverse, delay onset of or lessen the severity of one or more symptoms of a disease, disorder, or condition. A therapeutic protein or polypeptide may be administered either directly or indirectly (e.g., through administration of a polynucleotide (e.g., an RNA) molecule encoding the therapeutic protein or polypeptide and / or administration of a DNA molecule encoding such an RNA molecule), to a subject in need thereof. In addition, a therapeutic protein or polypeptide will be considered therapeutic if administration of the protein is expected to delay or inhibit the progression of a disease state or condition. A therapeutic protein or polypeptide may have prophylactic properties and may be used to delay the onset of a disease. It can also include therapeutically active variants of a protein. Examples of therapeutically active proteins include, but are not limited to, immunoglobulins, cytokines, antigens for vaccination, growth factors, enzymes, hormones, inhibitors of cytokines, blood clotting factors, peptide growth, and differentiation factors. Additional, non-limiting examples of a therapeutic protein or Attorney Docket: GBB-01125 polypeptide, as herein used, may include antigens, epitopes, or any variations thereof. A therapeutic protein or polypeptide as disclosed herein, includes a protein or polypeptide with immunogenic properties. A therapeutic protein or polypeptide as disclosed herein may be included in a vaccine. Additional non-limiting examples of therapeutic protein or polypeptides are disclosed herein. As used herein, the term “operably linked” includes any nucleic acid sequence that is joined with a second nucleic acid sequence and is in a functional relationship with the second nucleic acid sequence. Elements need not be contiguous to be operably linked. For example, the term “operably linked,” when used in reference to a regulatory sequence and a coding sequence, means that the regulatory sequence can affect the expression of the linked coding sequence. As used herein, the term “regulatory element” refers to a nucleic acid sequence that has regulatory activity (e.g., one that has the ability to affect the transcription and / or stability of a polynucleotide molecule). Regulatory elements include, but are not limited to, promoters, core promoter regions, cis-elements, UTRs, enhancers, introns, and / or transcription termination regions. The term “core” or “core sequence” as used herein refers to a region of a polynucleotide (including but not limited to: a promoter core sequence, a UTR core sequence, a 5' UTR core sequence, and a 3' UTR core sequence), including but not limited to those labeled as such in Tables 1, 4A, 4B, 7A, 7B, or 11, and other sequences which have at least 80% identity to those labeled as such in Tables 1, 4A, 4B, 7A, 7B, or 11. Core sequences can be used in combination with other regulatory elements or sequences disclosed herein. The term “core UTR sequence” or “UTR core sequence” refers to a sequence in aUTR (a 5 UTR or a 3 UTR) that is at least 80% identical to any of the sequences in Tables 1,4A, or 4B. The term “core promoter sequence” or “promoter core sequence” refers to a sequence in a promoter that is at least 80% identical to any of the sequences in Tables 7A, 7B, or 11. As used herein, the term “motif cluster” refers to a nucleic acid sequence that contains multiple sequences that are recognized by one or more transcription factors. As used herein, the term “heterologous” as pertaining to a polynucleotide or sequence refers to a polynucleotide or sequence which is on or in the same polynucleotide or sequenceas another polynucleotide or sequence (e.g., a UTR or promoter) but which does not naturally Attorney Docket: GBB-01125 occur with the other polynucleotide or sequence (e.g., the UTR or promoter), or does not naturally occur in the arrangement in which it appears relative to the other polynucleotide(s) or sequence(s) (e.g., the UTR or promoter) and / or any other polynucleotide(s) or sequence(s) on the same polynucleotide or sequence.5 and 3 Untranslated RegionsProvided herein are 5 untranslated regions (5 UTRs) and 3 untranslated regions (3UTRs), as well as polynucleotides (e.g., RNAs) comprising such 5 and / or 3 UTRs. SuchUTRs may, in some embodiments, be involved in the regulation of protein expression at thepost-transcriptional level. In some embodiments, provided herein are 5 UTRs and 3 UTRsthat stabilize RNA and / or increase mRNA translation. Transcription is typically mediated by transcription factors, RNA polymerase and a series of cis-acting elements located in the DNA, such as promoters, enhancers, silencers and locus-control elements, organized in a modular structure and regulating the production of RNA molecules, which in eukaryotes undergo several steps of processing endogenously before they become functional mRNAs. In eukaryotes, introns, if present, are removed, a 7-methyl-guanylate (m7G) cap structure is added at the 5 end of the first exon, and a stretch of100-250 adenine residues (the poly(A) tail) is added at the 3 end of the last exon, which isitself generated by endonucleolytic cleavage of the primary transcript. Sometimes the sequence of the mRNA is also altered in a process called mRNA editing, and the resulting coding sequence of the mature RNA differs from the corresponding sequence in the genome.The resultant mature mRNA, in eukaryotes, has a structure that includes a 5 untranslatedregion (5 UTR), a coding region encoding a protein and a 3 untranslated region (3UTR). UTRs may have a role in, for example, the spatial control of gene expression at the post-transcriptional level, as well as mRNA stability. The asymmetric localization of some mRNAs leads to an asymmetry of cellular distribution of the encoded proteins; such a situation is clearly more efficient than other possible mechanisms of protein localization because the same mRNA molecule can serve as a template for multiple rounds of translation. In some embodiments, as described in more detail below, a 5' UTR or 3' UTR can comprise any of various components including: a core UTR sequence, and an optional constant region. In some embodiments, in a 5' UTR, a constant region is a 5' UTR constant region or a Kozak region. In some embodiments, in a 3' UTR, a constant region is a 3' UTR constant region. In some embodiments, a polynucleotide can comprise a 5' UTR and / or a 3' UTR and / or a promoter. Attorney Docket: GBB-011255 Untranslated RegionsIn some embodiments, a 5' UTR comprises: a core UTR sequence. In some embodiments, a 5' UTR comprises: a 5' UTR constant region; a core UTR sequence; and a Kozak constant region. In some embodiments, a 5' UTR comprises: a 5' UTR constant region; and a core UTR sequence. In some embodiments, a 5' UTR comprises: a core UTR sequence; and a Kozak constant region. In some embodiments, a 5' UTR comprises, in 5' to 3' order: a 5' UTR constant region; a core UTR sequence; and a Kozak constant region. In some embodiments, a 5' UTR comprises, in 5' to 3' order: a 5' UTR constant region; and a core UTR sequence. In some embodiments, a 5' UTR comprises, in 5' to 3' order: a core UTRsequence; and a Kozak constant region. In some embodiments, a 5' UTR constant region is 5UTR constant region 1 (SEQ ID NO: 26), or 5' UTR constant region 2 (SEQ ID NO: 163). In some embodiments, a Kozak constant region is a reported nucleic acid motif that functions as the protein translation initiation site in most eukaryotic mRNA transcripts. Kozak et al. 1989 J. Cell Biol. 108:229-241. In some embodiments, in a 5' UTR, the sequence of a core UTR sequence is or comprises any of: PB-CA-0134 (SEQ ID NO: 21), PB-CA-0135 (SEQ ID NO: 22), PB-CA- 0136 (SEQ ID NO: 23), PB-CA-0137 (SEQ ID NO: 24), PB-CA-0138 (SEQ ID NO: 25), PB-CA-0139 (SEQ ID NO: 143), PB-CA-0140 (SEQ ID NO: 144), PB-CA-0141 (SEQ ID NO: 145), PB-CA-0142 (SEQ ID NO: 146), PB-CA-0143 (SEQ ID NO: 147), PB-CA-0144 (SEQ ID NO: 148), PB-CA-0145 (SEQ ID NO: 149), PB-CA-0146 (SEQ ID NO: 150), PB- CA-0147 (SEQ ID NO: 151), PB-CA-0148 (SEQ ID NO: 152), PB-CA-0149 (SEQ ID NO: 153), PB-CA-0150 (SEQ ID NO: 154), PB-CA-0151 (SEQ ID NO: 155), PB-CA-0152 (SEQ ID NO: 156), PB-CA-0153 (SEQ ID NO: 157), PB-CA-0154 (SEQ ID NO: 158), PB-CA- 0155 (SEQ ID NO: 159), PB-CA-0156 (SEQ ID NO: 160), PB-CA-0157 (SEQ ID NO: 161), or PB-CA-0158 (SEQ ID NO: 162). In some embodiments, in a 5' UTR, the sequence of a core UTR sequence has at least 90% identity to the sequence of any of: PB-CA-0134 (SEQ ID NO: 21), PB-CA-0135 (SEQ ID NO: 22), PB-CA-0136 (SEQ ID NO: 23), PB-CA-0137 (SEQ ID NO: 24), PB-CA-0138 (SEQ ID NO: 25), PB-CA-0139 (SEQ ID NO: 143), PB-CA- 0140 (SEQ ID NO: 144), PB-CA-0141 (SEQ ID NO: 145), PB-CA-0142 (SEQ ID NO: 146), PB-CA-0143 (SEQ ID NO: 147), PB-CA-0144 (SEQ ID NO: 148), PB-CA-0145 (SEQ ID NO: 149), PB-CA-0146 (SEQ ID NO: 150), PB-CA-0147 (SEQ ID NO: 151), PB-CA-0148 (SEQ ID NO: 152), PB-CA-0149 (SEQ ID NO: 153), PB-CA-0150 (SEQ ID NO: 154), PB- Attorney Docket: GBB-01125 CA-0151 (SEQ ID NO: 155), PB-CA-0152 (SEQ ID NO: 156), PB-CA-0153 (SEQ ID NO: 157), PB-CA-0154 (SEQ ID NO: 158), PB-CA-0155 (SEQ ID NO: 159), PB-CA-0156 (SEQ ID NO: 160), PB-CA-0157 (SEQ ID NO: 161), or PB-CA-0158 (SEQ ID NO: 162). In some embodiments, the present disclosure provides a polynucleotide (e.g., anRNA) comprising a 5 UTR comprising a core UTR sequence that is at least 90% (e.g., atleast 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to any of SEQ ID NOs: 21-25, or 143-162 (SeeTable 1). In some embodiments, the 5 UTR comprises a core UTR sequence comprisingSEQ ID NO: 21. In some embodiments, the 5 UTR comprises a core UTR sequencecomprising SEQ ID NO: 22. In some embodiments, the 5 UTR comprises a core UTRsequence comprising SEQ ID NO: 23. In some embodiments, the 5 UTR comprises a coreUTR sequence comprising SEQ ID NO: 24. In some embodiments, the 5 UTR comprises acore UTR sequence comprising SEQ ID NO: 25. In some embodiments, the 5 UTRcomprises a core UTR sequence comprising SEQ ID NO: 143. In some embodiments, the 5UTR comprises a core UTR sequence comprising SEQ ID NO: 144. In some embodiments,the 5 UTR comprises a core UTR sequence comprising SEQ ID NO: 145. In someembodiments, the 5 UTR comprises a core UTR sequence comprising SEQ ID NO: 146. Insome embodiments, the 5 UTR comprises a core UTR sequence comprising SEQ ID NO:147. In some embodiments, the 5 UTR comprises a core UTR sequence comprising SEQ IDNO: 148. In some embodiments, the 5 UTR comprises a core UTR sequence comprisingSEQ ID NO: 149. In some embodiments, the 5 UTR comprises a core UTR sequencecomprising SEQ ID NO: 150. In some embodiments, the 5 UTR comprises a core UTRsequence comprising SEQ ID NO: 151. In some embodiments, the 5 UTR comprises a coreUTR sequence comprising SEQ ID NO: 152. In some embodiments, the 5 UTR comprises acore UTR sequence comprising SEQ ID NO: 153. In some embodiments, the 5 UTRcomprises a core UTR sequence comprising SEQ ID NO: 154. In some embodiments, the 5UTR comprises a core UTR sequence comprising SEQ ID NO: 155. In some embodiments,the 5 UTR comprises a core UTR sequence comprising SEQ ID NO: 156. In someembodiments, the 5 UTR comprises a core UTR sequence comprising SEQ ID NO: 157. Insome embodiments, the 5 UTR comprises a core UTR sequence comprising SEQ ID NO:158. In some embodiments, the 5 UTR comprises a core UTR sequence comprising SEQ IDNO: 159. In some embodiments, the 5 UTR comprises a core UTR sequence comprisingSEQ ID NO: 160. In some embodiments, the 5 UTR comprises a core UTR sequence Attorney Docket: GBB-01125comprising SEQ ID NO: 161. In some embodiments, the 5 UTR comprises a core UTRsequence comprising SEQ ID NO: 162. Non-limiting examples of the sequences of 5' UTR core sequences are presented in Table 1, below. In some embodiments, a 5 UTR comprises one or more constant regions.In some embodiments, a 5 UTR comprises one or more constant regionsindependently selected from: 5 UTR constant region 1 (SEQ ID NO: 26) and 5' UTRconstant region 2 (SEQ ID NO: 163); and Kozak constant region (SEQ ID NO: 27). In someembodiments, a 5 UTR comprises a constant region, wherein the sequence of the constantregion is or comprises the sequence of any of: 5 UTR constant region 1 (SEQ ID NO: 26)and 5' UTR constant region 2 (SEQ ID NO: 163); or Kozak constant region (SEQ ID NO:27). In some embodiments, a 5 UTR comprises a constant region, wherein the sequence ofthe constant region has at least 90% identity to the sequence of any of: 5 UTR constantregion 1 (SEQ ID NO: 26) and 5' UTR constant region 2 (SEQ ID NO: 163); or Kozak constant region (SEQ ID NO: 27). In some embodiments, a 5 UTR comprises a 5 constant region selected from 5 UTRconstant region 1 (SEQ ID NO: 26) and 5' UTR constant region 2 (SEQ ID NO: 163). In some embodiments, a 5 UTR comprises one or more constant regionsindependently selected from: 5 UTR constant region 1 (SEQ ID NO: 26) and 5' UTRconstant region 2 (SEQ ID NO: 163); and Kozak constant region (SEQ ID NO: 27). In some embodiments, a 5 UTR comprises: (1) one or more constant regionsindependently selected from: 5 UTR constant region 1 (SEQ ID NO: 26) and 5' UTRconstant region 2 (SEQ ID NO: 163); (2) a core UTR sequence; and (3) and Kozak constant region (SEQ ID NO: 27). In some embodiments, a 5 UTR comprises: (1) one or more constant regions, whereinthe sequence of the constant region is or comprises the sequence of 5 UTR constant region 1(SEQ ID NO: 26) or 5' UTR constant region 2 (SEQ ID NO: 163); (2) a core UTR sequence, wherein the sequence of the core UTR sequence is or comprises the sequence of any of SEQ ID NOs: 21-25, or 143-162; and (3) and a Kozak constant region, wherein the sequence of the Kozak constant region is or comprises the sequence of SEQ ID NO: 27. In some embodiments, a 5 UTR comprises: (1) one or more constant regions, whereinthe sequence of the constant region is at least 90% identical to the sequence of 5 UTRconstant region 1 (SEQ ID NO: 26) or 5' UTR constant region 2 (SEQ ID NO: 163); (2) a core UTR sequence, wherein the sequence of the core UTR sequence is at least 90% identical Attorney Docket: GBB-01125 to the sequence of any of SEQ ID NOs: 21-25, or 143-162; and (3) and a Kozak constant region, wherein the sequence of the Kozak constant region is at least 90% identical to that of SEQ ID NO: 27. In some embodiments, a 5 UTR comprises, in 5' to 3' order: (1) one or more constantregions, wherein the sequence of the constant region is at least 90% identical to the sequenceof 5 UTR constant region 1 (SEQ ID NO: 26) or 5' UTR constant region 2 (SEQ ID NO:163); (2) a core UTR sequence, wherein the sequence of the core UTR sequence is at least 90% identical to the sequence of any of SEQ ID NOs: 21-25, or 143-162; and (3) and a Kozak constant region, wherein the sequence of the Kozak constant region is at least 90% identical to that of SEQ ID NO: 27. In some embodiments, a 5 UTR comprises a 5 constant region sequence comprisingSEQ ID NO: 26 (See Table 2). In some embodiments, the 5 UTR comprises a Kozakconstant region sequence comprising SEQ ID NO: 27 (See Table 2). In some embodiments, a5 UTR comprises a constant region comprising SEQ ID NO: 27 (See Table 2). In someembodiments, the 5 UTR comprises at least two guanine nucleotides between the core UTRsequence and the 3 constant region sequence.In some embodiments, in a 5' UTR, a constant region is any of: 5 UTR constantregion 1 (SEQ ID NO: 26), 5' UTR constant region 2 (SEQ ID NO: 163), or Kozak constant region (SEQ ID NO: 27). In some embodiments, in a 5' UTR, the sequence of a constantregion is or comprises the sequence of any of: 5 UTR constant region 1 (SEQ ID NO: 26), 5'UTR constant region 2 (SEQ ID NO: 163), or Kozak constant region (SEQ ID NO: 27). In some embodiments, in a 5' UTR, the sequence of a constant region has 90% identity to thesequence of any of: 5 UTR constant region 1 (SEQ ID NO: 26), 5' UTR constant region 2(SEQ ID NO: 163), or Kozak constant region (SEQ ID NO: 27). In some embodiments, the 5UTR comprises a 5 constant region sequence comprising SEQ ID NO: 26. In someembodiments, the 5 UTR comprises a Kozak constant region sequence comprising SEQ IDNO: 27. In some embodiments, the 5 UTR comprises at least two guanine nucleotidesbetween the core UTR sequence and the Kozak constant region sequence. Non-limiting examples of the sequences of 5' UTR constant regions are presented in Table 2, below. In some embodiments, the polynucleotide (e.g., RNA) comprising the 5 UTRcomprises a sequence that is at least 90 % (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%)identical to SEQ ID NO: 28-32 or 164-183 (See Table 3). In some embodiments, the 5 UTR Attorney Docket: GBB-01125comprises SEQ ID NO: 28. In some embodiments, the 5 UTR comprises SEQ ID NO: 29. Insome embodiments, the 5 UTR comprises SEQ ID NO: 30. In some embodiments, the 5UTR comprises SEQ ID NO: 31. In some embodiments, the 5 UTR comprises SEQ ID NO:32. In some embodiments, the 5 UTR comprises SEQ ID NO: 164. In some embodiments,the 5 UTR comprises SEQ ID NO: 165. In some embodiments, the 5 UTR comprises SEQID NO: 166. In some embodiments, the 5 UTR comprises SEQ ID NO: 167. In someembodiments, the 5 UTR comprises SEQ ID NO: 168. In some embodiments, the 5 UTRcomprises SEQ ID NO: 169. In some embodiments, the 5 UTR comprises SEQ ID NO: 170.In some embodiments, the 5 UTR comprises SEQ ID NO: 171. In some embodiments, the 5UTR comprises SEQ ID NO: 172. In some embodiments, the 5 UTR comprises SEQ ID NO:173. In some embodiments, the 5 UTR comprises SEQ ID NO: 174. In some embodiments,the 5 UTR comprises SEQ ID NO: 175. In some embodiments, the 5 UTR comprises SEQID NO: 176. In some embodiments, the 5 UTR comprises SEQ ID NO: 177. In someembodiments, the 5 UTR comprises SEQ ID NO: 178. In some embodiments, the 5 UTRcomprises SEQ ID NO: 179. In some embodiments, the 5 UTR comprises SEQ ID NO: 180.In some embodiments, the 5 UTR comprises SEQ ID NO: 181. In some embodiments, the 5UTR comprises SEQ ID NO: 182. In some embodiments, the 5 UTR comprises SEQ ID NO:183. Non-limiting examples of the sequences of 5' UTRs are presented in Table 3, below. In some embodiments, the present disclosure provides a polynucleotide encoding an RNA as set forth herein. In some embodiments, the polynucleotide is an expression vector.Table 1. Example 5 UTR Core SequencesC Se PB-CA-0140 TATACGCGTGCCCTGCAAAAGTGTTATCCCTATATCCGCGAGT 144 Attorney Docket: GBB-01125 TGCAGTA CTCAAGA Attorney Docket: GBB-01125 In this disclosure and the accompanying figures, the full sequence name may be abbreviated, removing the “PB-” prefix, punctuation, and one or more placeholder zeros; thus PB-CA-0134 is also designated “CA134”; PB-CA-0138 is also designated “CA138”; etc.Table 2. Additional Example 5 UTR SequencesAdditional Example 5 UTRSequence SEQ ID Se Table 3. Example 5 UTR SequencesSe D(5P(5P(5P(5P(5P(5 CGAGTTGCAGTAGCCACC Attorney Docket: GBB-01125(5 constant region 2(5(5(5(5(((((( CCACTGCGTGCGGCCACC Attorney Docket: GBB-01125 (5 constant region(((((5-P (( In various embodiments, one or more linkers and / or one or more adapters and / or one or more additional sequences can be interposed between any two components of a 5' UTR, or 5' or 3' to any component of a 5' UTR, wherein a component of a 5' UTR is a UTR core sequence or a 5' UTR constant region. In some embodiments, a linker, an adapter or an additional sequence is a portion of a polynucleotide that connects two other portions of a polynucleotide (e.g., a component such as a constant region, a UTR core sequence, a promoter core region, or a coding sequence, etc.) and can optionally but does not necessarily have a specific biological activity. In some cases the length of the linker, adapter or additional sequence can affect the spacing between biological entities such as proteins or protein-comprising complexes bound to two Attorney Docket: GBB-01125 components such as a constant region and a 5' UTR core sequence. In some embodiments, an adapter can optionally but does not necessarily have a specific biological activity, but can optionally comprise a sequence useful for molecular biology, e.g., a sequence that facilitates construction of a sequence library, and / or a sequence which is complementary to another sequence in the polynucleotide backbone and thus can facilitate cloning. In some embodiments, an additional sequence can optionally but does not necessarily have a specific biological activity, for example, acting as an origin of replication or selectable marker. Various linker, adapter and additional sequences are known to one of ordinary skill in the art. As non-limiting examples: In some embodiments, a 5' UTR comprises, in 5' to 3' order: additional sequence-5' UTR constant region-additional sequence-core UTR-additional sequence; adapter-5' UTR constant region-core UTR-Kozak constant region; 5' UTR constant region-core UTR-adapter; adapter-core UTR-Kozak constant region; Linker-5' UTR constant region-core UTR-Kozak constant region; 5' UTR constant region-core UTR-Linker; Linker-core UTR-Kozak constant region; additional sequence-5' UTR constant region-core UTR-Kozak constant region; 5' UTR constant region-core UTR-additional sequence; additional sequence-core UTR-Kozak constant region; adapter-5' UTR constant region-core UTR-Kozak constant region; 5' UTR constant region-Linker-core UTR-adapter; adapter-core UTR-Kozak constant region; Linker-5' UTR constant region-core UTR-Kozak constant region; adapter-5' UTR constant region-core UTR-Linker; Linker-core UTR-Kozak constant region; additional sequence-5' UTR constant region-core UTR-Kozak constant region; 5' UTR constant region-Linker-core UTR-adapter-additional sequence; or additional sequence- core UTR-Kozak constant region. In some embodiments, the polynucleotide comprising a 5 UTR does not comprise atranslated region. In some embodiments, the polynucleotide comprising a 5 UTR comprises atranslated region. In some embodiments, the UTR is a 5 UTR that is positioned 5 to thetranslated region. In some embodiments, the translated region encodes a therapeutic protein. In some embodiments, the polynucleotide is an RNA. In some embodiments, thepolynucleotide comprising a 5 UTR is an mRNA, circRNA, or a saRNA. In someembodiments, the polynucleotide comprising a 5 UTR comprises or encodes a gRNA, asgRNA, an RNAi, a tRNA, an rRNA, a snRNA or a snoRNA. In some embodiments, the polynucleotide comprises an additional UTR. In someembodiments, the additional UTR is positioned 3 to the translated region. In someembodiments, the additional UTR is positioned 5 to the translated region. Attorney Docket: GBB-01125 In some embodiments, a polynucleotide comprises, in 5' to 3' order: (1) a 5' UTR, (2) a promoter, (3) a coding sequence, and (4) a 3' UTR. 3' UTR sequences In some embodiments, a 3' UTR comprises: a core UTR sequence. In some embodiments, a 3' UTR comprises: a core UTR sequence; and 3' constant region. In some embodiments, a 3' UTR comprises: a first core UTR sequence; a second core UTR sequence; and 3' constant region, wherein the first and second core UTR sequences can be the same or different. In some embodiments, a 3' UTR comprises, in 5' to 3' order: a core UTR sequence; and 3' constant region. In some embodiments, a 3' UTR comprises, in 5' to 3' order: a first core UTR sequence; a second core UTR sequence, in 5' to 3' order; and 3' constant region, wherein the first and second core UTR sequences can be the same or different. In some embodiments, the present disclosure provides a polynucleotide (e.g., anRNA) comprising a 3 UTR comprising a core UTR sequence that is at least 90% (e.g., atleast 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to any of SEQ ID NOs: 1-8, 96, 98-106, or 108-118 (see Table 4A). In some embodiments, the 3 UTR comprises a core UTR sequencecomprising SEQ ID NO: 1. In some embodiments, the 3 UTR comprises a core UTRsequence comprising SEQ ID NO: 2. In some embodiments, the 3 UTR comprises a coreUTR sequence comprising SEQ ID NO: 3. In some embodiments, the 3 UTR comprises acore UTR sequence comprising SEQ ID NO: 4. In some embodiments, the 3 UTR comprisesa core UTR sequence comprising SEQ ID NO: 5. In some embodiments, the 3 UTRcomprises a core UTR sequence comprising SEQ ID NO: 6. In some embodiments, the 3UTR comprises a core UTR sequence comprising SEQ ID NO: 7. In some embodiments, the3 UTR comprises a core UTR sequence comprising SEQ ID NO: 8. In some embodiments,the 3 UTR comprises a core UTR sequence comprising SEQ ID NO: 96. In someembodiments, the 3 UTR comprises a core UTR sequence comprising SEQ ID NO: 98. Insome embodiments, the 3 UTR comprises a core UTR sequence comprising SEQ ID NO: 99.In some embodiments, the 3 UTR comprises a core UTR sequence comprising SEQ ID NO:100. In some embodiments, the 3 UTR comprises a core UTR sequence comprising SEQ IDNO: 101. In some embodiments, the 3 UTR comprises a core UTR sequence comprisingSEQ ID NO: 102. In some embodiments, the 3 UTR comprises a core UTR sequencecomprising SEQ ID NO: 103. In some embodiments, the 3 UTR comprises a core UTR Attorney Docket: GBB-01125sequence comprising SEQ ID NO: 104. In some embodiments, the 3 UTR comprises a coreUTR sequence comprising SEQ ID NO: 105. In some embodiments, the 3 UTR comprises acore UTR sequence comprising SEQ ID NO: 106. In some embodiments, the 3 UTRcomprises a core UTR sequence comprising SEQ ID NO: 108. In some embodiments, the 3UTR comprises a core UTR sequence comprising SEQ ID NO: 109. In some embodiments,the 3 UTR comprises a core UTR sequence comprising SEQ ID NO: 110. In someembodiments, the 3 UTR comprises a core UTR sequence comprising SEQ ID NO: 111. Insome embodiments, the 3 UTR comprises a core UTR sequence comprising SEQ ID NO:112. In some embodiments, the 3 UTR comprises a core UTR sequence comprising SEQ IDNO: 113. In some embodiments, the 3 UTR comprises a core UTR sequence comprisingSEQ ID NO: 114. In some embodiments, the 3 UTR comprises a core UTR sequencecomprising SEQ ID NO: 115. In some embodiments, the 3 UTR comprises a core UTRsequence comprising SEQ ID NO: 116. In some embodiments, the 3 UTR comprises a coreUTR sequence comprising SEQ ID NO: 117. In some embodiments, the 3 UTR comprises acore UTR sequence comprising SEQ ID NO: 118. Non-limiting examples of 3' UTR core sequences are presented in Table 4A. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 1. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 2. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 3. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 4. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 5. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 6. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 7. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 8. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 96. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 97. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 98. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 99. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 100. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 101. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 102. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 103. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID Attorney Docket: GBB-01125 NO: 104. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 105. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 106. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 107. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 108. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 109. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 110. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 111. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 112. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 113. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 114. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 115. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 116. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 117. In some embodiments, a polynucleotide comprises a sequence comprising SEQ ID NO: 118. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 1. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 2. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 3. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 4. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 5. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 6. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 7. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 8. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 96. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 97. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 98. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 99. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 100. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 101. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 102. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 103. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 104. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 105. In some Attorney Docket: GBB-01125 embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 106. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 107. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 108. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 109. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 110. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 111. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 112. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 113. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 114. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 115. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 116. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 117. In some embodiments, a polynucleotide comprises a sequence which is SEQ ID NO: 118. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 1. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 2. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 3. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 4. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 5. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 6. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 7. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 8. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 96. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 97. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 98. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 99. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 100. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 101. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 102. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to Attorney Docket: GBB-01125 SEQ ID NO: 103. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 104. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 105. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 106. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 107. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 108. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 109. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 110. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 111. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 112. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 113. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 114. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 115. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 116. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 117. In some embodiments, a polynucleotide comprises a sequence which is at least 90% identical to SEQ ID NO: 118. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 1; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 2; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 3; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 4; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 5; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 6; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 7; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 8; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 96; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a Attorney Docket: GBB-01125 sequence comprising SEQ ID NO: 97; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 98; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 99; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 100; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 101; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 102; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 103; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 104; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 105; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 106; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 107; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 108; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 109; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 110; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 111; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 112; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 113; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 114; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 115; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 116; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 117; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence comprising SEQ ID NO: 118; and (2) a heterologous polynucleotide. Attorney Docket: GBB-01125 In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 1; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 2; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 3; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 4; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 5; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 6; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 7; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 8; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 96; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 97; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 98; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 99; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 100; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 101; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 102; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 103; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 104; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 105; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 106; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 107; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 108; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 109; and (2) a heterologous polynucleotide. In some Attorney Docket: GBB-01125 embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 110; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 111; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 112; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 113; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 114; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 115; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 116; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 117; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is SEQ ID NO: 118; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 1; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 2; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 3; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 4; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 5; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 6; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 7; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 8; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 96; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 97; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 98; Attorney Docket: GBB-01125 and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 99; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 100; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 101; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 102; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 103; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 104; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 105; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 106; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 107; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 108; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 109; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 110; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 111; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 112; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 113; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 114; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 115; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 116; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to Attorney Docket: GBB-01125 SEQ ID NO: 117; and (2) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (1) a sequence which is at least 90% identical to SEQ ID NO: 118; and (2) a heterologous polynucleotide. In some embodiments, the present disclosure provides a polynucleotide (e.g., anRNA) comprising: (a) a 3 UTR comprising a core UTR sequence that is at least 90% (e.g., atleast 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to any of SEQ ID NOs: 97 or 107 (see Table 4B); and (b) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (a) a 3 UTR which comprises acore UTR sequence comprising SEQ ID NO: 97; and (b) a heterologous polynucleotide. Insome embodiments, a polynucleotide comprises: (a) a 3 UTR which comprises a core UTRsequence comprising SEQ ID NO: 107; and (b) a heterologous polynucleotide. In some embodiments, the 3 UTR comprises a 3' constant region.In some embodiments, the 3 UTR comprises a core UTR sequence and a 3' constantregion. In some embodiments, the 3 UTR comprises a 3 constant region positioned 3 to thecore UTR sequence. In some embodiments, the sequence of the 3' constant region is or comprises SEQ ID NO: 9 (See Table 5). In some embodiments, the 3' constant region has no more than 5, no more than four, no more than three, no more than two, or no more than 1 mismatch from SEQ ID NO: 9. A non-limiting example of a 3' constant regions is presented in Table 5. In some embodiments, the 3 UTR comprises a 3' constant region and / or apolyadenylation sequence (designated a polyA, poly-A, or poly(A) sequence) positioned 3 ofthe core UTR sequence. Various polyadenylation sequences are widely known in the art. In some embodiments, the 3 UTR comprises a core UTR sequence, a 3' constantregion, and a polyadenylation sequence. In some embodiments, the 3 UTR comprises a firstcore UTR sequence, a second core UTR sequence, a 3' constant region, and a polyadenylation sequence, wherein the first and second core UTR sequences are the same or different. In some embodiments, the polynucleotide (e.g., RNA) comprising the 3 UTRcomprises a sequence that is at least 90 % (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%)identical to SEQ ID NO: 13-20, or 119-142 (See Table 6). In some embodiments, the 3 UTRcomprises SEQ ID NO: 13. In some embodiments, the 3 UTR comprises SEQ ID NO: 14. Insome embodiments, the 3 UTR comprises SEQ ID NO: 15. In some embodiments, the 3 Attorney Docket: GBB-01125UTR comprises SEQ ID NO: 16. In some embodiments, the 3 UTR comprises SEQ ID NO:17. In some embodiments, the 3 UTR comprises SEQ ID NO: 18. In some embodiments, the3 UTR comprises SEQ ID NO: 19. In some embodiments, the 3 UTR comprises SEQ IDNO: 20. In some embodiments, the 3 UTR comprises SEQ ID NO: 119. In someembodiments, the 3 UTR comprises SEQ ID NO: 120. In some embodiments, the 3 UTRcomprises SEQ ID NO: 121. In some embodiments, the 3 UTR comprises SEQ ID NO: 122.In some embodiments, the 3 UTR comprises SEQ ID NO: 123. In some embodiments, the 3UTR comprises SEQ ID NO: 124. In some embodiments, the 3 UTR comprises SEQ ID NO:125. In some embodiments, the 3 UTR comprises SEQ ID NO: 126. In some embodiments,the 3 UTR comprises SEQ ID NO: 127. In some embodiments, the 3 UTR comprises SEQID NO: 128. In some embodiments, the 3 UTR comprises SEQ ID NO: 129. In someembodiments, the 3 UTR comprises SEQ ID NO: 130. In some embodiments, the 3 UTRcomprises SEQ ID NO: 131. In some embodiments, the 3 UTR comprises SEQ ID NO: 132.In some embodiments, the 3 UTR comprises SEQ ID NO: 133. In some embodiments, the 3UTR comprises SEQ ID NO: 134. In some embodiments, the 3 UTR comprises SEQ ID NO:135. In some embodiments, the 3 UTR comprises SEQ ID NO: 136. In some embodiments,the 3 UTR comprises SEQ ID NO: 137. In some embodiments, the 3 UTR comprises SEQID NO: 138. In some embodiments, the 3 UTR comprises SEQ ID NO: 139. In someembodiments, the 3 UTR comprises SEQ ID NO: 140. In some embodiments, the 3 UTRcomprises SEQ ID NO: 141. In some embodiments, the 3 UTR comprises SEQ ID NO: 142.Non-limiting examples of 3' UTR sequences are presented in Table 6. In some embodiments, the 3 UTR sequence comprises a first adapter sequencepositioned 3 to the core UTR sequence. In some embodiments, the 3 UTR comprises a firstadapter sequence positioned between the core UTR sequence and the 3' constant region. In some embodiments, the first adapter sequence is at least 80% identical to SEQ ID NO: 11. In some embodiments, the first adapter sequence is at least 90% identical to SEQ ID NO: 11. In some embodiments, the first adapter sequence is SEQ ID NO: 11 (see Table 5). In some embodiments, the first adapter sequence comprises SEQ ID NO: 11, but with up to three nucleotide mismatches. In some embodiments, the first adapter sequence comprises SEQ ID NO: 11, but with up to two nucleotide mismatches. In some embodiments, the first adapter sequence comprises SEQ ID NO: 11, but with zero or one nucleotide mismatch. Attorney Docket: GBB-01125 In some embodiments, the 3 UTR comprises a linker sequence positioned betweenthe first adapter sequence and the 3' constant region. In some embodiments, the linker sequence is SEQ ID NO: 12 (See Table 5). In some embodiments, the 3 UTR comprises a second adapter sequence positioned 5to the core UTR sequence. In some embodiments, the 3 UTR comprises a second adaptersequence positioned 5 of the core UTR sequence. In some embodiments, the second adaptersequence is at least 80% identical to SEQ ID NO: ID NO: 10. In some embodiments, the second adapter sequence is at least 90% identical to SEQ ID NO: ID NO: 10. In some embodiments, the second adapter sequence is SEQ ID NO: ID NO: 10 (See Table 5). In some embodiments, the first adapter sequence comprises SEQ ID NO: 10, but with up to three nucleotide mismatches. In some embodiments, the first adapter sequence comprises SEQ ID NO: 10, but with up to two nucleotide mismatches. In some embodiments, the first adapter sequence comprises SEQ ID NO: 10, but with zero or one nucleotide mismatch. As non-limiting examples: In some embodiments, a 3' UTR comprises, in 5' to 3' order: additional sequence-core UTR sequence-additional sequence-3' constant region- additional sequence-polyA sequence; additional sequence-core UTR sequence-additional sequence-core UTR sequence-additional sequence-3' constant region-additional sequence- polyA sequence; core UTR sequence-3' constant region-polyA sequence-additional sequence; linker-core UTR sequence-3' constant region-polyA sequence; linker-core UTR sequence- core UTR sequence-3' constant region-polyA sequence; adapter-core UTR sequence-3' constant region-polyA sequence; adapter-core UTR sequence-core UTR sequence-3' constant region-polyA sequence; additional sequence-core UTR sequence-3' constant region-polyA sequence; additional sequence-core UTR sequence-core UTR sequence-3' constant region- polyA sequence; linker-core UTR sequence-3' constant region-polyA sequence; adapter-core UTR sequence-core UTR sequence-3' constant region-polyA sequence; linker-core UTR sequence-3' constant region-adapter-polyA sequence; linker-core UTR sequence-additional sequence-core UTR sequence-adapter-3' constant region-polyA sequence; adapter-core UTR sequence-linker-3' constant region-polyA sequence; adapter-core UTR sequence-linker-core UTR sequence-3' constant region-polyA sequence; additional sequence-core UTR sequence- 3' constant region-polyA sequence; additional sequence-core UTR sequence-core UTR sequence-adapter-linker-3' constant region-polyA sequence; linker-core UTR sequence-3' constant region-polyA sequence; or Adapter-core UTR sequence-core UTR sequence-3' Attorney Docket: GBB-01125 constant region-polyA sequence. Non-limiting examples of adapter and linker sequences are presented in Table 5. In some embodiments, the polynucleotide comprising a 3 UTR does not comprise atranslated region (e.g., a coding sequence). In some embodiments, the polynucleotidecomprising a 3 UTR comprises a translated region. In some embodiments, the 3 UTR ispositioned 3 to the translated region. In some embodiments, the translated region encodes atherapeutic protein.Table 4A. Example 3 UTR Core SequencesCore UTR Se uence SEQ ID Se PB-CA-0159 GGGCATTGCCACGGGCCAGTTAGGGGTAGGCAGCTTTTTCGC 96 Attorney Docket: GBB-01125 TTTCCCCCTCCCTATTGCCAAGGACCGGCTCATCGCCTTCCTC CT Attorney Docket: GBB-01125 CCATTTAAGTGTGCTGCCAGGCCTTGCCCGCTGCTGGACAGG T Attorney Docket: GBB-01125Table 4B. Additional Example 3 UTR Core SequencesCore UTR Sequence SEQ ID Se Table 5. Additional Example 3 UTR SequencesAdD Se AdB: Adapter BTable 6: Example 3 UTR SequencesSe D AGGCTGGCCACGGAGGCTACTATTTCTTCCCTGACCTCCCCCC Attorney Docket: GBB-01125 AAAATTACATGGAGGCACTGCGGCTCCTGCAAACGCCTAATA CGTTTTGAGCTGCCTTGCCAAGGGCCCGCTGCTGGACAGGGG Attorney Docket: GBB-01125 CTCGGCTTGGCTCCTCACTGCGGCTCCTGCAAACGCCTAATAA GATACGCTGCCGCCACCACCGGCTCACACCCTTGCCCGCTGCT Attorney Docket: GBB-01125 GGACAGGGGCTCGGCTGTGATGCCTGAAACATCAAAATCAAC PB-TC-0112 CAGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGATGG 141 Attorney Docket: GBB-01125 CCACTGACAATTCCGTGGGTTATCTTGCTTCGGTACCACGCTT In this disclosure and the accompanying figures, the sequence name may be abbreviated, removing the “PB-” prefix, punctuation, and placeholder zeros; thus PB-TC- 0008 is also designated “TC8”; PB-TC-0011 is also designated “TC11”; etc. In some embodiments, the coding sequence encodes a therapeutic protein or polypeptide, such as an immunoglobulin, or an antibody or a fragment thereof. In some embodiments, the protein coding sequence encodes a protein or polypeptide of eukaryotic or prokaryotic origin. In some embodiments, the protein coding sequence encodes a human protein. In some embodiments, the protein coding sequence encodes a non-human protein. In some embodiments, the protein coding sequence encodes one or more antibodies or fragments thereof. For example, in some embodiments, the protein coding sequence encodes human antibodies of fragments thereof. The term “antibody” as used herein includes whole antibodies and any antigen binding fragments (i.e., “antigen-binding portions”) or single chains thereof. An “antibody” refers, in one embodiment, to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds, or an antigen binding portion thereof. Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. In certain naturally occurring antibodies, the heavy chain constant region is comprised of three domains, CH1, CH2 and CH3. In certain naturally occurring antibodies, each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region is comprised of one domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The Attorney Docket: GBB-01125 constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system. Antibodies typically bind specifically to their cognate antigen with high affinity, reflected by a dissociation constant (KD) of 105to 1011M or less. Any KD greater than about 104M is generally considered to indicate nonspecific binding. As used herein, an antibody that "binds specifically" to an antigen refers to an antibody that binds to the antigen and substantially identical antigens with high affinity, which means having a KD of 107M or less, preferably 108M or less, even more preferably 5 x 109M or less, and most preferably between 108M and 1010M or less, but does not bind with high affinity to unrelated antigens. An antigen is "substantially identical" to a given antigen if it exhibits a high degree of sequence identity to the given antigen, for example, if it exhibits at least 80%, at least 90%, preferably at least 95%, more preferably at least 97%, or even more preferably at least 99% sequence identity to the sequence of the given antigen. In some embodiments, the antibody may be a nanobody. Nanobodies are the recombinant variable domains of heavy-chain-only antibodies. In some embodiments, the coding sequence encodes an intrabody, or an antigen binding fragment thereof. In another embodiment, the intrabody, or antigen binding fragment thereof, is a murine, chimeric, humanized, composite, or human intrabody, or antigen binding fragment thereof. In another embodiment, the intrabody, or antigen binding fragment thereof, is detectably labeled, comprises an effector domain, comprises an Fc domain, and / or is selected from the groupconsisting of Fv, Fav, F(ab )2, Fab , dsFv, scFv, sc(Fv)2, and diabody fragments.In some embodiments, the polynucleotide is an mRNA, such as an mRNA therapeutic. As an example, the mRNA therapeutic may be mRNA included in a vaccine. In some embodiments, an RNA vaccine comprising messenger RNA (mRNA) can safely direct the body's cellular machinery to produce a disease-associated protein or a fragment thereof or a non-disease-causing variant thereof, to generate an immunogenic response. In some embodiments, a disease-associated protein can be a protein associated with a disease-related vector (e.g., a virus or bacterium) which is itself insufficient to mediate disease, but is sufficient to provoke an immune response to the protein (and thus to the entire active disease vector) that may be sufficient to prevent, treat or ameliorate the disease. In some embodiments, a disease-related vector is a virus. In some embodiments, the virus is SARS-CoV-2 (the causative agent of COVID-19) and the disease-associated protein is a Attorney Docket: GBB-01125 variant of a SARS-CoV-2 spike protein. The mRNA vaccines disclosed herein may be used to induce an immune response against any disease or disorder, comprising both cellular and humoral immunity. The RNA vaccines may be utilized in various settings depending on the prevalence of the disease. For example, the mRNA may encode a cancer antigen and therefore can be used as a cancer vaccine. In some embodiments, the mRNA vaccine may encode for viral protein or antigen to be included in a vaccine. In other embodiments, the vaccine comprises an mRNA encoding one or more antigens. In some embodiments, the mRNA encodes the at least two antigens. In other embodiments, the mRNA encodes a plurality of antigens. The polynucleotide (e.g., RNA) disclosed herein may comprise an mRNA that encodes a gene editing tool of a gene editing system. As used herein, the term “genome editing tool” is any component of “genome editing system” necessary or helpful for producing an edit in the genome of a cell. In some embodiments, the present disclosure provides for methods of delivering genome editing tools of a genome editing system (for example a zinc finger nuclease system, a TALEN system, a meganuclease system or a CRISPR / Cas system (Clustered modulated short palindromic repeats CRISPR-associated Cas9)) to a cell (or population of cells). Additional genome editing systems include CRISPR- Cas9 gene editing, CRISPR-Cas12, CRISPR-Cas13, CRISPRi, CRISPRa, and CRISPR-based epigenome editing. The CRISPR-Cas9 system uses an endonuclease that can be used for site-directed editing of various complex genomes, similarly to zinc finger endonucleases (ZFNs) and transcription activator-like effector nucleases (TALENs). The CRISPR / Cas9 vector after being modified is formed by combining a gRNA serving as a guide sequence with edited DNA in a base complementary pairing mode, so that the off-target probability is greatly reduced, and then Cas9 protein carried by a hairpin structure of the gRNA recognizes a corresponding base sequence under the action of PAM, so that double-stranded or single- stranded DNA is cut. Genome editing tools include, for example, nucleases capable of making single- or double-stranded break in the DNA or RNA of a cell, e.g., in the genome of a cell. The genome editing tools, e.g., nucleases, may optionally modify the genome of a cell without cleaving the nucleic acid, or nickases. A genome editing nuclease or nickase may be encoded by an mRNA. Such nucleases include, for example, RNA-guided DNA binding agents, and CRISPR / Cas components. In some embodiments, the nuclease is a Cas9 enzyme. In some Attorney Docket: GBB-01125 embodiments, the Cas9 enzyme is S. pneumoniae, S. pyogenes, or S. pneumoniae. S. thermophilus Cas9 and may contain mutated Cas9 from those organisms. Enzymes can be Cas9 homologs or orthologs. In some embodiments, the nuclease is a Cas12 nuclease, and the Cas12 nuclease is a Cas12a, Cas12b, Cas12c, CasY, or Cas12e. Enzymes can be Cas12 homologs or orthologs. In some embodiments, the nuclease is a Cas13 nuclease, Genome editing tools include fusion proteins, including, e.g., a nickase fused to an effector domain such as an editor domain. The polynucleotide (e.g., RNA) disclosed herein may comprise an RNA component of a gene editing system. RNA components include any item necessary or helpful for accomplishing the goal of a genome edit, such as, for example, gRNA (guide RNA), sgRNA (single guide RNA), dgRNA (dual guide RNA), and the like. In some embodiments, the RNA is a guide RNA. guide RNA is a specific RNA sequence that recognizes the target DNA region of interest and directs the Cas nuclease there for editing. The gRNA is made up of two parts: crispr RNA (crRNA), a nucleotide sequence complementary to the target DNA, and a tracr RNA, which serves as a binding scaffold for the Cas nuclease. In some embodiments, the RNA is a single guide RNA. sgRNA is a single RNA molecule that contains both the designed short crRNA sequence fused to the scaffold tracrRNA sequence. sgRNA can be synthetically generated or made in vitro. In some embodiments, the polynucleotide (e.g., RNA) may further comprise a poly-A tail. In one embodiment, the nucleic acid molecule disclosed herein further comprises a nucleic acid sequence which, when transcribed under the control of the promoter, codes for a nucleic acid sequence which is a polyadenyl sequence optionally comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides. In some embodiments, the polynucleotide (e.g., RNA) disclosed herein may be an RNAi agent. RNAi agents and “interfering nucleic acids” are herein used interchangeably. The RNAi agent may be a siRNA, shRNA, miRNA, or a peptide nucleic acid. RNAi agents, or interfering nucleic acids, generally include a sequence of cyclic subunits, each bearing a base-pairing moiety, linked by intersubunit linkages that allow the base-pairing moieties to hybridize to a target sequence in a nucleic acid (typically an RNA) by Watson-Crick base pairing, to form a nucleic acid:oligomer heteroduplex within the target sequence. Interfering RNA molecules include, but are not limited to, antisense molecules, siRNA molecules, single-stranded siRNA molecules, miRNA molecules and shRNA molecules. Attorney Docket: GBB-01125 Interfering nucleic acid molecules provided herein can contain RNA bases, non-RNA bases or a mixture of RNA bases and non-RNA bases. For example, interfering nucleic acid molecules provided herein can be primarily composed of RNA bases but also contain DNA bases or non-naturally occurring nucleotides. The interfering nucleic acids can employ a variety of oligonucleotide chemistries. Examples of oligonucleotide chemistries include, without limitation, peptide nucleic acid(PNA), linked nucleic acid (LNA), phosphorothioate, 2 O-Me-modified oligonucleotides, andmorpholino chemistries, including combinations of any of the foregoing. In general, PNA and LNA chemistries can utilize shorter targeting sequences because of their relatively high targetbinding strength relative to 2 O-Me oligonucleotides. Phosphorothioate and 2 O-Me-modifiedchemistries are often combined to generate 2 O-Me-modified oligonucleotides having aphosphorothioate backbone. See, e.g., PCT Publication Nos. WO / 2013 / 112053 and WO / 2009 / 008725, incorporated by reference in their entireties. Peptide nucleic acids (PNAs) are analogs of DNA in which the backbone is structurally homomorphous with a deoxyribose backbone, consisting of N-(2-aminoethyl) glycine units to which pyrimidine or purine bases are attached. PNAs containing natural pyrimidine and purine bases hybridize to complementary oligonucleotides obeying Watson- Crick base-pairing rules, and mimic DNA in terms of base pair recognition (Egholm, Buchardt et al. 1993). The backbone of PNAs is formed by peptide bonds rather than phosphodiester bonds, making them well-suited for antisense applications (see structure below). The backbone is uncharged, resulting in PNA / DNA or PNA / RNA duplexes that exhibit greater than normal thermal stability. PNAs are not recognized by nucleases or proteases. Despite a radical structural change to the natural structure, PNAs are capable of sequence-specific binding in a helix form to DNA or RNA. Characteristics of PNAs include a high binding affinity to complementary DNA or RNA, a destabilizing effect caused by single-base mismatch, resistance to nucleases and proteases, hybridization with DNA or RNA independent of salt concentration and triplex formation with homopurine DNA. PANAGENE.TM. has developed its proprietary Bts PNA monomers (Bts; benzothiazole-2- sulfonyl group) and proprietary oligomerization process. The PNA oligomerization using Bts PNA monomers is composed of repetitive cycles of deprotection, coupling and capping. PNAs can be produced synthetically using any technique known in the art. See, e.g., U.S. Pat. Nos. 6,969,766, 7,211,668, 7,022,851, 7,125,994, 7,145,006 and 7,179,896. See also U.S. Attorney Docket: GBB-01125 Pat. Nos. 5,539,082; 5,714,331; and 5,719,262 for the preparation of PNAs. Further teaching of PNA compounds can be found in Nielsen et al., Science, 254:1497-1500, 1991. Each of the foregoing is incorporated by reference in its entirety. Interfering nucleic acids may also contain “locked nucleic acid” subunits (LNAs). “LNAs” are members of a class of modifications called bridged nucleic acid (BNA). BNA is characterized by a covalent linkage that locks the conformation of the ribose ring in a C30- endo (northern) sugar pucker. For LNA, the bridge is composed of a methylene between the2 -O and the 4 -C positions. LNA enhances backbone preorganization and base stacking toincrease hybridization and thermal stability. The structures of LNAs can be found, for example, in Wengel, et al., Chemical Communications (1998) 455; Tetrahedron (1998) 54:3607, and Accounts of Chem. Research (1999) 32:301); Obika, et al., Tetrahedron Letters (1997) 38:8735; (1998) 39:5401, and Bioorganic Medicinal Chemistry (2008) 16:9230. Compounds provided herein may incorporate one or more LNAs; in some cases, the compounds may be entirely composed of LNAs. Methods for the synthesis of individual LNA nucleoside subunits and their incorporation into oligonucleotides are described, for example, in U.S. Pat. Nos. 7,572,582, 7,569,575, 7,084,125, 7,060,809, 7,053,207, 7,034,133, 6,794,499, and 6,670,461, each of which is incorporated by reference in its entirety. Typical intersubunit linkers include phosphodiester and phosphorothioate moieties; alternatively, non-phosphorous containing linkers may be employed. One embodiment is an LNA containing compound where each LNA subunit is separated by a DNA subunit. Certain compounds are composed of alternating LNA and DNA subunits where the intersubunit linker is phosphorothioate. “Phosphorothioates” (or S-oligos) are a variant of normal DNA in which one of the non-bridging oxygens is replaced by a sulfur. The sulfurization of the internucleotide bondreduces the action of endo-and exonucleases including 5 to 3 and 3 to 5 DNA POL 1exonuclease, nucleases S1 and P1, RNases, serum nucleases and snake venom phosphodiesterase. Phosphorothioates are made by two principal routes: by the action of a solution of elemental sulfur in carbon disulfide on a hydrogen phosphonate, or by the method of sulfurizing phosphite triesters with either tetraethylthiuram disulfide (TETD) or 3H-1, 2- bensodithiol-3-one 1, 1-dioxide (BDTD) (see, e.g., Iyer et al., J. Org. Chem. 55, 4693-4699, 1990). The latter methods avoid the problem of elemental sulfur’s insolubility in most organic solvents and the toxicity of carbon disulfide. The TETD and BDTD methods also yield higher purity phosphorothioates. A phosphorothioate can be in the R- or S-enantiomer. Attorney Docket: GBB-01125 “2 O-Me oligonucleotides” molecules carry a methyl group at the 2 -OH residue ofthe ribose molecule. 2 -O-Me-RNAs show the same (or similar) behavior as DNA, but areprotected against nuclease degradation. 2 -O-Me-RNAs can also be combined withphosphorothioate oligonucleotides (PTOs) for further stabilization. 2 O-Me oligonucleotides(phosphodiester or phosphorothioate) can be synthesized according to routine techniques in the art (see, e.g., Yoo et al., Nucleic Acids Res. 32:2008-16, 2004). The interfering nucleic acids described herein may be contacted with a cell or administered to an organism (e.g., a human). Alternatively, constructs and / or vectors encoding the interfering RNA molecules may be contacted with or introduced into a cell or organism. In certain embodiments, a viral, retroviral or lentiviral vector is used. In some embodiments, the vector has a tropism for cardiac tissue. In some embodiments the vector is an adeno-associated virus. Typically at least 17, 18, 19, 20, 21, 22 or 23 nucleotides of the complement of the target mRNA sequence are sufficient to mediate inhibition of a target transcript by an RNAi agent. Perfect complementarity is not necessary. In some embodiments, the interfering nucleic acids contains up to 1, 2 or 3 nucleotide mismatches with the target sequence. Theinterfering nucleic acid molecule may have a 2 nucleotide 3 overhang. If the interferingnucleic acid molecule is expressed in a cell from a construct, for example from a hairpin molecule or from an inverted repeat of the desired sequence, then the endogenous cellular machinery will create the overhangs. shRNA molecules can contain hairpins derived from microRNA molecules. For example, an RNAi vector can be constructed by cloning the interfering RNA sequence into a pCAG-miR30 construct containing the hairpin from the miR30 miRNA. Alternatively, each strand of an RNAi agent can be separately expressed, and form a structure with zero, one or two overhangs when annealed. RNA interference molecules may include DNA residues, as well as RNA residues. In some embodiments, the interfering nucleic acid molecule is a siRNA molecule. Such siRNA molecules should include a region of sufficient homology to the target region, and be of sufficient length in terms of nucleotides, such that the siRNA molecule down- regulate target RNA. The term “ribonucleotide” or “nucleotide” can, in the case of a modified RNA or nucleotide surrogate, also refer to a modified nucleotide, or surrogate replacement moiety at one or more positions. It is not necessary that there be perfect complementarity between the siRNA molecule and the target, but the correspondence must be sufficient to enable the siRNA molecule to direct sequence-specific silencing, such as by RNAi cleavage Attorney Docket: GBB-01125 of the target RNA. In some embodiments, the sense strand need only be sufficiently complementary with the antisense strand to maintain the overall double-strand character of the molecule. In addition, an siRNA molecule may be modified or include nucleoside surrogates. Single stranded regions of an siRNA molecule may be modified or include nucleoside surrogates, e.g., the unpaired region or regions of a hairpin structure, e.g., a region which links two complementary regions, can have modifications or nucleoside surrogates.Modification to stabilize one or more 3 - or 5 -terminus of an siRNA molecule, e.g., againstexonucleases, or to favor the antisense siRNA agent to enter into RISC are also useful. Modifications can include C3 (or C6, C7, C12) amino linkers, thiol linkers, carboxyl linkers, non-nucleotidic spacers (C3, C6, C9, C12, abasic, triethylene glycol, hexaethylene glycol), special biotin or fluorescein reagents that come as phosphoramidites and that have another DMT-protected hydroxyl group, allowing multiple couplings during RNA synthesis. Each strand of an siRNA molecule can be equal to or less than 35, 30, 25, 24, 23, 22, 21, or 20 nucleotides in length. In some embodiments, the strand is at least 19 nucleotides in length. For example, each strand can be between 21 and 25 nucleotides in length. In some embodiments, siRNA agents have a duplex region of 17, 18, 19, 29, 21, 22, 23, 24, or 25nucleotide pairs, and one or more overhangs, such as one or two 3 overhangs, of 2-3nucleotides. A “small hairpin RNA” or “short hairpin RNA” or “shRNA” includes a short RNA sequence that makes a tight hairpin turn that can be used to silence gene expression via RNA interference. The shRNAs provided herein may be chemically synthesized or transcribed from a transcriptional cassette in a DNA plasmid. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). In some embodiments, shRNAs are about 15-60, 15-50, or 15-40 (duplex) nucleotides in length, about 15-30, 15-25, or 19-25 (duplex) nucleotides in length, or are about 20-24, 21- 22, or 21-23 (duplex) nucleotides in length (e.g., each complementary sequence of the double-stranded shRNA is 15-60, 15-50, 15-40, 15-30, 15-25, or 19-25 nucleotides in length, or about 20-24, 21-22, or 21-23 nucleotides in length, and the double-stranded shRNA is about 15-60, 15-50, 15-40, 15-30, 15-25, or 19-25 base pairs in length, or about 18-22, 19-20,or 19-21 base pairs in length). shRNA duplexes may comprise 3 overhangs of about 1 toabout 4 nucleotides or about 2 to about 3 nucleotides on the antisense strand and / or 5 - Attorney Docket: GBB-01125 phosphate termini on the sense strand. In some embodiments, the shRNA comprises a sense strand and / or antisense strand sequence of from about 15 to about 60 nucleotides in length (e.g., about 15-60, 15-55, 15-50, 15-45, 15-40, 15-35, 15-30, or 15-25 nucleotides in length),or from about 19 to about 40 nucleotides in length (e.g., about 19-40, 19-35, 19-30, or 19-25 nucleotides in length), or from about 19 to about 23 nucleotides in length (e.g., 19, 20, 21, 22, or 23 nucleotides in length). Non-limiting examples of shRNA include a double-stranded polynucleotide molecule assembled from a single-stranded molecule, where the sense and antisense regions are linked by a nucleic acid-based or non-nucleic acid-based linker; and a double-stranded polynucleotide molecule with a hairpin secondary structure having self-complementary sense and antisense regions. In some embodiments, the sense and antisense strands of the shRNA are linked by a loop structure comprising from about 1 to about 25 nucleotides, from about 2 to about 20 nucleotides, from about 4 to about 15 nucleotides, from about 5 to about 12 nucleotides, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleotides. Additional embodiments related to the shRNAs, as well as methods of designing and synthesizing such shRNAs, are described in U.S. patent application publication number 2011 / 0071208, the disclosure of which is herein incorporated by reference in its entirety for all purposes. In some embodiments, provided herein are microRNAs (miRNAs). miRNAs represent a large group of small RNAs produced naturally in organisms, some of which regulate the expression of target genes. miRNAs are formed from an approximately 70 nucleotide single-stranded hairpin precursor transcript by Dicer. miRNAs are not translated into proteins, but instead bind to specific messenger RNAs, thereby blocking translation. In some instances, miRNAs base-pair imprecisely with their targets to inhibit translation. In some embodiments, the polynucleotides (e.g., RNA) are antisense oligonucleotide compounds. In certain embodiments, the degree of complementarity between the target sequence and antisense targeting sequence is sufficient to form a stable duplex. The region of complementarity of the antisense oligonucleotides with the target RNA sequence may be as short as 8-11 bases, but can be 12-15 bases or more, e.g., 10-40 bases, 12-30 bases, 12-25 bases, 15-25 bases, 12-20 bases, or 15-20 bases, including all integers in between these ranges. An antisense oligonucleotide of about 14-15 bases is generally long enough to have a unique complementary sequence. Attorney Docket: GBB-01125 In certain embodiments, antisense oligonucleotides may be 100% complementary to the target sequence, or may include mismatches, e.g., to improve selective targeting of allele containing a disease-associated mutation, as long as a heteroduplex formed between the oligonucleotide and target sequence is sufficiently stable to withstand the action of cellular nucleases and other modes of degradation which may occur in vivo. Hence, certain oligonucleotides may have about or at least about 70% sequence complementarity, e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity, between the oligonucleotide and the target sequence. Oligonucleotide backbones that are less susceptible to cleavage by nucleases are discussed herein. Mismatches, if present, are typically less destabilizing toward the end regions of the hybrid duplex than in the middle. The number of mismatches allowed will depend on the length of the oligonucleotide, the percentage of G:C base pairs in the duplex, and the position of the mismatch(es) in the duplex, according to well understood principles of duplex stability. In some embodiments, the polynucleotides disclosed herein are RNA molecules that code for a protein (e.g., mRNA molecules). In some embodiments, the RNA molecules are non-coding RNA molecules (e.g., gRNA molecules, inhibitory RNA molecules). In some embodiments, the polynucleotides (e.g., RNA) described herein are synthetic and / or recombinant. Synthetic and / or recombinant RNA molecules can be made by any known method in the art. Synthetic RNA molecules can also be ordered from companies such as Twist Biosciences (South San Francisco, CA), DNA Script (South San Francisco, CA), and Integrated DNA Technologies (Coralville, IA). While the sequences disclosed herein may be listed as DNA sequences, after converting thymine to uracil these same sequences can be used for RNA constructs. In some embodiments, wherein the polynucleotide comprises a modified base, sugar or phosphate, the polynucleotide can be synthesized chemically. In some embodiments, the addition of a polynucleotide comprising a regulatory element (e.g., a regulatory element disclosed herein) to a small polynucleotide (e.g., a gRNA, sgRNA or RNAi agent) may interfere with the small polynucleotide’s normal function; in such cases, the polynucleotide comprising the regulatory element may only be transiently associated with the small polynucleotide but may be removed. Such removal may be achieved, for example, via use of a labile linker between the polynucleotide comprising the regulatory element and the small polynucleotide, or enzymatically, e.g., via a Dicer or other Attorney Docket: GBB-01125 nuclease, capable of cleaving the polynucleotide comprising the regulatory element from the small polynucleotide. Recombinant RNA molecules, such as recombinant constructs, may be generated using standard molecular biology techniques, such as those set forth in Green and Sambrook (Molecular Cloning: A Laboratory Manual, Fourth Edition, ISBN-13: 978-1936113415). In some embodiments the polynucleotide (e.g., RNA) molecule is, without limitation, from 10 bp to 10 K bp in size. In some embodiments, the polynucleotide (e.g., RNA) molecule is at least 10 bp, at least 15 bp, at least 20 bp, at least 25 bp, at least 30 bp, at least 35 bp, at least 40 bp, at least 45 bp, at least 50 bp, at least 55 bp, at least 60 bp, at least 65 bp, at least 70 bp, at least 75 bp, at least 80 bp, at least 85 bp, at least 90 bp, at least 95 bp, at least 100 bp, at least 105 bp, at least 110 bp, at least 115 bp, at least 120 bp, at least 125 bp, at least 130 bp, at least 135 bp, at least 140 bp, at least 145 bp, at least 150 bp, at least 155 bp, at least 160 bp, at least 165 bp, at least 170 bp, at least 175 bp, at least 180 bp, at least 185 bp, at least 190 bp, at least 195 bp, at least 200 bp, at least 205 bp, at least 210 bp, at least 215 bp, at least 220 bp, at least 225 bp, at least 230 bp, at least 235 bp, at least 240 bp, at least 245 bp, at least 250 bp, at least 255 bp, at least 260 bp, at least 265 bp, at least 270 bp, at least 275 bp, at least 280 bp, at least 285 bp, at least 290 bp, at least 295 bp, at least 300 bp, at least 305 bp, at least 310 bp, at least 315 bp, at least 320 bp, at least 325 bp, at least 330 bp, at least 335 bp, at least 340 bp, at least 345 bp, at least 350 bp, at least 355 bp, at least 360 bp, at least 365 bp, at least 370 bp, at least 375 bp, at least 380 bp, at least 385 bp, at least 390 bp, at least 395 bp, at least 400 bp, at least 405 bp, at least 410 bp, at least 415 bp, at least 420 bp, at least 425 bp, at least 430 bp, at least 435 bp, at least 440 bp, at least 445 bp, at least 450 bp, at least 455 bp, at least 460 bp, at least 465 bp, at least 470 bp, at least 475 bp, at least 480 bp, at least 485 bp, at least 490 bp, at least 495 bp, at least 500 bp, at least 505 bp, at least 510 bp, at least 515 bp, at least 520 bp, at least 525 bp, at least 530 bp, at least 535 bp, at least 540 bp, at least 545 bp, at least 550 bp, at least 555 bp, at least 560 bp, at least 565 bp, at least 570 bp, at least 575 bp, at least 580 bp, at least 585 bp, at least 590 bp, at least 595 bp, at least 600 bp, at least 605 bp, at least 610 bp, at least 615 bp, at least 620 bp, at least 625 bp, at least 630 bp, at least 635 bp, at least 640 bp, at least 645 bp, at least 650 bp, at least 655 bp, at least 660 bp, at least 665 bp, at least 670 bp, at least 675 bp, at least 680 bp, at least 685 bp, at least 690 bp, at least 695 bp, at least 700 bp, at least 705 bp, at least 710 bp, at least 715 bp, at least 720 bp, at least 725 bp, at least 730 bp, at least 735 bp, at least 740 bp, at least 745 bp, at least 750 bp, at least 755 bp, at least 760 bp, at least 765 bp, at least 770 bp, at least 775 bp, at least 780 bp, at least 785 bp, at Attorney Docket: GBB-01125 least 790 bp, at least 795 bp, at least 800 bp, at least 805 bp, at least 810 bp, at least 815 bp, at least 820 bp, at least 825 bp, at least 830 bp, at least 835 bp, at least 840 bp, at least 845 bp, at least 850 bp, at least 855 bp, at least 860 bp, at least 865 bp, at least 870 bp, at least 875 bp, at least 880 bp, at least 885 bp, at least 890 bp, at least 895 bp, at least 900 bp, at least 905 bp, at least 910 bp, at least 915 bp, at least 920 bp, at least 925 bp, at least 930 bp, at least 935 bp, at least 940 bp, at least 945 bp, at least 950 bp, at least 955 bp, at least 960 bp, at least 965 bp, at least 970 bp, at least 975 bp, at least 980 bp, at least 985 bp, at least 990 bp, at least 995 bp, at least 1000 bp, at least 1025 bp, at least 1050 bp, at least 1075 bp, at least 1100 bp, at least 1125 bp, at least 1150 bp, at least 1175 bp, at least 1200 bp, at least 1225 bp, at least 1250 bp, at least 1275 bp, at least 1300 bp, at least 1325 bp, at least 1350 bp, at least 1375 bp, at least 1400 bp, at least 1425 bp, at least 1450 bp, at least 1475 bp, at least 1500 bp, at least 1525 bp, at least 1550 bp, at least 1575 bp, at least 1600 bp, at least 1625 bp, at least 1650 bp, at least 1675 bp, at least 1700 bp, at least 1725 bp, at least 1750 bp, at least 1775 bp, at least 1800 bp, at least 1825 bp, at least 1850 bp, at least 1875 bp, at least 1900 bp, at least 1925 bp, at least 1950 bp, at least 1975 bp, at least 2000 bp, at least 2025 bp, at least 2050 bp, at least 2075 bp, at least 2100 bp, at least 2125 bp, at least 2150 bp, at least 2175 bp, at least 2200 bp, at least 2225 bp, at least 2250 bp, at least 2275 bp, at least 2300 bp, at least 2325 bp, at least 2350 bp, at least 2375 bp, at least 2400 bp, at least 2425 bp, at least 2450 bp, at least 2475 bp, at least 2500 bp, at least 2525 bp, at least 2550 bp, at least 2575 bp, at least 2600 bp, at least 2625 bp, at least 2650 bp, at least 2675 bp, at least 2700 bp, at least 2725 bp, at least 2750 bp, at least 2775 bp, at least 2800 bp, at least 2825 bp, at least 2850 bp, at least 2875 bp, at least 2900 bp, at least 2925 bp, at least 2950 bp, at least 2975 bp, at least 3000 bp, at least 3025 bp, at least 3050 bp, at least 3075 bp, at least 3100 bp, at least 3125 bp, at least 3150 bp, at least 3175 bp, at least 3200 bp, at least 3225 bp, at least 3250 bp, at least 3275 bp, at least 3300 bp, at least 3325 bp, at least 3350 bp, at least 3375 bp, at least 3400 bp, at least 3425 bp, at least 3450 bp, at least 3475 bp, at least 3500 bp, at least 3525 bp, at least 3550 bp, at least 3575 bp, at least 3600 bp, at least 3625 bp, at least 3650 bp, at least 3675 bp, at least 3700 bp, at least 3725 bp, at least 3750 bp, at least 3775 bp, at least 3800 bp, at least 3825 bp, at least 3850 bp, at least 3875 bp, at least 3900 bp, at least 3925 bp, at least 3950 bp, at least 3975 bp, at least 4000 bp, at least 4025 bp, at least 4050 bp, at least 4075 bp, at least 4100 bp, at least 4125 bp, at least 4150 bp, at least 4175 bp, at least 4200 bp, at least 4225 bp, at least 4250 bp, at least 4275 bp, at least 4300 bp, at least 4325 bp, at least 4350 bp, at least 4375 bp, at least 4400 bp, at least 4425 bp, at least 4450 bp, at least 4475 bp, at least 4500 bp, at least 4525 bp, at least 4550 bp, Attorney Docket: GBB-01125 at least 4575 bp, at least 4600 bp, at least 4625 bp, at least 4650 bp, at least 4675 bp, at least 4700 bp, at least 4725 bp, at least 4750 bp, at least 4775 bp, at least 4800 bp, at least 4825 bp, at least 4850 bp, at least 4875 bp, at least 4900 bp, at least 4925 bp, at least 4950 bp, at least 4975 bp, at least 5000 bp, at least 5025 bp, at least 5050 bp, at least 5075 bp, at least 5100 bp, at least 5125 bp, at least 5150 bp, at least 5175 bp, at least 5200 bp, at least 5225 bp, at least 5250 bp, at least 5275 bp, at least 5300 bp, at least 5325 bp, at least 5350 bp, at least 5375 bp, at least 5400 bp, at least 5425 bp, at least 5450 bp, at least 5475 bp, at least 5500 bp, at least 5525 bp, at least 5550 bp, at least 5575 bp, at least 5600 bp, at least 5625 bp, at least 5650 bp, at least 5675 bp, at least 5700 bp, at least 5725 bp, at least 5750 bp, at least 5775 bp, at least 5800 bp, at least 5825 bp, at least 5850 bp, at least 5875 bp, at least 5900 bp, at least 5925 bp, at least 5950 bp, at least 5975 bp, at least 6000 bp, at least 6025 bp, at least 6050 bp, at least 6075 bp, at least 6100 bp, at least 6125 bp, at least 6150 bp, at least 6175 bp, at least 6200 bp, at least 6225 bp, at least 6250 bp, at least 6275 bp, at least 6300 bp, at least 6325 bp, at least 6350 bp, at least 6375 bp, at least 6400 bp, at least 6425 bp, at least 6450 bp, at least 6475 bp, at least 6500 bp, at least 6525 bp, at least 6550 bp, at least 6575 bp, at least 6600 bp, at least 6625 bp, at least 6650 bp, at least 6675 bp, at least 6700 bp, at least 6725 bp, at least 6750 bp, at least 6775 bp, at least 6800 bp, at least 6825 bp, at least 6850 bp, at least 6875 bp, at least 6900 bp, at least 6925 bp, at least 6950 bp, at least 6975 bp, at least 7000 bp, at least 7025 bp, at least 7050 bp, at least 7075 bp, at least 7100 bp, at least 7125 bp, at least 7150 bp, at least 7175 bp, at least 7200 bp, at least 7225 bp, at least 7250 bp, at least 7275 bp, at least 7300 bp, at least 7325 bp, at least 7350 bp, at least 7375 bp, at least 7400 bp, at least 7425 bp, at least 7450 bp, at least 7475 bp, at least 7500 bp, at least 7525 bp, at least 7550 bp, at least 7575 bp, at least 7600 bp, at least 7625 bp, at least 7650 bp, at least 7675 bp, at least 7700 bp, at least 7725 bp, at least 7750 bp, at least 7775 bp, at least 7800 bp, at least 7825 bp, at least 7850 bp, at least 7875 bp, at least 7900 bp, at least 7925 bp, at least 7950 bp, at least 7975 bp, at least 8000 bp, at least 8025 bp, at least 8050 bp, at least 8075 bp, at least 8100 bp, at least 8125 bp, at least 8150 bp, at least 8175 bp, at least 8200 bp, at least 8225 bp, at least 8250 bp, at least 8275 bp, at least 8300 bp, at least 8325 bp, at least 8350 bp, at least 8375 bp, at least 8400 bp, at least 8425 bp, at least 8450 bp, at least 8475 bp, at least 8500 bp, at least 8525 bp, at least 8550 bp, at least 8575 bp, at least 8600 bp, at least 8625 bp, at least 8650 bp, at least 8675 bp, at least 8700 bp, at least 8725 bp, at least 8750 bp, at least 8775 bp, at least 8800 bp, at least 8825 bp, at least 8850 bp, at least 8875 bp, at least 8900 bp, at least 8925 bp, at least 8950 bp, at least 8975 bp, at least 9000 bp, at least 9025 bp, at least 9050 bp, at least 9075 bp, at least Attorney Docket: GBB-01125 9100 bp, at least 9125 bp, at least 9150 bp, at least 9175 bp, at least 9200 bp, at least 9225 bp, at least 9250 bp, at least 9275 bp, at least 9300 bp, at least 9325 bp, at least 9350 bp, at least 9375 bp, at least 9400 bp, at least 9425 bp, at least 9450 bp, at least 9475 bp, at least 9500 bp, at least 9525 bp, at least 9550 bp, at least 9575 bp, at least 9600 bp, at least 9625 bp, at least 9650 bp, at least 9675 bp, at least 9700 bp, at least 9725 bp, at least 9750 bp, at least 9775 bp, at least 9800 bp, at least 9825 bp, at least 9850 bp, at least 9875 bp, at least 9900 bp, at least 9925 bp, at least 9950 bp, at least 9975 bp, at least 10000 bp. For example, in some embodiments, the nucleic acid molecule is between 200 bp and 10 kbp, between 300 bp and 10 kbp, between 400 bp and 10 kbp, between 500 bp and 10 kbp, 600 bp and 10 kbp, between 700 bp and 10 kbp, between 800 bp and 10 kbp, between 900 bp and 10 kbp, between 1 kbp and 10 kbp, between 2 kbp and 10 kbp, between 3 kbp and 10 kbp, between 4 kbp and 10 kbp, between 5 kbp and 10 kbp, between 6 kbp and 10 kbp, between 7 kbp and 10 kbp, between 8 kbp and 10 kbp or between 9 kbp and 10 kbp. In some embodiments, the polynucleotide (e.g., RNA) molecule is no more than 300 bp, 305 bp, 310 bp, 315 bp, 320 bp, 325 bp, 330 bp, 335 bp, 340 bp, 345 bp, 350 bp, 355 bp, 360 bp, 365 bp, 370 bp, 375 bp, 380 bp, 385 bp, 390 bp, 395 bp, 400 bp, 405 bp, 410 bp, 415 bp, 420 bp, 425 bp, 430 bp, 435 bp, 440 bp, 445 bp, 450 bp, 455 bp, 460 bp, 465 bp, 470 bp, 475 bp, 480 bp, 485 bp, 490 bp, 495 bp, 500 bp, 505 bp, 510 bp, 515 bp, 520 bp, 525 bp, 530 bp, 535 bp, 540 bp, 545 bp, 550 bp, 555 bp, 560 bp, 565 bp, 570 bp, 575 bp, 580 bp, 585 bp, 590 bp, 595 bp, 600 bp, 605 bp, 610 bp, 615 bp, 620 bp, 625 bp, 630 bp, 635 bp, 640 bp, 645 bp, 650 bp, 655 bp, 660 bp, 665 bp, 670 bp, 675 bp, 680 bp, 685 bp, 690 bp, 695 bp, 700 bp, 705 bp, 710 bp, 715 bp, 720 bp, 725 bp, 730 bp, 735 bp, 740 bp, 745 bp, 750 bp, 755 bp, 760 bp, 765 bp, 770 bp, 775 bp, 780 bp, 785 bp, 790 bp, 795 bp, 800 bp, 805 bp, 810 bp, 815 bp, 820 bp, 825 bp, 830 bp, 835 bp, 840 bp, 845 bp, 850 bp, 855 bp, 860 bp, 865 bp, 870 bp, 875 bp, 880 bp, 885 bp, 890 bp, 895 bp, 900 bp, 905 bp, 910 bp, 915 bp, 920 bp, 925 bp, 930 bp, 935 bp, 940 bp, 945 bp, 950 bp, 955 bp, 960 bp, 965 bp, 970 bp, 975 bp, 980 bp, 985 bp, 990 bp, 995 bp, 1000 bp, 1025 bp, 1050 bp, 1075 bp, 1100 bp, 1125 bp, 1150 bp, 1175 bp, 1200 bp, 1225 bp, 1250 bp, 1275 bp, 1300 bp, 1325 bp, 1350 bp, 1375 bp, 1400 bp, 1425 bp, 1450 bp, 1475 bp, 1500 bp, 1525 bp, 1550 bp, 1575 bp, 1600 bp, 1625 bp, 1650 bp, 1675 bp, 1700 bp, 1725 bp, 1750 bp, 1775 bp, 1800 bp, 1825 bp, 1850 bp, 1875 bp, 1900 bp, 1925 bp, 1950 bp, 1975 bp, 2000 bp, 2025 bp, 2050 bp, 2075 bp, 2100 bp, 2125 bp, 2150 bp, 2175 bp, 2200 bp, 2225 bp, 2250 bp, 2275 bp, 2300 bp, 2325 bp, 2350 bp, 2375 bp, 2400 bp, 2425 bp, 2450 bp, 2475 bp, 2500 bp, 2525 bp, 2550 bp, 2575 bp, 2600 bp, 2625 bp, 2650 bp, 2675 bp, 2700 Attorney Docket: GBB-01125 bp, 2725 bp, 2750 bp, 2775 bp, 2800 bp, 2825 bp, 2850 bp, 2875 bp, 2900 bp, 2925 bp, 2950 bp, 2975 bp, 3000 bp, 3025 bp, 3050 bp, 3075 bp, 3100 bp, 3125 bp, 3150 bp, 3175 bp, 3200 bp, 3225 bp, 3250 bp, 3275 bp, 3300 bp, 3325 bp, 3350 bp, 3375 bp, 3400 bp, 3425 bp, 3450 bp, 3475 bp, 3500 bp, 3525 bp, 3550 bp, 3575 bp, 3600 bp, 3625 bp, 3650 bp, 3675 bp, 3700 bp, 3725 bp, 3750 bp, 3775 bp, 3800 bp, 3825 bp, 3850 bp, 3875 bp, 3900 bp, 3925 bp, 3950 bp, 3975 bp, 4000 bp, 4025 bp, 4050 bp, 4075 bp, 4100 bp, 4125 bp, 4150 bp, 4175 bp, 4200 bp, 4225 bp, 4250 bp, 4275 bp, 4300 bp, 4325 bp, 4350 bp, 4375 bp, 4400 bp, 4425 bp, 4450 bp, 4475 bp, 4500 bp, 4525 bp, 4550 bp, 4575 bp, 4600 bp, 4625 bp, 4650 bp, 4675 bp, 4700 bp, 4725 bp, 4750 bp, 4775 bp, 4800 bp, 4825 bp, 4850 bp, 4875 bp, 4900 bp, 4925 bp, 4950 bp, 4975 bp, 5000 bp, 5025 bp, 5050 bp, 5075 bp, 5100 bp, 5125 bp, 5150 bp, 5175 bp, 5200 bp, 5225 bp, 5250 bp, 5275 bp, 5300 bp, 5325 bp, 5350 bp, 5375 bp, 5400 bp, 5425 bp, 5450 bp, 5475 bp, 5500 bp, 5525 bp, 5550 bp, 5575 bp, 5600 bp, 5625 bp, 5650 bp, 5675 bp, 5700 bp, 5725 bp, 5750 bp, 5775 bp, 5800 bp, 5825 bp, 5850 bp, 5875 bp, 5900 bp, 5925 bp, 5950 bp, 5975 bp, 6000 bp, 6025 bp, 6050 bp, 6075 bp, 6100 bp, 6125 bp, 6150 bp, 6175 bp, 6200 bp, 6225 bp, 6250 bp, 6275 bp, 6300 bp, 6325 bp, 6350 bp, 6375 bp, 6400 bp, 6425 bp, 6450 bp, 6475 bp, 6500 bp, 6525 bp, 6550 bp, 6575 bp, 6600 bp, 6625 bp, 6650 bp, 6675 bp, 6700 bp, 6725 bp, 6750 bp, 6775 bp, 6800 bp, 6825 bp, 6850 bp, 6875 bp, 6900 bp, 6925 bp, 6950 bp, 6975 bp, 7000 bp, 7025 bp, 7050 bp, 7075 bp, 7100 bp, 7125 bp, 7150 bp, 7175 bp, 7200 bp, 7225 bp, 7250 bp, 7275 bp, 7300 bp, 7325 bp, 7350 bp, 7375 bp, 7400 bp, 7425 bp, 7450 bp, 7475 bp, 7500 bp, 7525 bp, 7550 bp, 7575 bp, 7600 bp, 7625 bp, 7650 bp, 7675 bp, 7700 bp, 7725 bp, 7750 bp, 7775 bp, 7800 bp, 7825 bp, 7850 bp, 7875 bp, 7900 bp, 7925 bp, 7950 bp, 7975 bp, 8000 bp, 8025 bp, 8050 bp, 8075 bp, 8100 bp, 8125 bp, 8150 bp, 8175 bp, 8200 bp, 8225 bp, 8250 bp, 8275 bp, 8300 bp, 8325 bp, 8350 bp, 8375 bp, 8400 bp, 8425 bp, 8450 bp, 8475 bp, 8500 bp, 8525 bp, 8550 bp, 8575 bp, 8600 bp, 8625 bp, 8650 bp, 8675 bp, 8700 bp, 8725 bp, 8750 bp, 8775 bp, 8800 bp, 8825 bp, 8850 bp, 8875 bp, 8900 bp, 8925 bp, 8950 bp, 8975 bp, 9000 bp, 9025 bp, 9050 bp, 9075 bp, 9100 bp, 9125 bp, 9150 bp, 9175 bp, 9200 bp, 9225 bp, 9250 bp, 9275 bp, 9300 bp, 9325 bp, 9350 bp, 9375 bp, 9400 bp, 9425 bp, 9450 bp, 9475 bp, 9500 bp, 9525 bp, 9550 bp, 9575 bp, 9600 bp, 9625 bp, 9650 bp, 9675 bp, 9700 bp, 9725 bp, 9750 bp, 9775 bp, 9800 bp, 9825 bp, 9850 bp, 9875 bp, 9900 bp, 9925 bp, 9950 bp, 9975 bp, or 10000 bp in length. In some embodiments, a binding site is present in the polynucleotide (e.g., RNA) molecule; for example, the binding site can bind a primer for reverse transcription, an RNA polymerase, a transcription factor, and / or combinations thereof. Attorney Docket: GBB-01125 Promoter Sequences In some embodiments, a promoter is a sequence of DNA to which proteins bind to initiate transcription of a single RNA transcript from the DNA downstream of (or in some cases overlapping the 3' portion of) the promoter. In some embodiments, a RNA transcript may encode a protein (e.g., mRNA), or can have a function in and of itself, such as tRNA or rRNA. In some embodiments, a promoter may be recognized by RNA polymerase II (e.g., Pol2 or PolII) and may thus be designated a Pol2 (or PolII) promoter. In some embodiments, a promoter may be recognized by RNA polymerase III (e.g., Pol3 or PolIII) and may thus be designated a Pol3 (or PolIII) promoter. In some embodiments, a promoter can comprise a core promoter sequence (a minimal sequence sufficient for transcription under suitable conditions), and optionally an enhancer and / or constant region, which can increase transcription or change the conditions under which transcription occurs. RNA polymerase II is an enzyme responsible for transcribing RNA from DNA. RNA polymerase II (Pol2) promoters are regions of DNA that are recognized by RNA polymerase II and drive transcription of nearby genes. In certain aspects, provided herein are RNA polymerase II promoters, as well as DNA molecules, vectors and / or cells comprising such promoters. In some embodiments, the RNA polymerase II promoters mediate gene expression in muscle cells. In some embodiments, the promoters provided herein can be used in combination with other regulatory elements,such as 3 UTRs, 5 UTRs, cis-elements, enhancers, and / or introns, for example, by adding aheterologous regulatory element to a core promoter with its own partial or complete regulatory elements. In some embodiments, a Pol2 promoter comprises a core promoter sequence. In some embodiments, a Pol 2 core promoter sequence is any one of: PB-CA-0071 (SEQ ID NO: 36) or PB-CA-0070 (SEQ ID NO: 37). In some embodiments, the sequence of a Pol 2 core promoter sequence is or comprises the sequence of any one of: PB-CA-0071 (SEQ ID NO: 36) or PB-CA-0070 (SEQ ID NO: 37). In some embodiments, the sequence of Attorney Docket: GBB-01125 a Pol 2 core promoter sequence is at least 90% identical to the sequence of any one of: PB- CA-0071 (SEQ ID NO: 36) or PB-CA-0070 (SEQ ID NO: 37). In some embodiments, a polynucleotide comprises: (a) a Pol 2 core promoter sequence which is any one of: MCK promoter (SEQ ID NO: 33), PB-CA-0073 (SEQ ID NO: 34), or PB-CA-0072 (SEQ ID NO: 35); and (b) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (a) a Pol 2 core promoter sequence which is or comprises the sequence of any one of: MCK promoter (SEQ ID NO: 33), PB-CA-0073 (SEQ ID NO: 34), PB-CA-0072 (SEQ ID NO: 35), PB-CA-0071 (SEQ ID NO: 36), or PB-CA-0070 (SEQ ID NO: 37); and (b) a heterologous polynucleotide. In some embodiments, a polynucleotide comprises: (a) a Pol 2 core promoter which has a sequence at least 90% identical to the sequence of any one of: MCK promoter (SEQ ID NO: 33), PB-CA-0073 (SEQ ID NO: 34), or PB-CA-0072 (SEQ ID NO: 35); and (b) a heterologous polynucleotide. In some embodiments, provided herein are polynucleotides comprising a core sequence (e.g., a core promoter sequence) that is at least 90% identical (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) to SEQ ID NO: 36 or 37 (see Table 7A). In some embodiments, provided herein are polynucleotides comprising: (a) a core sequence (e.g., a core promoter sequence) that is at least 90% identical (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) to any one of SEQ ID NO: 33, 34, or 35 (see Table 7B); and (b) a heterologous polynucleotide. In some embodiments, the polynucleotide comprises a core promoter sequence of SEQ ID NO: 36. In some embodiments, the polynucleotide comprises a core promoter sequence of SEQ ID NO: 37. Non-limiting examples of Pol2 core promoter sequences are presented in Table 7A. In some embodiments, the polynucleotide comprises: (a) a core promoter sequence of SEQ ID NO: 33; and (b) a heterologous polynucleotide. In some embodiments, the polynucleotide comprises: (a) a core promoter sequence of SEQ ID NO: 34; and (b) a heterologous polynucleotide. In some embodiments, the polynucleotide comprises: (a) a core promoter sequence of SEQ ID NO: 35; and (b) a heterologous polynucleotide. Non-limiting examples of Pol2 core promoter sequences are presented in Table 7B. In some embodiments, a Pol2 promoter comprises a Pol2 core promoter and a 3' constant region. Attorney Docket: GBB-01125 In some embodiments, the polynucleotide comprises the 3 constant region sequence:ATTCTACCACCACCTCCACAGCACAGACAGACACTCAGGAGCCAGCCAG (SEQ IDNO: 38). In some embodiments, the sequence of the 3 constant region sequence is orcomprises the sequence of: ATTCTACCACCACCTCCACA GCACAGACAGACACTCAGGAGCCAGCCAG (SEQ ID NO: 38). In some embodiments,the sequence of the 3 constant region sequence is at least 90% identical to the sequence of:ATTCTACCACCACCTCCACAGCACA GACAGACACTCAGGAGCCAGCCAG (SEQ ID NO: 38). In some embodiments, a Pol2 promoter comprises an enhancer and a Pol2 core promoter sequence. In some embodiments, an enhancer is a sequence which increases expression from a core promoter; in some embodiments, an enhancer is or comprises a regulatory element. In some embodiments, the polynucleotide comprises a first enhancer sequence. As is known to one of ordinary skill in the art: if an enhancer is operably linked to a core promoter (e.g., a Pol2 or a Pol3 core promoter) and a coding sequence, the enhancer can be placed 5' to the core promoter, between the core promoter and the coding sequence, or 3' to the codingsequence. In some embodiments, the first enhancer sequence is positioned 5 to the corepromoter sequence. In some embodiments, the first enhancer sequence is positioned 3 to thecore promoter sequence. In some embodiments, the polynucleotide comprises the following components in the following order (5' to 3'): enhancer sequence-core promoter. In some embodiments, the polynucleotide comprises the following components in the following order (5' to 3'): core promoter-enhancer sequence. In some embodiments, the polynucleotide comprises the following components in the following order (5' to 3'): enhancer sequence-enhancer sequence-core promoter. In some embodiments, the polynucleotide comprises the following components in the following order (5' to 3'): enhancer sequence-core promoter-enhancer sequence. In some embodiments, the polynucleotide comprises the following components in the following order (5' to 3'): enhancer sequence-core promoter-coding sequence. In some embodiments, the polynucleotide comprises the following components in the following order (5' to 3'): core promoter-enhancer sequence-coding sequence. In some embodiments, the polynucleotide comprises the following components in the following order (5' to 3'): core promoter-coding sequence-enhancer sequence. Attorney Docket: GBB-01125 In some embodiments, the polynucleotide comprises the following components in the following order (5' to 3'): enhancer sequence-enhancer sequence-core promoter-coding sequence. In some embodiments, three or more enhancer sequences (which can be the same or different) can be positioned 5' to (or otherwise operably linked to) a core promoter. In some embodiments, the polynucleotide comprises the following components in the following order (5' to 3'): enhancer sequence-core promoter-enhancer sequence-coding sequence. In some embodiments, the polynucleotide comprises the following components in the following order (5' to 3'): enhancer sequence-core promoter-coding sequence-enhancer sequence. In some embodiments, one or more enhancers can be added 5' to any of the orders of components described above. In some embodiments, a core promoter is a Pol2 promoter. In some embodiments, a core promoter is a Pol3. Without wishing to be bound by any particular theory, the present disclosure notes that several Pol3 promoters (e.g., sequences comprising a Pol3 core promoters) have been reported in the art which do not require and are not normally associated with the presence of an enhancer sequence. In various embodiments, one or more linkers and / or one or more adapters and / or one or more additional sequences can be interposed between any two components, or 5' or 3' to any component in the polynucleotide. As is known to one of ordinary skill in the art, an enhancer operably linked to a core promoter can be adjacent to the core promoter, or can be several kbp or more away from the core promoter. In some embodiments, a sequence interposed between an enhancer and a core promoter can comprise one or more of: a linker, an adapter, or an additional sequence. In some embodiments, a linker can optionally but does not necessarily have a specific biological activity, although in some cases the length of the linker can affect the spacing between biological entities such as proteins or protein- comprising complexes bound to two components such as an enhancer and a core promoter. In some embodiments, an adapter can optionally but does not necessarily have a specific biological activity, but can optionally comprise a sequence useful for molecular biology, e.g., a sequence that facilitates construction of a sequence library, and / or a sequence which is complementary to another sequence in the polynucleotide backbone and thus can facilitate cloning. In some embodiments, an additional sequence can optionally but does not necessarily have a specific biological activity, for example, acting as an origin of replication Attorney Docket: GBB-01125 or selectable marker. Various linker, adapter and additional sequences are known to one of ordinary skill in the art. As a non-limiting example: a polynucleotide comprising the following components in the following order (5' to 3'): enhancer sequence-core promoter-coding sequence can comprise the following components in the following order (5' to 3'): linker-enhancer sequence-additional sequence-core promoter-coding sequence; enhancer sequence-adapter- core promoter-coding sequence; additional sequence-enhancer sequence-linker-core promoter-coding; sequence-adapter; enhancer sequence-core promoter-adapter-linker-coding sequence; enhancer sequence-linker-core promoter-coding sequence-additional sequence; enhancer sequence-core promoter-coding sequence-linker; or adapter-enhancer sequence-core promoter-coding sequence; etc. In various embodiments, a core promoter can be a Pol2 or a Pol3 core promoter. In some embodiments, an enhancer is any one of: HCe1 (SEQ ID NO: 39), HCe2 (SEQ ID NO: 40), HCe4 (SEQ ID NO: 41), or HCe3 (SEQ ID NO: 42). In some embodiments, the sequence of an enhancer is or comprises the sequence of any one of: HCe1 (SEQ ID NO: 39), HCe2 (SEQ ID NO: 40), HCe4 (SEQ ID NO: 41), or HCe3 (SEQ ID NO: 42). In some embodiments, the sequence of an enhancer is at least 90% identical to the sequence of any one of: HCe1 (SEQ ID NO: 39), HCe2 (SEQ ID NO: 40), HCe4 (SEQ ID NO: 41), or HCe3 (SEQ ID NO: 42). In some embodiments, the first enhancer sequence is at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42 (see Table 8). In some embodiments, the first enhancer sequence is one of SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. In some embodiments, the first enhancer sequence is SEQ ID NO: 39. In some embodiments, the first enhancer sequence is SEQ ID NO: 40. In some embodiments, the first enhancer sequence is SEQ ID NO: 41. In some embodiments, the first enhancer sequence is SEQ ID NO: 42. In some embodiments, the polynucleotide comprises a linker sequence between the first enhancer sequence and the core promoter sequence. In some embodiments, the linker sequence is: CACCGGAGGACCGGATCAACT (SEQ ID NO: 43). In some embodiments, the polynucleotide comprises a second enhancer sequence. In some embodiments, the first and the second enhancer sequences are the same or different. Insome embodiments, the second enhancer sequence is positioned 5 of the core promoter Attorney Docket: GBB-01125sequence. In some embodiments, the second enhancer sequence is positioned 3 of the corepromoter sequence. In some embodiments, the second enhancer sequence is at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42 (see Table 8). In some embodiments, the second enhancer sequence is one of SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. In some embodiments, the second enhancer sequence is SEQ ID NO: 39. In some embodiments, the second enhancer sequence is SEQ ID NO: 40. In some embodiments, the second enhancer sequence is SEQ ID NO: 41. In some embodiments, the second enhancer sequence is SEQ ID NO: 42. In some embodiments, the first enhancer sequence comprises SEQ ID NO: 39 and the second enhancer sequence comprises SEQ ID NO: 40, wherein the first enhancer sequenceand the second enhancer sequence are 5 of the core promoter sequence. In someembodiments, the first enhancer sequence comprises SEQ ID NO: 39 and the second enhancer sequence comprises SEQ ID NO: 42, wherein the first enhancer sequence and thesecond enhancer sequence are 5 of the core promoter sequence. In some embodiments, thefirst enhancer sequence comprises SEQ ID NO: 39 and the second enhancer sequence comprises SEQ ID NO: 41, wherein the first enhancer sequence and the second enhancersequence are 5 of the core promoter sequence.In some embodiments, the first enhancer sequence comprises SEQ ID NO: 40 and the second enhancer sequence comprises SEQ ID NO: 39, wherein the first enhancer sequenceand the second enhancer sequence are 5 of the core promoter sequence. In someembodiments, the first enhancer sequence comprises SEQ ID NO: 40 and the second enhancer sequence comprises SEQ ID NO: 42, wherein the first enhancer sequence and thesecond enhancer sequence are 5 of the central sequence. In some embodiments, the firstenhancer sequence comprises SEQ ID NO: 40 and the second enhancer sequence comprises SEQ ID NO: 41, wherein the first enhancer sequence and the second enhancer sequence are5 of the core promoter sequence.In some embodiments, the first enhancer sequence comprises SEQ ID NO: 42 and the second enhancer sequence comprises SEQ ID NO: 39, wherein the first enhancer sequenceand the second enhancer sequence are 5 of the core promoter sequence. In someembodiments, the first enhancer sequence comprises SEQ ID NO: 42 and the second enhancer sequence comprises SEQ ID NO: 40, wherein the first enhancer sequence and the Attorney Docket: GBB-01125second enhancer sequence are 5 of the core promoter sequence. In some embodiments, thefirst enhancer sequence comprises SEQ ID NO: 42 and the second enhancer sequence comprises SEQ ID NO: 41, wherein the first enhancer sequence and the second enhancersequence are 5 of the core promoter sequence.In some embodiments, the first enhancer sequence comprises SEQ ID NO: 41 and the second enhancer sequence comprises SEQ ID NO: 39, wherein the first enhancer sequenceand the second enhancer sequence are 5 of the core promoter sequence. In someembodiments, the first enhancer sequence comprises SEQ ID NO: 41 and the second enhancer sequence comprises SEQ ID NO: 40, wherein the first enhancer sequence and thesecond enhancer sequence are 5 of the core promoter sequence. In some embodiments, thefirst enhancer sequence comprises SEQ ID NO: 41 and the second enhancer sequence comprises SEQ ID NO: 42, wherein the first enhancer sequence and the second enhancersequence are 5 of the core promoter sequence.In some embodiments, the polynucleotides disclosed herein comprise a sequence that is at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, or SEQ ID NO: 48 (see Table 9). In some embodiments, the polynucleotides disclosed herein comprise SEQ ID NO: 44. In some embodiments, the polynucleotides disclosed herein comprise SEQ ID NO: 45. In some embodiments, the polynucleotides disclosed herein comprise SEQ ID NO: 46. In some embodiments, the polynucleotides disclosed herein comprise SEQ ID NO: 47. In some embodiments, the polynucleotides disclosed herein comprise SEQ ID NO: 48. Non-limiting examples of sequences of enhancers are presented in Table 8. In some embodiments, a polynucleotide comprises a promoter, wherein the promoter comprises a core promoter sequence and an enhancer. In some embodiments, an enhancer is a sequence which increases expression from a core promoter; in some embodiments, an enhancer is or comprises a regulatory element. In some embodiments, enhancers are genomic sequences that play a role in regulating tissue-specific gene expression levels. In some embodiments, enhancers are gene-distal cis-regulatory sequences that govern spatiotemporal and quantitative expression dynamics of target genes. In some embodiments, enhancers are widely believed to physically contact the target promoters to effect transcriptional activation. In some embodiments, an enhancer comprises a binding site for a trans-acting factor (e.g., a Attorney Docket: GBB-01125 protein) which also binds to the promoter, or which interacts with another trans-acting factor which binds to the promoter. In some embodiments, the promoter is an RNA polymerase II (Pol2) promoter or an RNA polymerase III (Pol3) promoter. In some embodiments, the polynucleotide is operably linked to a promoter. In some embodiments, an enhancer can be placed 5' or 3' to a core promoter. In some embodiments, in a polynucleotide which comprises the components of an enhancer, a core promoter and a coding sequence, the components can be arranged in any of the following orders, from 5' to 3': enhancer sequence-core promoter-sequence-coding sequence; core- promoter sequence-enhancer sequence-coding sequence; or core-promoter sequence-coding sequence-enhancer sequence. As is known to one of ordinary skill in the art, an enhancer can be located adjacent to a core promoter or up to several kbp (or kb) or more from the core promoter. In some embodiments, the polynucleotide comprises an Enhancer sequence. In some embodiments, the polynucleotide comprises at least one of an Enhancer sequence selected from SEQ ID NOs: 39-42. In some embodiments, a polynucleotide comprises a promoter, wherein the promoter comprises the Enhancer HCe1 (SEQ ID NO: 39). In some embodiments, a polynucleotide comprises a promoter, wherein the promoter comprises the Enhancer HCe2 (SEQ ID NO: 40). In some embodiments, a polynucleotide comprises a promoter, wherein the promoter comprises the Enhancer HCe3 (SEQ ID NO: 42). In some embodiments, a polynucleotide comprises a promoter, wherein the promoter comprises the Enhancer HCe4 (SEQ ID NO: 41). As non-limiting examples: An example promoter comprising HCe1 (SEQ ID NO: 39) is any of PB-TC-0003 (SEQ ID NO: 44), PB-TC-0004 (SEQ ID NO: 45), PB-TC-0005 (SEQ ID NO: 46) or PB-TC- 0007 (SEQ ID NO: 48). An example promoter comprising HCe2 (SEQ ID NO: 40) is any of PB-TC-0004 (SEQ ID NO: 45) or PB-TC-0005 (SEQ ID NO: 46). An example promoter comprising HCe3 (SEQ ID NO: 42) is PB-TC-0006 (SEQ ID NO: 47). Attorney Docket: GBB-01125 An example promoter comprising HCe4 (SEQ ID NO: 41) is PB-TC-0006 (SEQ ID NO: 47). In some aspects, the disclosure provides a polynucleotide comprising an enhancer sequence(s) comprising SEQ ID NOs: 39-42. In some embodiments, a polynucleotide comprises two or more enhancers. In some embodiments, a polynucleotide comprises a promoter, wherein the promoter comprises a core promoter and two or more enhancers. In some embodiments, the polynucleotide comprises at least two of any one of the Enhancer sequences set forth in SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. As non-limiting examples: a promoter comprising two or more enhancers include: PB-TC-0004 (SEQ ID NO: 45), PB-TC-0005 (SEQ ID NO: 46), and PB-TC-0007 (SEQ ID NO: 48). In some aspects, the disclosure provides a polynucleotide comprising an enhancer comprising at least one of Motif Cluster Sequences of SEQ ID NOs: 49-78 (See Table 10). In some embodiments, the disclosure provides a polynucleotide comprising a sequence at least 90% identity of any of SEQ ID NOs: 49-78. In some embodiments, the disclosure provides a polynucleotide comprising an enhancer comprising a sequence at least 90% identity of any of SEQ ID NOs: 49-78. In some embodiments, the disclosure provides a polynucleotide comprising a promoter, wherein the promoter comprises a core promoter and an enhancer comprising a sequence at least 90% identity of any of SEQ ID NOs: 49-78. In some embodiments, the polynucleotide comprises at least two of the motif cluster sequences set forth in SEQ ID NOs: 49-78, wherein the at least two motif cluster sequences are different from each other. In some embodiments, the motif cluster sequence(s) comprise or are comprised within a cis-regulatory element. In some embodiments, the polynucleotide comprises a coding sequence. In some embodiments, the coding sequence is a therapeutic protein. Table 10 Exam le Motif Cluster Se uences Se S S _ _ _ SMALLCLUSTER_F_02_1 TTTCCCAACCCAAGTTTAAAATAAGCAGGCAT 51 Attorney Docket: GBB-01125 SMALLCLUSTER F 02 2 CCTGATATTGGATCTAAAAACGGAATCACTATGTCAT 52 S S S S S S S S S S S S SSS S S S S S S S S S S S MALLCLUSTER_F_22_1 TTG 78 Attorney Docket: GBB-01125 In some embodiments, an enhancer sequence comprises a Motif Cluster Sequence. In some embodiments, a promoter comprises an enhancer. Various Motif Cluster Sequences described herein are comprised within an enhancer, and the enhancer is in turn comprised within a promoter. As non-limiting examples: Motif Cluster Sequence SMALLCLUSTER_F_01_2 (SEQ ID NO: 50) is comprised within Enhancers HCe1 (SEQ ID NO: 39) and HCe4 (SEQ ID NO: 41), which are variously comprised within Pol2 Promoter Sequences PB-TC-0003 (SEQ ID NO: 44), PB-TC-0004 (SEQ ID NO: 45), PB-TC-0005 (SEQ ID NO: 46), PB-TC-0006 (SEQ ID NO: 47), and PB- TC-0007 (SEQ ID NO: 48). Motif Cluster Sequence SMALLCLUSTER_F_02_2 (SEQ ID NO: 52) is comprised within Enhancer HCe4 (SEQ ID NO: 41), which is comprised within Pol2 Promoter Sequence PB-TC-0006 (SEQ ID NO: 47). Motif Cluster Sequence SMALLCLUSTER_F_04_1 (SEQ ID NO: 54) is comprised within Enhancers HCe1 to 4 (SEQ ID NOs: 39 to 42, respectively), which are variously comprised within Pol2 Promoter Sequences PB-TC-0003 (SEQ ID NO: 44), PB-TC-0004 (SEQ ID NO: 45), PB-TC-0005 (SEQ ID NO: 46), PB-TC-0006 (SEQ ID NO: 47), and PB- TC-0007 (SEQ ID NO: 48). Motif Cluster Sequence SMALLCLUSTER_F_05_1 (SEQ ID NO: 55) is comprised within Enhancer HCe1 (SEQ ID NO: 39), which is comprised within Pol2 Promoter Sequences PB-TC-0003 (SEQ ID NO: 44), PB-TC-0004 (SEQ ID NO: 45), PB-TC-0005 (SEQ ID NO: 46), and PB-TC-0007 (SEQ ID NO: 48). Motif Cluster Sequence SMALLCLUSTER_F_06_1 (SEQ ID NO: 57) is comprised within Enhancers HCe2 (SEQ ID NO: 40) and HCe3 (SEQ ID NO: 42), which are variously comprised within Pol2 Promoter Sequences PB-TC-0003 (SEQ ID NO: 44), PB-TC-0005 (SEQ ID NO: 46), and PB-TC-0006 (SEQ ID NO: 47). Motif Cluster Sequence SMALLCLUSTER_F_09_1 (SEQ ID NO: 61) is comprised within Enhancers HCe1 (SEQ ID NO: 39) and HCe4 (SEQ ID NO: 41), which are variously comprised within Pol2 Promoter Sequences PB-TC-0003 (SEQ ID NO: 44), PB-TC-0004 (SEQ ID NO: 45), PB-TC-0005 (SEQ ID NO: 46), PB-TC-0006 (SEQ ID NO: 47), and PB- TC-0007 (SEQ ID NO: 48). Attorney Docket: GBB-01125 Motif Cluster Sequence SMALLCLUSTER_F_10_1 (SEQ ID NO: 62) is comprised within Enhancers HCe2 (SEQ ID NO: 40) and HCe4 (SEQ ID NO: 41), which are variously comprised within Pol2 Promoter Sequences PB-TC-0003 (SEQ ID NO: 44), PB-TC-0005 (SEQ ID NO: 46), and PB-TC-0006 (SEQ ID NO: 47). Motif Cluster Sequence SMALLCLUSTER_F_12_1 (SEQ ID NO: 65) is comprised within Enhancer HCe2 (SEQ ID NO: 40), which is comprised within Pol2 Promoter Sequences PB-TC-0003 (SEQ ID NO: 44), and PB-TC-0005 (SEQ ID NO: 46). Motif Cluster Sequence SMALLCLUSTER_F_15_1 (SEQ ID NO: 69) is comprised within Enhancer HCe3 (SEQ ID NO: 42), which is comprised within Pol2 Promoter Sequence PB-TC-0006 (SEQ ID NO: 47). Motif Cluster Sequence SMALLCLUSTER_F_21_1 (SEQ ID NO: 77) is comprised within Enhancer HCe3 (SEQ ID NO: 42), which is comprised within Pol2 Promoter Sequence PB-TC-0006 (SEQ ID NO: 47). In some embodiments, an enhancer sequence comprises more than one copy of a Motif Cluster Sequence. In some embodiments, an enhancer sequence comprises more than one copy of each of two or more Motif Cluster Sequences. In some embodiments, a promoter sequence comprises more than one copy of a Motif Cluster Sequence. In some embodiments, a promoter sequence comprises more than one copy of each of two or more Motif Cluster Sequences. As non-limiting examples: Promoter Sequence PB-TC-0007 (SEQ ID NO: 48) comprises 2 copies of Motif Cluster Sequence SMALLCLUSTER_F_04_1 (SEQ ID NO: 54). Promoter Sequence PB-TC-0006 (SEQ ID NO: 47) comprises 3 copies of Motif Cluster Sequence SMALLCLUSTER_F_04_1 (SEQ ID NO: 54). Promoter Sequence PB-TC-0004 (SEQ ID NO: 45) comprises 4 copies of Motif Cluster Sequence SMALLCLUSTER_F_04_1 (SEQ ID NO: 54). Promoter Sequence PB-TC-0005 (SEQ ID NO: 46) comprises 4 copies of Motif Cluster Sequence SMALLCLUSTER_F_04_1 (SEQ ID NO: 54). In some embodiments, the polynucleotide comprises a coding sequence. In some embodiments, the coding sequence encodes a therapeutic protein. In some embodiments, the polynucleotide encodes an mRNA, a gRNA, a sgRNA, or an RNAi agent. In some embodiments, the Pol2 promoter is SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, or SEQ ID NO: 48 (See Table 9). In some embodiments, the Attorney Docket: GBB-01125 Pol3 promoter is SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, or SEQ ID NO: 95 (See Table 12). Table 7A. Example Pol2 Promoter Core Sequences Core Promoter Sequence SEQ ID Se Table 7B. Additional Example Pol2 Promoter Core Sequences C Se TATACCAGATCTAAGCCTGGGAGCTCTCTGGCTAACT Table 8 Exam le Enhancer Se uences E N AAAATTCTTACATGGTCTATTTATGTGTGGGTGCTGATGATCT Attorney Docket: GBB-01125 ATTTATAGAACTGTGGTGGTGCTGATGATCTATTTATAGAACT Table 9. Example Pol2 Promoter SequencesSe GCCGCCGGCCGGCCGCCTCCTCCGTGCGCCCGCCAGCCTCGCC Attorney Docket: GBB-01125 CGCGCCGTCACCATTCTACCACCACCTCCACAGCACAGACAG CC C GC C G C G C C C GG GCC GCC G In some embodiments, the first enhancer sequence is 5 of the second enhancersequence. In some embodiments, the polynucleotide is an RNA polymerase II (Pol2) promoter. In some embodiments, the polynucleotide comprises a coding sequence. In some embodiments, the coding sequence encodes a therapeutic protein. In some embodiments, a Pol2 promoter is any one of: PB-TC-0003 (SEQ ID NO: 44), PB-TC-0004 (SEQ ID NO: 45), PB-TC-0005 (SEQ ID NO: 46), PB-TC-0006 (SEQ ID NO: Attorney Docket: GBB-01125 47), or PB-TC-0007 (SEQ ID NO: 48). In some embodiments, the sequence of a Pol2 promoter is or comprises the sequence of any one of: PB-TC-0003 (SEQ ID NO: 44), PB-TC- 0004 (SEQ ID NO: 45), PB-TC-0005 (SEQ ID NO: 46), PB-TC-0006 (SEQ ID NO: 47), or PB-TC-0007 (SEQ ID NO: 48). In some embodiments, the sequence of a Pol2 promoter is at least 90% identical to the sequence of any one of: PB-TC-0003 (SEQ ID NO: 44), PB-TC- 0004 (SEQ ID NO: 45), PB-TC-0005 (SEQ ID NO: 46), PB-TC-0006 (SEQ ID NO: 47), or PB-TC-0007 (SEQ ID NO: 48). Non-limiting examples of Pol2 promoters are presented in Table 9. In some embodiments, a polynucleotide comprising SEQ ID NO: 36 or 37 further comprises a coding sequence (e.g., any protein coding sequence disclosed herein, including a DNA or RNA sequence encoding a protein encoding sequence). In some embodiments, a polynucleotide comprising any one of SEQ ID NO: 33 to 35 further comprises a heterologous polynucleotide, e.g., a coding sequence (e.g., any protein coding sequence disclosed herein, including a DNA or RNA sequence encoding a protein encoding sequence). In some embodiments, a polynucleotide comprising any one or more of SEQ ID NO: 39-42 further comprises a protein coding sequence (e.g., any protein coding sequence disclosed herein, including a DNA or RNA sequence encoding a protein encoding sequence). In some embodiments, a polynucleotide comprising any one or more of SEQ ID NO: 44-48 further comprises a protein coding sequence (e.g., any protein coding sequence disclosed herein, including a DNA or RNA sequence encoding a protein encoding sequence). In some embodiments, the protein coding sequence encodes for a therapeutic protein disclosed herein, such as an antibody or antibody fragment. Also included herein are polynucleotides comprising SEQ ID NO: 36 or 37 and a gene of interest. Also included herein are polynucleotides comprising any one or more of SEQ ID NO: 33-35 and a heterologous polynucleotide, e.g., a gene of interest. Also included herein are polynucleotides comprising any one of SEQ ID NO: 44-48 and a gene of interest.In some embodiments, the gene of interest is flanked by a 5 UTR or a 3 UTR sequencedisclosed herein. In some embodiments, the gene of interest is flanked by any one of SEQ ID NOs: 28-32 or 164-183 and / or any one of SEQ ID NOs: 13-20 or 119-142 disclosed herein. In some embodiments, the polynucleotide is a cis-regulatory element. In some embodiments, a cis-regulatory element alters the expression or regulation of another genetic component (e.g., a promoter, coding sequence, etc.) on the same nucleic acids; in some embodiments, a cis-regulatory element comprises a binding site for a trans-acting factor Attorney Docket: GBB-01125 (including but not limited to a protein) which also directly interacts with (e.g., binds to a binding in or near) the other genetic component or which indirectly interacts with the other genetic component by binding to another trans-acting factor which binds to the other genetic component. RNA Polymerase III Promoter Sequences RNA Polymerase (Pol) III is an RNA polymerase reportedly specialized for the transcription of untranslated RNAs. In some embodiments, core promoters can be used incombination with other regulatory elements, such as 3 UTRs, 5 UTRs, cis-elements,enhancers, and / or introns, for example, by adding a heterologous regulatory element to a core promoter with its own partial or complete regulatory elements. Without wishing to be bound by any particular theory, the present disclosure notes that Pol3 promoters reportedly often transcribe housekeeping genes (e.g., 5S ribosomal RNA, tRNA, and other small RNAs), whose expression is required in all cell types and most environmental conditions; and Pol3 transcription reportedly generally requires fewer regulatory proteins than Pol2 promoters. Several Pol3 promoters (e.g., sequences comprising a Pol3 core promoters) have been reported in the art which do not require and are not normally associated with the presence of an enhancer sequence. In addition, without wishing to be bound by any particular theory, the present disclosure notes that several Pol3 promoters are known in the art which do not require and are not normally associated with the presence of a 5' UTR or 3' UTR. In some embodiments, a Pol3 promoter comprises a Pol3 core promoter. Non-limiting examples of Pol3 core promoters are: PB-CA-0039 (SEQ ID NO: 79), PB-CA-0040 (SEQ ID NO: 80), PB-CA-0008 (SEQ ID NO: 81), PB-CA-0009 (SEQ ID NO: 82), PB-CA-0011 (SEQ ID NO: 83), PB-CA-0012 (SEQ ID NO: 84), PB-CA-0010 (SEQ ID NO: 85), and PB- CA-0130 (SEQ ID NO: 86). In some embodiments, the sequence of a core promoter is or comprises the sequence of any of: PB-CA-0039 (SEQ ID NO: 79), PB-CA-0040 (SEQ ID NO: 80), PB-CA-0008 (SEQ ID NO: 81), PB-CA-0009 (SEQ ID NO: 82), PB-CA-0011 (SEQ ID NO: 83), PB-CA-0012 (SEQ ID NO: 84), PB-CA-0010 (SEQ ID NO: 85), and PB- CA-0130 (SEQ ID NO: 86). In some embodiments, the sequence of a core promoter is at least 90% identical to the sequence of any of: PB-CA-0039 (SEQ ID NO: 79), PB-CA-0040 (SEQ ID NO: 80), PB-CA-0008 (SEQ ID NO: 81), PB-CA-0009 (SEQ ID NO: 82), PB-CA- 0011 (SEQ ID NO: 83), PB-CA-0012 (SEQ ID NO: 84), PB-CA-0010 (SEQ ID NO: 85), and Attorney Docket: GBB-01125 PB-CA-0130 (SEQ ID NO: 86). Non-limiting examples of Pol3 core promoters are presented in Table 11. In some embodiments, a Pol3 promoter comprises a Pol3 core promoter and a 3' constant region. In some embodiments, the polynucleotide comprises the 3 constant region sequence:ATTCTACCACCACCTCCACAGCACAGACAGACACTCAGGAGCCAGCCAG (SEQ IDNO: 38). In some embodiments, the sequence of the 3 constant region sequence is orcomprises the sequence of: ATTCTACCACCACCTCCACA GCACAGACAGACACTCAGGAGCCAGCCAG (SEQ ID NO: 38). In some embodiments,the sequence of the 3 constant region sequence is at least 90% identical to the sequence of:ATTCTACCACCACCTCCACAGCACA GACAGACACTCAGGAGCCAGCCAG (SEQ ID NO: 38). In some embodiments, the sequence of a core Pol3 promoter comprises or is the sequence of PB-CA-0039 (SEQ ID NO: 79), PB-CA-0040 (SEQ ID NO: 80), PB-CA-0008 (SEQ ID NO: 81), PB-CA-0009 (SEQ ID NO: 82), PB-CA-0011 (SEQ ID NO: 83), PB-CA- 0012 (SEQ ID NO: 84), PB-CA-0010 (SEQ ID NO: 85), or PB-CA-0130 (SEQ ID NO: 86). In some embodiments, the sequence of a core Pol3 promoter is at least 90% identical to the sequence of PB-CA-0039 (SEQ ID NO: 79), PB-CA-0040 (SEQ ID NO: 80), PB-CA-0008 (SEQ ID NO: 81), PB-CA-0009 (SEQ ID NO: 82), PB-CA-0011 (SEQ ID NO: 83), PB-CA- 0012 (SEQ ID NO: 84), PB-CA-0010 (SEQ ID NO: 85), or PB-CA-0130 (SEQ ID NO: 86). Therefore, in certain aspects, provided herein are polynucleotides comprising a core sequence (e.g., a core promoter sequence) that is at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, or SEQ ID NO: 86 (See Table 11). In some embodiments, the polynucleotide comprises a core promoter sequence of SEQ ID NO: 79. In some embodiments, the polynucleotide comprises a core promoter sequence of SEQ ID NO: 80. In some embodiments, the polynucleotide comprises a core promoter sequence of SEQ ID NO: 81. In some embodiments, the polynucleotide comprises a core promoter sequence of SEQ ID NO: 82. In some embodiments, the polynucleotide comprises a core promoter sequence of SEQ ID NO: 83. In some embodiments, the polynucleotide comprises a core promoter sequence of SEQ ID NO: 84. In some embodiments, the polynucleotide Attorney Docket: GBB-01125 comprises a core promoter sequence of SEQ ID NO: 85. In some embodiments, the polynucleotide comprises a core promoter sequence of SEQ ID NO: 86. In some embodiments, a Pol3 promoter comprises a Pol3 core promoter. In some embodiments, a Pol3 promoter comprises a Pol3 core promoter and a Pol3 constant region. In some embodiments, a Pol3 promoter comprises, in 5' to 3' order, a Pol3 core promoter and a Pol3 constant region. In some embodiments, the sequence of a Pol3 constant region comprises or is the sequence of GGAAAGGACGAAACACCG (SEQ ID NO: 87). In some embodiments, the sequence of a Pol3 constant region has 90% or more identity to the sequence of GGAAAGGACGAAACACCG (SEQ ID NO: 87). In some embodiments, the polynucleotide comprises a constant region sequence of GGAAAGGACGAAACACCG (SEQ ID NO: 87)positioned 3 of the core promoter sequence.Non-limiting examples of Pol3 promoters comprising a Pol3 core promoter and a Pol3 constant region are: PB-TC-0030 (SEQ ID NO: 88), PB-TC-0031 (SEQ ID NO: 89), PB-TC- 0032 (SEQ ID NO: 90), PB-TC-0033 (SEQ ID NO: 91), PB-TC-0034 (SEQ ID NO: 92), PB- TC-0035 (SEQ ID NO: 93), PB-TC-0036 (SEQ ID NO: 94), and PB-TC-0037 (SEQ ID NO: 95). In some embodiments, the sequence of a Pol3 promoter is or comprises the sequence of PB-TC-0030 (SEQ ID NO: 88), PB-TC-0031 (SEQ ID NO: 89), PB-TC-0032 (SEQ ID NO: 90), PB-TC-0033 (SEQ ID NO: 91), PB-TC-0034 (SEQ ID NO: 92), PB-TC-0035 (SEQ ID NO: 93), PB-TC-0036 (SEQ ID NO: 94), or PB-TC-0037 (SEQ ID NO: 95). In some embodiments, the sequence of a Pol3 promoter comprises a sequence that is at least 90% identical to that of PB-TC-0030 (SEQ ID NO: 88), PB-TC-0031 (SEQ ID NO: 89), PB-TC- 0032 (SEQ ID NO: 90), PB-TC-0033 (SEQ ID NO: 91), PB-TC-0034 (SEQ ID NO: 92), PB- TC-0035 (SEQ ID NO: 93), PB-TC-0036 (SEQ ID NO: 94), or PB-TC-0037 (SEQ ID NO: 95). In some embodiments, the polynucleotide comprises a sequence that is at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, or SEQ ID NO: 95 (See Table 12). In some embodiments, the polynucleotide comprises SEQ ID NO: 88. In some embodiments, the polynucleotide comprises SEQ ID NO: 89. In some embodiments, the polynucleotide comprises SEQ ID NO: 90. In some embodiments, the polynucleotide Attorney Docket: GBB-01125 comprises SEQ ID NO: 91. In some embodiments, the polynucleotide comprises SEQ ID NO: 92. In some embodiments, the polynucleotide comprises SEQ ID NO: 93. In some embodiments, the polynucleotide comprises SEQ ID NO: 94. In some embodiments, the polynucleotide comprises SEQ ID NO: 95. Non-limiting examples of Pol3 promoters are presented in Table 12. Table 11. Example Pol3 Promoter Core Sequences Core Promoter Sequence SEQ ID Se GGCTTTATATATCTCGT Attorney Docket: GBB-01125 PB-CA-0130 GATTTCCCATGATTCCTTCTAATTTGCATACTCACCGTAACTTA 86 Table 12. Example Pol3 Promoter Sequences Sequence Name Sequence SEQ ID CGAAACACCG Attorney Docket: GBB-01125 In some embodiments, optional adapters, linkers and additional sequences can be freely interposed between, 5' to, or 3' to any of the components of a Pol3 promoter (e.g., a Pol3 core promoter or Pol3 constant region) and / or any other component of a polynucleotide (e.g., a coding sequence). As non-limiting examples, a Pol3 promoter can comprise, in 5' to 3' order: additional sequence-Pol3 core promoter-additional sequence-Pol3 constant region-additional sequence; linker-Pol3 core promoter-Pol3 constant region-additional sequence; additional sequence- Pol3 core promoter-linker-Pol3 constant region; Pol3 core promoter-Pol3 constant region- linker; Pol3 core promoter-Pol3 constant region-additional sequence; adapter-Pol3 core promoter-linker-Pol3 constant region; additional sequence-Pol3 core promoter-Pol3 constant region-linker-linker; Pol3 core promoter-Pol3 constant region-additional sequence-linker; adapter-Pol3 core promoter-Pol3 constant region; Pol3 core promoter-adapter-Pol3 constant region-linker; adapter-Pol3 core promoter-additional sequence-Pol3 constant region-adapter; or Pol3 core promoter-Pol3 constant region-adapter. As non-limiting examples, a polynucleotide can comprise, in 5' to 3' order: additional sequence-Pol3 core promoter-additional sequence-Pol3 constant region-additional sequence- coding sequence-additional sequence; linker-Pol3 core promoter-Pol3 constant region-coding sequence-additional sequence; additional sequence-Pol3 core promoter-linker-Pol3 constant region-coding sequence; Pol3 core promoter-Pol3 constant region-linker-coding sequence; Pol3 core promoter-Pol3 constant region-additional sequence-coding sequence; adapter-Pol3 core promoter-linker-Pol3 constant region-coding sequence; additional sequence-Pol3 core promoter-Pol3 constant region-linker-coding sequence-linker; Pol3 core promoter-Pol3 constant region-additional sequence-coding sequence-linker; adapter-Pol3 core promoter- Pol3 constant region-coding sequence; Pol3 core promoter-adapter-Pol3 constant region- linker-coding sequence; adapter-Pol3 core promoter-additional sequence-Pol3 constant region-adapter-coding sequence; or Pol3 core promoter-Pol3 constant region-coding sequence-adapter. In some embodiments, the polynucleotide comprises a polymerase III (Pol3) promoter. In some embodiments, the polynucleotide encodes an mRNA, a gRNA, a sgRNA, or an RNAi agent. In some embodiments, the polynucleotide is operably linked to a sequence encodingan RNA comprising a 3 UTR and / or a 5 UTR as herein disclosed. In some embodiments, the Attorney Docket: GBB-01125 polynucleotide (e.g., an RNA) encodes a therapeutic protein. In some embodiments, the polynucleotide (e.g., an RNA) encodes a nuclease, e.g., a Cas nuclease. In some embodiments, the polynucleotide is operably linked to a sequence encoding a guide RNA. In some embodiments, the polynucleotide is operably linked to a sequence encoding a short interfering RNA. In some embodiments, the polynucleotide is operably linked to a sequence encoding an antisense RNA. In some embodiments, the core promoter is operably linked to a sequence encoding a guide RNA. In some embodiments, the core promoter is operably linked to a sequence encoding a short interfering RNA. In some embodiments, the core promoter is operably linked to a sequence encoding an antisense RNA. In some embodiments, the promoter is operably linked to a sequence encoding a guide RNA. In some embodiments, the promoter is operably linked to a sequence encoding a short interfering RNA. In some embodiments, the promoter is operably linked to a sequence encoding an antisense RNA. In some embodiments, polynucleotides comprising SEQ ID NO: 79-86 also comprise an RNA sequence (e.g., any RNA disclosed herein, or a DNA coding an RNA disclosed herein). In some embodiments, polynucleotides comprising SEQ ID NO: 88-95 also comprise an RNA sequence (e.g., any RNA disclosed herein, or a DNA coding an RNA disclosed herein). In some embodiments, the RNA is a sgRNA or gRNA. In some embodiments, the polynucleotide is an RNA. In some embodiments, the RNA is a tRNA sequence. In some embodiments, the RNA is a ribosomal RNA sequence (e.g., a 5S RNA sequence). In some embodiments, the RNA is a snRNA sequence. In some embodiments, the RNA is a small nucleolar RNAs (snoRNAs) sequence. In some embodiments, the RNA is a small nuclear RNAs (snRNAs) sequence. Transfer RNA (abbreviated tRNA) is a small RNA molecule that plays a key role in protein synthesis. Transfer RNA serves as a link (or adaptor) between the messenger RNA (mRNA) molecule and the growing chain of amino acids that make up a protein. Each time an amino acid is added to the chain, a specific tRNA pairs with its complementary sequence on the mRNA molecule, ensuring that the appropriate amino acid is inserted into the protein being synthesized. In certain aspects, the disclosure provides a polynucleotide comprising an enhancer sequence that is at least 90% identical to SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. Attorney Docket: GBB-01125 In certain aspects, the disclosure provides a polynucleotide comprising an enhancer sequence selected from any one of the sequences set forth in SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. In certain aspects, the disclosure provides a polynucleotide comprising at least two of any of the enhancer sequences set forth in SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. In some embodiments, the polynucleotide further comprises a core promoter sequence, wherein the core promoter sequence is or comprises any of SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37. In some embodiments, the at least one enhancer sequence is operably linked to the core promoter sequence. In some embodiments, the core promoter sequence is any of SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37. In some embodiments, the core promoter sequence is SEQ ID NO: 36 or SEQ ID NO: 37. In some embodiments, the core promoter sequence is SEQ ID NO: 36. In some embodiments, the core promoter sequence is SEQ ID NO: 37. In some embodiments, the polynucleotide further comprises a cis-regulatory element. Constructs In certain aspects, the disclosure provides a construct comprising and / or encoding any of the herein described polynucleotide (e.g., RNA) molecules. In some embodiments, any of the herein described polynucleotide (e.g., RNA) molecules can be used in a CRISPR system. In some embodiments, a polynucleotide comprising any of the herein described Pol3 promoter sequences is operably linked to a guide RNA. In some embodiments, a polynucleotide comprising any of the herein described Pol3 promoter sequences is operably linked to a short interfering RNA. In some embodiments, a polynucleotide comprising any of the herein described Pol3 promoter sequences is operably linked to a sequence encoding an antisense RNA. In some embodiments, a polynucleotide comprising any of the Pol2 promoters described herein is operably linked to a gene encoding a nuclease, e.g., a Cas gene. In some embodiments, a polynucleotide comprising any of the herein described Pol2 promoter sequences is operably linked to a short interfering RNA. In some embodiments, a polynucleotide comprising any of the herein described Pol2 promoter sequences is operably linked to a sequence encoding an antisense RNA. Attorney Docket: GBB-01125 In some embodiments, the gene encoding a nuclease (e.g., a Cas gene) and the Pol2 promoter may be encoded by the same construct. In some embodiments, the gene encoding anuclease (e.g., a Cas gene) and the Pol2 promoter are flanked by any one of the 3 UTRand / or 5 UTR sequences herein described. In some embodiments, the Pol3 promoter and thePol2 promoters are encoded by the same construct. In some embodiments, the Pol3 and Pol2 promoters are encoded by separate constructs. In some embodiments, provided herein are DNA plasmids and viral replicating vectors comprising nucleic acid sequences encoding the polynucleotide (e.g., RNA) molecules as described above and herein. In some embodiments, the entire size of the DNA plasmids designed are from about 2000 bp to about 15,000 bp (e.g., about 5,000 bp, about 6,000 bp, about 7,000 bp, about 8,000 bp, about 9,000 bp, about 10,000 bp, about 12,000 bp, about 14,000 bp, about 15,000 bp, about 16,000 bp, about 17,000 bp, about 18,000 bp, about 19,000 bp, or about 20,000 bp). Generally, the plasmid backbone comprises an origin of replication and an expression cassette for expressing a sequence of interest and / or a selection gene. In some embodiments, the expression cassette for expressing a selection gene is in the antisense orientation from the central ribozyme. The selection gene can be any marker known in the art for selection of a host cell that has been transformed with a desired plasmid. In some embodiments, the selection marker comprises a polynucleotide encoding a gene or protein conferring antibiotic resistance, heat tolerance, fluorescence, or luminescence. In some embodiments, viral replicating vectors can be used to express the polynucleotide (e.g., RNA) constructs as described. In planta, gemini viruses are a representative DNA virus that can be used as an expression system (reviewed in, e.g., Hefferon, Vaccines (2014) 2:642-53). In animal cells, there are more choices. In some embodiments, plasmid expression constructs containing viral origins of replication, while not truly viral replicating systems, are stably maintained in cells. In some embodiments, truly replicating viral systems of use include, without limitation, adenovirus, adeno-associated virus, baculovirus, and Vaccinia virus vectors, which are known in the art. In some aspects, the one or more DNA constructs, as described above and herein, are first transcribed in vitro into RNA and then the RNA transcript is transfected into a host cell. The cell may be an epithelial cell. The cell may be a muscle cell. The step of transcribing the one or more DNA constructs into RNA in vitro can be performed using any methodologies known in the art. In vitro transcription of one or more (e.g., a population of) DNA constructs comprising a library of inserts containing a nucleic acid sequence of interest can be achieved Attorney Docket: GBB-01125 using purified RNA polymerases, e.g., T7 RNA polymerase. Such methodologies are described in, e.g., Green and Sambrook, Molecular Cloning, A Laboratory Manual, 4thEd., Cold Spring Harbor Press, (2012). In some aspects, the disclosure provides a cell comprising any of the herein described polynucleotide (e.g., RNA) molecules, polynucleotides and constructs. In certain aspects, the disclosure provides a polynucleotide comprising a 3' untranslated region (3' UTR) sequence comprising a core UTR sequence that is at least 90% identical to any of SEQ ID NOs: 97 or 107, and (b) a heterologous polynucleotide. In certain aspects, the disclosure provides a polynucleotide comprising a Pol2 core promoter sequence which is or comprises the sequence of any one of: SEQ ID NOs: 33, 34, 35, 36, or 37, and (b) a heterologous polynucleotide. In certain aspects, the disclosure provides a polynucleotide comprising (a) a Pol2 core promoter sequence which has a sequence at least 90% identical to the sequence of any one of: SEQ ID NOs: 33, 34, 35, and (b) a heterologous polynucleotide. AAV Vectors In some embodiments, provide herein are an adeno-associated virus (AAV) vector comprising a DNA sequence encoding a polynucleotide (e.g., RNA) disclosed herein. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) present a review of adenovirus-based gene therapy. In some embodiments, the AAV vector comprises a DNA sequence encoding thepolynucleotide (e.g., RNA) of the 3 UTR (See Tables 1-3) and / or 5 UTR (See Tables 4A,4B, 5, and 6) disclosed herein. In some embodiments, the AAV vector comprises a DNA sequence encoding the polynucleotide (e.g., RNA) of the Pol2 promoter disclosed herein (See Tables 7A-7B and Table 9). In some embodiments, the AAV vector comprises a DNA sequence encoding the motif clusters disclosed herein (See Table 10). In some embodiments, the AAV vector comprises a DNA sequence encoding the polynucleotide (e.g., RNA) of the Pol3 promoter disclosed herein (See Table 11 and Table 12). In some embodiments, the AAV vector comprises a DNA sequence encoding the polynucleotide (e.g., RNA) of the enhancer(s) disclosed herein (See Table 8). The adeno-associated virus is a non-pathogenic parvovirus, consisting of a 4.7 kb single-stranded DNA genome, with no envelope icosahedral capsid. The genome contains Attorney Docket: GBB-01125 three open reading frames (ORFs) flanked by inverted terminal repeats (ITRs) that function as a replication and packaging signal of viral origin. Rep ORF encodes four non-structural proteins that play a role in virus replication, transcriptional regulation, site-specific integration, and virion assembly. Cap ORF encodes three structural proteins (VP 1-3), which are assembled to form a 60-dimensional viral capsid. Finally, ORF, present as an alternative reading frame in the cap gene, produces assembly activating protein (AAP), a viral protein that localizes AAV capsid proteins into the nucleolus and functions during capsid assembly. There are several natural ("wild type") serotypes and more than 100 known AAV variants, each of which differs in amino acid sequence, especially in the hypervariable regions of capsid proteins, and thus in its gene delivery properties. No association has been found between any AAV and any human disease, which makes recombinant AAV attractive for clinical applications. For the purposes of the description herein, the term “AAV” is an abbreviation for adeno-associated virus, including, in some embodiments, without limitation, the virus itself and its derivatives. Except where otherwise indicated, the terminology refers to all subtypes or serotypes, and both replication-competent and recombinant forms. The term “AAV” includes, without limitation, AAV type 1 (AAV-1 or AAV1), AAV type 2 (AAV-2 or AAV2), AAV type 3A (AAV-3A or AAV3A), AAV type 3B (AAV-3B or AAV3B), AAV type 4 (AAV-4 or AAV4), AAV type 5 (AAV-5 or AAV5), AAV type 6 (AAV-6 or AAV6), AAV type 7 (AAV-7 or AAV7), type AAV 8 (AAV-8 or AAV8), AAV type 9 (AAV-9 or AAV9), AAV type 10 (AAV-10 or AAV10 or AAVrh10), avian AAV, bovine AAV, canine AAV, goat AAV, equine AAV, AAV primacy, AAV is not primate, and sheep AAV. “Primate AAV” refers to AAV that infects primates, “Primate AAV” refers to AAV that infects non-primate mammals, In some embodiments, an AAV vector that expresses a nucleic acid agent encoding a interferon peptide is a recombinant AAV vector having, for example, either an U6 or H1 RNA promoter, or a cytomegalovirus (CMV) promoter. The sequence for the U6 (e.g., as used in the data shown in FIG. 7 is: GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTA GAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATA CGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTT AAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTT ATATATCTTGTGGAAAGGACGAAACACCG, SEQ ID NO: 184). Attorney Docket: GBB-01125 Suitable AAV vectors for use in agents, compositions, and methods described include, but are not limited to AAVs described in Passini et al., Methods Mol. Biol. 246: 225-36 (2004). Genomic sequences of various AAV serotypes, as well as sequences of native terminal repeats (TRs), Rep proteins and capsid subunits, are known in the art and included in the present disclosure. Such sequences can be found in the literature or in public databases such as GenBank. See, for example, GenBank access numbers NC_002077.1 (AAV1), AF063497.1 (AAV1), NC_001401.2 (AAV2), AF043303.1 (AAV2), J01901.1 (AAV2), U48704.1 (AAV3A), NC_001729.1 (AAV3A), AF028705.1 (AAV3B), NC_001829.1 (AAV4), U89790.1 (AAV4), NC_006152.1 (AA5), AF085716.1 (AAV-5), AF028704.1 (AAV6) , NC_006260.1 (AAV7), AF513851.1 (AAV7), AF513852.1 (AAV8) NC_006261.1 (AAV-8), AY530579.1 (AAV9), AAT46337 (AAV10) and AAO88208 (AAVrh10); the descriptions of which are incorporated herein by reference. See also, for example, Srivistava et al. (1983) J. Virology 45: 555; Chiorini et al. (1998) J. Virology 71: 6823; Chiorini et al. (1999) J. Virology 73: 1309; Bantel-Schaal et al. (1999) J. Virology 73: 939; Xiao et al. (1999) J. Virology 73: 3994; Muramatsu et al. (1996) Virology 221: 208; Shade et al. (1986) J. Virol. 58: 921; Gao et al. (2002) Proc. Nat. Acad Sci. USA 99: 11854; Moris et al. (2004) Virology 33: 375-383; international patent publications WO 00 / 28061, WO 99 / 61601, WO 98 / 11244; and US Pat. US No. 6156303. The sequences of naturally occurring cap (capsid) proteins associated with AAV serotypes are known in the art and include those described herein as AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 and AAVrh10. Also included herein are AAV variants for targeting cells and / or tissues of interest. The terms “AAV capsid protein variant” or “AAV variant” refer to an AAV capsid protein containing an amino acid sequence that includes at least one modification or substitution (including deletion, insertion, point mutation, etc.) compared to the sequence a naturally occurring, or wild-type AAV capsid protein sequence. An AAV capsid protein variant may have about 80% identity or more of the wild-type capsid protein amino acid sequence, for example 85% or more, 90% identity or more, or 95% identity or more for the wild-type capsid protein amino acid sequence, for example 98 % or 99% identity with wild-type capsid protein. The AAV capsid protein variant may be a non-wild type capsid protein. Also provided herein are AAV platforms that deliver a nucleic acid encoding at least one interferon peptide. Also included are isolated nucleic acids comprising a nucleotide Attorney Docket: GBB-01125 sequence that encodes an AAV capsid protein variant as described above. An isolated nucleic acid may be an AAV vector, for example, a recombinant AAV vector. The term "rAAV" is an abbreviation that refers to a recombinant adeno-associated virus. "Recombinant" as applied to a polynucleotide means that the polynucleotide is the product of various combinations of the cloning, restriction or ligation steps and other procedures that result in a construct different from the polynucleotide found in nature. A recombinant virus is a viral particle containing a recombinant polynucleotide. The terms respectively include replicates of the original polynucleotide construct and offspring of the original viral construct. The term “rAAV vector” embraces rAAV virions (i.e., viral particles of rAAV) (e.g., an infectious rAAV virion), which by definition include an rAAV polynucleotide; and also encompasses polynucleotides encoding rAAV (e.g., a single- stranded polynucleotide encoding rAAV (sc-rAAV), a double-stranded polynucleotide encoding rAAV (dc-rAAV), for example, plasmids encoding rAAV; and the like). If the AAV virion contains a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, for example, a transgene that must be delivered to the target cell), it is usually called the "recombinant AAV (rAAV) virion" or "viral particle rAAV". In general, a heterologous polynucleotide is flanked by at least one and, as a rule, two inverted AAV terminal repeat sequences (ITRs). In some embodiments of the rAAV vector embodiment described herein, a nucleotide sequence encoding a gene product of interest is operably linked to a constitutive promoter. Suitable constitutive promoters include, for example, the cytomegalovirus (CMV) promoter (Stinski et al. (1985) Journal of Virology 55 (2): 431-441), the chicken early -actin (CBA) promoter / rabbit -globin intron (CAG) (Miyazaki et al. (1989) Gene 79 (2): 269-277, CB SB (Jacobson et al. (2006) Molecular Therapy 13 (6): 1074-1084), human elongation factor1 promoter (EF1 ) (Kim et al. (1990) Gene 91 (2): 217-223), human phosphoglyceratekinase (PGK) promoter (Singer-Sam et al. (1984) Gene 32 (3): 409-417, heavy chain mitochondrial promoter (Loderio et al. (2012) PNAS 109 (17): 6513-6518), the ubiquitin promoter (Wulff et al. (1990) FEBS Letters 261: 101-105). In other embodiments, the nucleotide sequence encoding the protein of interest is operably linked to an inducible promoter. In some cases, a nucleotide sequence encoding a gene product of interest is operably linked to a tissue-specific or cell-specific regulatory element. The term "auxiliary virus" for AAV refers to a virus that allows AAV (e.g., wild-type AAV) to replicate and pack using mammalian cells. Many such auxiliary viruses for AAV Attorney Docket: GBB-01125 are known in the art, including adenoviruses, herpes viruses and poxviruses, such as smallpox. Adenoviruses cover a number of different subgroups, although type 5 adenovirus subgroup C is most commonly used. Numerous human, non-human, and avian adenoviruses are known and accessible from repositories such as ATCC. Herpes viruses include, for example, herpes simplex viruses (HSV) and Epstein-Barr viruses (EBV), as well as cytomegaloviruses (CMV) and Aujeszky's disease viruses (PRV); which are also available at depositories such as ATCC. Modified Bases The nucleic acid molecules disclosed herein (e.g., the RNA molecules and the polynucleotides disclosed herein) may have one or more modified bases. In some embodiments, a “modified base” is a ribonucleotide base of uracil, cytosine, adenine, or guanine that possesses a chemical modification from its normal structure. For example, one type of modified base is a methylated base, such as N6-methyladenosine (m6A). A modified base may also be a substituted base, meaning the base possesses a structural modification that renders it a chemical entity other than uracil, cytosine, adenine, or guanine. For example, pseudouridine is one type of substituted RNA base. Table 13 below provides a list of example modified bases that may be present in a nucleic acid molecule described herein. T A m m m m mmmmm ms io A 2-methylthio-N -(cis-hydroxyisopentenyl) adenosine Attorney Docket: GBB-01125 ms2hn6A 2-methylthio-N6-hydroxynorvalyl carbamoyladenosine m m ms2s2s2ACGImYUAGac m m mmim s4ch m ininin nncnc m U 5-carbamoylmethyluridine Attorney Docket: GBB-01125cmnm5Um 5-carboxymethylaminomethyl-2 -O-methyluridinec c cf5f5h ho mmm m m m m m m m m tm tmmmpr pr m G D o ga lQ galactosyl-queuosine Attorney Docket: GBB-01125 OHyW hydroxywybutosine I im k2m m mmmmmmmacac mmmio ac g6hn i6m m t6mmmo2 yW peroxywybutosine Attorney Docket: GBB-01125 Y pseudouridine Q O c m y im In some embodiments, the nucleic acid molecule may include one or more substitutions, insertions and / or additions, deletions, and covalent modifications. In some embodiments, the nucleic acid molecule includes one or more post-transcriptional modifications (e.g., capping, cleavage, polyadenylation, splicing, poly-A sequence, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and nitrosylation of thiol groups and tyrosine residues, etc.). The one or more post-transcriptional modifications can be any post-transcriptional modification, such as any of the more than one hundred different nucleoside modifications that have been identified in RNA (Rozenski, J, Crain, P, and McCloskey, J. (1999). The RNA Modification Database: 1999 update. Nucl Acids Res 27: 196-197). In some embodiments, the nucleic acid molecule comprises at least one nucleoside selected from the group consisting of pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2- thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1- carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5- taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1- taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl- pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1- methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy- pseudouridine, and 4-methoxy-2-thio-pseudouridine. In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4- methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio- pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza- Attorney Docket: GBB-01125 pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5- methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2- methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-1-methyl- pseudoisocytidine. In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl) adenosine, N6-glycinylcarbamoyladenosine, N6- threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6- dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine. In some embodiments, mRNA comprises at least one nucleoside selected from the group consisting of inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza- guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7- methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1- methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7- methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine. In some embodiments, the nucleic acid molecule includes any useful modification, such as to the sugar, the nucleobase, or the internucleoside linkage (e.g., to a linking phosphate / to a phosphodiester linkage / to the phosphodiester backbone). One or more atoms of a pyrimidine nucleobase may be replaced or substituted with optionally substituted amino, optionally substituted thiol, optionally substituted alkyl (e.g., methyl or ethyl), or halo (e.g., chloro or fluoro). In certain embodiments, modifications (e.g., one or more modifications) are present in each of the sugar and the internucleoside linkage. Modifications may be modifications of ribonucleic acids (RNAs) to deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs) or hybrids thereof). The nucleic acid molecules can be comprised wholly of naturally occurring nucleic acids, or in certain aspects can contain one or more nucleic acid analogues or derivatives. The nucleic acid analogues can include backbone analogues and / or nucleic acid base analogues and / or utilize non-naturally occurring base pairs. Illustrative artificial nucleic acids that can be used in the present constructs include, without limitation, nucleic backbone analogs Attorney Docket: GBB-01125 peptide nucleic acids (PNA), morpholino and locked nucleic acids (LNA), bridged nucleic acids (BNA), glycol nucleic acids (GNA) and threose nucleic acids (TNA). Nucleic acid base analogues that can be used in the present constructs include, without limitation, fluorescent analogs (e.g., 2-aminopurine (2-AP), 3-Methylindole (3-MI), 6-methyl isoxanthoptherin (6- MI), 6-MAP, pyrrolo-dC and derivatives thereof, furan-modified bases, 1,3-Diaza-2- oxophenothiazine (tC), 1,3-diaza-2-oxophenoxazine); non-canonical bases (e.g., inosine, thiouridine, pseudouridine, dihydrouridine, queuosine and wyosine), 2-aminoadenine, thymine analogue 2,4-difluorotoluene (F), adenine analogue 4-methylbenzimidazole (Z), isoguanine, isocytosine; diaminopyrimidine, xanthine, isoquinoline, pyrrolo[2,3-b]pyridine; 2-amino-6-(2-thienyl)purine, pyrrole-2-carbaldehyde, and universal bases (e.g., 2' deoxyinosine (hypoxanthine deoxynucleotide) derivatives, nitroazole analogues). Non- naturally occurring base pairs that can be used in the present nucleic acid molecules include, without limitation, isoguanine and isocytosine; diaminopyrimidine and xanthine; 2- aminoadenine and thymine; isoquinoline and pyrrolo[2,3-b]pyridine; 2-amino-6-(2- thienyl)purine and pyrrole-2-carbaldehyde; two 2,6-bis(ethylthiomethyl)pyridine (SPy) with a silver ion; pyridine-2,6-dicarboxamide (Dipam) and a mondentate pyridine (Py) with a copper ion. In some embodiments, the nucleic acid molecule includes at least one N(6)methyladenosine (m6A) modification to increase translation efficiency. In some embodiments, the N(6)methyladenosine (m6A) modification can reduce immunogeneicity of the nucleic acid molecule. In some embodiments, the modification may include a chemical or cellular induced modification. For example, some non-limiting examples of intracellular RNA modifications are described by Lewis and Pan in “RNA modifications and structures cooperate to guide RNA-protein interactions” from Nat Reviews Mol Cell Biol, 2017, 18:202-210. In some embodiments, chemical modifications to the ribonucleotides of the nucleic acid molecule may enhance immune evasion. The nucleic acid molecule may be synthesized and / or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S. L. et al. (Eds.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference. Modificationsinclude, for example, end modifications, e.g., 5 end modifications (phosphorylation (mono-,di- and tri-), conjugation, inverted linkages, etc.), 3 end modifications (conjugation, DNAnucleotides, inverted linkages, etc.), base modifications (e.g., replacement with stabilizing Attorney Docket: GBB-01125 bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners), removal of bases (abasic nucleotides), or conjugated bases. In some embodiments, the bases of the modified nucleic acid molecule include 5-methylcytidine and / or pseudouridine. In some embodiments, base modifications may modulate expression, immune response, stability, subcellular localization, to name a few functional effects, of the nucleic acid molecule. In some embodiments, the modification includes a bi-orthogonal nucleotides, e.g., an unnatural base. See for example, Kimoto et al, Chem Commun (Camb), 2017, 53:12309, DOI: 10.1039 / c7cc06661a, which is hereby incorporated by reference. In some embodiments, sugar modifications (e.g., at the 2 position or 4 position) orreplacement of the sugar one or more nucleotides of the nucleic acid molecule may, as well as backbone modifications, include modification or replacement of the phosphodiester linkages. Specific examples of nucleic acid molecule include, but are not limited to nucleic acid molecule including modified backbones or no natural internucleoside linkages such as internucleoside modifications, including modification or replacement of the phosphodiester linkages. Nucleic acid molecules having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. In particular embodiments, the nucleic acid molecule will include ribonucleotides with a phosphorus atom in its internucleoside backbone. In some embodiments, modified nucleic acid molecule backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters,aminoalkylphosphotriesters, methyl and other alkyl phosphonates such as 3 -alkylenephosphonates and chiral phosphonates, phosphinates, phosphoramidates such as 3 -aminophosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal3 -5 linkages, 2 -5 linked analogs of these, and those having inverted polarity wherein theadjacent pairs of nucleoside units are linked 3 -5 to 5 -3 or 2 -5 to 5 -2 . Various salts, mixedsalts and free acid forms are also included. In some embodiments, the nucleic acid molecule may be negatively or positively charged. The modified nucleotides, which may be incorporated into the nucleic acid molecule, can be modified on the internucleoside linkage (e.g., phosphate backbone). Herein, in the context of the polynucleotide backbone, the phrases “phosphate” and “phosphodiester” are used interchangeably. In some embodiments, backbone phosphate groups are modified by replacing one or more of the oxygen atoms with a different substituent. In some Attorney Docket: GBB-01125 embodiments, the modified nucleosides and nucleotides can include the wholesale replacement of an unmodified phosphate moiety with another internucleoside linkage as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linking oxygens replaced by sulfur. In some embodiments, the phosphate linker can also be modified by the replacement of a linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates). In some embodiments, a thio substituted phosphate moiety is provided to confer stability to RNA and DNA polymers through the unnatural phosphorothioate backbone linkages. In some embodiments, phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half-life in a cellular environment. In some embodiments, phosphorothioate linked to the nucleic acid molecule is expected to reduce the innate immune response through weaker binding / activation of cellular innate immune molecules. In some embodiments, a modified nucleoside includes an alpha-thio-nucleoside (e.g.,5 -0-(1-thiophosphate)-adenosine, 5 -0-(1-thiophosphate)-cytidine (a-thio-cytidine), 5 -0-(1-thiophosphate)-guanosine, 5 -0-(1-thiophosphate)-uridine, or 5 -0-(1-thiophosphate)-pseudouridine). In some embodiments, the nucleic acid molecule may include one or more cytotoxic nucleosides. For example, cytotoxic nucleosides may be incorporated into nucleic acid molecule, such as bifunctional modification. In some embodiments, cytotoxic nucleosidesinclude, but are not limited to, adenosine arabinoside, 5-azacytidine, 4 -thio-aracytidine,cyclopentenylcytosine, cladribine, clofarabine, cytarabine, cytosine arabinoside, l-(2-C- cyano-2-deoxy-beta-D-arabino-pentofuranosyl)-cytosine, decitabine, 5-fluorouracil, fludarabine, floxuridine, gemcitabine, a combination of tegafur and uracil, tegafur ((RS)-5-fluoro-1-(tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione), troxacitabine, tezacitabine, 2 -deoxy-2 -methylidenecytidine (DMDC), and 6-mercaptopurine. Additional examples includefludarabine phosphate, N4-behenoyl-1-beta-D-arabinofuranosylcytosine, N4-octadecyl-1- beta-D-arabinofuranosylcytosine, N4-palmitoyl-1-(2-C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl) cytosine, and P-4055 (cytarabine 5 -elaidic acid ester). Attorney Docket: GBB-01125 In some embodiments, the nucleic acid molecule may or may not be uniformly modified along the entire length of the molecule. In some embodiments, one or more or all types of nucleotides (e.g., naturally occurring nucleotides, purine or pyrimidine, or any one or more or all of A, G, U, C, I, pU) are, or are not, uniformly modified in the nucleic acid molecule, or in a given predetermined sequence region thereof. In some embodiments, the nucleic acid molecule includes a pseudouridine. In some embodiments, the nucleic acid molecule includes an inosine, which may aid in the immune system characterizing the nucleic acid molecule as endogenous versus viral RNAs. The incorporation of inosine may also mediate improved RNA stability / reduced degradation. See for example, Yu, Z. et al. (2015) RNA editing by ADAR1 marks dsRNA as “self”. Cell Res. 25, 1283-1284, which is incorporated by reference in its entirety. In some embodiments, a modification is in a non-coding region of the nucleic acid molecule provided herein. In some embodiments, the nucleic acid molecule includes from about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e. any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, or from 95% to 100%). Therapeutic Methods In some embodiments, provided herein is a method of expressing a protein in a cell, said method comprising delivering a polynucleotide provided herein (e.g., an RNA provided herein) into the cell. In some embodiments, the method includes transfection using lipofection or electroporation. In some embodiments, the nucleic acid molecule is transfected into a cell using a nanocarrier. In some embodiments, the nanocarrier is a lipid, polymer or a lipo-polymeric hybrid. Attorney Docket: GBB-01125 In some embodiments, the DNA and / or RNA provided herein is delivered into a cell using any method known in the art, e.g., by electroporation of protoplasts, fusion of liposomes to cell membranes, cell transfection methods using calcium ions or PEG, use of gold or tungsten microparticles coated with plasmid with the gene gun. Such methodologies are described in, e.g., Green and Sambrook, Molecular Cloning, A Laboratory Manual, 4th Ed., Cold Spring Harbor Press, (2012). In some embodiments, provided herein are compositions, e.g., compositions comprising a nucleic acid molecule and a pharmaceutically acceptable carrier. In one aspect, the present disclosure provides pharmaceutical compositions comprising an effective amount of a nucleic acid molecule described herein and a pharmaceutically acceptable excipient. Pharmaceutical compositions of the present disclosure may comprise RNA and / or DNA molecule as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, excipients or diluents. In some embodiments, pharmaceutical compositions of the present disclosure may comprise a nucleic acid molecule expressing cell, e.g., a plurality of nucleic acid molecule-expressing cells, as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, excipients or diluents. In some embodiments, a pharmaceutically acceptable carrier can be an ingredient in a pharmaceutical composition, other than an active ingredient, which is nontoxic to the subject. A pharmaceutically acceptable carrier can include, but is not limited to, a buffer, excipient, stabilizer, or preservative. Examples of pharmaceutically acceptable carriers are solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible, such as salts, buffers, saccharides, antioxidants, aqueous or non-aqueous carriers, preservatives, wetting agents, surfactants or emulsifying agents, or combinations thereof. The amounts of pharmaceutically acceptable carrier(s) in the pharmaceutical compositions may be determined experimentally based on the activities of the carrier(s) and the desired characteristics of the formulation, such as stability and / or minimal oxidation. In some embodiments, such compositions may comprise buffers such as acetic acid, citric acid, histidine, boric acid, formic acid, succinic acid, phosphoric acid, carbonic acid, malic acid, aspartic acid, Tris buffers, HEPPSO, HEPES, neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, sucrose, mannose, or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating Attorney Docket: GBB-01125 agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); antibacterial and antifungal agents; and preservatives. In certain embodiments, compositions of the present disclosure can be formulated for a variety of means of parenteral or non-parenteral administration. In one embodiment, the compositions can be formulated for infusion or intravenous administration. Compositions disclosed herein can be provided, for example, as sterile liquid preparations, e.g., isotonic aqueous solutions, emulsions, suspensions, dispersions, or viscous compositions, which may be buffered to a desirable pH. NON-LIMITING EMBODIMENTS Embodiment 1. A polynucleotide comprising an untranslated region (UTR), wherein the UTR comprises a core UTR sequence that is at least 90% identical to any of SEQ ID NOs: 1-8, 96, 98-106, or 108-118, and wherein the UTR is a 5' UTR or a 3' UTR. Embodiment 2. The polynucleotide of embodiment 1, wherein the core UTR sequence is at least 95% identical to any of SEQ ID NOs: 1-8, 96, 98-106, or 108-118. Embodiment 3. The polynucleotide of embodiment 1, wherein the core UTR sequence is or comprises any of SEQ ID NOs: 1-8, 96, 98-106, or 108-118. Embodiment 4. The polynucleotide of any of embodiments 1-3, wherein the UTRfurther comprises a 3 constant region positioned 3 to the core UTR sequence.Embodiment 5. The polynucleotide of embodiment 4, wherein the 3 constant regionis at least 80% identical to SEQ ID NO: 9. Embodiment 6. The polynucleotide of embodiment 4 or embodiment 5, wherein the3 constant region is at least 90% identical to SEQ ID NO: 9.Embodiment 7. The polynucleotide of embodiment 4, wherein the 3 constant regionis or comprises SEQ ID NO: 9. Embodiment 8. The polynucleotide of any of embodiments 4-7, wherein the UTRsequence further comprises a first adapter sequence positioned 3 to the core UTR sequence.Embodiment 9. The polynucleotide of embodiment 8, wherein the first adapter sequence is at least 80% identical to SEQ ID NO: 11. Embodiment 10. The polynucleotide of embodiment 8, wherein the first adapter sequence is at least 90% identical to SEQ ID NO: 11. Embodiment 11. The polynucleotide of embodiment 8, wherein the first adapter sequence is or comprises SEQ ID NO: 11. Attorney Docket: GBB-01125 Embodiment 12. The polynucleotide of any one of embodiments 8-11, wherein the UTR further comprises a linker sequence positioned between the first adapter sequence and the 3' constant region. Embodiment 13. The polynucleotide of embodiment 12, wherein the linker sequence is or comprises SEQ ID NO: 12. Embodiment 14. The polynucleotide of any one of embodiments 1-13, wherein theUTR further comprises a second adapter sequence positioned 5 to the core UTR sequence.Embodiment 15. The polynucleotide of embodiment 14, wherein the second adapter sequence is at least 80% identical to SEQ ID NO: 10. Embodiment 16. The polynucleotide of embodiment 14, wherein the second adapter sequence is at least 90% identical to SEQ ID NO: 10. Embodiment 17. The polynucleotide of embodiment 14, wherein the second adapter sequence is or comprises SEQ ID NO: 10. Embodiment 18. The polynucleotide of any one of embodiments 1-17, wherein thepolynucleotide further comprises a polyadenylation (polyA) sequence positioned 3 to thecore UTR sequence. Embodiment 19. The polynucleotide of any one of embodiments 1-18, wherein the polynucleotide does not comprise a translated region. Embodiment 20. The polynucleotide of any one of embodiments 1-18, wherein the polynucleotide further comprises a translated region. Embodiment 21. The polynucleotide of embodiment 20, wherein the UTR is a 3UTR that is positioned 3 to the translated region.Embodiment 22. The polynucleotide of any one of embodiments 20-21, wherein thetranslated region encodes a therapeutic protein. Embodiment 23. The polynucleotide of any one of embodiments 1-22, wherein the polynucleotide is an RNA. Embodiment 24. The polynucleotide of any one of embodiments 1-22, wherein the polynucleotide is an mRNA, circRNA, or saRNA. Embodiment 25. The polynucleotide of any one of embodiments 1-19, wherein the polynucleotide comprises or encodes a gRNA, a sgRNA, an RNAi, a tRNA, an rRNA, a snRNA or a snoRNA. Attorney Docket: GBB-01125 Embodiment 26. A polynucleotide comprising an untranslated region (UTR), wherein the UTR comprises a core UTR sequence that is at least 90% identical to any of SEQ ID NOs: 21-25, or 143-162. Embodiment 27. The polynucleotide of embodiment 26, wherein the core UTR sequence is at least 95% identical to any of SEQ ID NOs: 21-25, or 143-162. Embodiment 28. The polynucleotide of embodiment 26, wherein the core UTRsequence is or comprises any of SEQ ID NOs: 21-25, or 143-162. Embodiment 29. The polynucleotide of any one of embodiments 26-28, wherein theUTR further comprises a 5 constant region sequence positioned 5' to the core UTR sequence,wherein the 5' constant region sequence is or comprises SEQ ID NO: 26. Embodiment 30. The polynucleotide of any of embodiments 26-29, wherein the UTR further comprises a Kozak constant region sequence positioned 3' to the core UTR sequence, wherein the Kozak constant region sequence is or comprises SEQ ID NO: 27. Embodiment 31. The polynucleotide of embodiment 30, wherein the UTR further comprises at least two guanine nucleotides between the core UTR sequence and the Kozak constant region sequence. Embodiment 32. The polynucleotide of any one of embodiments 26-31, wherein the polynucleotide does not comprise a translated region. Embodiment 33. The polynucleotide of any one of embodiments 26-31, wherein the polynucleotide further comprises a translated region. Embodiment 34. The polynucleotide of embodiment 33, wherein the UTR is a 5UTR that is positioned 5 to the translated region.Embodiment 35. The polynucleotide of any one of embodiments 33-34, wherein the translated region encodes a therapeutic protein. Embodiment 36. The polynucleotide of any one of embodiments 26-35, wherein the polynucleotide is an RNA. Embodiment 37. The polynucleotide of any one of embodiments 26-35, wherein the polynucleotide is an mRNA, circRNA, or a saRNA. Embodiment 38. The polynucleotide of any one of embodiments 26-32, wherein the polynucleotide encodes or comprises a gRNA, a sgRNA, an RNAi, a tRNA, an rRNA, a snRNA, or a snoRNA. Attorney Docket: GBB-01125 Embodiment 39. The polynucleotide of any one of embodiments 1-25, further comprising an additional UTR, wherein the additional UTR comprises a second core UTR sequence that is at least 90% identical to any of SEQ ID NOs: 21-25, or 143-162. Embodiment 40. The polynucleotide of embodiment 39, wherein the second core UTR sequence is at least 95% identical to any of SEQ ID NOs: 21-25, or 143-162. Embodiment 41. The polynucleotide of embodiment 39, wherein the second core UTR sequence is or comprises any of SEQ ID NOs: 21-25, or 143-162. Embodiment 42. The polynucleotide of any one of embodiments 39-41, wherein theadditional UTR further comprises a 5 constant region sequence, wherein the 5' constantregion sequence is or comprises SEQ ID NO: 26. Embodiment 43. The polynucleotide of any of embodiments 39-42, wherein the additional UTR further comprises a Kozak constant region sequence, wherein the Kozak constant region sequence is or comprises SEQ ID NO: 27. Embodiment 44. The polynucleotide of embodiment 43, wherein the additional UTR further comprises at least two guanine nucleotides between the second core UTR sequence and the Kozak constant region. Embodiment 45. The polynucleotide of any one of embodiments 39-44, further comprising a translated region. Embodiment 46. The polynucleotide of embodiment 45, wherein the additional UTRis positioned 3 to the translated region.Embodiment 47. The polynucleotide of embodiment 45, wherein the additional UTRis positioned 5 to the translated region.Embodiment 48. A polynucleotide comprising the polynucleotide of any one of embodiments 1-47 and an additional polynucleotide. Embodiment 49. The polynucleotide of embodiment 48, wherein the polynucleotide is an expression vector. Embodiment 50. A lipid nanoparticle comprising the polynucleotide of any one of embodiments 1-49. Embodiment 51. A polynucleotide comprising a core promoter sequence that is at least 90% identical to SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37, and a heterologous polynucleotide. Attorney Docket: GBB-01125 Embodiment 52. The polynucleotide of embodiment 51, wherein the core promoter sequence is at least 95% identical to SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37. Embodiment 53. The polynucleotide of embodiment 51, wherein the core promoter sequence is or comprises any of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37. Embodiment 54. The polynucleotide of any one of embodiments 51-53, furthercomprising a 3 constant region sequence, wherein the 3 constant region sequence is orcomprises SEQ ID NO: 38. Embodiment 55. The polynucleotide of any one of embodiments 51-54, wherein the polynucleotide further comprises one or more motif cluster sequences. Embodiment 56. The polynucleotide of any one of embodiments 55, wherein any of the one or more motif cluster sequences are at least 90% identical to any one or more of SEQ ID NOs: 49-78. Embodiment 57. The polynucleotide of any one of embodiments 55, wherein any of the one or more motif cluster sequences is or comprises one or more of SEQ ID NOs: 49-78. Embodiment 58. The polynucleotide of any one of embodiments 51-54, wherein the polynucleotide further comprises a first enhancer sequence. Embodiment 59. The polynucleotide of embodiment 58, wherein the first enhancersequence is positioned 5 to the core promoter sequence.Embodiment 60. The polynucleotide of embodiment 58, wherein the first enhancersequence is positioned 3 to the core promoter sequence.Embodiment 61. The polynucleotide of embodiment 58, wherein the first enhancer sequence is at least 90% identical to SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. Embodiment 62. The polynucleotide of embodiment 61, wherein the first enhancer sequence is or comprises one of SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. Embodiment 63. The polynucleotide of any one of embodiments 58-62, further comprising a linker sequence between the first enhancer sequence and the core promoter sequence. Embodiment 64. The polynucleotide of embodiment 63, wherein the linker sequence is or comprises SEQ ID NO: 43. Attorney Docket: GBB-01125 Embodiment 65. The polynucleotide of any one of embodiments 58-64, wherein the polynucleotide further comprises a second enhancer sequence, wherein the sequence of the first and the second enhancer sequences are the same or different. Embodiment 66. The polynucleotide of embodiment 65, wherein the second enhancersequence is positioned 5 to the core promoter sequence.Embodiment 67. The polynucleotide of embodiment 65, wherein the second enhancersequence is positioned 3 to the core promoter sequence.Embodiment 68. The polynucleotide of embodiment 65, wherein the second enhancer sequence is at least 90% identical to SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. Embodiment 69. The polynucleotide of embodiment 65, wherein the second enhancer sequence is or comprises one of SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. Embodiment 70. The polynucleotide of embodiment 65, wherein the first enhancer sequence comprises SEQ ID NO: 39 and the second enhancer sequence comprises SEQ ID NO: 40. Embodiment 71. The polynucleotide of embodiment 65, wherein the first enhancer sequence comprises SEQ ID NO: 39 and the second enhancer sequence comprises SEQ ID NO: 42. Embodiment 72. The polynucleotide of embodiment 65, wherein the first enhancer sequence comprises SEQ ID NO: 39 and the second enhancer sequence comprises SEQ ID NO: 41. Embodiment 73. The polynucleotide of embodiment 65, wherein the first enhancer sequence comprises SEQ ID NO: 40 and the second enhancer sequence comprises SEQ ID NO: 39. Embodiment 74. The polynucleotide of embodiment 65, wherein the first enhancer sequence comprises SEQ ID NO: 40 and the second enhancer sequence comprises SEQ ID NO: 42. Embodiment 75. The polynucleotide of embodiment 65, wherein the first enhancer sequence comprises SEQ ID NO: 40 and the second enhancer sequence comprises SEQ ID NO: 41. Attorney Docket: GBB-01125 Embodiment 76. The polynucleotide of embodiment 65, wherein the first enhancer sequence comprises SEQ ID NO: 42 and the second enhancer sequence comprises SEQ ID NO: 39. Embodiment 77. The polynucleotide of embodiment 65, wherein the first enhancer sequence comprises SEQ ID NO: 42 and the second enhancer sequence comprises SEQ ID NO: 40. Embodiment 78. The polynucleotide of embodiment 65, wherein the first enhancer sequence comprises SEQ ID NO: 42 and the second enhancer sequence comprises SEQ ID NO: 41. Embodiment 79. The polynucleotide of embodiment 65, wherein the first enhancer sequence comprises SEQ ID NO: 41 and the second enhancer sequence comprises SEQ ID NO: 39. Embodiment 80. The polynucleotide of embodiment 65, wherein the first enhancer sequence comprises SEQ ID NO: 41 and the second enhancer sequence comprises SEQ ID NO: 40. Embodiment 81. The polynucleotide of embodiment 65, wherein the first enhancer sequence comprises SEQ ID NO: 41 and the second enhancer sequence comprises SEQ ID NO: 42. Embodiment 82. The polynucleotide of any one of embodiments 67-81, wherein thefirst enhancer sequence is positioned 5 to the second enhancer sequence.Embodiment 83. The polynucleotide of any one of embodiments 51-82, wherein the polynucleotide comprises an RNA polymerase II (Pol2) promoter. Embodiment 84. The polynucleotide of any one of embodiments 51-83, further comprising a coding sequence. Embodiment 85. The polynucleotide of embodiment 84, wherein the coding sequence encodes a therapeutic protein. Embodiment 86. A polynucleotide comprising a promoter sequence that is at least 90% identical to SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, or SEQ ID NO: 48. Embodiment 87. The polynucleotide of embodiment 86, wherein the promoter sequence is at least 95% identical to SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, or SEQ ID NO: 48. Attorney Docket: GBB-01125 Embodiment 88. The polynucleotide of embodiment 86, wherein the promoter sequence is or comprises SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, or SEQ ID NO: 48. Embodiment 89. A polynucleotide comprising an enhancer sequence that is at least 90% identical to SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. Embodiment 90. A polynucleotide comprising at least one enhancer sequence selected from any one of the sequences set forth in SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42. Embodiment 91. A polynucleotide comprising at least two of any of the enhancer sequences, set forth in SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42, wherein the at least two enhancer sequences are the same or different from each other. Embodiment 92. The polynucleotide of any one of embodiments 89-91, wherein the polynucleotide further comprises a core promoter sequence, wherein the core promoter sequence is or comprises any of SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37. Embodiment 93. The polynucleotide of embodiment 92, wherein the at least one enhancer sequence is operably linked to the core promoter sequence. Embodiment 94. The polynucleotide of embodiment 93, wherein the core promoter sequence is any of SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37. Embodiment 95. The polynucleotide of embodiment 93, wherein the core promoter sequence is SEQ ID NO: 36 or SEQ ID NO: 37. Embodiment 96. The polynucleotide of embodiment 93, wherein the core promoter sequence is SEQ ID NO: 36. Embodiment 97. The polynucleotide of embodiment 93, wherein the core promoter sequence is SEQ ID NO: 37. Embodiment 98. The polynucleotide of embodiment 97, wherein the polynucleotide further comprises a cis-regulatory element. Embodiment 99. A polynucleotide comprising at least one of the motif cluster sequences listed in SEQ ID NOs: 49-78. Embodiment 100. A polynucleotide comprising at least two of the motif cluster sequences listed in SEQ ID NOs: 49-78, wherein the at least two motif cluster sequences are different from each other. Attorney Docket: GBB-01125 Embodiment 101. The polynucleotide of embodiment 99-100, wherein the motif cluster sequence(s) comprise or are comprised within a cis-regulatory element. Embodiment 102. The polynucleotide of any one of embodiments 89-101, further comprising a coding sequence. Embodiment 103. The polynucleotide of embodiment 102, wherein the coding sequence encodes a therapeutic protein. Embodiment 104. A polynucleotide comprising a core promoter sequence that is at least 90% identical to SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, or SEQ ID NO: 86. Embodiment 105. The polynucleotide of embodiment 104, wherein the core promoter sequence is at least 95% identical to SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, or SEQ ID NO: 86. Embodiment 106. The polynucleotide of embodiment 105, wherein the core promoter sequence is or comprises SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, or SEQ ID NO: 86. Embodiment 107. The polynucleotide of any one of embodiments 104-106, further comprising a constant region sequence, wherein the constant region sequence is or comprisesSEQ ID NO: 87, and the constant region sequence is positioned 3 to the promoter sequence.Embodiment 108. A polynucleotide comprising a promoter sequence that is at least 90% identical to SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, or SEQ ID NO: 95. Embodiment 109. The polynucleotide of embodiment 108, wherein the promoter sequence is at least 95% identity to SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, or SEQ ID NO: 95. Embodiment 110. The polynucleotide of embodiment 108, wherein the promoter sequence is or comprises SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, or SEQ ID NO: 95. Embodiment 111. The polynucleotide of any one of embodiments 104-110, wherein the promoter sequence comprises or is comprised within an RNA polymerase III (Pol3) promoter. Embodiment 112. The polynucleotide of any one of embodiments 106-111, wherein the polynucleotide encodes or comprises a gRNA, a sgRNA, or an RNAi agent. Attorney Docket: GBB-01125 Embodiment 113. A polynucleotide of any one of embodiments 51-103, wherein the polynucleotide of any one of embodiments 51-103 is operably linked to a polynucleotide of any one of embodiments 1-33. Embodiment 114. The polynucleotide of embodiment 113, wherein the polynucleotide encodes a therapeutic protein. Embodiment 115. The polynucleotide of embodiment 113, wherein the polynucleotide encodes a Cas nuclease. Embodiment 116. The polynucleotide of any one of embodiments 104-107, wherein the core promoter sequence is operably linked to a sequence encoding a guide RNA. Embodiment 117. The polynucleotide of any one of embodiments 104-107, wherein the core promoter sequence is operably linked to a sequence encoding a short interfering RNA. Embodiment 118. The polynucleotide of any one of embodiments 104-107, wherein the core promoter sequence is operably linked to a sequence encoding an antisense RNA. Embodiment 119. The polynucleotide of any one of embodiments 108-112, wherein the promoter sequence is operably linked to a sequence encoding a guide RNA. Embodiment 120. The polynucleotide of any one of embodiments 108-112, wherein the promoter sequence is operably linked to a sequence encoding a short interfering RNA. Embodiment 121. The polynucleotide of any one of embodiments 108-112, wherein the promoter sequence is operably linked to a sequence encoding an antisense RNA. Embodiment 122. An adeno-associated virus (AAV) vector comprising a DNA sequence encoding the polynucleotide of any one of embodiments 1-25, wherein the polynucleotide is an RNA. Embodiment 123. An AAV vector comprising a DNA sequence encoding the polynucleotide of any one of embodiments 26-38, wherein the polynucleotide is an RNA. Embodiment 124. An AAV vector comprising a DNA sequence encoding the polynucleotide of any one of embodiments 39-47, wherein the polynucleotide is an RNA. Embodiment 125. An AAV vector comprising the polynucleotide of any one of embodiments 51-88, wherein the polynucleotide is a DNA; the polynucleotide of any one of embodiments 89-103, wherein the polynucleotide is a DNA; and / or the polynucleotide of any one of embodiments 104-112, wherein the polynucleotide is a DNA. Embodiment 126. An AAV vector comprising the polynucleotide of any one of embodiments 51-103, wherein the polynucleotide is a DNA; the polynucleotide of any one of Attorney Docket: GBB-01125 embodiments 1-47, wherein the polynucleotide is a DNA; and the polynucleotide of any one of embodiments 104-112, wherein the polynucleotide is a DNA. Embodiment 127. The AAV vector of embodiment 126, wherein the translated region of the polynucleotide encodes a Cas nuclease. Embodiment 128. The AAV vector of embodiment 127, wherein the polynucleotide of any one of embodiments 104-112 encodes or comprises a gRNA or a sgRNA. Embodiment 129. A cell comprising the polynucleotide of any one of embodiments 1-25, the polynucleotide of any one of embodiments 26-38, the polynucleotide of any one of embodiments 51-88, the polynucleotide of any one of embodiments 90-103, and / or the polynucleotide of any one of embodiments 104-112. Embodiment 130. The cell of embodiment 129, wherein the cell is a muscle cell. Embodiment 131. A method of expressing a polypeptide in a cell, wherein the method comprises the step of contacting the cell with the polynucleotide of any one of embodiments 113-121, or the AAV vector of any one of embodiments 122-128. Embodiment 132. A method of expressing a polypeptide in a subject, wherein the method comprises the step of administering to the subject the polynucleotide of any one of embodiments 113-121, the AAV vector of any one of embodiments 122-128, or the cell of embodiment 129 or 130. Embodiment 133. A polynucleotide comprising: (a) a 3' untranslated region (3' UTR) sequence comprising a core UTR sequence that is at least 90% identical to any of SEQ ID NOs: 97 or 107; and (b) a heterologous polynucleotide. Embodiment 134. A polynucleotide comprising: (a) a Pol2 core promoter sequence which is or comprises the sequence of any one of: SEQ ID NOs: 33, 34, 35, 36, or 37; and (b) a heterologous polynucleotide. Embodiment 135. A polynucleotide comprising: (a) a Pol2 core promoter sequence which has a sequence at least 90% identical to the sequence of any one of: SEQ ID NOs: 33, 34, 35; and (b) a heterologous polynucleotide. EXAMPLES The following examples are provided to further illustrate some embodiments of the present disclosure, but are not intended to limit its scope; it will be understood by their nature as examples that other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used. Attorney Docket: GBB-01125 Example 1: Development of improved regulatory elements Improved regulatory elements for gene therapy, gene editing, and mRNA therapeutics were designed by harnessing the power of high-throughput assays and machine learning. An example of an approach included the following: design pooled libraries of 10k+ regulatory elements, test these elements in high-throughput massively parallel reporter assay (MPRA) pooled screens, train machine learning models on our assay results, use learnings and machine learning models to design new sequences to test via pooled library / MPRA, re-iterate through design, test, learn as needed, and select a handful of elements to validate in “single- clone” experiments, which may also include protein or functional measurements. Over 100 pooled libraries of 3 UTRs, 5 UTRs, promoters, and enhancers, totalingmillions of regulatory elements were designed and tested. Numerous MPRA-style assays, capable of measuring RNA stability over time, RNA expression from DNA (including Pol2 and Pol3-driven expression), protein translation strength from RNA, and protein expression from DNA were designed and implemented. Almost 100 machine learning models that predict expression based on an element’s nucleotide sequence were generated. The high- throughput sequence design and measurements, machine learning models, and domain expertise facilitated the ability to design the regulatory elements herein disclosed. 3UTRs, 5 UTRs, Pol2 promoters (comprising four short promoter units paired withfour modular enhancers), and eight Pol3 promoters were designed and tested with optimized characteristics. As detailed in Example 2: The 3 UTRs increased stability of their mRNA molecules,leading to prolonged and higher protein expression. In Table 6, the complete 3 UTRs arelisted, and in Table 4A, the modular engineered (i.e., core) 3 UTR sequences are shown. Asdetailed in Example 3: The 5 UTRs increased stability of their mRNA molecules and alsoincreased protein translation, again leading to prolonged and higher protein expression. InTable 3, the complete 5 UTRs are listed, and in Table 1, the modular engineered (i.e., core)5 UTR sequences are shown. As detailed in Example 4: The Pol2 promoters and enhancersincreased mRNA expression in vitro and in vivo, leading to higher, and in some cases more tissue-specific, protein expression. The Pol2 promoters were shorter than many industry standards, addressing space limitations. In Table 9, the complete Pol2 promoter sequences are listed, and in Tables 7A-7B and 8, the modular engineered (i.e., core Pol2 promoter and enhancer sequences are shown. As detailed in Example 5: The Pol3 promoters increased expression of guide RNA molecules and facilitated gene editing, and some were shorter than Attorney Docket: GBB-01125 industry standards, addressing space limitations. In Table 12, the complete Pol3 promoter sequences are listed, and in Table 11, the modular engineered (i.e., core) Pol 3 promoter sequences are shown. The regulatory elements of the present disclosure can be applied to any gene therapy, gene editing, or mRNA therapeutic technology that uses those regulatory elements. Some examples of applications are: the Pol2 promoters could be used to increase protein expressionin muscle in AAV gene therapies, while reducing expression in liver; the 5 UTRs and 3UTRs could be used in mRNA vaccines to increase immune response and vaccine effectiveness; the short Pol3 promoters could be used in CRISPR-Cas9, or other editing systems, to express higher levels of guide RNA with a shorter length; the Pol2 promoters,Pol3 promoters, 5 UTRs and 3 UTRs could all be used in the same AAV gene editingtherapy together to lower the dose, reduce off-target effects, and increase effectiveness; the short Pol3 promoter could be used to express higher levels of guide RNA; and the Pol2promoter, 5 UTR, and 3 UTR could be used to increase expression and specificity of Cas9proteins, or other nucleases, in the same vector.Example 2: Development and characterization of 3 UTR elementsIn some embodiments, the 3 untranslated region (3 UTR) is the section of messengerRNA that immediately follows the translation termination codon. In some embodiments, a 3' UTR may influence protein expression via post-transcriptional mechanisms such as mRNA localization, mRNA stability, and translation. mRNA therapeutics are a burgeoning area of gene therapy, with applications for vaccines, gene replacement, and gene editing. However, the instability of mRNA molecules remains a hurdle to achieving long-lasting therapeutic levels of protein expression. Another challenge is achieving adequate protein expression from the mRNA molecules in the cells. The goal of this experiment was to use a high-throughput MPRA screening platform to iteratively design and test thousands of candidate 3' UTR sequences, followed by in vivo validation. The purpose was to find sequences that could drive higher stability and / or expression of a transgene compared to the UTRs currently used for mRNA therapeutics. This experiment included an MPRA assay, performed both in cell and in mouse and a stability assay for measuring the degradation over time of a population of mRNAs. In both cases, thousands to tens of thousands of candidate sequences were synthesized and cloned into an expression cassette and mRNA was expressed through in vitro transcription. mRNA containing the pooled library of UTRs was introduced into cells. It was then extracted at Attorney Docket: GBB-01125 specific timepoints and subsequently sequenced using next-generation sequencing (NGS). The relative amounts of the library members were quantified and transformed into stability measurements. The resulting measurements were used to train predictive models that map 3' UTR sequence to relevant metrics. These models were explored computationally to design new libraries, which were then synthesized and assayed. After several iterations of library designs, multiple sequences that outperform a given benchmark were selected, and three of these sequences were validated in vivo, using LNP delivery of luciferase mRNA with each 3' UTR and measured via IVIS imaging across two weeks. The resulting 3' UTRs can be used for mRNA vaccines, mRNA therapeutics, and gene editing using mRNA-delivered enzymes, as well as for additional nucleotide therapeutics such as AAV-delivered DNA therapies, engineered cell therapies, and mRNA therapeutics. Data Summary 100k+ 3 UTR sequences were designed. A further 100k+ 3' UTR sequences weredesigned. 1000s demonstrated measurable high stability. 8 sequences were selected, followed by a further 23 sequences. In vivo LNP-delivered protein validation data in C57BL / 6J mice for candidates TC9, TC10, and TC11 is shown in FIG. 1. In vivo AAV-delivered protein validation data in C57BL / 6J mice for candidate TC38 is shown in FIG. 2. Data from stability MPRA measurements in HEK293 cells with normal uridine is shown in FIG. 3B. Data from stability MPRA measurements in HEK293 cells with N1-methylpseudouridine is shown in FIG. 3B.Example 3: Development and characterization of 5 UTR elementsIn some embodiments, the 5' untranslated region (5 UTR) is the section of messengerRNA beginning at the start of the mRNA and ending with the base before the coding sequence start codon (usually AUG). In some embodiments, a 5' UTR may influence protein expression via post-transcriptional mechanisms, especially the recruitment of translation initiation factors required for ribosomal subunit association and translation. One challenge for mRNA therapeutics, mRNA vaccines, and gene therapies is achieving adequate protein expression from the mRNA molecules in the cells. The goal of this experiment was to use a high-throughput MPRA screening platform to design and test thousands of candidate 5' UTR sequences. The purpose was to find sequences that could Attorney Docket: GBB-01125 drive higher stability and / or expression of a transgene compared to the UTRs currently used for mRNA therapeutics. This experiment included three MPRAs, performed in cell: a stability assay for measuring the degradation over time of a population of mRNAs; a protein production assay for measuring protein expression from a population of DNAs that are transcribed into mRNAs; and a translation rate assay for measuring ribosome binding to a population of mRNAs. The stability assay is described above in Example 2. In the protein production assay, thousands to tens of thousands of candidate sequences were synthesized and cloned into an expression cassette for a fluorescent protein, which was then integrated into a cell line’s genome. Cells were sorted based on fluorescence and subsequently sequenced using next- generation sequencing (NGS). The relative amounts of the library members in each sorted population were quantified and transformed into translation efficiency measurements. In the translation rate assay, thousands to tens of thousands of candidate sequences were synthesized and cloned into an expression cassette and mRNA was expressed through in vitro transcription. mRNA containing the pooled library of UTRs was introduced into cells. Cellular RNA was then extracted and ribosome-associated transcripts were fractionated using sucrose gradient ultracentrifugation. Each fraction was subsequently sequenced using next- generation sequencing (NGS). The relative amounts of the library members in each fraction were quantified and transformed into translation rate measurements, where higher ribosome load is indicative of stronger translation rate. External measurements and the resulting measurements from the MPRA were used to train predictive models that map 5' UTR sequence to relevant metrics. These models were explored computationally to design new libraries, which were then synthesized and assayed. Multiple sequences that outperform a given benchmark were selected, and 25 of these sequences were validated in cell, with mRNA delivered to Huh7 cells and protein expression measured by AlphaLISA for the translated protein. The resulting 5' UTRs can be used for mRNA vaccines, mRNA therapeutics, and gene editing using mRNA-delivered enzymes, as well as for additional nucleotide therapeutics such as AAV-delivered DNA therapies, engineered cell therapies, and mRNA therapeutics. Data Summary 20k+ 5 UTR sequences were designed. 1000s demonstrated high stability, hightranslation, or high expression. 25 sequences were selected. Data from protein production and Attorney Docket: GBB-01125 stability MPRA measurements in HEK293 cells is shown in FIGs. 4A-4D. Data from translation rate MPRA measurements in Huh7 cells is shown in FIG. 4E. Data from arrayed AlphaLISA-based protein measurements in Huh7 cells is shown in FIG. 4F. Example 4: Development and characterization of Pol2 promoters RNA polymerase II is the enzyme responsible for transcribing RNA from DNA, especially messenger RNA. Pol2 promoters are regions of DNA that are recognized by RNA polymerase II and drive transcription of nearby genes. Promoters are typically found immediately upstream of (and may also include) transcription start sites, while enhancers may be more distal and may occur upstream or downstream of the transcription start site. Many gene therapies require the expression of RNA from DNA. Many challenges exist in developing gene therapies, including achieving adequate expression in target tissues, reducing expression in off-target tissues, and reducing promoter length to accommodate larger coding sequences. Our goal was to design highly active, muscle-specific promoters that were shorter than commonly used 1kb+ promoters for muscle gene therapy. This experiment included an MPRA assay, performed in mouse: a gene expression assay for measuring the expression of RNA from DNA from a population of regulatory elements. In the gene expression assay, thousands to tens of thousands of candidate sequences were synthesized and cloned into an expression cassette, which was then transfected into cells or mice. DNA and RNA were extracted from cells, and subsequently sequenced using next-generation sequencing (NGS). The relative amounts of the library members in RNA vs DNA were quantified and transformed into gene expression measurements. Resulting measurements from the MPRA were used to iteratively design more active Pol2 promoters, including via the use of machine learning predictive models. The resulting regulatory elements can be used for AAV-delivered gene therapy as well as for additional nucleotide therapeutics such as engineered cell therapies. Data Summary 100k+ enhancer sequences and 50k+ short promoter unit sequences were designed. 1000s were measured with high RNA expression. 5 total promoters, comprising four short promoter units and four modular enhancers were selected. In vivo protein single clone validation data (AAV-packaged, IV delivery, muscle expression) in C57BL / 6J mice is shown in FIGs. 5A-5D. Data from in vivo EP muscle MPRA measurements in C57BL / 6J mice is shown in FIG. 6. Attorney Docket: GBB-01125 Example 5: Development and characterization of Pol3 promoters RNA polymerase III is the enzyme responsible for transcribing small non-coding RNA from DNA, including guide RNA used in gene editing. Pol3 promoters are regions of DNA that are recognized by RNA polymerase III and drive transcription of downstream RNAs. Therapeutic CRISPR-Cas gene editing requires the presence of both a Cas enzyme and an RNA guide at sufficient levels. Guide RNAs (gRNA) are expressed by RNA Polymerase III (Pol3), and standard gene therapies use natural U6, 7SK, or U6 mini Pol3 promoters to express them. However, there is a need for higher levels of gRNA expression and for shorter Pol3 promoters. Additionally, arrayed CRISPR requires diverse Pol3 promoters to avoid recombination in the construct. This experiment included an MPRA assay, performed in cells and in mouse: a gene expression assay for measuring the expression of Pol2- and Pol3-specific RNA transcription from DNA from a population of regulatory elements. In the gene expression assay, thousands to tens of thousands of candidate sequences were synthesized and cloned into an expression cassette, which was then transfected into cells or mice. DNA and RNA were extracted from cells, RNA was optionally filtered for Pol2- or Pol3-specific transcripts, and nucleotides were subsequently sequenced using next-generation sequencing (NGS). The relative amounts of the library members in RNA vs DNA were quantified and transformed into gene expression measurements. Resulting measurements from the MPRA were used to iteratively design more active Pol3 promoters, including via the use of machine learning predictive models. A range of Pol3 promoters were designed and characterized. These promoters showed increased gRNA expression in vitro and in vivo, and are a range of sizes, including promoters under 100 bases. They also were validated for increased gRNA expression in single clone measurements, and the gRNAs they expressed were validated for functional cutting abilities when paired with Cas9 enzyme (FIG. 7). The Pol3 promoters disclosed herein can be used in genetic therapeutics and other gene-modifying tools that requires gRNA expression, including but not limited to CRISPR- Cas9 gene editing, CRISPR-Cas12, CRISPR-Cas13, CRISPRi, CRISPRa, CRISPR-based epigenome editing. These tools could be used for human therapeutics or for animal, agricultural, or other organismal uses. They may also be used to express other small non- coding RNA molecules that require Pol3 transcription, including tRNAs, snRNAs, snoRNAs, and rRNAs or other RNAs used in RNA-protein complexes. Attorney Docket: GBB-01125 Data Summary 50k+ Pol3 promoter sequences designed, 1000s were measured with high Pol3 expression, 8 sequences were selected. Functional cutting assay results of three sequences is shown in FIG. 7. Luciferase expression results from seven candidate sequences with single clone qPCR validation is shown in FIGs. 8A-8D. Data from total, Pol3, and Pol2 MPRA measurements in HEK293 cells is shown in FIG. 9. Incorporation by Reference All publications, patents, and patent applications mentioned herein are hereby incorporated by reference in their entirety as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, will control. Equivalents Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

Attorney Docket: GBB-01125 CLAIMS What is claimed is:

1. A polynucleotide comprising an untranslated region (UTR), wherein the UTR comprises a core UTR sequence that is at least 90% identical to any of SEQ ID NOs: 1-8, 96, 98-106, or 108-118, and wherein the UTR is a 5' UTR or a 3' UTR.

2. The polynucleotide of claim 1, wherein the core UTR sequence is at least 95% identical to any of SEQ ID NOs: 1-8, 96, 98-106, or 108-118.

3. The polynucleotide of claim 1, wherein the core UTR sequence is or comprises any of SEQ ID NOs: 1-8, 96, 98-106, or 108-118.

4. The polynucleotide of any of claims 1-3, wherein the UTR further comprises a 3constant region positioned 3 to the core UTR sequence.

5. The polynucleotide of claim 4, wherein the 3 constant region is at least 80% identicalto SEQ ID NO: 9.

6. The polynucleotide of claim 4 or claim 5, wherein the 3 constant region is at least90% identical to SEQ ID NO: 9.

7. The polynucleotide of claim 4, wherein the 3 constant region is or comprises SEQ IDNO:

9.

8. The polynucleotide of any of claims 4-7, wherein the UTR sequence furthercomprises a first adapter sequence positioned 3 to the core UTR sequence.

9. The polynucleotide of claim 8, wherein the first adapter sequence is at least 80% identical to SEQ ID NO:

11.

10. The polynucleotide of claim 8, wherein the first adapter sequence is at least 90% identical to SEQ ID NO: 11.Attorney Docket: GBB-01125 11. The polynucleotide of claim 8, wherein the first adapter sequence is or comprises SEQ ID NO:

11.

12. The polynucleotide of any one of claims 8-11, wherein the UTR further comprises a linker sequence positioned between the first adapter sequence and the 3' constant region.

13. The polynucleotide of claim 12, wherein the linker sequence is or comprises SEQ ID NO:

12.

14. The polynucleotide of any one of claims 1-13, wherein the UTR further comprises asecond adapter sequence positioned 5 to the core UTR sequence.

15. The polynucleotide of claim 14, wherein the second adapter sequence is at least 80% identical to SEQ ID NO:

10.

16. The polynucleotide of claim 14, wherein the second adapter sequence is at least 90% identical to SEQ ID NO:

10.

17. The polynucleotide of claim 14, wherein the second adapter sequence is or comprises SEQ ID NO:

10.

18. The polynucleotide of any one of claims 1-17, wherein the polynucleotide furthercomprises a polyadenylation (polyA) sequence positioned 3 to the core UTR sequence.

19. The polynucleotide of any one of claims 1-18, wherein the polynucleotide does not comprise a translated region.

20. The polynucleotide of any one of claims 1-18, wherein the polynucleotide further comprises a translated region.

21. The polynucleotide of claim 20, wherein the UTR is a 3 UTR that is positioned 3 tothe translated region.Attorney Docket: GBB-01125 22. The polynucleotide of any one of claims 20-21, wherein the translated region encodes a therapeutic protein.

23. The polynucleotide of any one of claims 1-22, wherein the polynucleotide is an RNA.

24. The polynucleotide of any one of claims 1-22, wherein the polynucleotide is an mRNA, circRNA, or saRNA.

25. The polynucleotide of any one of claims 1-19, wherein the polynucleotide comprises or encodes a gRNA, a sgRNA, an RNAi, a tRNA, an rRNA, a snRNA or a snoRNA.

26. A polynucleotide comprising an untranslated region (UTR), wherein the UTR comprises a core UTR sequence that is at least 90% identical to any of SEQ ID NOs: 21-25, or 143-162.

27. The polynucleotide of claim 26, wherein the core UTR sequence is at least 95% identical to any of SEQ ID NOs: 21-25, or 143-162.

28. The polynucleotide of claim 26, wherein the core UTR sequence is or comprises any of SEQ ID NOs: 21-25, or 143-162.

29. The polynucleotide of any one of claims 26-28, wherein the UTR further comprises a5 constant region sequence positioned 5' to the core UTR sequence, wherein the 5' constantregion sequence is or comprises SEQ ID NO:

26.

30. The polynucleotide of any of claims 26-29, wherein the UTR further comprises a Kozak constant region sequence positioned 3' to the core UTR sequence, wherein the Kozak constant region sequence is or comprises SEQ ID NO:

27.

31. The polynucleotide of claim 30, wherein the UTR further comprises at least two guanine nucleotides between the core UTR sequence and the Kozak constant region sequence.Attorney Docket: GBB-01125 32. The polynucleotide of any one of claims 26-31, wherein the polynucleotide does not comprise a translated region.

33. The polynucleotide of any one of claims 26-31, wherein the polynucleotide further comprises a translated region.

34. The polynucleotide of claim 33, wherein the UTR is a 5 UTR that is positioned 5 tothe translated region.

35. The polynucleotide of any one of claims 33-34, wherein the translated region encodes a therapeutic protein.

36. The polynucleotide of any one of claims 26-35, wherein the polynucleotide is an RNA.

37. The polynucleotide of any one of claims 26-35, wherein the polynucleotide is an mRNA, circRNA, or a saRNA.

38. The polynucleotide of any one of claims 26-32, wherein the polynucleotide encodes or comprises a gRNA, a sgRNA, an RNAi, a tRNA, an rRNA, a snRNA, or a snoRNA.

39. The polynucleotide of any one of claims 1-25, further comprising an additional UTR, wherein the additional UTR comprises a second core UTR sequence that is at least 90% identical to any of SEQ ID NOs: 21-25, or 143-162.

40. The polynucleotide of claim 39, wherein the second core UTR sequence is at least 95% identical to any of SEQ ID NOs: 21-25, or 143-162.

41. The polynucleotide of claim 39, wherein the second core UTR sequence is or comprises any of SEQ ID NOs: 21-25, or 143-162.Attorney Docket: GBB-01125 42. The polynucleotide of any one of claims 39-41, wherein the additional UTR furthercomprises a 5 constant region sequence, wherein the 5' constant region sequence is orcomprises SEQ ID NO:

26.

43. The polynucleotide of any of claims 39-42, wherein the additional UTR further comprises a Kozak constant region sequence, wherein the Kozak constant region sequence is or comprises SEQ ID NO:

27.

44. The polynucleotide of claim 43, wherein the additional UTR further comprises at least two guanine nucleotides between the second core UTR sequence and the Kozak constant region.

45. The polynucleotide of any one of claims 39-44, further comprising a translated region.

46. The polynucleotide of claim 45, wherein the additional UTR is positioned 3 to thetranslated region.

47. The polynucleotide of claim 45, wherein the additional UTR is positioned 5 to thetranslated region.

48. A polynucleotide comprising the polynucleotide of any one of claims 1-47 and an additional polynucleotide.

49. The polynucleotide of claim 48, wherein the polynucleotide is an expression vector.

50. A lipid nanoparticle comprising the polynucleotide of any one of claims 1-49.

51. A polynucleotide comprising a core promoter sequence that is at least 90% identical to SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37, and a heterologous polynucleotide.

52. The polynucleotide of claim 51, wherein the core promoter sequence is at least 95% identical to SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37.Attorney Docket: GBB-01125 53. The polynucleotide of claim 51, wherein the core promoter sequence is or comprises any of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37.

54. The polynucleotide of any one of claims 51-53, further comprising a 3 constantregion sequence, wherein the 3 constant region sequence is or comprises SEQ ID NO: 38.

55. The polynucleotide of any one of claims 51-54, wherein the polynucleotide further comprises one or more motif cluster sequences.

56. The polynucleotide of any one of claims 55, wherein any of the one or more motif cluster sequences are at least 90% identical to any one or more of SEQ ID NOs: 49-78.

57. The polynucleotide of any one of claims 55, wherein any of the one or more motif cluster sequences is or comprises one or more of SEQ ID NOs: 49-78.

58. The polynucleotide of any one of claims 51-54, wherein the polynucleotide further comprises a first enhancer sequence.

59. The polynucleotide of claim 58, wherein the first enhancer sequence is positioned 5to the core promoter sequence.

60. The polynucleotide of claim 58, wherein the first enhancer sequence is positioned 3to the core promoter sequence.

61. The polynucleotide of claim 58, wherein the first enhancer sequence is at least 90% identical to SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO:

42.

62. The polynucleotide of claim 61, wherein the first enhancer sequence is or comprises one of SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO:

42.

63. The polynucleotide of any one of claims 58-62, further comprising a linker sequence between the first enhancer sequence and the core promoter sequence.Attorney Docket: GBB-01125 64. The polynucleotide of claim 63, wherein the linker sequence is or comprises SEQ ID NO:

43.

65. The polynucleotide of any one of claims 58-64, wherein the polynucleotide further comprises a second enhancer sequence, wherein the sequence of the first and the second enhancer sequences are the same or different.

66. The polynucleotide of claim 65, wherein the second enhancer sequence is positioned5 to the core promoter sequence.

67. The polynucleotide of claim 65, wherein the second enhancer sequence is positioned3 to the core promoter sequence.

68. The polynucleotide of claim 65, wherein the second enhancer sequence is at least 90% identical to SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO:

42.

69. The polynucleotide of claim 65, wherein the second enhancer sequence is or comprises one of SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO:

42.

70. The polynucleotide of claim 65, wherein the first enhancer sequence comprises SEQ ID NO: 39 and the second enhancer sequence comprises SEQ ID NO:

40.

71. The polynucleotide of claim 65, wherein the first enhancer sequence comprises SEQ ID NO: 39 and the second enhancer sequence comprises SEQ ID NO:

42.

72. The polynucleotide of claim 65, wherein the first enhancer sequence comprises SEQ ID NO: 39 and the second enhancer sequence comprises SEQ ID NO:

41.

73. The polynucleotide of claim 65, wherein the first enhancer sequence comprises SEQ ID NO: 40 and the second enhancer sequence comprises SEQ ID NO: 39.Attorney Docket: GBB-01125 74. The polynucleotide of claim 65, wherein the first enhancer sequence comprises SEQ ID NO: 40 and the second enhancer sequence comprises SEQ ID NO:

42.

75. The polynucleotide of claim 65, wherein the first enhancer sequence comprises SEQ ID NO: 40 and the second enhancer sequence comprises SEQ ID NO:

41.

76. The polynucleotide of claim 65, wherein the first enhancer sequence comprises SEQ ID NO: 42 and the second enhancer sequence comprises SEQ ID NO:

39.

77. The polynucleotide of claim 65, wherein the first enhancer sequence comprises SEQ ID NO: 42 and the second enhancer sequence comprises SEQ ID NO:

40.

78. The polynucleotide of claim 65, wherein the first enhancer sequence comprises SEQ ID NO: 42 and the second enhancer sequence comprises SEQ ID NO:

41.

79. The polynucleotide of claim 65, wherein the first enhancer sequence comprises SEQ ID NO: 41 and the second enhancer sequence comprises SEQ ID NO:

39.

80. The polynucleotide of claim 65, wherein the first enhancer sequence comprises SEQ ID NO: 41 and the second enhancer sequence comprises SEQ ID NO:

40.

81. The polynucleotide of claim 65, wherein the first enhancer sequence comprises SEQ ID NO: 41 and the second enhancer sequence comprises SEQ ID NO:

42.

82. The polynucleotide of any one of claims 67-81, wherein the first enhancer sequence ispositioned 5 to the second enhancer sequence.

83. The polynucleotide of any one of claims 51-82, wherein the polynucleotide comprises an RNA polymerase II (Pol2) promoter.

84. The polynucleotide of any one of claims 51-83, further comprising a coding sequence.Attorney Docket: GBB-01125 85. The polynucleotide of claim 84, wherein the coding sequence encodes a therapeutic protein.

86. A polynucleotide comprising a promoter sequence that is at least 90% identical to SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, or SEQ ID NO:

48.

87. The polynucleotide of claim 86, wherein the promoter sequence is at least 95% identical to SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, or SEQ ID NO:

48.

88. The polynucleotide of claim 86, wherein the promoter sequence is or comprises SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, or SEQ ID NO:

48.

89. A polynucleotide comprising an enhancer sequence that is at least 90% identical to SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO:

42.

90. A polynucleotide comprising at least one enhancer sequence selected from any one of the sequences set forth in SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO:

42.

91. A polynucleotide comprising at least two of any of the enhancer sequences, set forth in SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42, wherein the at least two enhancer sequences are the same or different from each other.

92. The polynucleotide of any one of claims 89-91, wherein the polynucleotide further comprises a core promoter sequence, wherein the core promoter sequence is or comprises any of SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO:

37.

93. The polynucleotide of claim 92, wherein the at least one enhancer sequence is operably linked to the core promoter sequence.

94. The polynucleotide of claim 93, wherein the core promoter sequence is any of SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 37.Attorney Docket: GBB-01125 95. The polynucleotide of claim 93, wherein the core promoter sequence is SEQ ID NO: 36 or SEQ ID NO:

37.

96. The polynucleotide of claim 93, wherein the core promoter sequence is SEQ ID NO:

36.

97. The polynucleotide of claim 93, wherein the core promoter sequence is SEQ ID NO:

37.

98. The polynucleotide of claim 97, wherein the polynucleotide further comprises a cis- regulatory element.

99. A polynucleotide comprising at least one of the motif cluster sequences listed in SEQ ID NOs: 49-78.

100. A polynucleotide comprising at least two of the motif cluster sequences listed in SEQ ID NOs: 49-78, wherein the at least two motif cluster sequences are different from each other.

101. The polynucleotide of claim 99-100, wherein the motif cluster sequence(s) comprise or are comprised within a cis-regulatory element.

102. The polynucleotide of any one of claims 89-101, further comprising a coding sequence.

103. The polynucleotide of claim 102, wherein the coding sequence encodes a therapeutic protein.

104. A polynucleotide comprising a core promoter sequence that is at least 90% identical to SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, or SEQ ID NO: 86.Attorney Docket: GBB-01125 105. The polynucleotide of claim 104, wherein the core promoter sequence is at least 95% identical to SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, or SEQ ID NO:

86.

106. The polynucleotide of claim 105, wherein the core promoter sequence is or comprises SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, or SEQ ID NO:

86.

107. The polynucleotide of any one of claims 104-106, further comprising a constant region sequence, wherein the constant region sequence is or comprises SEQ ID NO: 87, andthe constant region sequence is positioned 3 to the promoter sequence.

108. A polynucleotide comprising a promoter sequence that is at least 90% identical to SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, or SEQ ID NO:

95.

109. The polynucleotide of claim 108, wherein the promoter sequence is at least 95% identity to SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, or SEQ ID NO:

95.

110. The polynucleotide of claim 108, wherein the promoter sequence is or comprises SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, or SEQ ID NO:

95.

111. The polynucleotide of any one of claims 104-110, wherein the promoter sequence comprises or is comprised within an RNA polymerase III (Pol3) promoter.

112. The polynucleotide of any one of claims 106-111, wherein the polynucleotide encodes or comprises a gRNA, a sgRNA, or an RNAi agent.

113. A polynucleotide of any one of claims 51-103, wherein the polynucleotide of any one of claims 51-103 is operably linked to a polynucleotide of any one of claims 1-33.Attorney Docket: GBB-01125 114. The polynucleotide of claim 113, wherein the polynucleotide encodes a therapeutic protein.

115. The polynucleotide of claim 113, wherein the polynucleotide encodes a Cas nuclease.

116. The polynucleotide of any one of claims 104-107, wherein the core promoter sequence is operably linked to a sequence encoding a guide RNA.

117. The polynucleotide of any one of claims 104-107, wherein the core promoter sequence is operably linked to a sequence encoding a short interfering RNA.

118. The polynucleotide of any one of claims 104-107, wherein the core promoter sequence is operably linked to a sequence encoding an antisense RNA.

119. The polynucleotide of any one of claims 108-112, wherein the promoter sequence is operably linked to a sequence encoding a guide RNA.

120. The polynucleotide of any one of claims 108-112, wherein the promoter sequence is operably linked to a sequence encoding a short interfering RNA.

121. The polynucleotide of any one of claims 108-112, wherein the promoter sequence is operably linked to a sequence encoding an antisense RNA.

122. An adeno-associated virus (AAV) vector comprising a DNA sequence encoding the polynucleotide of any one of claims 1-25, wherein the polynucleotide is an RNA.

123. An AAV vector comprising a DNA sequence encoding the polynucleotide of any one of claims 26-38, wherein the polynucleotide is an RNA.

124. An AAV vector comprising a DNA sequence encoding the polynucleotide of any one of claims 39-47, wherein the polynucleotide is an RNA.Attorney Docket: GBB-01125 125. An AAV vector comprising the polynucleotide of any one of claims 51-88, wherein the polynucleotide is a DNA; the polynucleotide of any one of claims 89-103, wherein the polynucleotide is a DNA; and / or the polynucleotide of any one of claims 104-112, wherein the polynucleotide is a DNA.

126. An AAV vector comprising the polynucleotide of any one of claims 51-103, wherein the polynucleotide is a DNA; the polynucleotide of any one of claims 1-47, wherein the polynucleotide is a DNA; and the polynucleotide of any one of claims 104-112, wherein the polynucleotide is a DNA.

127. The AAV vector of claim 126, wherein the translated region of the polynucleotide encodes a Cas nuclease.

128. The AAV vector of claim 127, wherein the polynucleotide of any one of claims 104-112 encodes or comprises a gRNA or a sgRNA.

129. A cell comprising the polynucleotide of any one of claims 1-25, the polynucleotide of any one of claims 26-38, the polynucleotide of any one of claims 51-88, the polynucleotide of any one of claims 90-103, and / or the polynucleotide of any one of claims 104-112.

130. The cell of claim 129, wherein the cell is a muscle cell.

131. A method of expressing a polypeptide in a cell, wherein the method comprises the step of contacting the cell with the polynucleotide of any one of claims 113-121, or the AAV vector of any one of claims 122-128.

132. A method of expressing a polypeptide in a subject, wherein the method comprises the step of administering to the subject the polynucleotide of any one of claims 113-121, the AAV vector of any one of claims 122-128, or the cell of claim 129 or 130.

133. A polynucleotide comprising: (a) a 3' untranslated region (3' UTR) sequence comprising a core UTR sequence that is at least 90% identical to any of SEQ ID NOs: 97 or 107; and (b) a heterologous polynucleotide.Attorney Docket: GBB-01125 134. A polynucleotide comprising: (a) a Pol2 core promoter sequence which is or comprises the sequence of any one of: SEQ ID NOs: 33, 34, 35, 36, or 37; and (b) a heterologous polynucleotide.

135. A polynucleotide comprising: (a) a Pol2 core promoter sequence which has a sequence at least 90% identical to the sequence of any one of: SEQ ID NOs: 33, 34, 35; and(b) a heterologous polynucleotide.