MAPT siRNA AND USES THEREOF

Abstract

Provided herein are small interfering ribonucleic acid (siRNA) agents targeting a microtubule-associated protein tau (MAPT) gene and compositions comprising such siRNA agents.

Description

MAPT siRNA AND USES THEREOFCROSS REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of priority of United States Provisional Application No. 63 / 643,490, filed May 7, 2024, which is incorporated by reference herein, in its entirety and for all purposes.REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY

[0002] This application contains a computer readable Sequence Listing which has been submitted in XML file format with this application, the entire content of which is incorporated by reference herein in its entirety. The Sequence Listing XML file submitted with this application is entitled “PRD4315WOPCTl_SL.xml”, was created on May 2, 2025, and is 11.2 megabytes in size.FIELD OF THE INVENTION

[0003] The described invention generally relates to small interfering ribonucleic acid (siRNA) agents targeting a microtubule-associated protein tau (MAPT) gene, compositions comprising such siRNA agents and methods of using the same.BACKGROUND OF THE INVENTION

[0004] Under normal physiological conditions, Tau is a soluble protein associated with microtubules in neurons with its most well-characterized function being microtubule polymerization. Under pathological conditions, however, Tau becomes hyperphosphorylated and dissociated from the microtubules, forms intracellular soluble oligomer species and insoluble aggregates rich in P-sheet structure. Certain Tau assemblies can be released and transmitted to neurons in anatomically connected regions to induce or “seed” the native monomeric Tau to oligomerize into aggregates, thus propagating Tau aggregates in a prionlike manner. The molecular mechanism whereby Tau exerts its pathogenic action in Alzheimer's disease is not known today. What is clear, however, is that the pathogenic action of Tau involves toxic gain-of-functions exerted by small or large aggregated forms of Tau protein species.

[0005] Thus, the need exists for compounds and agents that inhibit the expression of the MAPT gene, for example, to treat Alzheimer’s disease.SUMMARY OF THE INVENTION

[0006] According to one aspect, provided herein are non-naturally occurring small interfering ribonucleic acid (siRNA) agents comprising a sense strand and an antisense strand forming a double stranded region.

[0007] According to another aspect, the described invention provides a small interfering ribonucleic acid (siRNA) comprising a sense strand and an antisense strand forming a double stranded duplex, wherein (a) the sense strand comprises 21 nucleotides having the sequence: UCCCAUGAUUUCUUCGGUAAA, wherein from the 5 ’end (i) the nucleotide at one or more positions selected from 1-8 and 12-21 is optionally modified with 2’-O-methyl; (ii) the nucleotide at position 6 optionally comprises a lipophilic moiety; (iii) the nucleotide at one or more positions selected from 9-11 is optionally modified with 2’fluoro; wherein the sense strand optionally further comprises an inverse abasic nucleotide (InvAb) at the 5’ end linked to the nucleotide at position 1 and / or an inverse abasic nucleotide (InvAb) at the 3’ end linked to the nucleotide at position 21, and wherein the sense strand optionally comprises at least two phosphorothioate linkages at the 5 ’end and / or at least two phosphorothioate linkages at the 3’end; and (b) the antisense strand comprises 21 nucleotides having the sequence: UUUACCGAAGAAAUCAUGGGA, wherein from the 5’ end (i) the nucleotide at position 1 is optionally modified with vinyl phosphonate 2’-O-methyl; (ii) the nucleotide at one or more positions selected from 2, 14, and 16 is optionally modified with 2’fluoro; (iii) the nucleotide at one or more positions selected from 1, 3, 5, 6, 8-13, 15, and 17-21 is optionally modified with 2’-O-methyl; (iv) optionally, the nucleotide at one or more positions selected from 4 and 7 is a deoxynucleotide; and wherein the antisense strand optionally comprises at least two phosphorothioate linkages at the 5 ’end and / or at least two phosphorothioate linkages at the 3’end.

[0008] According to one embodiment, the sense strand comprises a nucleotide modified with 2’-O-methyl at positions 1-8 and 12-21 from the 5’ end. According to another embodiment, the sense strand comprises a nucleotide modified with 2’fluoro at positions 9-11 from the 5’ end. According to another embodiment, the sense strand comprises an inverse abasic nucleotide (InvAb) at the 5’ end and an inverse abasic nucleotide (InvAb) at the 3’ end. According to another embodiment, the inverse abasic nucleotide (InvAb) at the 5’ end is linked to the nucleotide at position 1 from the 5’ end. According to another embodiment, the inverse abasic nucleotide (InvAb) at the 3’ end is linked to the nucleotide at position 21 fromthe 5’ end. According to another embodiment, the sense strand comprises two phosphorothioate linkages at the 5 ’end and two phosphorothioate linkages at the 3 ’end.

[0009] According to one embodiment, the sense strand comprises a lipophilic moiety at position 6 from the 5’ end. According to another embodiment, the lipophilic moiety is L4 as depicted in FIGURE 1.

[0010] According to one embodiment, the antisense strand comprises a nucleotide at position 1 modified with vinyl phosphonate 2’-O-methyl at position from the 5’ end.According to another embodiment, the antisense strand comprises a nucleotide modified with 2’fluoro at positions 2, 14, and 16 from the 5’ end. According to another embodiment, the antisense strand comprises a nucleotide modified with 2’-O-methyl at positions 1, 3, 5, 6, 8- 13, 15, and 17-21 from the 5’ end. According to another embodiment, the antisense strand comprises a deoxynucleotide at positions 4 and 7 from the 5’ end. According to another embodiment, the antisense strand comprises two phosphorothioate linkages at the 5 ’end and two phosphorothioate linkages at the 3 ’end.

[0011] According to another aspect, the described invention provides an siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 819, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 820.

[0012] According to another aspect, the described invention provides an siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 421, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 422.

[0013] According to another aspect, the described invention provides an siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 523, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 524.

[0014] According to another aspect, the described invention provides an siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 527, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 528.

[0015] According to another aspect, the described invention provides an siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 529, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 530.

[0016] According to another aspect, the described invention provides an siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 611, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 612.

[0017] According to another aspect, the described invention provides an siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 613, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 614.

[0018] According to another aspect, the described invention provides an siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 619, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 620.

[0019] According to another aspect, the described invention provides an siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 623, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 624.

[0020] According to another aspect, the described invention provides an siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 625, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 626.

[0021] According to another aspect, the described invention provides an siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 627, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 628.

[0022] According to another aspect, the described invention provides an siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 759, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 760.

[0023] According to another aspect, the described invention provides an siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 809, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 810.

[0024] According to another aspect, the described invention provides a small interfering ribonucleic acid (siRNA) comprising a sense strand and an antisense strand forming a doublestranded region, wherein: (a) the antisense strand comprises a nucleotide sequence corresponding to any one of the antisense nucleotide sequences in Tables 1, 2, 3 or 4; and (b) the sense strand comprises a nucleotide sequence corresponding to any one of the sense nucleotide sequences in Tables 1, 2, 3 or 4.

[0025] According to another aspect, the described invention provides a small interfering ribonucleic acid (siRNA) comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 1, and the sense strand comprises a nucleotide sequence corresponding to the sense nucleotide sequence in the same row of Table 1.

[0026] According to another aspect, the described invention provides a small interfering ribonucleic acid (siRNA) comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 2, and the sense strand comprises a nucleotide sequence corresponding to the sense nucleotide sequence in the same row of Table2.

[0027] According to another aspect, the described invention provides a small interfering ribonucleic acid (siRNA) comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 3, and the sense strand comprises a nucleotide sequence corresponding to the sense nucleotide sequence in the same row of Table3.

[0028] According to another aspect, the described invention provides a small interfering ribonucleic acid (siRNA) comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 4, and the sense strand comprises a nucleotide sequence corresponding to the sense nucleotide sequence in the same row of Table4.

[0029] According to one embodiment, the antisense strand, the sense strand, or both the antisense and the sense strand comprise at least one modified nucleotide. According to another embodiment, the antisense strand, the sense strand, or both the antisense and the sense strand comprise at least one modified internucleoside linkage. According to another embodiment, the antisense strand, the sense strand, or both the antisense and the sense strand is conjugated to one or more lipophilic moieties. According to another embodiment, the oneor more lipophilic moieties are selected from the group consisting of LI, L2, L3, L4, L5, L6, L7, L8, L9, LIO, Li l, L12, L13, L14, L15, L16, L17, L18, L19, L20, L21, L22, L23, and L24 as depicted in FIGURE 1. According to another embodiment, the one or more lipophilic moieties is L4 as depicted in FIGURE 1. According to another embodiment, the one or more lipophilic moieties is L21 as depicted in FIGURE 1. According to another embodiment, the one or more lipophilic moieties is L22 as depicted in FIGURE 1. According to another embodiment, the one or more lipophilic moieties is L23 as depicted in FIGURE 1.

[0030] According to one embodiment, the described invention provides a composition comprising the siRNA and a carrier. According to another embodiment, the described invention provides a method of inhibiting expression of MAPT gene in a cell or population of cells comprising contacting the cell or population of cells with the composition.

[0031] According to one embodiment, the described invention provides a method of inhibiting expression of MAPT gene in a cell or population of cells comprising contacting the cell or population of cells with the siRNA.BRIEF DESCRIPTION OF THE DRAWINGS

[0032] FIGURE 1 provides the chemical structures of 3’- and / or 5’-terminal lipid derivatives, and internal 2’ -O-lipid derivatives.DETAILED DESCRIPTION OF THE INVENTION

[0033] The described invention can be better understood from the following description of exemplary embodiments, taken in conjunction with the accompanying figures. It should be apparent to those skilled in the art that the described embodiments of the described invention provided herein are merely exemplary and illustrative and not limiting.

[0034] Definitions:

[0035] Various terms used throughout this specification have the definitions set out herein.

[0036] The siRNA agents of the described invention can be used to inhibit the expression of the MAPT gene. The term “MAPT gene”, which is also known as MTBT1 gene, PPP1R103 gene, FTDP-17 gene, Tau-40 gene, MTBT2 gene, MAPTL gene, PPND gene, MSTD gene, Tau gene, and microtubule associated protein Tau gene are used interchangeably herein to refer to the gene encoding a protein called microtubule associated protein Tau.

[0037] The human MAPT gene that encodes Tau protein is located on chromosome 17q23.1 , spans -150 kb and comprises 16 exons. 11 out of the 16 exons are expressed in the central nervous system (CNS). In human brain, six isoforms of Tau with 0, 1, or 2 N- terminal repeats (ON, IN, or 2N) and 3 or 4 microtubule-binding repeats (3R or 4R) are generated by alternative splicing of exons 2, 3, and 10. Bigger splicing variants that include exon 4a or exon 6 are mostly found in the peripheral nervous system, or in the spinal cord and skeletal muscle, respectively. Tau protein is predominantly expressed in the CNS neurons and located to the axons and dendrites. The half-life of Tau is reported as approximately 7 days in human iPSC-derived neuronal cultures and 23 ± 6.4 days in human CNS (Sato, C., et al. (2018). ”Tau Kinetics in Neurons and the Human Central Nervous System.” Neuron 98(4): 861-864). It is suggested that a fraction of newly synthesized Tau protein is C-terminally truncated and released from neurons with a delay of 3 days to the cerebrospinal fluid (CSF), and the estimated CSF Tau production rates from amyloidnegative and -positive cohorts are 22.9 ± 7.2 pg / mL / day and 27.8 ± 7.0 pg / mL / day, respectively (Sato, C., et al. (2018). ”Tau Kinetics in Neurons and the Human Central Nervous System.” Neuron 98(4): 861-864).

[0038] The term “small interfering RNA agent” or “siRNA agent” as used herein refers to an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that contains both a sense and an anti-sense strand. In some embodiments, the siRNA sense strand is 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18 or 17 nucleotides in length. In some embodiments, the siRNA anti-sense strand is 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18 or 17 nucleotides in length. The sense strand and / or antisense strand of a siRNA agent may comprise another moiety (e.g, a lipid moiety). For example, a lipid moiety may be incorporated into the sense strand of a siRNA agent. The sense strand and / or antisense strand of a siRNA agent may be linked or conjugated, directly or indirectly, to another moiety (e.g, a lipid moiety). For example, the sense strand of the siRNA agent may be linked or conjugated, directly or indirectly, to another moiety (e.g., a lipid moiety). In a specific embodiment, a siRNA agent is a double-stranded RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide comprising a sense stand and an antisense strand forming a double-stranded region. The double-stranded region may be the entire length of the sense strand, antisense strand, or both. Alternatively, the double-stranded region may be less than the entire length of the sense strand, antisense strand, or both. The double-stranded region may be the result of the antisense strand being fully complementary, partially complementary, or substantially complementary to the sense strand. In a specificembodiment, the antisense strand of a siRNA agent is partially complementary to a target RNA transcript. In some embodiments, the antisense strand of a siRNA agent is substantially complementary to a target RNA transcript. In another specific embodiment, the antisense strand of a siRNA agent is fully complementary to a target RNA transcript.

[0039] The two strands forming the double-stranded region or duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules.

[0040] Where the two substantially complementary strands of a siRNA agent are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. In some embodiments where the two strands are connected covalently by means other than a contiguous chain of nucleotides between the 3 ’-end of one strand and the 5 ’-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a “linker”. The RNA strands of a siRNA agent may have the same or a different number of nucleotides. In some embodiments, one or both strands of a siRNA agent comprise an overhang. In some embodiments, the siRNA agent is blunt ended.

[0041] In one embodiment, a siRNA agent described herein mediates messenger RNA (mRNA) degradation or inhibition of translation of the mRNA in a sequence-specific manner. In specific embodiments, a siRNA agent described herein inhibits MAPT gene expression via an RNA-induced silencing complex (RISC) pathway

[0042] The term “complementary” when used herein to describe a first nucleotide sequence e.g., a sense strand of a siRNA agent, or targeted sequence) in relation to a second nucleotide sequence (e.g., antisense strand of a siRNA agent, or a single-stranded antisense oligonucleotide), refers to the ability of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro) and form a duplex or double helical structure under certain conditions with an oligonucleotide or polynucleotide including the second nucleotide sequence. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled.Sequence identity or complementarity is independent of modification. For example, fA and mA are complementary to U (or T) and identical to A for the purposes of determining identity or complementarity.

[0043] The term “fully complementary” as used herein in the context of two nucleotide sequences means that all (100%) of the bases in a contiguous sequence of a first nucleotide sequence will hybridize to the same number of bases in a contiguous sequence of a secondnucleotide sequence to form a duplex. Where two nucleotide sequences are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a siRNA agent comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the 23 nucleotides oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the 21 nucleotides oligonucleotide, are considered “fully complementary” for the purposes described herein. In a specific embodiment, two nucleotide sequences are “fully complementary” when all (100%) of the bases of a first nucleotide sequence hybridize to all (100%) of the bases in a second nucleotide sequence to form a duplex. In some embodiments, the two nucleotide sequences hybridize under stringent conditions. In some embodiments, the two nucleotide sequences hybridize under very stringent conditions.

[0044] The term “partially complementary” as used herein in the context of two nucleotide sequences means that at least 65% but less than 80% of the bases in a contiguous sequence of a first nucleotide sequence will hybridize to the same number of bases in a contiguous sequence of a second nucleotide sequence to form a duplex. In some embodiments, the two nucleotide sequences hybridize under stringent conditions. In some embodiments, the two nucleotide sequences hybridize under very stringent conditions.

[0045] The term “substantially complementary” as used herein in the context of two nucleotide sequences means that at least 80% but less than 100% of the bases in a contiguous sequence of a first nucleotide sequence will hybridize to the same number of bases in a contiguous sequence of a second nucleotide sequence to form a duplex. In some embodiments, two nucleotide sequences are substantially complementary when at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, but less than 100% of the bases in a contiguous sequence of a first oligonucleotide will hybridize to the same number of bases in a contiguous sequence of a second oligonucleotide to form a duplex. In some embodiments, the two nucleotide sequences hybridize under stringent conditions. In some embodiments, the two nucleotide sequences hybridize under very stringent conditions.

[0046] The terms "inhibiting", "inhibit" or "inhibition" are used herein to refer to reducing the amount or rate of a process, to stopping the process entirely, or to decreasing, limiting, or blocking the action or function thereof. Inhibition may include a reduction or decrease of the amount, rate, action function, or process of a substance by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 45%, at least50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%.

[0047] The terms “about” and “approximate” as used herein when referring to a numerical value encompass the recited numerical value and variations within + / - 20%. For example, about 20% would encompass 16% to 24% and values in between, including 20%. In some embodiments, the terms “about” and “approximate” when referring to a numerical value encompass the recited numerical value and variations within + / -15%. In some embodiments, the terms “about” and “approximate” when referring to a numerical value encompass the recited numerical value and variations within + / - 10%. In some embodiments, the terms “about” and “approximate” when referring to a numerical value encompass the recited numerical value and variations within + / - 5%.

[0048] The term “stringent” as used herein when referring to hybridization means that under “stringent conditions”, or “stringent hybridization conditions”, a first nucleotide sequence will hybridize to a second nucleotide, with minimal hybridization to other sequences. In a specific embodiment, an antisense sequence will hybridize under stringent conditions to its target sequence, with minimal targeting to other sequences. Stringent conditions are sequence dependent (e.g., sequence length, complementarity), and vary under different environmental parameters (e.g., assay conditions, physiological environment). An example of stringent hybridization conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing.

[0049] The term “very stringent” as used herein when referring to hybridization means that under “very stringent conditions” or “very stringent hybridization conditions”, a first nucleotide sequence will only be observed to hybridize to a second nucleotide. In a specific embodiment, an antisense sequence will be observed to only hybridize to its target sequence under very stringent conditions. Also, very stringent conditions may not allow hybridization to occur between partially complementary sequences. Very stringent conditions are sequence dependent (e.g., sequence length, complementarity), and vary under different environmental parameters (e.g, assay conditions, physiological environment). Very stringent conditions may include a higher temperature, lower ionic strength, and / or shorter reaction time compared to stringent conditions under the same circumstance. For example, very stringent conditions may include a hybridization temperature of about 71° C, about 72° C, about 73° C, about 74° C, about 75° C, about 76° C, about 77° C, about 78° C, about 79° C, about 80° C, or higher.

[0050] The phrase “Ribonucleic Acid interference”, “RNA interference” or “RNAi” as used herein refers to a biological process in which RNA or RNA-like molecules inhibit gene expression or translation, by neutralizing targeted mRNA molecules (e.g., target sequences).

[0051] The term “target sequence” as used herein refers to a contiguous portion of a nucleotide sequence of a RNA molecule formed during the transcription of a MAPT gene, including mRNA that is a product of RNA processing of a primary transcription product (e.g., MAPT mRNA resulting from alternate splicing). In some embodiments, the contiguous portion of the nucleotide sequence is at least long enough to serve as a substrate for RNA interference (RNAi)-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a MAPT gene. In some embodiments, the target sequence is about 15-30 nucleotides in length. For example, the target sequence can be from about 15-30 nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23,18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21,19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29,21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. In some embodiments, the target sequence is 19-25 nucleotides in length. In some embodiments, the target sequence is 21-23 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.

[0052] The phrase “nucleotide sequence corresponding to any one of the antisense strand nucleotide sequences”, “nucleotide sequence corresponding to the antisense strand nucleotide sequence”, “nucleotide sequence corresponding to any one of the sense strand nucleotide sequences”, “nucleotide sequence corresponding to the sense strand nucleotide sequence”, “nucleotide sequence corresponding to any one of the nucleotide sequences”, or “nucleotide sequence corresponding to any one of SEQ ID NOs” as used herein refers to an oligonucleotide comprising a chain of nucleotides comprising the recited unmodified nucleotides, or one or more modified nucleotides, or one or more conjugated moi eties (e.g., a moiety described herein, such as, e.g., a lipid, or a modified nucleotide conjugated to a moiety described herein). A skilled person is aware that the recited unmodified nucleotide may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Thus, a nucleotide containing uracil, guanine, or adenine can be replaced by a nucleotide containing, for example, inosine. In another example, adenine and cytosinemay be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA.

[0053] The phrase “non-naturally occurring small interfering ribonucleic acid (siRNA) agent”, “non-naturally occurring small interfering ribonucleic acid agent”, or “non-naturally occurring siRNA agent” as used herein refers to a siRNA agent that is not found in nature. The non-naturally occurring siRNA may contain one or more modified nucleotides.

[0054] The term “overhang” as used herein in the context of a 5’ or 3’ nucleotide overhang refers to at least one unpaired nucleotide that protrudes from the duplex structure of a siRNA agent. For example, when a 3'-end of one strand of a siRNA agent extends beyond the 5'-end of the other strand, or vice versa, there is a nucleotide overhang. In some embodiments, the overhang is present at the 3 ’-end of the sense strand, antisense strand, or both strands. In some embodiments, the 3 ’-overhang is present in the antisense strand. In some embodiments, the 3 ’-overhang is present in the sense strand. In some embodiments, the overhang is present at the 5 ’-end of the sense strand, antisense strand, or both strands. In some embodiments, the 5’-overhang is present in the antisense strand. In some embodiments, the 5 ’-overhang is present in the sense strand. The overhangs may be due to one strand being longer than the other, or the result of two strands of the same length being staggered. In some embodiments, the overhang forms a mismatch with the target sequence. In some embodiments, the overhang is complementary to the gene sequences being targeted. The nucleotides in the overhang region of a siRNA agent may each independently be a modified or unmodified nucleotide (e.g., 2’-fluoro-modified nucleotide, 2’-O-methyl modified nucleotide, deoxynucleotide, or a combination thereof).

[0055] In some embodiments, the 5’ - or 3’ - overhangs of the sense strand or antisense strand of a siRNA agent are phosphorylated. In some embodiments, the 5’- or 3’- overhangs of the sense strand and the antisense strand of a siRNA agent are phosphorylated. In some embodiments, the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, and those two nucleotides can be the same or different.

[0056] In some embodiments, a siRNA agent contains only a single overhang, which can strengthen the interference activity of the siRNA agent, without affecting its overall stability. For example, the single-stranded overhang may be located at the 3 '-terminal end of the sense strand of the siRNA agent, or, alternatively, at the 3'-terminal end of the antisense strand of the siRNA agent. The siRNA agent may also have a blunt end, located at the 5 ’-end of the antisense strand (or the 3 ’-end of the sense strand) or vice versa. In some embodiments, theantisense strand of the siRNA agent has a nucleotide overhang at the 3’-end, and the 5’-end is blunt ended.

[0057] In some embodiments, one strand of a siRNA agent comprises a 5’-end, a 3’-end, or both a 5 ’-end and a 3 ’-end overhang of at least 1 nucleotide, at least 2 nucleotides, or at least 3 nucleotides. In certain embodiments, one strand of a siRNA agent comprises a 5 ’-end, a 3 ’-end, or both a 5 ’-end and a 3 ’-end overhang of at least 1 nucleotide, at least 2 nucleotides, or at least 3 nucleotides, but no more than 5 nucleotides. In some embodiments, one strand of a siRNA agent comprises a 5’-end, a 3’-end, or both a 5’-end and a 3’-end overhang of 1 nucleotide, 2 nucleotides, or 3 nucleotides. In certain embodiments, one strand of a siRNA agent comprises a 5’-end, a 3’-end, or both a 5’-end and a 3’-end overhang of 1 to 2 nucleotides, 1 to 3 nucleotides, 1 to 4 nucleotides, or 1 to 5 nucleotides. In some embodiments, one strand of a siRNA agent comprises a 5 ’-end, a 3 ’-end, or both a 5 ’-end and a 3 ’-end overhang of 2 to 3 nucleotides, 2 to 4 nucleotides, or 2 to 5 nucleotides. In some embodiments, one strand of a siRNA agent comprises a 5 ’-end, a 3 ’-end, or both a 5 ’-end and a 3 ’-end overhang of 3 to 4 nucleotides, or 4 to 5 nucleotides. The strand may be an antisense strand or a sense strand. A nucleotide overhang may comprise or consist of a nucleotide analog or a nucleoside analog.

[0058] In some embodiments, each strand of a siRNA agent comprises a 5’-end, a 3’-end, or both a 5 ’-end and a 3 ’-end overhang of at least 1 nucleotide, at least 2 nucleotides, or at least 3 nucleotides. In some embodiments, each strand of a siRNA agent comprises a 5’-end, a 3 ’-end, or both a 5 ’-end and a 3 ’-end overhang of at least 1 nucleotide, at least 2 nucleotides, or at least 3 nucleotides, but no more than 5 nucleotides. In some embodiments, each strand of a siRNA agent comprises a 5’-end, a 3’-end, or both a 5’-end and a 3’-end overhang of 1 nucleotide, 2 nucleotides, or 3 nucleotides. In some embodiments, each strand of a siRNA agent comprises a 5’-end, a 3’-end, or both a 5’-end and a 3’-end overhang of 1 to 2 nucleotides, 1 to 3 nucleotides, 1 to 4 nucleotides, or 1 to 5 nucleotides. In some embodiments, each strand of a siRNA agent comprises a 5’-end, a 3’-end, or both a 5’-end and a 3 ’-end overhang of 2 to 3 nucleotides, 2 to 4 nucleotides, or 2 to 5 nucleotides. In some embodiments, each strand of a siRNA agent comprises a 5’-end, a 3’-end, or both a 5’-end and a 3 ’-end overhang of 3 to 4 nucleotides, or 4 to 5 nucleotides. A nucleotide overhang may comprise or consist of a nucleotide analog or a nucleoside analog.

[0059] The term “blunt” or “blunt ended” as used herein in the context of a siRNA agent means that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a siRNA agent, z.e., no nucleotide overhang. In some embodiments, one end of a siRNAagent is blunt ended. In other words, the 5 ’-end of one strand and the 3 ’-end of the other strand do not include an unpaired nucleotide or nucleotide analog. In some embodiments, both ends of a siRNA agent are blunt ended. In other words, there is no nucleotide overhang at either end of the siRNA agent.

[0060] The term “antisense strand” or “guide strand” as used herein in the context of a siRNA agent refers to the strand which includes a region that is complementary to a target sequence.

[0061] The term “sense strand” or “passenger strand” as used herein in the context of a siRNA agent refers to the strand of a siRNA agent that includes a region that is complementary to a region of the antisense strand.

[0062] The term “modified” as used herein in the context of a nucleobase or nucleotide of a siRNA agent, refers to a nucleobase or nucleotide not found in nature in an RNA molecule.

[0063] The phrase “naturally occurring RNA sequence” as used herein refers to an RNA sequence that includes purine bases adenine (A) and guanine (G), and pyrimidine bases cytosine (C) and uracil (U).

[0064] The term “isomer” as used herein refers to different compounds that have the same molecular formula. “Stereoisomers” are isomers that differ only in the way the atoms are arranged in space. “Atropisomers” are stereoisomers from hindered rotation about single bonds. “Enantiomers” are a pair of stereoisomers that are non-superimposable mirror images of each other. A mixture of a pair of enantiomers in any proportion can be known as a “racemic” mixture. “Diastereoisomers” are stereoisomers that have at least two asymmetric atoms, but which are not mirror-images of each other.

[0065] Stereoisomers” can also include E and Z isomers, or a mixture thereof, and cis and trans isomers or a mixture thereof. In some embodiments, a compound described herein is isolated as either the E or Z isomer. In some embodiments, a compound described herein is a mixture of the E and Z isomers.

[0066] It should be noted that if there is a discrepancy between a depicted structure and a name for that structure, the depicted structure is to be accorded more weight.

[0067] The term “pathology” as used herein refers to the nature of a disease condition, especially changes in body tissues and organs that cause or are caused by a disease or condition. For example, Alzheimer’s disease pathology includes, but is not limited to, accumulation and aggregation of amyloid plaques, hyperphosphorylation of tau protein, neurofibrillary tangle formation, inflammatory responses such as microglial activation and cytokine release, astrocytosis, acute protein release, over-expression of majorhistocompatibility complex class II (MHC II) and the like, oxidative injury, ventricular enlargement, neuronal / neurite dysfunction and death in the hippocampus and cerebral cortex, progressive neurotransmitter deficits, synaptic loss and shrinkage of neuronal perikarya.

[0068] The term “moiety” as used herein refers to a part, portion, group, component, etc. of a structure, molecule, compound or composition. For example, a moiety may be a specific group of atoms within a molecule that is responsible for a characteristic function of that molecule or may be a core component of a molecule that is responsible for a physiological or pharmacological action.

[0069] The phrase "lipophilic moiety" or “lipid moiety” are used interchangeably herein to refer to a moeity that prefers or possesses an affinity for a non-polar environment compared to a polar or aqueous environment.

[0070] The terms “comprising” and “including” are used interchangeably herein. The terms “comprising” and “including” are to be interpreted as specifying the presence of the stated features or components as referred to, but does not preclude the presence or addition of one or more features, or components, or groups thereof. Additionally, the terms “comprising” and “including” are intended to include examples encompassed by the term “consisting of’. Consequently, the term “consisting of’ can be used in place of the terms “comprising” and “including” to provide for more specific embodiments.

[0071] The term “or” as used herein is to be interpreted as an inclusive “or” meaning any one or any combination. Therefore, “A, B, or C” means any of the following: A; B; C; A and B; A and C; B and C; A, B, and C. An exception to this definition will occur only when a combination of elements, functions, steps or acts are in some way inherently mutually exclusive.

[0072] The phrase “and / or” as used in a phrase such as “A and / or B” herein is intended to include both A and B; A or B; A (alone); and B (alone). Likewise, the phrase “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).NUCLEOTIDE SEQUENCES

[0073] Provided herein are siRNA agents which inhibit (e.g., partially or completely) the expression of a MAPT gene (e.g., a human MAPT gene). In some embodiments, a siRNA described herein inhibits expression of a MAPT gene (e.g., a human MAPT gene) by at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60% relative to a negative control (e.g., PBS or siRNA directed to an RNA molecule formedduring the transcription of a gene other than MAPT) in an assay known to one of skill in the art, or described herein. In some embodiments, a siRNA described herein inhibits expression of a MAPT gene (e.g., a human MAPT gene) by at least about 70%, at least 75%, at least 80%, or at least 85% relative to a negative control (e.g., PBS or siRNA directed to an RNA molecule formed during the transcription of a gene other than MAPT) in an assay known to one of skill in the art, or described herein. In some embodiments, a siRNA described herein inhibits expression of a MAPT gene (e.g., a human MAPT gene) by at least about 90%, at least 95%, at least 96%, at least 97%, or at least 98% relative to a negative control (e.g., PBS or siRNA directed to an RNA molecule formed during the transcription of a gene other than MAPT) in an assay known to one of skill in the art, or described herein. In some embodiments, a siRNA described herein inhibits expression of a MAPT gene (e.g., a human MAPT gene) by 25% to 50%, 50% to 75%, 75% to 85%, 85% to 95%, 90% to 95%, or 95% to 99% relative to a negative control (e.g., PBS or siRNA directed to an RNA molecule formed during the transcription of a gene other than MAPT) in an assay known to one of skill in the art, or described herein. In some embodiments, a siRNA described herein inhibits expression of a MAPT gene (e.g., a human MAPT gene) by 100% relative to a negative control (e.g., PBS or siRNA directed to an RNA molecule formed during the transcription of a gene other than MAPT) in an assay known to one of skill in the art, or described herein. In some embodiments, inhibition of MAPT gene (e.g., a human MAPT gene) expression may be assessed using an in vitro assay. In some embodiments, a siRNA agent described herein exhibits knockdown efficiency in vitro or ex vivo. In some embodiments, a siRNA agent described herein exhibits knockdown efficiency in vivo in a mouse model.

[0074] In some embodiments, a siRNA agent described herein inhibits the expression of a MAPT gene (e.g., human MAPT gene) in neurons (e.g., human iPSC-neurons) at an ICso of 10 nM to 200 nM in an assay known to one of skill in the art or described herein. In some embodiments, a siRNA agent described herein inhibits the expression of a MAPT gene (e.g., human MAPT gene) in neurons (e.g., human iPSC-neurons) at an ICso of 10 nM to 100 nM in an assay known to one of skill in the art, or described herein In some embodiments, a siRNA agent described herein inhibits the expression of a MAPT gene (e.g., human MAPT gene) in neurons (e.g., human iPSC-neurons) at an ICso of 10 nM to 50 nM in an assay known to one of skill in the art, or described herein.

[0075] In some embodiments, a siRNA agent of the described invention is a doublestranded RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide. In some embodiments, the double-stranded RNA or RNA-like oligonucleotide comprises a sensestand and an antisense strand. In some embodiments, the sense strand and antisense strand anneal to form a double-stranded region or duplex. In some embodiments, the antisense strand includes a region that is substantially complementary to a target sequence. In some embodiments, the antisense strand includes a region that is fully complementary to a target sequence. In some embodiments, the sense strand includes a region that is complementary to the antisense strand. In some embodiments, the sense strand and antisense strand hybridize and form a duplex structure when combined under suitable conditions. As described herein and as known in the art, the complementary sequences of a siRNA agent can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides. In some embodiments, annealing of the sense strand and antisense strand sequences form a duplex that is stable as assessed by a melting temperature (Tm). In some embodiments, the Tm is about 40° C, about 41° C, about 42° C, about 43° C, about 44° C, about 45° C, or higher.

[0076] In some embodiments, the sense strand and the antisense strand of a siRNA agent of the described invention may be the same length or different lengths. In some embodiments, the sense strand and the antisense strand of a siRNA agent of the described invention can each be 15 to 30 nucleotides in length. In some embodiments, the sense strand and the antisense strand of a siRNA agent of the described invention are each no more than 30 nucleotides in length. In some embodiments, the sense strand and the antisense strand of a siRNA agent of the described invention are each independently 15 to 30 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent of the described invention are each independently 16 to 30 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent of the described invention are each independently 17 to 30 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent of the described invention are each independently 18 to 30 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent of the described invention are each independently 19 to 30 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent of the described invention are each independently 20 to 30 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent of the described invention are each independently 21 to 30 nucleotides in length.

[0077] In some embodiments, the sense strand and the antisense strand of a siRNA agent described herein are each independently 15 to 25 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent described herein are eachindependently 16 to 25 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent described herein are each independently 17 to 25 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent described herein are each independently 18 to 25 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent described herein are each independently 19 to 25 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent described herein are each independently 20 to 25 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent described herein are each independently 21 to 25 nucleotides in length.

[0078] In some embodiments, the sense strand and the antisense strand of a siRNA agent described herein are each independently 19 to 23 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent described herein are each independently 19 to 22 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent described herein are each independently 19 to 21 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent described herein are each independently 19 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent described herein are each independently 20 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent described herein are each independently 21 nucleotides in length. In some embodiments, the sense and the antisense strand of a siRNA agent described herein are each independently 22 nucleotides in length.

[0079] In some embodiments, the double stranded region formed by hybridization of the antisense strand and the sense strand of a siRNA agent of the described invention may be the entire length of both strands. For example, the antisense strand of a siRNA agent of the described invention may be 19 nucleotides in length, the sense strand of the siRNA agent may be 19 nucleotides in length, and the double strand region formed by hybridization of the strands is 19 nucleotides. In another example, the antisense strand of a siRNA agent of the described invention may be 21 nucleotides in length, the sense strand of the siRNA agent may be 21 nucleotides in length, and the double strand region formed by hybridization of the strands is 21 nucleotides. In some embodiments, the double stranded region formed by hybridization of the antisense strand and the sense strand of a siRNA agent of the described invention may be less than entire length of one or both strands. For example, the antisense strand of a siRNA agent of the described invention may be 19 nucleotides in length, the sense strand of the siRNA agent may be 21 nucleotides in length, and the double strand regionformed by hybridization of the strands is 19 nucleotides. In another example, the antisense strand of a siRNA agent of the described invention may be 21 nucleotides in length, the sense strand of the siRNA agent may be 19 nucleotides in length, and the double strand region formed by hybridization of the strands is 19 nucleotides. In another example, the antisense strand of a siRNA agent of the described invention may be 21 nucleotides in length, the sense strand of the siRNA agent may be 21 nucleotides in length, and the double strand region formed by hybridization of the strands is 19 nucleotides. In some embodiments, the doublestrand region of a siRNA agent of the described invention is long enough to serve as a substrate for an endonuclease that functions in the RNA interference (RNAi) pathway. A non-limiting example of an endonuclease that functions in the RNAi pathway is the Dicer enzyme.

[0080] In some embodiments, the double strand region of a siRNA agent described herein is 15 to 30 base pairs in length. In some embodiments, the double strand region of a siRNA agent described herein may be 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19- 20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21- 28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. In some embodiments, the double strand region of a siRNA agent described herein is 15 to 25 base pairs in length. In some embodiments, the double strand region of a siRNA agent described herein is 16 to 25 base pairs in length. In some embodiments, the double strand region of a siRNA agent described herein is 17 to 25 base pairs in length. In some embodiments, the double strand region of a siRNA agent described herein is 18 to 25 base pairs in length. In some embodiments, the double strand region of a siRNA agent described herein is 19 to 25 base pairs in length. In some embodiments, the double strand region of a siRNA agent described herein is 20 to 25 base pairs in length. In some embodiments, the double strand region of a siRNA agent described herein is 21 to 25 base pairs in length. In some embodiments, the double strand region of a siRNA agent described herein is 19 to 23 base pairs in length. In some embodiments, the double strand region of a siRNA agent described herein is 19 to 22 base pairs in length. In some embodiments, the double strand region of a siRNA agent described herein is 19 to 21 base pairs in length. In some embodiments, the double strand region of a siRNA agent described herein is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 base pairs in length. In some embodiments, the double strand region of a siRNA agent describedherein is 19, 20, 21, 22 or 23 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.

[0081] In some embodiments, a siRNA agent described herein is blunt ended. In some embodiments, the sense strand or the antisense strand of a siRNA agent described herein comprises an overhang. The overhang may be at the 5’ end, the 3’ end, or both the 5’ and 3’ end of either the sense strand or antisense strand of the siRNA agent. In some embodiments, the sense strand and the antisense strand of a siRNA agent described herein comprise an overhang. In some embodiments, the overhang of the sense strand may be at the 5’ end of the sense strand, and the overhang of the antisense strand may be at the 3’ end of the antisense strand. In some embodiments, the overhang of the sense strand may be at the 3’ end of the sense strand. In some embodiments, the overhang of the antisense strand may be at the 5’ end of the antisense strand. In some embodiments, the overhang of a strand of a siRNA agent described herein comprises at least 1 nucleotide. In some embodiments, the overhang of a strand of a siRNA agent described herein comprises at least 2 nucleotides. In some embodiments, the overhang of a strand of a siRNA agent described herein comprises at least 3 nucleotides. In some embodiments, the overhang of a strand of a siRNA agent described herein comprises at least 4 nucleotides. In some embodiments, the overhang of a strand of a siRNA agent described herein comprises at least 5 nucleotides. In some embodiments, the overhang of a strand of a siRNA agent described herein comprises 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, or more. In some embodiments, the overhang of a strand of a siRNA agent described herein comprises 1 to 5 nucleotides, 1 to 4 nucleotides, 1 to 3 nucleotides, or 1 to 2 nucleotides. In some embodiments, the overhang of a strand of a siRNA agent described herein comprises 2 to 5 nucleotides, 2 to 4 nucleotides, 2 to 3 nucleotides, 3 to 4 nucleotides, 3 to 4 nucleotides, or 4 to 5 nucleotides.

[0082] In some embodiments, the sense strand of a siRNA agent described herein is 19 nucleotides in length and the antisense strand of the siRNA agent described herein is 21 nucleotides in length. In some embodiments, the sense strand of a siRNA agent described herein is 20 nucleotides in length and the antisense strand of the siRNA agent is 21 nucleotides in length. In some embodiments, the sense strand of a siRNA agent described herein is 21 nucleotides in length and the antisense strand of the siRNA agent is 21 nucleotides in length. In some embodiments, the sense strand of a siRNA agent described herein is 21 nucleotides in length and the antisense strand of the siRNA agent is 19 nucleotides in length. In some embodiments, the sense strand of a siRNA agent described herein is 21 nucleotides in length and the antisense strand of the siRNA agent is 20nucleotides in length. In some embodiments, the sense strand of a siRNA agent described herein is 19 nucleotides in length and the antisense strand of the siRNA agent is 19 nucleotides in length. In some embodiments, the sense strand of a siRNA agent described herein is 20 nucleotides in length and the antisense strand of the siRNA agent is 20 nucleotides in length.

[0083] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region. In some embodiments, the sense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 3.

[0084] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 3.

[0085] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of the antisense strand nucleotide sequence in a row in Table 3, and wherein the sense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of the sense strand nucleotide sequence in the same row in Table 3. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of the antisense strand nucleotide sequence of U111, U920, U1074, U1079, U3351, U3353, U3410, U3412, U3416, U3417, U4815, U5427 or U5471 in Table 3, and the sense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of the sense strand nucleotide sequence of Ul l l, U920, U1074, U1079, U3351, U3353, U3410, U3412, U3416, U3417, U4815, U5427 or U5471 in Table 3, respectively.

[0086] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 3, and the sense strand comprises a nucleotide sequence partially complementary to the antisense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table3, and the sense strand comprises a nucleotide sequence substantially complementary to the antisense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 3, and the sense strand comprises a nucleotide sequence fully complementary to the antisense strand.

[0087] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 3, and the antisense strand comprises a nucleotide sequence partially complementary to the sense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 3, and the antisense strand comprises a nucleotide sequence substantially complementary to the sense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 3, and the antisense strand comprises a nucleotide sequence fully complementary to the sense strand.

[0088] In some embodiments, a siRNA agent of the described invention does not comprise, e.g., chemical modifications or conjugations known in the art and described herein. In some embodiments, a siRNA agent of the described invention comprises chemical modifications or conjugations. Chemical modifications and conjugations are known in the art and described herein. In some embodiments, a siRNA agent of the described invention comprises one or more chemical modifications and / or conjugations described herein. In some embodiments, the nucleobase of a nucleotide is modified. In some embodiments, the sugar of the nucleotide is modified. In some embodiments, the phosphate backbone of the nucleotide is modified.

[0089] In some embodiments, the siRNA agents may contain only naturally occurring nucleotides. In some embodiments, the siRNA agents may contain one or more modified nucleotides. In some embodiments, the nucleobase of a nucleotide is modified. In some embodiments, the sugar of the nucleotide is modified. In some embodiments, the phosphate backbone of the nucleotide is modified.

[0090] In some embodiments, the modified nucleotides comprise one or more modified nucleotides. Modified nucleotides include, but are not limited to, a 2’0-methyl modified nucleotide, a deoxy-nucleotide, a 2’-fluoro modified nucleotide, a 2’-O-methyl-uridine, a 3’- O-methyl modified nucleotide, a 3’-O-methyl modified nucleotide with 2’-5’ linked phosphate, an inverted abasic nucleotide, a nucleotide comprising S-glycol nucleic acid (GNA), an unlocked nucleotide, a 5’-vinylphosphonate-2’-O-methyl-uridine, a cis-cyclobutyl phosphonate modified nucleotide, a 5 ’-cis-cyclobutyl phosphonate-2’-O-m ethyl modified nucleotide, a (L)-a-threofuranosyl modified nucleotide, and combinations thereof.

[0091] In some embodiments, the antisense strand of a siRNA agent described herein comprises at least one modified internucleoside linkage.

[0092] In some embodiments, the sense strand of a siRNA agent described herein comprises at least one modified internucleoside linkage.

[0093] In some embodiments, the antisense strand and the sense strand of a siRNA agent described herein each comprise at least one modified internucleoside linkage. In some embodiments, the modified intemucleoside linkages include phosphorothioate.

[0094] In some embodiments, a siRNA agent described herein comprises one or more of the following: a phosphorothioate (PS) linkage, 2’-fluororibose (2’-F), 2’ -methoxyribose (2’- OMe), deoxyribose, 2’-O-(2-methoxyethyl)ribose (2’-M0E), an inverted linkage (inverted abasic site, InvAb), unlocked nucleic acid (UNA), and glycol nucleic acid (GNA).

[0095] In some embodiments, a siRNA agent described herein exhibits stability as assessed by an assay described herein or known to one skilled in the art. In some embodiments, a siRNA agent described herein comprises one or more modified nucleotides that exhibits increased stability relative to the same siRNA agent without those one or more modified nucleotides, as assessed using a method described herein or known to one skilled in the art.

[0096] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 1. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 1

[0097] In some embodiments, provided herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strandcomprises the nucleotide sequence of the antisense strand nucleotide sequence in a row in Table 1, and wherein the sense strand comprises the nucleotide sequence of the sense strand nucleotide sequence in the same row in Table 1.

[0098] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 1, and the sense strand comprises a nucleotide sequence partially complementary to the antisense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 1, and the sense strand comprises a nucleotide sequence substantially complementary to the antisense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 1, and the sense strand comprises a nucleotide sequence fully complementary to the antisense strand.

[0099] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 1, and the antisense strand comprises a nucleotide sequence partially complementary to the sense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 1, and the antisense strand comprises a nucleotide sequence substantially complementary to the sense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 1, and the antisense strand comprises a nucleotide sequence fully complementary to the sense strand.

[0100] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of the antisense strand nucleotide sequence of Mi l l, M920, M1074, M1079, M3351, M3353, M3410, M3412, M3416, M3417, M4815, M5427 or M5471 in Table 1, and the sense strandcomprises a nucleotide sequence corresponding to the nucleotide sequence of the sense strand nucleotide sequence of Mi l l, M920, M1074, M1079, M3351, M3353, M3410, M3412, M3416, M3417, M4815, M5427 or M5471 in Table 1, respectively.

[0101] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 4. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 4. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of the antisense strand nucleotide sequence in a row in Table 4, and the sense strand comprises the nucleotide sequence of the sense strand nucleotide sequence in the same row in Table 4.

[0102] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 4, and the sense strand comprises a nucleotide sequence partially complementary to the antisense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 4, and the sense strand comprises a nucleotide sequence substantially complementary to the antisense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 4, and the sense strand comprises a nucleotide sequence fully complementary to the antisense strand.

[0103] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 4, and the antisense strand comprises a nucleotide sequence partially complementary to the sense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequencesin Table 4, and the antisense strand comprises a nucleotide sequence substantially complementary to the sense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 4, and the antisense strand comprises a nucleotide sequence fully complementary to the sense strand.

[0104] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of the antisense strand nucleotide sequence of Ul l l, U920, U1074, U1079, U3351, U3353, U3410, U3412, U3416, U3417, U4815, U5427 or U5471 in Table 4, and the sense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of the sense strand nucleotide sequence of Ul l l, U920, U1074, U1079, U3351, U3353, U3410, U3412, U3416, U3417, U4815, U5427 or U5471 in Table 4, respectively.

[0105] In some embodiments, a siRNA agent described herein is conjugated to one or more non-nucleotide groups. Non-nucleotide groups include, but are not limited to, a targeting group, a linking group, a delivery polymer, or a delivery vehicle. In some embodiments, the one or more non-nucleotide groups is one or more of the ones described herein.

[0106] In some embodiments, the antisense strand of a siRNA agent described herein is conjugated directly or indirectly to one or more lipophilic moieties See, e.g., S. Winiwarter, M. Ridderstrbm, A.-L. Ungell, T.B. Andersson, I. Zamora, Use of Molecular Descriptors for Absorption, Distribution, Metabolism, and Excretion Predictions. Comprehensive Medicinal Chemistry II, Volume 5, 2007, pages 531-554 regarding lipophilicity). In some embodiments, the sense strand of a siRNA agent described herein is conjugated directly or indirectly to one or more lipophilic moieties. In specific embodiments, the antisense strand and sense strand of a siRNA agent described herein are each conjugated directly or indirectly to one or more lipophilic moieties. The one or more lipophilic moieties may be conjugated to one or more terminal positions of the siRNA agent. For example, the lipophilic moieties may be conjugated to the 5’ end and / or 3’ end of one or both strands of the siRNA agent.Alternatively, or in addition, the one or more lipophilic moieties may be conjugated to one or more internal positions of the double stranded region of the siRNA agent. In some embodiments, the lipophilic moieties are conjugated to one or more terminal positions of the siRNA agent and one or more internal positions of the siRNA agent. In some embodiments,the one or more lipophilic moieties are conjugated via a linker or a carrier. In some embodiments, a linker is one described herein. For example, the linker may comprise one of the following structures:In some embodiments, a lipophilic moiety comprises a lipophilic moiety described herein. In some embodiments, the lipophilic moiety is selected from one or more of the following: LI, L2, L3, L4, L5, L6, L7, L8, L9, LIO, LI 1, L12, L13, L14, L15, L16, L17, L18, L19, L20, L20, L21, L22, L23, and / or L24 as described in FIGURE 1. In some embodiments, the lipophilic moiety comprises l-((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-(((Z)- octadec-9-en-l-yl)oxy)tetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione; N,N'- ((((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2,3- diyl)bis(oxy))bis(propane-3,l-diyl))dipalmitamide; N-((2R,3R,4S,5R)-2-(2,4-dioxo-3,4- dihydropyrimidin-l(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl)palmitamide; (2R,3R,4R,5R)-2-(2,4-di oxo-3, 4-dihy dropyrimidin-1 (2H)-yl)-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate; 3-(((2R,3R,4R,5R)-2-(2,4-dioxo-3.4-dihy dropyrimidin-1 (2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl)oxy)-N- hexadecylpropanamide; l-((2R,3R,4R,5R)-3-(2-(hexadecyloxy)ethoxy)-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione; Hexadecyl ((2R,3R,4S,5R)-2-(2,4-di oxo-3, 4-dihy dropyrimidin-1 (2H)-yl)-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-3-yl)carbamate; (2R,3R,4R,5R)-5-(heptadecyloxy)-2- (hydroxymethyl)-4-(2 -methoxy ethoxy )tetrahydrofuran-3-ol; (2R,3R,4R,5R)-4- (hexadecyloxy)-2-(hydroxymethyl)-5-methoxytetrahydrofuran-3-ol; (2R,3R,4R,5R)-5- (heptadecyloxy)-4-(hexadecyloxy)-2-(hydroxymethyl)tetrahydrofuran-3-ol; (2R,3R,4R,5R)-4.5-bis(hexadecyloxy)-2-(hydroxymethyl)tetrahydrofuran-3-ol; (2R,3R,4S,5R)-5,6- bis(hexadecyloxy)-2-(hydroxymethyl)-4-methoxytetrahydro-2H-pyran-3-ol; 1- ((2R,3R,4R,5R)-3-((15-((3r,5r,7r)-adamantan-l-yl)pentadecyl)oxy)-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione; (ls,4s)-4- heptadecanamidocyclohexane- 1 -carboxyl-; 16-oxo- 16-(((l S,2R,4S)- 1,7,7- 1trimethylbicyclo[2.2.1]heptan-2-yl)oxy)hexadecanonyl-; 16-(((1S,2R,4S)-1,7,7- trimethylbicyclo[2.2.1]heptan-2-yl)oxy)hexadecanonyl-; 15-((3r,5r,7r)-adamantan-l- yl)pentadecanonyl-; 2-(2-(N-hexadecylpalmitamido)-N-methylacetamido)ethanonyl-; 16- (((lR,2S,5R)-2-isopropyl-5-methylcyclohexyl)oxy)-16-oxohexadecanonyl-; 16-(((1R,2S,5R)- 2-isopropyl-5-methylcyclohexyl)oxy)hexadecananonyl-; (2R,3R,4R,5R)-2-(6-amino-9H- purin-9-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate; (2R,3R,4R,5R)-2-(4-amino-2-oxopyrimidin-l(2H)-yl)-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate; (2R,3R,4R,5R)-2-(2-amino-6- oxo-l,6-dihydro-9H-purin-9-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate; or (2R,3R,4S,5R,6R)-4,6-bis(hexadecyloxy)-2-(hydroxymethyl)-5- methoxytetrahydro-2H-pyran-3-ol. In some embodiments, the lipophilic moiety is conjugated to the sense strand of the siRNA agent.

[0107] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 1, and wherein the sense strand is conjugated to a lipid moiety conjugated to the sense strand of the siRNA agent. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of the antisense strand nucleotide sequence in a row in Table 1, and the sense strand comprises the nucleotide sequence of the sense strand nucleotide sequence in the same row in Table 1, and wherein the sense strand is conjugated to a lipid moiety conjugated to the sense strand of the siRNA agent.

[0108] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 1, and the sense strand comprises a nucleotide sequence partially complementary to the antisense strand, and wherein the sense strand of the siRNA agent is conjugated to a lipid moiety, such as, e.g., described in FIGURE 1. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 1, and the sense strand comprises a nucleotide sequence substantially complementary to the antisense strand, and wherein the sense strand of the siRNA agent is conjugated to a lipid moiety, such as, e.g., described in FIGURE 1. In some embodiments, described herein is a siRNA agent comprising a sense strand and anantisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 1, and the sense strand comprises a nucleotide sequence fully complementary to the antisense strand, and wherein the sense strand of the siRNA agent is conjugated to a lipid moiety, such as, e.g., described in FIGURE 1.

[0109] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 1, wherein the sense strand is conjugated to a lipid moiety, such as, e.g., described in FIGURE 1 and the antisense strand comprises a nucleotide sequence partially complementary to the sense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 1, wherein the sense strand is conjugated to a lipid moiety, such as, e.g., described in FIGURE 1 and the antisense strand comprises a nucleotide sequence substantially complementary to the sense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 1, wherein the sense strand is conjugated to a lipid moiety, such as, e.g., described in FIGURE 1 and the antisense strand comprises a nucleotide sequence fully complementary to the sense strand.

[0110] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of the antisense strand nucleotide sequence of Mi l l, M920, M1074, M1079, M3351, M3353, M3410, M3412, M3416, M3417, M4815, M5427 or M5471 in Table 1, and the sense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of the sense strand nucleotide sequence of Mi l l, M920, M1074, M1079, M3351, M3353, M3410, M3412, M3416, M3417, M4815, M5427 or M5471 in Table 1, respectively, wherein the sense strand is conjugated to a lipid moiety, such as, e.g., described in FIGURE 1.

[0111] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 2. In some embodiments, described herein is a siRNA agent comprising a sense strandand an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 2, wherein the sense strand is conjugated to a lipid moiety as indicated in the same row of Table 2.

[0112] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 2. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 2, and wherein the sense strand is conjugated to a lipophilic moiety described herein.

[0113] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of the antisense strand nucleotide sequence in a row in Table 2, and the sense strand comprises the nucleotide sequence of the sense strand nucleotide sequence in the same row in Table 2. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of the antisense strand nucleotide sequence in a row in Table 2, and the sense strand comprises the nucleotide sequence of the sense strand nucleotide sequence in the same row in Table 2, and wherein the sense strand is conjugated to a lipid moiety as indicated in the same row of Table 2.

[0114] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 2, and the sense strand comprises a nucleotide sequence partially complementary to the antisense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 2, and the sense strand comprises a nucleotide sequence partially complementary to the antisense strand, and wherein the sense strand is conjugated to a lipophilic moiety described herein. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 2, and the sense strand comprises a nucleotide sequencesubstantially complementary to the antisense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 2, and the sense strand comprises a nucleotide sequence substantially complementary to the antisense strand, and wherein the sense strand is conjugated to a lipophilic moiety described herein. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 2, and the sense strand comprises a nucleotide sequence fully complementary to the antisense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises the nucleotide sequence of any one of the antisense strand nucleotide sequences in Table 2, and the sense strand comprises a nucleotide sequence fully complementary to the antisense strand, and wherein the sense strand is conjugated to a lipid moiety described herein.

[0115] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 2, and the antisense strand comprises a nucleotide sequence partially complementary to the sense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 2, wherein the sense strand is conjugated to a lipid moiety as indicated in the same row of Table 2, and the antisense strand comprises a nucleotide sequence partially complementary to the sense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 2, and the antisense strand comprises a nucleotide sequence substantially complementary to the sense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 2, wherein the sense strand is conjugated to a lipid moiety as indicated in the same row of Table 2, and the antisense strand comprises a nucleotide sequence substantially complementary to the sense strand. In some embodiments, described herein is asiRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 2, and the antisense strand comprises a nucleotide sequence fully complementary to the sense strand. In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence of any one of the sense strand nucleotide sequences in Table 2, wherein the sense strand is conjugated to a lipid moiety as indicated in the same row of Table 2, and the antisense strand comprises a nucleotide sequence fully complementary to the sense strand.

[0116] In some embodiments, described herein is a siRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of the antisense strand nucleotide sequence of Ml 1 IL, M920L, M1074L, M1079L, M3351L, M3353L, M3410L, M3412L, M3416L, M3417L, M4815L, M5427L or M5471L in Table 2, and the sense strand comprises a nucleotide sequence corresponding to the nucleotide sequence of the sense strand nucleotide sequence of Mi l IL, M920L, M1074L, M1079L, M3351L, M3353L, M3410L, M3412L, M3416L, M3417L, M4815L, M5427L or M5471L in Table 2, respectively.

[0117] In some embodiments, a siRNA agent described herein comprises the antisense strand and the sense strand of one named in Table 1, 2, 3, or 4. In some embodiments, a siRNA agent described herein comprises the antisense strand and the sense strand of one named in Table 1, 2, 3 or 4. In some embodiments, the sense strand of the siRNA agent is conjugated to a lipid moiety described herein (e.g., FIGURE 1).

[0118] In some embodiments, a siRNA agent described herein further comprises a nonnucleotide group, such as a ligand (e.g., a targeting ligand). The non-nucleotide group, such as a ligand (e.g., a targeting ligand) may be conjugated directly or indirectly to the antisense strand of the siRNA agent. The non-nucleotide group, such as a ligand (e.g., a targeting ligand) may be conjugated directly or indirectly to the sense strand of the siRNA agent. The non-nucleotide group, such as a ligand (e.g., a targeting ligand) may replace one or more nucleotides in an internal position of the double stranded region of a siRNA agent described herein. In some embodiments, the non-nucleotide group, such as a ligand (e.g., a targeting ligand) is conjugated to a strand of the siRNA agent via a linker or carrier (e.g., a delivery vehicle). In some embodiments, the non-nucleotide group, such as a ligand (e.g., a targeting ligand) is one described herein, infra.

[0119] Table 1: Modified Nucleotide Sense and Antisense Sequences (5’ to 3’)Modification: mN=2'0Me; fN=2'F; dN=deoxy; ps=phosphorothioate; VP=vinyl phosphonate; invAb=inverse abasicCHEMICAL MODIFICATIONS TO NUCLEOTIDES

[0120] In some embodiments, a siRNA agent described herein comprises one or more nucleotide modifications. Nucleotide modifications include, but are not limited to, end modifications, e.g., 5 ’-end modifications (e.g., phosphorylation, conjugation, inverted linkages); 3 ’-end modifications (e.g., conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2’ -position or 4’ -position) or replacement of the sugar; or backbone modifications, including, for example, modification or replacement of the phosphodiester linkages. In some embodiments, the siRNA agent comprises at least one modification selected from the group consisting of modified intemucleoside linkage, modified nucleobase, modified sugar, and any combinations thereof. Without limitations, such a modification can be present anywhere in the siRNA agent (e.g., in the sense strand, antisense strand, or both strands).

[0121] In some embodiments, the siRNA agent comprises one or more modified sugar modifications. In some embodiments, the one or more modified sugar modifications, includes one or more substituted sugar moieties. In some embodiments, a siRNA agent described herein includes one of the following at the 2'-position: H; F; or OCH3 (OMe).

[0122] In some embodiments, a siRNA agent described herein includes one or more glycol nucleic acids (GNA). In some embodiments, the GNA is an acyclic nucleic acid analogue, wherein its repeating glycol units are linked by phosphodiester bonds, differing from RNA’s ribose sugar-phosphodiester backbone composition.

[0123] In some embodiments, a siRNA agent described herein includes one or more terminal modifications. Terminal modifications included, but are not limited to, 5 ’-terminal phosphorylation, conjugation, or inverted linkages. In some embodiments, the terminalmodifications include a 5’ -phosphate, for example, a 5’-terminal phosphate on the antisense strand of the siRNA agent.

[0124] In some embodiments, the siRNA agent includes a sense strand and / or an antisense strand with an inverted abasic nucleotide. In some embodiments, the sense strand contains an inverted abasic nucleotide at 3’ end. In some embodiments, the sense strand contains an inverted abasic nucleotide at 5’ end. In some embodiments, the sense strand contains an inverted abasic nucleotide at the 5’ and 3’ end.

[0125] In some embodiments, the siRNA agent comprises a phosphate or phosphate mimic at the 5 ’-end of the antisense strand. A non-limiting example of a phosphate mimic is a 5 ’-vinyl phosphonate (VP).

[0126] In some embodiments, the siRNA agent comprises one or more modified nucleotides. Modified nucleotides include, but are not limited to, a 2’O-methyl modified nucleotide, a deoxy-nucleotide, a 2’-fluoro modified nucleotide, a 2’-O-methyl-uridine, a 3’- O-methyl modified nucleotide, a 3’-O-methyl modified nucleotide with 2’-5’ linked phosphate, an inverted abasic nucleotide, a nucleotide comprising S-glycol nucleic acid (GNA), an unlocked nucleotide, a 5’-vinylphosphonate-2’-O-methyl-uridine, a cis-cyclobutyl phosphonate modified nucleotide, a 5 ’-cis-cyclobutyl phosphonate-2’-O-m ethyl modified nucleotide, a (L)-a-threofuranosyl modified nucleotide, and combinations thereof.

[0127] In some embodiments, the siRNA agent comprises one or more modified internucleoside linkages (i.e., a modified RNA backbone). Modified internucleoside linkages include, but are not limited to, phosphorothioates (e.g., phosphoromonothioates). The described invention also includes various salts, mixed salts and free acid forms are also included. In some embodiments, a siRNA agent described herein is in a free acid form. In some embodiments, a siRNA agent described herein is in a salt form. In some embodiments, a siRNA agent described herein is in a sodium salt form. In some embodiments, when a siRNA agent described herein is in the salt form, cations of the salt (e.g., sodium cations) are present as counterions for substantially all of the electronegative groups (e.g., phosphodiester and / or phosphorothioate groups) present in the agent. In some embodiments, the counterion is a condensed counterion. In some embodiments, the counterion is a condensed sodium cation. In some embodiments, the condensed counterion is hydrated. In some embodiments, the condensed counterion is a hydrated sodium cation. A siRNA agent in which substantially all of the phosphodiester and / or phosphorothioate linkages have a counterion include not more than 5, 4, 3, 2, or 1 phosphodiester and / or phosphorothioate linkages without acounterion. In other words, the electronegative potential of the siRNA agent is neutralized or substantially neutralized by counterion condensation around the siRNA. In some embodiments, when a siRNA agent described herein is in the sodium salt form, sodium ions are present around the agent as counterions for substantially all of the phosphodiester and / or phosphorothioate groups present in the siRNA agent.

[0128] In some embodiments, a phosphate group of an internucleoside phosphodiester linkage present in the siRNA agent can be modified by replacing one of the oxygens with a different substituent. One result of this modification can be increased resistance of the oligonucleotide to nucleolytic breakdown. Another result of this modification can be increased stability of hybridized single-stranded RNA (ssRNA) in the siRNA agent. A nonlimiting example of a modified phosphate group includes phosphorothioates (e.g., phosphoromonothioates).

[0129] In some embodiments, the siRNA agent comprises an RNA mimetic, in which both the sugar and the intemucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with alternate groups. Such alternate groups include, but are not limited to, boranophosphates (borano), phosphorothioates (PS), phosphorodithioates (PDS), phosphoramidates (PA), methylphosphonates (MP), amides (AM), triazole linkages (TL) ureas, squaramides (SQAM) and triazoles. In some embodiments, the bases of the siRNA agent comprising an RNA mimetic are maintained for hybridization with an appropriate target sequence.

[0130] In some embodiments, a siRNA agent described herein can contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), such as for sugar anomers, or as (D) or (L) such as for amino acids. Included in a siRNA agent described herein are all such possible isomers, as well as their racemic and optically pure forms.

[0131] Table 2: The modified sense and antisense strand sequences of lipid conjugated MAPT siRNA(Modification: mN=2'0Me; fN=2'F; dN=deoxy; ps=phosphorothioate; VP=vinyl phosphonate; InvAb=inverse abasic; J2-CONC16U=L4; J2-CONC16A=L21; J2- CONC16C=L22; J2-CONC16G=L23)MOIETIES LINKED TO NUCLEOTIDE SEQUENCE

[0132] In some embodiments, a siRNA agent described herein is conjugated to one or more non-nucleotide groups. In some embodiments, the non-nucleotide groups can, e.g., enhance targeting, delivery or attachment of the siRNA agent. In some embodiments, the non-nucleotide groups can be covalently linked to the 3' end, 5' end, and / or internally to either the sense strand or the antisense strand of the siRNA agent. In some embodiments, the non-nucleotide groups can be covalently linked to the 3' end, 5' end, both the 3’ end and 5’ end, internally, both the 3’ end and internally, both 5’ end and internally, or at the 3’ end, the 5’ end, and internally of the sense strand and / or the antisense strand of the siRNA agent. In some embodiments, a siRNA agent described herein contains a non-nucleotide group linked to the 3' end, 5' end, both the 3’ end and 5’ end, internally, both the 3’ end and internally, both 5’ end and internally, or at the 3’ end, the 5’ end and internally of the sense strand. In some embodiments, a siRNA agent described herein contains a non-nucleotide group linked to the 5' end of the sense strand. In some embodiments, a siRNA agent described herein contains a non-nucleotide group linked to the 3’ end of the sense strand. In some embodiments, a siRNA agent described herein contains a non-nucleotide group linked to the sense strand internally. In some embodiments, the non-nucleotide group may be linked directly or indirectly to the siRNA agent via a linker / linking group.

[0133] In some embodiments, a siRNA agent is linked to one or more lipid moieties. In some embodiments, the lipid moiety that is linked to a siRNA agent comprises one or more of the following compounds depicted FIGURE 1, or a stereoisomer thereof, or a pharmaceutically acceptable salt thereof: LI, L2, L3, L4, L5, L6, L7, L8, L9, LIO, LI 1, L12, L13, L14, L15, L16, L17, L18, L19, L21, L22, L23, and / or L24. In some embodiments, the lipid moiety is selected from one or more of the following: LI, L2, L3, L4, L5, L6, L7, L8, L9, LIO, Li l, L12, L13, L14, L15, L16, L17, L18, L19, L21, L22, L23, and / or L24 (seeFIGURE 1). In some embodiments, the lipid moiety comprises l-((2R,3R,4R,5R)-4- hydroxy-5-(hydroxymethyl)-3-(((Z)-octadec-9-en-l-yl)oxy)tetrahydrofuran-2-yl)pyrimidine- 2,4(lH,3H)-dione; N,N'-((((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2,3- diyl)bis(oxy))bis(propane-3,l-diyl))dipalmitamide; N-((2R,3R,4S,5R)-2-(2,4-dioxo-3,4- dihydropyrimidin-l(2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl)palmitamide; (2R,3R,4R,5R)-2-(2,4-di oxo-3, 4-dihy dropyrimidin-1 (2H)-yl)-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate; 3-(((2R,3R,4R,5R)-2-(2,4-dioxo-3.4-dihy dropyrimidin-1 (2H)-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl)oxy)-N- hexadecylpropanamide; l-((2R,3R,4R,5R)-3-(2-(hexadecyloxy)ethoxy)-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione; Hexadecyl ((2R,3R,4S,5R)-2-(2,4-di oxo-3, 4-dihy dropyrimidin-1 (2H)-yl)-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-3-yl)carbamate; (2R,3R,4R,5R)-5-(heptadecyloxy)-2- (hydroxymethyl)-4-(2 -methoxy ethoxy )tetrahydrofuran-3-ol; (2R,3R,4R,5R)-4- (hexadecyloxy)-2-(hydroxymethyl)-5-methoxytetrahydrofuran-3-ol; (2R,3R,4R,5R)-5- (heptadecyloxy)-4-(hexadecyloxy)-2-(hydroxymethyl)tetrahydrofuran-3-ol; (2R,3R,4R,5R)-4.5-bis(hexadecyloxy)-2-(hydroxymethyl)tetrahydrofuran-3-ol; (2R,3R,4S,5R)-5,6- bis(hexadecyloxy)-2-(hydroxymethyl)-4-methoxytetrahydro-2H-pyran-3-ol; 1- ((2R,3R,4R,5R)-3-((15-((3r,5r,7r)-adamantan-l-yl)pentadecyl)oxy)-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione; (ls,4s)-4- heptadecanamidocyclohexane- 1 -carboxyl-; 16-oxo- 16-(((l S,2R,4S)- 1,7,7- trimethylbicyclo[2.2.1]heptan-2-yl)oxy)hexadecanonyl-; 16-(((1S,2R,4S)-1,7,7- trimethylbicyclo[2.2.1]heptan-2-yl)oxy)hexadecanonyl-; 15-((3r,5r,7r)-adamantan-l- yl)pentadecanonyl-; 2-(2-(N-hexadecylpalmitamido)-N-methylacetamido)ethanonyl-; 16- (((lR,2S,5R)-2-isopropyl-5-methylcyclohexyl)oxy)-16-oxohexadecanonyl-; 16-(((1R,2S,5R)- 2-isopropyl-5-methylcyclohexyl)oxy)hexadecananonyl-; -; (2R,3R,4R,5R)-2-(6-amino-9H- purin-9-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate; (2R,3R,4R,5R)-2-(4-amino-2-oxopyrimidin-l(2H)-yl)-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate; (2R,3R,4R,5R)-2-(2-amino-6- oxo-l,6-dihydro-9H-purin-9-yl)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-3-yl hexadecylcarbamate; or (2R,3R,4S,5R,6R)-4,6-bis(hexadecyloxy)-2-(hydroxymethyl)-5- methoxytetrahydro-2H-pyran-3-ol. In some embodiments, the lipid moiety is conjugated to the sense strand of a siRNA agent. In some embodiments, the lipid moiety that is linked to a siRNA agent comprises one or more of the following compounds depicted FIGURE 1: LI, L2, L3, L4, L5, L6, L7, L8, L9, LIO, LI 1, L12, L13, L14, L15, L16, L17, L18, L19, L21,L22, L23, and / or L24 in FIGURE 1. In some embodiments, the lipid moiety is linked to the 3’ end, 5’ end, and / or internally to the sense strand.

[0134] In some embodiments, the sense strand of a siRNA agent described herein is conjugated, directly or indirectly, to a lipid moiety at the 5’ end. In some embodiments, the first nucleotide at the 5’ end of the sense strand is connected to a lipid moiety. In some embodiments, the sense strand of a siRNA agent described herein is conjugated, directly or indirectly, to a lipid moiety internally. In some embodiments, the sense strand is conjugated, directly or indirectly, to a lipid moiety at the 3’ end. In some embodiments, the first nucleotide at the 3’ end of the sense strand is connected to a lipid moiety. In some embodiments, the first nucleotide at the 3’ end of the sense strand is connected to a lipid moiety via a linker. In some embodiments, the linker is a nucleotide linker of the length of 1, 2, 3, 4, or 5 nucleotides. In some embodiments, the nucleotide linker is deoxythyminedeoxythymine (dTdT). In some embodiments, the linker is an inverted abasic nucleotide (InvAb). In some embodiments, the sense strand is conjugated, directly or indirectly, to a lipid moiety at the 5’ end, and the sense strand is also conjugated, directly or indirectly, to a lipid moiety at the 3’ end, each of which is as described herein and elsewhere. In some embodiments, the sense strand is conjugated, directly or indirectly, to a lipid moiety at the 5’ end, at the 3’ end, and / or internally. In some embodiments, the lipid moiety at the 5’ end and the 3’ end are the same moiety. In some embodiments, the lipid moiety at the 5’ end and the 3’ end are different moi eties.

[0135] In some embodiments, a linking group is conjugated to the siRNA agent. The linking group can facilitate covalent linkage of the agent to a targeting ligand or delivery polymer or delivery vehicle. The linking group can be linked to the 3' end, the 5' end, and / or internally of the siRNA agent sense strand. In some embodiments, the linking group is linked to the siRNA agent sense strand. In some embodiments, the linking group is conjugated to the 5' end, 3' end, and / or internally to the sense strand of a siRNA agent. In some embodiments, a linking group is conjugated to the 5' end of the sense strand of a siRNA agent. In some embodiments, a linking group is conjugated to the 3' end of the sense strand of a siRNA agent. In some embodiments, a linking group is conjugated internally to the sense strand of a siRNA agent.

[0136] A linker or linking group is a connection between two atoms that links one chemical group (such as a siRNA agent) or segment of interest to another chemical group (such as a targeting group or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage may optionally include aspacer that increases the distance between the two joined atoms. A spacer may further add flexibility and / or length to the linkage.

[0137] Any of the siRNA agent nucleotide sequences listed in Table 1, 2, 3 or 4, whether modified or unmodified, may contain a 3' end, a 5' end, and / or internal targeting ligand and / or linking group. Any of the siRNA agent duplexes listed in Table 1, 2, 3 or 4, whether modified or unmodified, may further comprise a targeting ligand and / or linking group. The targeting ligand or linking group may be attached to the 3' end, 5' end, and / or internally to either the sense strand or the antisense strand of the siRNA agent duplex.SYNTHESIS OF siRNA AGENTS

[0138] A siRNA agent can be synthesized by standard methods known in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al.(Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference, or described herein (e.g., in Section 7, infra). For example, a siRNA agent may be prepared using a two-step procedure. First, the individual strands of the siRNA agent are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA agent can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide strands comprising unnatural or modified nucleotides can be easily prepared. Similarly, single-stranded oligonucleotides can be prepared using solution-phase or solid-phase organic synthesis or both. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems® (Foster City, Calif.). In some embodiments, an oligonucleotide(s) of a siRNA agent of the described invention is synthesized so that it contains a reactive group, such as an amine group, at the 5'-end, 3 ’-end and / or internally. Such a reactive group may be used to subsequently attach a ligand (e.g., targeting ligand) using methods known in the art. In some embodiments, an oligonucleotide(s) of a siRNA agent of the described invention is synthesized with a linking group. This linking group can be used to conjugate a nonnucleotide group (e.g., a lipid moiety, a ligand or delivery group) to the siRNA agent. In some embodiments, an oligonucleotide(s) of a siRNA agent of the described invention is synthesized by an automated synthesizer using phosphoramidites (e.g., standard phosphoramidites and non-standard phosphoramidites, which are commercially available). In some embodiments, a siRNA agent of the described invention is produced using a method described herein, infra. In some embodiments, methods described herein are used to produce a siRNA agent, including one conjugated to a non-nucleotide group, such as described herein, supra.DELIVERY VEHICLES

[0139] In some embodiments, a delivery vehicle may be used to deliver a siRNA agent described herein to a cell or tissue. In some embodiments, the delivery vehicle is a lipid. In some embodiments, the lipid forms a micelle. In some embodiments, the lipid forms a liposome. In some embodiments, the lipid is cationic. In some embodiments, the lipid is ionizable. In some embodiments, the delivery vehicle is a lipid-based nanoparticle (LNP). LNPs may include, but are not limited to, a combination of a cationic or ionizable lipid, a helper lipid and / or a polyethylene glycol)(PEG)-lipid. In some embodiments, the delivery vehicle is a polymer. Polymers include, but are not limited to, poly(lactic-co-glycolic acid) (PLGA), polyethylenimine (PEI), poly(l-lysine) (PLL) and poly(beta-amino ester)s (PBAEs). In some embodiments, the delivery vehicle is a polymer-based nanoparticle. Polymer-based nanoparticles include, but are not limited to, PEG-grafted PEI, cyclodextrin-PEI conjugates, iron oxide nanoparticles and the like. In some embodiments, the delivery vehicle is a ligand. A non-limiting example of a ligand is N-acetylgalactosamine (GalNAc).COMPOSITIONS

[0140] In one aspect, provided herein are compositions comprising a siRNA agent described herein. The composition may further comprise a pharmaceutically acceptable carrier or excipient. Pharmaceutical acceptable carriers include, but are not limited to, any and all solvents, diluents, or other liquid vehicle, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired. Remington's Pharmaceutical Sciences Ed. by Gennaro, Mack Publishing, Easton, Pa., 1995 provides various carriers used in formulating pharmaceutical compositions and known techniques for the preparation thereof. Some examples of materials which can serve as pharmaceutically acceptable carriers include, but are not limited to, sugars such as glucose and sucrose; glycols such a propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; and phosphate buffer solutions, as well as other non-toxic compatible lubricants such as sodium lauryl sulfate and magnesium stearate. Pharmaceutically acceptable excipients include, but are not limited to, cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil. In some embodiments, the composition may further comprisecoloring agents, releasing agents, coating agents, preservatives and antioxidants, according to the judgment of the formulator.USES OF siRNA AGENTS

[0141] The siRNA agents and compositions of the described invention may be used to inhibit the expression of a MAPT gene, e.g., a human MAPT gene. As shown in the Examples, the siRNA agents inhibit expression of the MAPT gene. The siRNA agents and compositions of the invention may also be used to inhibit the levels of Tau. Certain assays and methods for measuring MAPT expression levels and for measuring tau levels are described here and are known in the art.

[0142] Inhibition of MAPT gene expression and / or inhibition of Tau levels can be useful for studying diseases, such as Alzheimer’s Disease. Tau levels have been associated with Alzheimer’s disease. The siRNAs of the described invention may be used to study how inhibition of MAPT gene expression impact Tau levels. The siRNAs of the described invention may be used in animal models to study how inhibition of MAPT gene expression impact Tau levels. The siRNAs of the described invention may be used to study how levels of MAPT gene expression and / or Tau levels impact one or more symptoms of Alzheimer’s Disease.

[0143] In some embodiments, described herein is a method for inhibiting the expression of a MAPT gene (e.g., human MAPT gene) in a cell, comprising contacting a cell with a siRNA agent described herein, or a composition comprising a siRNA agent described herein. In some embodiments, described herein is a method for inhibiting the expression of a MAPT gene (e.g., human MAPT gene) in a population of cells, comprising contacting a population of cells with a siRNA agent described herein. The contact between cell(s) and a siRNA agent described herein may be direct or indirect. For example, the cell(s) may be put into physical contact with the siRNA agent, or the cell(s) may be put into a situation that will permit or cause it to subsequently come into contact with the siRNA agent. The contact between cell(s) and a siRNA agent described herein may be in vitro. The contact between cell(s) and a siRNA agent described herein may be in vivo. The contact between cell(s) and a siRNA agent described herein may be ex vivo. The contact between cell(s) and a siRNA agent described herein may be in situ.

[0144] The expression of a MAPT gene (e.g., human MAPT gene) may be measured directly or indirectly. For example, the levels of MAPT RNA (e.g., pre-mRNA levels, mRNA levels, or both), the levels of a protein encoded by a MAPT gene, a function(s) of the protein encoded by a MAPT gene, or a combination thereof may be measured. Alternatively,or in addition, the expression of genes whose expression is indirectly or directly impacted by the expression of a MAPT gene, a function of a protein, which is indirectly or directly impacted by the expression of the MAPT gene, or a combination thereof may be measured.BIOLOGICAL ASSAYS

[0145] Biological assays known to one of skill in the art or described herein (e.g., infra) may be used to assess the ability of a siRNA agent described herein to inhibit MAPT gene expression, the specificity of a siRNA agent described herein, the stability of a siRNA agent described herein, the off-target effects of a siRNA agent described herein, the toxicity of a siRNA agent described herein, the localization of a siRNA agent described herein to specific tissues, the pharmacokinetics of a siRNA agent described herein, and the immunogenicity of a siRNA agent described herein.

[0146] In some embodiments, MAPT gene expression is measured at the RNA or protein level. The expression level of MAPT gene can be assessed by any method known in the art for measuring RNA. In some embodiments, the RNA may be isolated from samples by RNA extraction methods, for example, organic extraction, membrane-based spin column, and paramagnetic particle technology. In some embodiments, MAPT RNA levels may be measured by UV spectroscopy, in situ hybridization, fluorescent in situ hybridization (FISH), northern blotting, microarray, reverse transcription polymerase chain reaction (RT-PCR), quatitiative RT-PCR, fluorescent dye-based quantification, and gel electrophoresis. The MAPT protein expression levels can be measured by any method known in the art for characterizing proteins. In some embodiments, MAPT protein can be purified by salt precipitation, dialysis, and chromatography (e.g., gel filtration, ion exchange, affinity purification). In some embodiments, crude samples containing MAPT protein or purified MAPT protein can be characterized by UV absorbance and spectroscopy, electrophoresis, capillary electrophoresis, chromatography (e.g., gel filtration, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography), mass spectrometry. In some embodiments, crude samples containing MAPT protein or purified MAPT protein can be characterized by flow cytometry, immunodiffusion, immunoelectrophoresis, western blot, immunoblot, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like. In some embodiments, the function of the protein encoded by the MAPT gene may be assessed to measure expression of the gene. For example, microtubule polymerization and / or microtubule stabilization by the protein encodedby the MAPT gene may be assessed. Cells contacted in vitro or ex vivo with a siRNA agent may be assessed for expression of the gene.

[0147] In some embodiments, a function(s) of the Tau protein encoded by the MAPT gene (e.g., microtubule stabilization) is assessed using an assay known to one of skill in the art. Multiple functions have been proposed for normal Tau with the most established one being microtubule stabilization.

[0148] In some embodiments, the MAPT gene expression level may be assessed using indirect measurement including expression of certain genes, functional assays of downstream proteins, and reporter assays. In some embodiments, the expression of the MAPT gene may be assessed by detecting the expression of a protein regulated by the expression of the MAPT gene. In some embodiments, the expression of the MAPT gene may be assessed by detecting the function of a protein regulated by the expression of the MAPT gene. In some embodiments, a reporter gene can be introduced to facilitate indication of target expression. For example, a reporter gene regulated by a protein downstream of the protein encoded by the MAPT gene can indicate the expression level of the MAPT gene. Reporter genes may include, FLAG-tag, green fluorescence protein (GFP), the chloramphenicol acetyltransferase gene (cat) from Tn9 of E. coli. the luciferase gene (luc) from firefly Photinus pyralis, and P- glucuronidase (GUC). The easily detectable proteins encoded by the reporter gene indicate the MAPT gene expression level. The reporter assays may include fluorescence-based assays, for example, fluorescence spectroscopy, fluorescence immune assays, flow cytometry, fluorescence spectrometry, and ELISA.

[0149] In some embodiments, the specificity of a siRNA agent may be analyzed by the effect generated by the inhibited genes it targets or by the off-target genes that are affected. The effect includes inhibition of the MAPT gene expression, wherein the siRNA agent displays its potency by a half maximal inhibitory concentration, z.e., ICso. The candidate siRNA agents are selected using ICso value in terms of effectiveness. In some embodiments, a siRNA agent described herein has an ICso of 10 nM to 200 nM in neurons (e.g., human iPSC-neurons). In certain embodiments, the specificity of the siRNA agents is tested using a negative control, wherein a scrambled or random sequence may be used. The siRNA agent that does not affect the negative target may be qualified as specific. In some embodiments, the specificity of the siRNA agents is tested using a single target gene. Different siRNA agents to the same gene with comparable gene inhibitory efficacy should induce similar changes in gene expression profiles or phenotypes. Any changes induced by one siRNA agent and not the other(s) may be attributed to off-target effects or non-specificity. In someembodiments, the specificity of the siRNA agents is tested using titration. A non-specific effect is mitigated when siRNA agents are used at lower concentrations. The siRNA agent that displays a lower effective concentration may have a higher specificity. In some embodiments, the specificity of the siRNA agents is tested by monitoring both RNA and protein levels. For example, RNA gene reduction seen without a corresponding reduction in protein levels indicates that protein turnover is slow. The siRNA agent being investigated may have off-target effects. In some embodiments, a transcriptome assay may be used to assess off-target effects.

[0150] In some embodiments, the Forster resonance energy transfer (FRET) method based on agarose gel electrophoresis is used to evaluate the stability of a siRNA agent described in a biological sample or fluid, such as, e.g., serum or cerebrospinal fluid sample. See, e.g., Tuttolomondo and Ditzel, 2021, Methods Mol Biol 2282:43-56 for a description of such an assay. In some embodiments, such an assay is also used to evaluate the interaction of siRNA agent described herein with serum proteins and enzymes. In some embodiments, an agarose gel shift assay is used to evaluate the stability of a siRNA agent described herein in a biological sample or fluid, such as, e.g., serum or cerebrospinal fluid sample.

[0151] In some embodiments, the stability of a siRNA agent may be investigated under a variety of conditions, including temperature, and RNase degradation in biological fluids. In some embodiments, thermal melting temperature (Tm) of a siRNA agent is measured with equimolar concentrations of both strands by monitoring A260 with increasing temperature (e.g., l°C / min). Tm is measured as the maximum of the first derivative of the melting curve (A260 vs T) of pre-hybridized duplexes. A stable unmodified RNA may have a Tm ranging from 40°C to 60°C in terms of the thermal stability. A modified RNA may be stabilized or destabilized by ~10°C. In some embodiments, the stability of a siRNA agent toward RNase degradation is determined by incubating with different biological fluid. For example, the serum stability can be determined by incubating with fetal bovine serum or human serum at 37°C for various time periods up to 48 hours. The RNA in the samples can be examined by northern blot, in situ hybridization, qPCR, and any RNA detecting methods known in the art. The activity of siRNA agent can be tested. A stable siRNA agent may show minor degradation at 37°C for 24 hours. In some embodiments, a siRNA agent of the described invention shows stability for at least 2 hours. In other embodiments, the stability of a siRNA agent exposed to, but not limited to, skin, salvia, topical creams or nanoparticles may be tested.

[0152] In some embodiments, stability of siRNA agents described herein are assessed in human liver lysosomes and rat liver tritosomes.

[0153] In some embodiments, the toxicity of a siRNA agent to in vitro or ex vivo cellbased models is investigated. In some embodiments, the toxicity is evaluated by the degree to which the siRNA agent can cause damage to a cell. The damage can be necrosis (uncontrolled cell death), apoptosis (programmed cell death), autophagy, or stop actively growing and dividing to decrease cell proliferation. In some embodiments, cytotoxicity assays are performed to measure the ability of the siRNA agent to cause cell damage or cell death. For example, the release of lactate dehydrogenase (LDH) and glucose 6-phosphate dehydrogenase (G6PD) can be used as biomarkers for cellular plasma membrane damage. In some embodiments, cell viability under the treatment of the siRNA agent can be detected by various mechanisms, for example, membrane integrity, enzyme activity, or metabolic activity.

[0154] In some embodiments, RNA in situ hybridization assays may be used to image a siRNA agent and to assess the inhibition of MAPT gene expression in tissues samples from a subject. RNAscope® may be used, e.g., for RNA in situ hybridization assays.In some embodiments, a siRNA agent described herein is used to study Alzheimer’s disease in an animal model (e.g., a mouse model). Such animal models are known in the art.

[0155] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges which can independently be included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either both of those included limits are also included in the invention.

[0156] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the described invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and described the methods and / or materials in connection with which the publications are cited.

[0157] It must be noted that as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. All technical and scientific terms used herein have the same meaning.

[0158] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the described invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.EXAMPLES

[0159] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the described invention and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.EXAMPLE 1: siRNA SYNTHESIS

[0160] Table 3 provides the unmodified sense and antisense strand nucleotide sequences of siRNAs targeting human MAPT, Gene ID: 4137. Table 1 provides chemical modifications, including 2’-Fluoro, 2’-O-Methyl, and phosphorothioate, applied to the siRNA sequences in Table 3.

[0161] Table 3: Unmodified Sense Strand and Antisense Strand NucleotideSequences (5’ to 3’)

[0162] Synthesis ofMAPT siRNA duplex

[0163] The human MAPT siRNA were synthesized and annealed as below. Briefly, single-stranded sense and antisense oligonucleotides were synthesized at 0.2 pmol scale on a Dr. Oligo 192 synthesizer (Biolytic Lab Performance) using the standard solid-phase phosphoramidite chemistry. Controlled pore glass (CPG, 500 A) was used as solid supportloaded with first base or UnyLinker™. 3% Di chloroacetic acid in Dichloromethane was used for detrityl ati on. 2’-0Me and 2’-F modified nucleotides were coupled by using corresponding phosphoramidites. Coupling time for all phosphoramidites was 6-8 minutes using 5- Ethylthio-IH-tetrazole (ETT) as activator (0.25 M in acetonitrile). Phosphor othioate linkages were generated using a 0.2 M solution of xanthane hydride in anhydrous pyridine. The oxidation time was 3 minutes using 0.02 M b in tetrahydrofuran with 10% water.

[0164] After synthesis, the solid support was transferred to a 1.5 mL vial. Cleavage and deprotection were performed using 500 pL AMA (concentrated ammonia / 40% aqueous methylamine, v / v = 1 : 1). After the completion of cleavage and deprotection, the sample was filtrated to remove the solid support and washed once with water. The sample was purified using a 6 mL Source 15Q ion exchange column (Cytiva) on an AKTA Purifier System equipped with autosampler and fraction collector. Fractions were analyzed by LC-MS to confirm the quality. The appropriate fractions were pooled and desalted using CentriPure P10 Columns (emp Biotech). Samples from each sequence were analyzed by LC-MS to confirm the identity, UV (260 nm) for quantification and IP-RP chromatography to determine purity. Duplex annealing was performed by mixing equimolar of sense and antisense single strands. Final duplex sample solution was dried under vacuum using GeneVac evaporator (SP Scientific). The final QC specifications are ± 0.05% of calculated mass (by LC / MS) for single strand identity, >85% full length oligonucleotide (by HPLC) for single strand purity, and >90% by non-denaturing HPLC for duplex purity.

[0165] TABLE 4: Annealed, Unmodified Sense Strand and Antisense StrandNucleotide Sequences (5’ to 3’)

[0166] siRNA-lipid conjugation

[0167] A subset of the siRNA compounds was synthesized with different novel lipid conjugates and at different positions (573 ’-end, or internal). Lipids were incorporated to the sense strands via on-column and / or post-column synthesis. To perform on-column synthesis, lipid moiety was modified at the corresponding phosphoramidite monomer or CPG, followed by solid-phase phosphoramidite chemistry, to synthesize sense strand with 573’ terminal and / or the internal lipid conjugates. For post-column synthesis the lipids were introduced in solution phase with their corresponding N-hydroxysuccinimide esters and the appended amine linker of the nucleotide.

[0168] On-column synthesis

[0169] For example, on-column introduction of compound 2 at the 3’ end of the sense strand was performed using 3 ’-amino modifier such as 2-dimethoxytrityloxymethyl-6- fluorenylmethoxycarbonylamino-hexane-l-succinoyl)-long chain alkylamino-CPG 1 (Scheme 1). Following the deprotection of the Fmoc group with 20% piperidine in DMF the CPG was thoroughly washed with DMF, MeCN, diethyl ether, and dried. A solution of 80pmol of compound 2 in 2 ml of 1,4-di oxane was added to the above CPG followed by 30 pl of DIPEA and shaken for 12 hours to produce compound 3. The CPG was washed with DCM, MeCN, and Et2O. A solution of 1 ml of CAP A and CAP B was added and shaken for 30 minutes. Compound 3 was washed with DCM, MeCN, Et2O, and dried and used for the oligonucleotide synthesis.Scheme 1

[0170] Introduction of compound 2 at the 5’ end of the sense strand was carried out using 5 ’-amino modifier such as 6-(4-monomethoxytritylamino)hexyl-(2-cyanoethyl)-(N,N’- diisopropyl)-phosphoramidite. After the synthesis of the sense strand on the CPG following the standard procedure, in the penultimate step the 5’ end of the sense strand was coupled to 6-(4-monomethoxytritylamino)hexyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite followed by deblocking of 4-monomethoxytrityl group with 3% DCA / DCM for 30 minutes. The CPG was subsequently washed with DCM, ACN and coupled with compound 2 for 12 hours (Scheme 2), followed by strand cleavage and deprotection.Scheme 21 ) 3%DCA / DCM, 30'

[0171] The adamantly lipid at the internal position was introduced during the sense strand synthesis with corresponding phosphoramidite monomer. For example, Scheme 3 illustrates this with uridine based phosphoramidite monomer 7.Scheme 3

[0172] The synthesis, cleavage and deprotection, the lipid conjugated oligonucleotides were purified by reversed-phase or ion-exchange chromatography. The buffers for reverse phase were 0.05 M sodium acetate in 90 / 10% water / acetonitrile (Buffer A) and acetonitrile (Buffer B), and the buffers for ion-exchange are 20 mM sodium phosphate in 90 / 10% water / acetonitrile (buffer A) and 20 mM sodium phosphate in 90 / 10% water / acetonitrile, 1.8 M sodium bromide (buffer B). Fractions containing full-length oligonucleotides were pooled, desalted, and the compounds were analyzed by LC-MS.

[0173] Post-column synthesis

[0174] Lipids were conjugated at the 573’ terminal position and at the internal position of the sense strand in the solution phase after the purification and desalting of the corresponding oligonucleotide.

[0175] For example, incorporation at the internal position was carried out with phosphoramidite monomer derivatized with an amine linker at the 2’ position of respective nucleotide. Scheme 4 illustrates this with uridine based phosphoramidite monomer compound 9. After incorporation of compound 9 at the internal position and completesynthesis, cleavage and deprotection, purification and desalting process, the free oligonucleotide with the pendant amine was coupled with corresponding lipid-NHS esters in solution phase.Scheme 4

[0176] Conjugation at the terminal / internal positions was carried out with 0.15 mM solution of deprotected and desalted oligonucleotide in 0.1M solution of NaHCCh (pH 8.4) with 1.5 mM solution of the corresponding lipid-NHS ester in DMF at 60 °C. To a solution (0.25 mL) of oligonucleotide was added DMF solution of lipid-NHS ester (0.6 mL) and the resulting mixture heated at 63 °C. Progress was monitored by RP-HPLC (C-18 column, A: 50 mM TEAA, B: MeCN; gradient 5-100% B at 30 °C). Reaction was > 90% completed usually in less than one hour. Reaction mixture was diluted with water and purified by RP- HPLC (C-8 Xbridge Waters column; A: 50 mM NaOAc, B: MeCN; 5-100% B gradient, at 60 °C). Isolated yields of lipid conjugated oligonucleotides were 60-70%. After purification, the products were desalted and duplex annealing, as described above.EXAMPLE 2: IN VITRO KNOCKDOWN EFFICIENCY ASSESSMENT OF siRNA CONJUGATES IN HUMAN iPSC-DERIVED NEURONS

[0177] The in vitro knockdown efficiencies of lipid-siRNA conjugates were assessed in human iPSC-derived cortical neurons following the procedure described as below.

[0178] Table 5 summarizes the efficiency of MAPT siRNAs (listed in Table 2) in knocking down MAPT mRNA in human iPSC-neurons after incubation for 7 days. Data are presented as remaining MAPT mRNA relative to control. Mean ± S.D., n=3.

[0179] Differentiation of human iPSCs into cortical neurons

[0180] The human iPSC line (Sigma #iPSC0028) was derived with OSKM retroviral reprogramming of epithelial cells from a 24-years old Caucasian female donor. iPSCs were first differentiated into cortical neural stem cells (NSCs) following a dual SMAD inhibitor protocol (Shi et al., 2012, Nat. Proc. 7(10): 1836-46) with some modifications. Briefly, iPSCs were plated at 500,000 cells / cm2on wells of a cell culture plate coated with Matrigel (Corning 354230) in mTeSR medium (StemCell Technologies 5850) supplemented with 10 pM ROCK inhibitor (Sigma-Aldrich Y0503) and cultured at 37 °C and with 5% O2. The media were replaced with mTeSR the next day (day -1). From day 0 till day 12, cell media were changed every day with cortical Neural Induction Medium comprised of 10 pM SB43142 (Tocris 1614) and 1 pM Dorsomorphin (Tocris 3093) supplemented in Neural Maintenance Medium (1 : 1 DMEM:F12 Glutamax (ThermoFisher Scientific 10565108), Neurobasal (ThermoFisher Scientific 21103049), 2.5 pg / mL Insulin (Sigma-Aldrich 19278- 5ML), 50 uM 2-mercaptoethanol (ThermoFisher Scientific, 31350010), 0.5% Non-Essential Amino Acids (ThermoFisher Scientific 11140035), 0.5% GlutaMAX supplement (ThermoFisher Scientific, 10565018), 0.5 mM Sodium Pyruvate (ThermoFisher Scientific 11360070), 1% Penicillin-Streptomycin (Sigma P4333), 0.5% N2 supplement (ThermoFisher Scientific 17502048), 1% B27 supplement (ThermoFisher Scientific 17504044). At day 12, the neuroepithelial sheet was gently detached into large aggregates of 300 to 500 cells using a needle and lifter and the clumps were collected in a 15 mL falcon by centrifugation at 160 x g for 2 min. Cell pellets were gently resuspended in Neural Induction Medium for a 1 / 2 or 1 / 3 passage into wells of a 6-well cell culture plate coated with 10 pg / mL laminin (Sigma- Aldrich L2020) in a total volume of 2 mL of Neural Induction Medium per well of the 6-well plate. Media were changed at day 13 and day 15 into Neural Maintenance Medium supplemented with 20 ng / mL of FGF2 (Stemcell Technologies 2634). At day 17, the neural rosettes were detached with dispase (ThermoFisher Scientific 17105041) for a 1 / 3 passage and plated into laminin-coated wells of a cell culture plate. One to two extra dispase steps were performed for an additonal week. At around days 25-30, neural stem cells were dissociated with Accutase (ThermoFisher Scientific Al 110501) into single-cell suspensions and cryopreserved in freshly prepared Neural Freezing Medium containing Neural Maintenance Medium supplemented with 10 % (V / V) DMSO and 20 ng / mL FGF2. The frozen vials of neural stem cells (NSCs) were stored in liquid nitrogen prior to use.

[0181] To generate iPSC-neurons, the frozen vials of neural stem cells (NSCs) were thawed and plated on laminin-coated wells of a cell culture plate at 70,000 cells / cm2inNeural Maintenance Medium supplemented with 10 pM ROCK inhibitor and 20 ng / mL FGF2. In the following two days, media were replaced daily with neural maintenance medium. At around day 4 after thawing, cells were dissociated with Accutase and placed at 28,000 cells per well in 96-well plates pre-coated with poly-L-omithine and laminin in Neural Maintenance Medium supplemented with 10 pM ROCK inhibitor. One day after replating, culture media were replaced with Neural Differentiation Medium comprised of Neural Maintenance Medium supplemented with 20 ng / mL brain-derived neurotrophic factor (BDNF) (R&D Systems 212-BD-050 / CF), 20ng / mL glial cell line-derived neurotrophic factor (GDNF) (R&D Systems 212-GD-050 / CF), 500 pM dibutyryl (DB)-cAMP (Sigma D0627) and 20 mM Ascorbic Acid (Sigma A4403). Cultures were differentiated in Neural Differentiation Medium with 50% medium change twice per week. Two to three weeks after differentiation from neural stem cells (NSCs), neurons were treated with siRNA for 7 days for RNA analysis by Reverse transcription and Real time PCR.

[0182] Total RNA isolation

[0183] RNA extraction was performed using the RNeasy 96 kit (Qiagen) following manufacture’s protocol. Briefly, 125 pL RLT buffer was added to each well of a 96-well plate to lysate cells with orbital shaking at 200 rpm for 1 min. Next, cell plates were transferred to a -80°C freezer for storage. On the day of RNA extraction, frozen cell plates were removed from the -80°C freezer and quickly thawed in a 37 °C oven. Immediately after thawing, an equal volume 125 pL of 70% (V / V) ethanol was added to each well to mix with RLT lysate. The mixture was subsequently transferred to wells of the RNeasy 96 plate, placed on top of QIAvac 96 vacuum block, and RNA was bound to the RNeasy 96 plate membrane by applying vacuum until liquid transfer was complete. Next, serial wash steps including 1 time of 800 pL RW 1 buffer, 2 times of 800 pL RPE buffer were applied to the RNeasy 96 plate using vacuum filtration to remove the liquid. After the last wash was performed, the RNeasy 96 plate was centrifuged at 5600 x g for 3 min to remove the residual lipid. RNA was eluted using 60 pL RNase-free water by centrifugation at 5600 x g for 3 min at room temperature. Next, RNA concentration was measured by Nanodrop 8000 (ThermoFisher) and the eluted RNA was stored at -80°C until further analysis.

[0184] Reverse transcription and Real time PCR

[0185] The eluted, frozen RNA was thawed and used as a template to produce cDNA via reverse transcription using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems) following manufacture’s protocol. Briefly, a 20 pL final reaction mixture was incubated at 25 °C for 10 min, followed by reverse transcription at 37 °C for 2 hours andenzyme inactivation at 85 °C for 5 min. For quantitative PCR (qPCR) reaction, the reverse transcribed cDNAs were diluted 10 times and mixed with 2X PowerUp™ SYBR™ Green Mater Mix (ThermoFisher A25743) and 500 nM qPCR primers to a final volume of 10 pL. The qPCR cycles were performed with a QuantStudio™ 12K instrument (Applied Biosystems™) using a standard thermal cycling protocol. Multiple validated primers were used to detect MAPT mRNA, and reference primers targeting housekeeping genes ecto-NOX disulfide-thiol exchanger 2 (ENOX2) and glyceraldehyde-3 -phosphate dehydrogenase (GAPDH) were used for normalization of gene expression (Table 7). Quantitative PCR data were analyzed using qBase+ software (Biogazelle).

[0186] TABLE 5: Knockdown Efficiency of MAPT siRNA in Human iPSC-Derived Neurons (SD=Standard Deviation)EXAMPLE 3: IN VIVO KNOCKDOWN EFFICIENCY ASSESSMENT OF siRNA CONJUGATES IN MOUSE MODELS

[0187] The in vivo knockdown efficiencies of lipid-siRNA conjugates were assessed in hTAU KI mice with intracerebroventricular (ICV) injection following the procedure described below.

[0188] Table 6 summarizes the efficiency of MAPT siRNAs selected from Table 2 in knocking down MAPT mRNA in hTAU KI mice after a single ICV dose at 15 nmol. Data are presented as MAPT mRNA knockdown (%) relative to control. Mean ± S.D., n=4 mice per group.

[0189] Mice and intracerebroventricular injection

[0190] Human Tau (hTau) KI (C57BL6; hMAPT: Knock-In) mice at age 2 to 3 months were randomly assigned to different treatment groups. Mice were anesthetized with isoflurane (induction: 4-5 %; maintenance: 1.8-2.5 %) and stereotaxically injected using a motorized drill and microinjection robot (Neurostar, Germany, Sterodrive Sof eware v 2019) into the bilateral ventricles at coordinates: AP: -0.62 mm, ML: + / - 1.05 mm: and DV: 2.2 mm. Each injection was performed in 5 pL volume over 5 min. Following injection, the needle is withdrawn in three steps: (1) 1 mm in 60 sec and kept there for 5 min; (2) another 0.5 mm in 30 sec, wait 5 min; and (3) withdrawal out of the brain at very slow speed to avoid compound reflux along the needle tract. After each withdrawal step, the amount of backflow was checked. At selected post-injection days, animals were sacrificed and different brain regions including cortex, hippocampus, brainstem, cerebellum, striatum, midbrain, and cervical spinal cord were dissected, the brain tissue was snap frozen in liquid nitrogen before ultimately being stored at -80°C.

[0191] RNA extraction from brain tissues

[0192] Brain tissues were collected in Lysing Matrix D (MP Biomedicals 6913-500) 2 mL Tubes containing 1.4 mm ceramic spheres and stored in -80°C freezer until furtheranalysis. Tissues were removed from the -80°C freezer, placed on ice under laminar flow and 750 pL Trizol (ThermoFisher 15596026 / 15596018) was immediately added per tube. Next, tissues were disrupted and homogenized using the FastPrep-24™ 5G Grinder with 3 cycles of 30 sec at speed 5 m / sec. Between cycles, the tissues were cooled on ice for 2 minutes. After homogenization, the tubes containing homogenized tissue were briefly centrifuged. Next, a 20 % volume of Chloroform (150 pL Chloroform when 750 pL Trizol was used) was added to each tube. Tubes were then vortexed for 15 sec and centrifuge at 14,000 x g for 15 min at 4 °C. The upper aqueous phase formed in each tube after centrifugation was transferred to a deep 96-well plate. One volume of 70% ethanol was added to each well of the 96-well plate and the plate was vortexed to thoroughly mix each well. Next, RNA was extracted from each well using a RNeasy 96 kit (Qiagen) following manufacture’s protocol. Briefly, a RNeasy 96 plate was placed on top of a Square-Well Block holder. Next, the extracted samples (Trizol / Chloroform extraction) were applied to the wells of the RNeasy 96 plate and sealed with a AirPore cover to prevent contamination. The sealed RNeasy plate was centrifuged at 5,600 x g for 3 min at room temperature and the solution was discarded. After centrifugation, the RNeasy plate was washed 1 time with 800 pL RW 1 buffer and 2 times with 800 pL RPE buffer. Wash buffers were removed by centrifugation at 5,600 x g for 3 min after each wash step. After the last wash, the RNeasy 96 plate was centrifuged at 5,600 x g for 3 min to remove residual lipid. RNA was then eluted using 60 pL RNase-free water by centrifugation at 5,600 x g for 3 min at room temperature. The concentration of eluted RNA was measured by Nanodrop 8000 (ThermoFisher) and stored at -80°C until further analysis.

[0193] RT-qPCR

[0194] The eluted, frozen RNA was thawed and used as a template to produce cDNA via reverse transcription using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems) following manufacture’s protocol. Briefly, a final reaction mixture of 20 pL was incubated at 25°C for 10 min, followed by reverse transcription at 37°C for 2 hours and enzyme inactivation at 85 °C for 5 min. The quantitative PCR (qPCR) reaction was performed using reverse transcribed cDNAs diluted 10 times and mixed with 2X PowerUp™ SYBR™ Green Mater Mix (ThermoFisher A25743) and 500 nM qPCR primers to a final reaction volume of 10 pL. The qPCR cycles were performed with a QuantStudio™ 12K instrument (Applied Biosystems™) using a standard thermal cycling protocol. Multiple primers were used to detect MAPT mRNA, and reference primers targeting mouse housekeeping genes adapter related protein complex 3 subunit delta (AP3D1) and p21- activated protein kinase-interacting protein 1 (PAK1IP1) were included for normalization ofgene expression (Table 7). The qPCR data were analyzed using qBase+ software (Biogazelle).

[0195] TABLE 6: Knockdown Efficiency of MAPT siRNAs in hTAU KI Mice (SD=Standard Deviation)J&J Reference No. PRD4315WOPCT1

[0196] Table 7: qPCR primer Sequences

[0197] The invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described will become apparent to those skilled in the art from the foregoing description and accompanying Figures. Such modifications are intended to fall within the scope of the appended claims.

[0198] All references cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

Claims

What is claimed is:

1. A small interfering ribonucleic acid (siRNA) comprising a sense strand and an antisense strand forming a double stranded duplex, wherein(a) the sense strand comprises 21 nucleotides having the sequence: UCCCAUGAUUUCUUCGGUAAA, wherein from the 5 ’end(i) the nucleotide at one or more positions selected from 1-8 and 12-21 is optionally modified with 2’-O-methyl;(ii) the nucleotide at position 6 optionally comprises a lipophilic moiety;(iii) the nucleotide at one or more positions selected from 9-11 is optionally modified with 2’fluoro; wherein the sense strand optionally further comprises an inverse abasic nucleotide (InvAb) at the 5’ end linked to the nucleotide at position 1 and / or an inverse abasic nucleotide (InvAb) at the 3’ end linked to the nucleotide at position 21, and wherein the sense strand optionally comprises at least two phosphorothioate linkages at the 5 ’end and / or at least two phosphorothioate linkages at the 3 ’end; and(b) the antisense strand comprises 21 nucleotides having the sequence:UUUACCGAAGAAAUCAUGGGA, wherein from the 5’ end(i) the nucleotide at position 1 is optionally modified with vinyl phosphonate 2’-O- methyl;(ii) the nucleotide at one or more positions selected from 2, 14, and 16 is optionally modified with 2’fluoro;(iii) the nucleotide at one or more positions selected from 1, 3, 5, 6, 8-13, 15, and 17- 21 is optionally modified with 2’-O-methyl;(iv) the nucleotide at one or more positions selected from 4 and 7 is optionally a deoxynucleotide; and wherein the antisense strand optionally comprises at least two phosphorothioate linkages at the 5 ’end and / or at least two phosphorothioate linkages at the 3 ’end.

2. A composition comprising the siRNA of claim 1, and a carrier.

3. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 1.

4. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 2.

5. The siRNA of claim 1, wherein the sense strand comprises a nucleotide modified with 2’- O-methyl at positions 1-8 and 12-21 from the 5’ end.

6. The siRNA of claim 1, wherein the sense strand comprises a lipophilic moiety at position 6 from the 5 ’ end.

7. The siRNA of claim 6, wherein the lipophilic moiety is L4 as depicted in FIGURE 1.

8. The siRNA of claim 1, wherein the sense strand comprises a nucleotide modified with 2’fluoro at positions 9-11 from the 5’ end.

9. The siRNA of claim 1, wherein the sense strand comprises an inverse abasic nucleotide (InvAb) at the 5’ end and an inverse abasic nucleotide (InvAb) at the 3’ end.

10. The siRNA of claim 9, wherein the inverse abasic nucleotide (InvAb) at the 5’ end is linked to the nucleotide at position 1 from the 5’ end.

11. The siRNA of claim 9, wherein the inverse abasic nucleotide (InvAb) at the 3’ end is linked to the nucleotide at position 21 from the 5’ end.

12. The siRNA of claim 1, wherein the sense strand comprises two phosphorothioate linkages at the 5 ’end and two phosphorothioate linkages at the 3 ’end.

13. The siRNA of claim 1, wherein the antisense strand comprises a nucleotide at position 1 modified with vinyl phosphonate 2’-O-methyl at position from the 5’ end.

14. The siRNA of claim 1, wherein the antisense strand comprises a nucleotide modified with 2’fluoro at positions 2, 14, and 16 from the 5’ end.

15. The siRNA of claim 1, wherein the antisense strand comprises a nucleotide modified with 2’-O-methyl at positions 1, 3, 5, 6, 8-13, 15, and 17-21 from the 5’ end.

16. The siRNA of claim 1, wherein the antisense strand comprises a deoxynucleotide at positions 4 and 7 from the 5’ end.

17. The siRNA of claim 1, wherein the antisense strand comprises two phosphorothioate linkages at the 5 ’end and two phosphorothioate linkages at the 3 ’end.

18. An siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 819, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 820.

19. A composition comprising the siRNA of claim 18, and a carrier.

20. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 18.

21. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 19.

22. An siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 421, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 422.

23. A composition comprising the siRNA of claim 22, and a carrier.

24. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 22.

25. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 23.

26. An siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 523, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 524.

27. A composition comprising the siRNA of claim 26, and a carrier.

28. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 26.

29. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 27.

30. An siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 527, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 528.

31. A composition comprising the siRNA of claim 30, and a carrier.

32. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 30.

33. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 31.

34. An siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 529, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 530.

35. A composition comprising the siRNA of claim 34, and a carrier.

36. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 34.

37. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 35.

38. An siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 611, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 612.

39. A composition comprising the siRNA of claim 38, and a carrier.

40. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 38.

41. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 39.

42. An siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 613, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 614.

43. A composition comprising the siRNA of claim 42, and a carrier.

44. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 42.

45. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 43.

46. An siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 619, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 620.

47. A composition comprising the siRNA of claim 46, and a carrier.

48. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 46.

49. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 47.

50. An siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 623, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 624.

51. A composition comprising the siRNA of claim 50, and a carrier.

52. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 50.

53. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 51.

54. An siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 625, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 626.

55. A composition comprising the siRNA of claim 54, and a carrier.

56. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 54.

57. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 55.

58. An siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 627, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 628.

59. A composition comprising the siRNA of claim 58, and a carrier.

60. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 58.

61. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 59.

62. An siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 759, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 760.

63. A composition comprising the siRNA of claim 62, and a carrier.

64. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 62.

65. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 63.

66. An siRNA comprising a sense strand and an antisense strand forming a double stranded duplex, wherein the sense strand comprises nucleotides having the sequence of SEQ ID NO: 809, and the antisense strand comprises nucleotides having the sequence of SEQ ID NO: 810.

67. A composition comprising the siRNA of claim 66, and a carrier.

68. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 66.

69. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 67.

70. A small interfering ribonucleic acid (siRNA) comprising a sense strand and an antisense strand forming a double stranded region, wherein:(a) the antisense strand comprises a nucleotide sequence corresponding to any one of the antisense nucleotide sequences in Tables 1, 2, 3 or 4; and(b) the sense strand comprises a nucleotide sequence corresponding to any one of the sense nucleotide sequences in Tables 1, 2, 3 or 4.

71. A small interfering ribonucleic acid (siRNA) comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 1, and the sense strand comprises a nucleotide sequence corresponding to the sense nucleotide sequence in the same row of Table 1.

72. A small interfering ribonucleic acid (siRNA) comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 2, and the sense strand comprises a nucleotide sequence corresponding to the sense nucleotide sequence in the same row of Table 2.

73. A small interfering ribonucleic acid (siRNA) comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 3, and the sense strand comprises a nucleotide sequence corresponding to the sense nucleotide sequence in the same row of Table 3.

74. The siRNA of claim 73, wherein the antisense strand, the sense strand, or both the antisense and the sense strand comprise at least one modified nucleotide.

75. The siRNA of claim 73, wherein the antisense strand, the sense strand, or both the antisense and the sense strand comprise at least one modified internucleoside linkage.

76. The siRNA of claim 73, wherein the antisense strand, the sense strand, or both the antisense and the sense strand is conjugated to one or more lipophilic moieties.

77. The siRNA of claim 76, wherein the one or more lipophilic moieties are selected from the group consisting of LI, L2, L3, L4, L5, L6, L7, L8, L9, LIO, Lil, L12, L13, L14, L15, L16, L17, L18, L19, L20, L21, L22, L23, and L24 as depicted in FIGURE 1.

78. The siRNA of claim 77, wherein the one or more lipophilic moieties is L4 as depicted in FIGURE 1.

79. The siRNA of claim 77, wherein the one or more lipophilic moieties is L21 as depicted in FIGURE 1.

80. The siRNA of claim 77, wherein the one or more lipophilic moieties is L22 as depicted in FIGURE 1.

81. The siRNA of claim 77, wherein the one or more lipophilic moieties is L23 as depicted in FIGURE 1.

82. A composition comprising the siRNA of claim 73, and a carrier.

83. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 73.

84. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 82.

85. A small interfering ribonucleic acid (siRNA) comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence corresponding to an antisense nucleotide sequence in a row of Table 4, and the sensestrand comprises a nucleotide sequence corresponding to the sense nucleotide sequence in the same row of Table 4.

86. The siRNA of claim 85, wherein the antisense strand, the sense strand, or both the antisense and the sense strand comprise at least one modified nucleotide.

87. The siRNA of claim 85, wherein the antisense strand, the sense strand, or both the antisense and the sense strand comprise at least one modified internucleoside linkage.

88. The siRNA of claim 85, wherein the antisense strand, the sense strand, or both the antisense and the sense strand is conjugated to one or more lipophilic moieties.

89. The siRNA of claim 85, wherein the one or more lipophilic moieties are selected from the group consisting of LI, L2, L3, L4, L5, L6, L7, L8, L9, LIO, Lil, L12, L13, L14, L15, L16, L17, L18, L19, L20, L21, L22, L23, and L24 as depicted in FIGURE 1.

90. The siRNA of claim 89, wherein the one or more lipophilic moieties is L4 as depicted in FIGURE 1.

91. The siRNA of claim 89, wherein the one or more lipophilic moieties is L21 as depicted in FIGURE 1.

92. The siRNA of claim 89, wherein the one or more lipophilic moieties is L22 as depicted in FIGURE 1.

93. The siRNA of claim 89, wherein the one or more lipophilic moieties is L23 as depicted in FIGURE 1.

94. A composition comprising the siRNA of claim 85, and a carrier.

95. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the siRNA of claim 85.

96. A method of inhibiting expression of MAPT gene in a cell or population of cells, the method comprising contacting the cell or population of cells with the composition of claim 94.Ill