Enzyme and microorganism capable of defluorinating hydrophilic group-containing fluoroalkane, and use thereof
The enzyme from Pandoraea pnomenusa (DYG4 strain) addresses the limitation of existing enzymes by defluorinating fluoroalkane compounds at both the α- and β-positions, achieving efficient decomposition with high efficacy.
Patent Information
- Application Number
- PCT/JP2025/019392
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-28
- Filing Date
- 2025-05-28
- Publication Date
- 2025-12-04
AI Technical Summary
Existing enzymes are limited in their ability to defluorinate organofluorine compounds, specifically failing to defluorinate at the β-position, and there is a need for a method that can efficiently and simply decompose a wide range of organic fluorine compounds with low energy consumption and minimal environmental impact.
Isolation of an enzyme from Pandoraea pnomenusa (DYG4 strain) with an amino acid sequence (SEQ ID NO: 1) and nucleotide sequence (SEQ ID NO: 2) capable of defluorinating fluoroalkane compounds at both the α- and β-positions, including those with hydrophilic groups, using a method involving expression vectors and host cells for enzyme production.
The enzyme effectively defluorinates fluoroalkane compounds at both the α- and β-positions, achieving defluorination rates greater than 10% and enabling efficient decomposition of compounds like monofluoroacetic acid and difluoroacetic acid.
Smart Images

Figure JP2025019392_04122025_PF_FP_ABST
Abstract
Description
Enzymes and microorganisms that defluorinate fluoroalkanes containing hydrophilic groups and their uses
[0001] The present invention relates to enzymes and microorganisms that defluorinate fluoroalkane compounds containing hydrophilic groups, and their uses.
[0002] There is a need for the development of a technology that can decompose and remove organofluorine compounds with low energy consumption, little environmental impact, and high efficiency. Decomposition by microorganisms or their enzymes is considered to be an energy-saving and environmentally compatible technology that makes use of the capabilities of natural ecosystems. Haloacetate dehydrogenase isolated from microorganisms of the genus Burkholderia is known as an enzyme that decomposes organofluorine compounds (Non-Patent Document 1, etc.). However, known enzymes that decompose / defluorinate organofluorine compounds only defluorinate at the α-position, and no enzymes capable of defluorinating at the β-position have been reported.
[0003] Keiji Jitsumori et.al., JOURNAL OF BACTERIOLOGY,Apr.2009,p.2630-2637 Vol.191,No.8 "X-Ray Crystallographic and Mutational Studies of Fluoroacetate Dehalogenase from Burkholderia sp. Strain FA1"
[0004] An object of the present invention is to provide a new enzyme that defluorinates a wide range of organic fluorine compounds. In particular, an object of the present invention is to provide an enzyme that defluorinates the fluorine at the β-position of organic fluorine compounds. A further object of the present invention is to provide a new method for efficiently and simply defluorinating organic fluorine compounds.
[0005] As a result of intensive research to solve the above problems, the present inventors isolated an enzyme and a microorganism that defluorinates a fluoroalkane compound containing a hydrophilic group from environmental microorganisms, and found that the enzyme defluorinates fluorines not only at the α-position but also at the β-position relative to the hydrophilic group, thereby completing the present invention.
[0006] That is, the present invention provides the following: [1] A method for defluorinating a fluoroalkane compound containing a hydrophilic group, for example, sulfonic acid, carboxylic acid, phosphoric acid, or a salt thereof, and which may contain an oxygen atom and / or a halogen atom other than fluorine, the method comprising treating the fluoroalkane compound with an enzyme containing any of the following amino acid sequences: (a) the amino acid sequence set forth in SEQ ID NO: 1, (b) an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 1, (c) the amino acid sequence set forth in SEQ ID NO: 1 in which 1 to 60 amino acids have been substituted, deleted, inserted, or added, (d) an amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO: 2, (e) an amino acid sequence encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence set forth in SEQ ID NO: 2, or (f) an amino acid sequence encoded by a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 2. [2] The method according to [1], in which the fluorine at the α-position of the fluoroalkane compound is defluorinated. [3] The method according to [1], wherein the fluorine at the β-position of the fluoroalkane compound is defluorinated. [4] The method according to [1], wherein the fluoroalkane compound contains a carboxylic acid or a salt thereof. [5] The method according to [4], wherein the fluoroalkane compound is a fluoroalkylcarboxylic acid represented by formula I: R1-COOH (I), wherein R1 represents a fluoroalkyl group having 1 to 2 carbon atoms which may contain an oxygen atom and / or a halogen atom other than fluorine, or a salt thereof. [6] The method according to any of [1] to [5], wherein the defluorination activity of the enzyme for the fluoroalkane compound is {(amount of fluorine ions contained in the aqueous fluoroalkane solution after defluorination treatment) - (amount of fluorine ions contained in the aqueous fluoroalkane solution before defluorination treatment)} / {fluorine atoms bonded to the fluoroalkane compound contained in the aqueous fluoroalkane solution before defluorination treatment} > 10%.[7] An enzyme capable of defluorinating a fluoroalkane compound which contains a carboxylic acid or a salt thereof and which may contain an oxygen atom and / or a halogen atom other than fluorine, the enzyme comprising any of the following amino acid sequences: (a) the amino acid sequence set forth in SEQ ID NO: 1, (b) an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 1, (c) an amino acid sequence in which 1 to 60 amino acids have been substituted, deleted, inserted or added in the amino acid sequence set forth in SEQ ID NO: 1, (d) an amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO: 2, (e) an amino acid sequence encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence set forth in SEQ ID NO: 2, or (f) an amino acid sequence encoded by a nucleotide sequence which hybridizes under stringent conditions to a nucleotide sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 2. [8] The enzyme set forth in [7], which defluorinates the fluorine at the α-position of the fluoroalkane compound. [9] The enzyme set forth in [7], which defluorinates the fluorine at the β-position of the fluoroalkane compound.
[10] The enzyme according to [7], wherein the fluoroalkane compound is a fluoroalkylcarboxylic acid represented by formula I: R1-COOH (I), wherein R1 represents a fluoroalkyl group having 1 to 2 carbon atoms, which may contain an oxygen atom and / or a halogen atom other than fluorine, or a salt thereof.
[11] An expression vector comprising the following nucleotides: (a) a nucleotide set forth in SEQ ID NO: 2, (b) a nucleotide having at least 80% identity to the base sequence set forth in SEQ ID NO: 2, or (c) a nucleotide that hybridizes under stringent conditions to a base sequence complementary to the base sequence set forth in SEQ ID NO: 2.
[12] A host cell comprising the expression vector according to
[11] .
[13] A method for producing an enzyme capable of defluorinating a fluoroalkane compound, which contains a carboxylic acid or its salt and which may contain an oxygen atom and / or a halogen atom other than fluorine, comprising culturing the host cell according to
[12] .
[14] The method according to
[13] , wherein the enzyme defluorinates the fluorine at the β-position of the fluoroalkane compound.
[15] The method according to
[13] , wherein the enzyme defluorinates the fluorine at the α-position of the fluoroalkane compound.
[16] The method according to
[13] , wherein the fluoroalkane compound is a fluoroalkylcarboxylic acid represented by formula I: R1-COOH (I), wherein R1 represents a fluoroalkyl group having 1 to 2 carbon atoms which may contain an oxygen atom and / or a halogen atom other than fluorine, or a salt thereof.
[17] A microorganism deposited with NITE under accession number NITE ABP-04122 or accession number NITE BP-04122.
[18] An enzyme capable of defluorinating a fluoroalkylcarboxylic acid, produced by the microorganism according to
[17] .
[19] A method for producing an enzyme capable of defluorinating a fluoroalkylcarboxylic acid, comprising culturing the microorganism according to
[17] .
[0007] According to the present invention, there is provided an enzyme capable of defluorinating fluorines at not only the α-position but also the β-position relative to the hydrophilic group of a fluoroalkane compound containing a hydrophilic group. The present invention also provides a microorganism that produces such an enzyme. Therefore, using the enzyme and microorganism according to the present invention, fluoroalkane compounds containing a hydrophilic group and having a wide range of structures can be defluorinated efficiently and simply.
[0008] Figure 1 shows the sequence of SEQ ID NO: 1. Figure 2 shows the sequence of SEQ ID NO: 2. Figure 3 is a graph showing the results of an experiment to decompose monofluoroacetic acid by DYG4 strain cells. Figure 4 is a graph showing the results of an experiment to decompose difluoroacetic acid by DYG4 strain cells. Figure 5 is a graph showing the results of an experiment to decompose chlorofluoroacetic acid by DYG4 strain cells. NC indicates no addition of microorganisms. DYG4 indicates addition of DYG4 microorganisms. Figure 6 is a graph showing the results of the production of glyoxylic acid in relation to chlorofluoroacetic acid by DYG4 strain cells. NC indicates no addition of microorganisms. DYG4 indicates addition of DYG4 microorganisms. Figure 7 shows a copy of the certificate of accession issued by the international depositary authority in accordance with Regulation 7.1 of the Budavest Treaty for the DYG4 strain obtained in Example 1.
[0009] In one aspect, the present invention provides a method for defluorinating a fluoroalkane compound containing a hydrophilic group, the method comprising allowing an enzyme capable of defluorinating the fluoroalkane compound to act on the fluoroalkane compound.
[0010] As used herein, the phrase "allowing an enzyme capable of defluorinating a fluoroalkane compound containing a hydrophilic group to act on the fluoroalkane compound" refers to contacting the enzyme with the fluoroalkane compound to defluorinate the fluoroalkane compound. Typically, this is carried out in an aqueous medium. For example, the enzyme and the fluoroalkane compound may be added to an aqueous medium and reacted for a certain period of time. Reaction conditions such as temperature, pH, optional factors to be supplemented in the reaction system, and reaction time can be appropriately selected by those skilled in the art. The enzyme may be purified, crude, or partially purified, and may be in the form of a microbial extract or a microbial culture medium. Microbial cells themselves may also be used as the enzyme. The enzyme may be used in a free state or immobilized on a carrier.
[0011] In another aspect, the present invention provides an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group. In this specification, an "enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group" may be simply referred to as an "enzyme."
[0012] The enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group is an enzyme comprising the amino acid sequence set forth in SEQ ID NO: 1. The enzyme comprising the amino acid sequence set forth in SEQ ID NO: 1 is an enzyme isolated from an environmental microorganism (a strain of Pandoraea pnomenusa (referred to herein as "DYG4 strain")), and is characterized by defluorinating fluorine not only at the α-position but also at the β-position of a fluoroalkane compound containing a hydrophilic group.
[0013] The amino acid sequence of the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group is shown in SEQ ID NO: 1. The base sequence of DNA that encodes the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group is shown in SEQ ID NO: 2. In the present invention, an enzyme having the amino acid sequence shown in SEQ ID NO: 1 or an enzyme having an amino acid sequence encoded by the base sequence shown in SEQ ID NO: 2 is preferably used.
[0014] A mutant of the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group may be used in the present invention to defluorinate a fluoroalkane compound containing a hydrophilic group. The mutant of the enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group is described below. In this specification, unless otherwise specified, the term "enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group" includes the mutant.
[0015] In the present invention, a mutant enzyme having an activity to defluorinate a fluoroalkane compound containing a hydrophilic group equivalent to or greater than that of the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group is preferably used. The activity to defluorinate a fluoroalkane compound containing a hydrophilic group equivalent to or greater than that of the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group refers to an activity that is about 50% or more, preferably about 70% or more, more preferably about 80% or more, and even more preferably about 90% or more of the activity of the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group, which comprises the amino acid sequence set forth in SEQ ID NO: 1.
[0016] The activity of an enzyme to defluorinate a fluoroalkane compound containing a hydrophilic group can be measured by reacting the enzyme with the fluoroalkane compound containing a hydrophilic group and analyzing the product. For example, the activity of defluorinating a fluoroalkane compound containing a hydrophilic group can be measured by reacting the enzyme with the fluoroalkane compound containing a hydrophilic group for a certain period of time, following the procedures described in the Examples of this specification, and then subjecting the resulting reaction mixture to LC-MS analysis to measure the amount of the defluorinated fluoroalkane compound containing a hydrophilic group or the remaining fluoroalkane compound containing a hydrophilic group. The certain period of time may be any period of time, for example, about 4 hours, about 8 hours, about 16 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, etc. For example, the defluorination activity of an enzyme toward a fluoroalkane compound containing a hydrophilic group can be expressed by the following formula: {(amount of fluorine ions contained in the aqueous solution of the fluoroalkane compound after defluorination) - (amount of fluorine ions contained in the aqueous solution of the fluoroalkane compound before defluorination)} / {fluorine atoms bonded to the fluoroalkane compound contained in the aqueous solution of the fluoroalkane compound before defluorination}. The value obtained from the above formula can also be multiplied by 100 to calculate the percentage (%) of the enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group. The percentage of the enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group (defluorination rate) varies depending on the reaction time (a certain time), but may be > about 10%, > about 20%, > about 30%, > about 40%, > about 50%, > about 60%, > about 70%, > about 80%, or > about 90%. The amount of fluoride ions can be measured by well-known techniques, such as ion chromatography, absorptiometry, and ion electrode methods.
[0017] Specific examples of mutants of the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group include, but are not limited to, enzymes comprising an amino acid sequence having at least about 30%, for example, at least about 40%, preferably at least about 50%, more preferably at least about 62%, even more preferably at least about 70% (e.g., at least 75%, at least 80%, at least 85%), and even more preferably at least about 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%) identity to the amino acid sequence shown in SEQ ID NO: 1, and having activity to defluorinate a fluoroalkane compound containing a hydrophilic group that is equal to or greater than that of the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group. The identity of amino acid sequences can be determined using known search tools such as FASTA and BLAST.
[0018] Further specific examples of mutants of the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group include, but are not limited to, enzymes having an amino acid sequence in which one to several or several tens of amino acids have been substituted, deleted, inserted, or added in the amino acid sequence shown in SEQ ID NO: 1, and which have activity to defluorinate fluoroalkane compounds containing a hydrophilic group that is equal to or greater than that of the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group. "Several" refers to 2, 3, 5, 4, 6, 7, 8, or 9 amino acids. "Several tens" refers to about 10 to about 90 amino acids, for example, about 20, about 30, about 40, about 50, about 60, about 70, about 80, or about 90 amino acids, or any number between these values. Amino acids in the amino acid sequence may be substituted with any amino acid, but are preferably substituted with amino acids having similar properties and / or structure (conservative amino acid substitutions). For example, the amino acids in the following brackets may be substituted for each other: (G, A), (K, R, H), (D, E), (N, Q), (S, T, Y), (C, M), (F, W, Y, H), (V, L, I).
[0019] Further specific examples of mutants of the enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group of the present invention include mutants that have a nucleotide sequence that is at least about 30%, for example, at least about 40%, preferably at least about 50%, more preferably at least about 62%, even more preferably at least about 70% (e.g., at least 75%, at least 80%, at least 85%), and even more preferably at least about 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%) of the base sequence shown in SEQ ID NO: 2. Examples of the enzyme include, but are not limited to, an enzyme having an amino acid sequence encoded by a base sequence having an identity of at least 99.7%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%, and having an activity for defluorinating a fluoroalkane compound containing a hydrophilic group that is equal to or greater than that of the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group. The identity of the base sequence can be determined using known search tools such as FASTA and BLAST.
[0020] Further specific examples of mutants of the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group include, but are not limited to, enzymes having an amino acid sequence encoded by a base sequence that hybridizes to a base sequence complementary to the base sequence shown in SEQ ID NO: 2 under stringent conditions, and having activity for defluorinating fluoroalkane compounds containing a hydrophilic group that is equal to or greater than that of the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group.
[0021] Stringent conditions are known to those skilled in the art and include, for example, the following conditions: 0.25M Na 2 HPO 4The hybridization is carried out for 16 to 24 hours in a buffer solution containing 1× Denhardt's solution, pH 7.2, 7% SDS, 1 mM EDTA, and 1× Denhardt's solution at a temperature of 60 to 68° C., preferably 65° C., and more preferably 68° C., and further in a buffer solution containing 20 mM Na 2 HPO 4 or a condition in which prehybridization is performed overnight at 42°C in a hybridization solution containing 25% formamide, or for more stringent conditions, 50% formamide, 4xSSC (sodium chloride / sodium citrate), 50 mM HEPES pH 7.0, 10x Denhardt's solution, and 20 µg / ml denatured salmon sperm DNA, followed by washing at 37°C in a buffer containing 1xSSC and 0.1% SDS, or for more stringent conditions, at 42°C in a buffer containing 0.5xSSC and 0.1% SDS, or for even more stringent conditions, at 65°C in a buffer containing 0.2xSSC and 0.1% SDS. Stringent conditions are not limited to the above examples.
[0022] Examples of the base sequence encoding the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group include the following: (a) the base sequence set forth in SEQ ID NO: 2; (b) a base sequence having at least about 30%, for example at least about 40%, preferably at least about 50%, more preferably at least about 62%, even more preferably at least about 70% (e.g., at least 75%, at least 80%, at least 85%), and even more preferably at least about 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%) identity to the base sequence set forth in SEQ ID NO: 2; (c) A base sequence that hybridizes under stringent conditions to a base sequence complementary to the base sequence shown in SEQ ID NO: 2. The stringent conditions are as described above. Furthermore, degenerate sequences of the base sequences (a) to (c) above are also encompassed in the base sequence of the present invention that encodes an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group.
[0023] The mutant of the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group may be naturally occurring or may be artificially produced using, for example, genetic engineering techniques.
[0024] When the enzyme or variant thereof of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group is naturally derived, it may be derived from any organism, and is preferably derived from a microorganism, particularly a bacterium. Examples of bacteria include bacteria of the genus Pandoraea. Examples of bacteria of the genus Pandoraea include Pandoraea pnomenusa. The organisms from which the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group is derived are not limited to those mentioned above. The gene encoding the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group can be obtained using known cloning methods.
[0025] The fluoroalkane compound containing a hydrophilic group may contain one or more oxygen atoms and / or halogen atoms other than fluorine in the fluoroalkane. Fluoroalkane compounds containing oxygen atoms include, for example, structures in which -C- is replaced by -O-, -COO-, or -OCO-, structures in which -H is replaced by -OH, or combinations thereof, but are not limited to the above. The number of oxygen atoms contained in the fluoroalkane is not particularly limited. For example, compounds containing one, two, or three oxygen atoms other than the oxygen atom contained in the hydrophilic group may be mentioned.
[0026] A fluoroalkane compound containing a hydrophilic group may contain one or more oxygen atoms and / or halogen atoms other than fluorine in the fluoroalkane. Fluoroalkane compounds containing halogen atoms other than fluorine include, for example, a structure in which -H is replaced with a halogen atom other than -fluorine. The number of halogen atoms other than fluorine contained in the fluoroalkane is not particularly limited. Examples include compounds containing one, two, or three halogen atoms other than fluorine. The halogen atom other than fluorine includes chlorine, bromine, iodine, astatine, tennessine, or any combination thereof. Fluoroalkanes containing one chlorine atom, such as chlorofluoroacetic acid, are particularly exemplified. When a fluoroalkane compound containing a halogen atom other than fluorine is defluorinated, a halogen atom other than fluorine may be eliminated in addition to the fluorine. When a fluoroalkane compound containing chlorine is defluorinated, chlorine may be eliminated in addition to the fluorine.
[0027] The hydrophilic group includes, but is not limited to, a group that ionizes in water to become an ion, and a group that does not ionize but hydrates through hydrogen bonding. The fluoroalkane may contain one or more hydrophilic groups. Preferably, there is one or two, and most preferably, there is one. Specific examples of the hydrophilic group include a sulfonic acid group (-SO 3 H), carboxylic acid group (-COOH), phosphate group (-H 2 P.O. 4 ), hydroxyl group (-OH), amino group (-NH 2 ), or an amide group (-CONH2). The hydrophilic group may be in the form of a salt. Examples of salts of the hydrophilic group include, but are not limited to, ammonium salts, nitrate salts, potassium salts, sodium salts, calcium salts, magnesium salts, sulfate salts, or phosphate salts.
[0028] The number of carbon atoms constituting the fluoroalkane skeleton is typically 1 to 2, or 1 or 2.
[0029] A fluoroalkane is an alkane in which one or more hydrogen atoms bonded to a carbon atom are replaced by a fluorine atom. The fluorine atoms can be present in any number and at any position of the fluoroalkane. The fluorine atoms can be present at the α-position or β-position relative to the hydrophilic group, or any combination thereof. The fluorine atoms can be 1 to 5, 1 to 4, 1 to 3, 1 to 2, 1, or 2 in the fluoroalkane. The fluorine atoms can be 0 to 3, 0 to 2, 0 to 1, 1 to 3, 1 to 2, 0, 1, 2, or 3 at the α-position or β-position relative to the hydrophilic group, respectively.
[0030] Specific examples of fluoroalkane compounds or salts thereof that contain a hydrophilic group and may contain an oxygen atom and / or a halogen atom other than fluorine include fluoroalkane compounds that contain a carboxylic acid or a salt thereof and may contain an oxygen atom and / or a halogen atom other than fluorine. Specific examples include, but are not limited to, fluoroalkylcarboxylic acids represented by the chemical formula: R1-COOH (wherein R1 represents a fluoroalkyl group having 1 to 2 carbon atoms that may contain an oxygen atom and / or a halogen atom other than fluorine), or salts thereof.
[0031] In the fluoroalkylcarboxylic acid, fluorine atoms can be present in any number and at any position. The fluorine atoms may be present at the α-position or β-position relative to the carboxyl group, or any combination thereof. The fluorine atoms may be 1 to 5, 1 to 4, 1 to 3, 1 to 2, 1, or 2 in the fluoroalkylcarboxylic acid. The fluorine atoms may be 0 to 3, 0 to 2, 0 to 1, 1 to 3, 1 to 2, 0, 1, 2, or 3 in the α-position or β-position relative to the carboxyl group, respectively.
[0032] Specific examples of fluoroalkylcarboxylic acids include, but are not limited to, 2-fluoropropanoic acid, 2,2-difluoropropanoic acid, 3-fluoropropanoic acid, 2,3-difluoropropanoic acid, 2,2,3-trifluoropropanoic acid, 3,3-difluoropropanoic acid, 2,3,3-trifluoropropanoic acid, 2,2,3,3-tetrafluoropropanoic acid, 3,3,3-trifluoropropanoic acid, 2,3,3,3-tetrafluoropropanoic acid, or 2,2,3,3,3-pentafluoropropanoic acid.
[0033] Specific examples of fluoroalkylcarboxylic acids include, but are not limited to, monofluoroacetic acid, difluoroacetic acid, trifluoroacetic acid, and chlorofluoroacetic acid.
[0034] When the fluoroalkyl group in the fluoroalkylcarboxylic acid has 2 carbon atoms, the number of fluorine atoms present on each carbon atom is preferably 0 or 1. Specific examples of fluoroalkylcarboxylic acids that are preferably defluorinated in the present application include, but are not limited to, monofluoroacetic acid, difluoroacetic acid, chlorofluoroacetic acid, 2-fluoropropanoic acid, 3-fluoropropanoic acid, and 2,3-difluoropropanoic acid.
[0035] The salt of the fluoroalkyl carboxylic acid may be, but is not limited to, an ammonium salt, a potassium salt, a sodium salt, a calcium salt, or a magnesium salt. The fluoroalkyl carboxylic acid may be a salt in which H in COOH is replaced, such as a sodium salt, or an ammonium salt.
[0036] The enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group and its mutants can be produced using known methods.For example, the gene of the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group, or its homolog or ortholog, can be cloned using PCR, ligated into an expression vector, and the expression vector can be introduced into a host cell, and the host cell can be cultured to produce the enzyme and its mutants.For example, the base sequence of the gene of the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group can be modified using known methods such as site-directed mutagenesis, and a mutant of the enzyme can be produced using the modified gene.
[0037] Thus, in one aspect, the present invention provides an expression vector comprising nucleotides of a base sequence encoding the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group. For example, nucleotides of any of the base sequences (a) to (c) above may be incorporated into an expression vector. Alternatively, nucleotides of a degenerate sequence of any of the base sequences (a) to (c) above, designed for codon optimization, may be incorporated into an expression vector.
[0038] In a further aspect, the present invention provides a host cell comprising an expression vector containing a nucleotide sequence encoding an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group.
[0039] In a further aspect, the present invention provides a method for producing the enzyme, which comprises culturing a host cell containing an expression vector containing nucleotides of a base sequence encoding an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group. Expression vectors, host cells, and methods for culturing them are known, and those skilled in the art can select and use them as appropriate.
[0040] In a further aspect, the present invention provides the Pandoraea pnomenusa DYG4 strain, which was deposited at the Patent Microorganisms Depositary (NPMD) of the NITE (National Institute of Technology and Evaluation) Biotechnology Center (Address: Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture) on May 27, 2024 (Accession No. NITE ABP-04122) and assigned Accession No. NITE BP-04122 on August 1, 2024. The DYG4 strain produces an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group, the enzyme comprising the amino acid sequence set forth in SEQ ID NO: 1. Thus, in a further aspect, the present invention provides an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group, produced by the DYG4 strain. In a further aspect, the present invention also provides a method for producing an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group, comprising culturing the DYG4 strain.
[0041] In a further aspect, the present invention provides a mutant strain of the above-mentioned DYG4 strain, which produces an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group.
[0042] The polypeptide comprising the amino acid sequence shown in SEQ ID NO: 1 and the polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 2 are novel. Furthermore, their variants may also be novel.
[0043] Thus, in one aspect, the present invention provides a polypeptide comprising an amino acid sequence having at least about 90% identity (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100%) to the amino acid sequence set forth in SEQ ID NO:1. In a further aspect, the present invention provides a polynucleotide comprising a nucleotide sequence having at least about 90% identity (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100%) to the nucleotide sequence shown in SEQ ID NO:2.
[0044] Unless otherwise specified, terms used in this specification are to be interpreted as they are commonly understood in the fields of chemistry, biology, biochemistry, etc. In this specification, when "about" is used before a numerical value, it represents the numerical value ±20%, preferably the numerical value ±10%, and more preferably the numerical value ±5%.
[0045] The present invention will be described in more detail and specifically below by showing examples. However, the examples are for illustrative purposes only and should not be construed as limiting the scope of the present invention.
[0046] Example 1: Isolation and Identification of Microorganisms Producing Enzymes That Defluorinate Fluoroalkylcarboxylic Acids. One gram of a Japanese environmental sample was added to 20 mL of sterilized DYG medium, and difluoroacetic acid was added to a concentration of 50 ppm. The sample was cultured at 30°C with shaking (passage 1). Every two weeks, 200 μL of the culture medium was collected and sterilized by filtration through a 0.22 μm membrane filter. The difluoroacetic acid concentration in the culture supernatant was measured by LC-MS. When the residual difluoroacetic acid concentration reached 25 ppm or less, the culture was transferred to fresh DYG medium at a concentration of 1% (v / v) (passage 2). Difluoroacetic acid was added again to a concentration of 100 ppm. The culture was transferred again (passage 3), and the fluoride ion concentration was measured once decomposition of difluoroacetic acid was confirmed. After detecting fluoride ions, the culture was transferred again (passage 4). After decomposition of difluoroacetic acid was confirmed, the culture was serially diluted as appropriate and plated on DYG agar medium containing 100 ppm difluoroacetic acid. The resulting colonies were inoculated into DYG medium containing 100 ppm difluoroacetic acid, and their degradation ability was evaluated to obtain strain DYG4. The 16S rRNA gene of strain DYG4 was examined and found to be 99.9% identical to the 16S rRNA gene of strain Pandoraea pnomenusa TF-18 (described in Microbiol Resour Announc. 2020 Jan; 9(1): e01008-19). Based on this, strain DYG4 was identified as a strain of Pandoraea pnomenusa. The DYG4 strain was deposited at the National Institute of Technology and Evaluation (NITE) Biotechnology Center, Patent Microorganism Deposit Center (NPMD) (Address: Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture) on May 27, 2024 (Accession number NITE ABP-04122), and was assigned the accession number NITE BP-04122 on August 1, 2024.
[0047] Example 2: Cloning of a gene encoding an enzyme that defluorinates fluoroalkyl carboxylic acids from the DYG4 strain. Using the total DNA of the DYG4 strain as a template, primers with restriction enzyme sites (fac-dex DYG4_F: TTTGGATCCGTAAGGAGGTGTTCATATGGACTTTCCAGGATTCAA, fac-dex DYG4_R: TTTCTCGAGGCCGTTTCGAGCAAGAA) were used to amplify the region from the transcription start site of the gene encoding the defluorinating enzyme, excluding the stop codon. The PCR product was purified and blunt-end ligated into EcoRV-treated pZErO-2. After introduction into E. coli DH5α, transformants were selected for kanamycin resistance. The plasmid was extracted, and sequence analysis confirmed that the PCR-amplified sequence was free of mutations. The resulting vector was digested with restriction enzymes, and the fragment containing the target gene was purified. The resulting fragment was ligated into pET-26b(+) and used to transform the DH5α strain. Transformants were selected and the plasmid extracted, and the plasmid was then used to transform E. coli BL21 strain to construct a heterologous expression system. The amino acid sequence of the enzyme that defluorinates fluoroalkylcarboxylic acids was determined as SEQ ID NO: 1. The nucleotide sequence of the gene encoding the enzyme that defluorinates fluoroalkylcarboxylic acids was determined as SEQ ID NO: 2.
[0048] Example 3 Evaluation of the activity of an enzyme that defluorinates fluoroalkyl carboxylic acids 1. Evaluation using microorganisms (1) Method for evaluating decomposition activity 1. DYG4 strain stored at -80°C was inoculated into DYG agar medium containing 100 ppm of fluoroalkyl carboxylic acid and cultured at 30°C for 3 days. 2. Small colonies thought to have fluoroalkyl carboxylic acid decomposition activity were selected from the formed colonies and inoculated into DYG liquid medium containing fluoroalkyl carboxylic acid. 3. The amount of remaining fluoroalkyl carboxylic acid from day 0 to day 3 of culture was analyzed using LC-MS. 4. Fluoride ions contained in the culture solution on day 2 of culture were measured using an electrode. (2) Evaluation results of defluorination rate (after 2 days): Fluoride ion analysis (n=1) The experimental results are shown in Table 1. -; No data available (3) Evaluation results of remaining amount of fluoroalkylcarboxylic acid: LC-MS analysis (i) Monofluoroacetic acid (Monofluoroacetate) The results are shown in Figure 3. In the DYG4 strain-added system, monofluoroacetic acid disappeared after 3 days of reaction, whereas no disappearance of monofluoroacetic acid was observed in the DYG4 strain-free system. (ii) Difluoroacetic acid (Difluoroacetate) The results are shown in Figure 4. In the DYG4 strain-added system, difluoroacetic acid disappeared after 2 days of reaction, whereas no disappearance of difluoroacetic acid was observed in the DYG4 strain-free system. 2. Evaluation of crude enzyme solution (1) Degradation activity evaluation method 1. DYG4 strain stored at -80°C was inoculated onto DYG agar medium containing 100 ppm of fluoroalkyl carboxylic acid and cultured at 30°C for 3 days. 2. Small colonies suspected to have fluoroalkyl carboxylic acid degrading activity were selected from the formed colonies and inoculated onto DYG liquid medium containing fluoroalkyl carboxylic acid. 3. Cultured for 2 days, and the amount of remaining fluoroalkyl carboxylic acid was confirmed by LC-MS. 4. The culture medium was centrifuged at 6,000 × g at 4°C for 30 minutes to recover the cells. 5. The cells were resuspended in Tris-H2SO4 buffer and centrifuged as in step 4. 6. The cells were washed by repeating steps 4 and 5. 7. The washed cells were resuspended in Tris-H2SO4 buffer and adjusted to a turbidity of 30. 8. The cells were ultrasonically disrupted on ice, centrifuged at 6,000 × g at 4°C for 10 minutes, and the supernatant was recovered and filtered through a 0.45 μm pore size membrane filter. 9. Fluoroalkylcarboxylic acid was added to the filtrate to a concentration of 100 ppm and reacted at 30°C. 10. A portion of the crude enzyme solution was recovered and immediately inactivated by heating at 90°C for 10 minutes. 11. After 16 hours, the same treatment as in 10 was carried out. 12. The reaction solutions of 10 and 11 were filtered through a membrane filter with a pore size of 0.22 μm, and the amount of remaining fluoroalkylcarboxylic acid was evaluated by LC-MS, and fluoride ions were detected using an electrode. (2) Decomposition activity evaluation results (after 16 hours): Fluoride ion analysis (n=2) The results are shown in Table 2. 3. Heterologous expression (E. coli) (1) Method for evaluating degradation activity 1. The gene sequence expressing the enzyme identified in Example 2 was introduced into pET-26b(+). 2. The plasmid constructed in 1. was introduced into E. coli BL21 strain. 3. The E. coli prepared in 2. was cultured at 100 μg mL -1 4. The E. coli culture was cultured in 200 mL of LB+Km medium at 37°C for 16 hours, until the turbidity of the culture reached 0.5. IPTG was added to a final concentration of 1 mM, and the culture was continued for an additional 3-5 hours at 37°C. 5. The cells were recovered by centrifuging 400 mL of the culture at 6,000 x g for 30 minutes at 20°C. 6. Washing was performed with 100 mL of NMM4 medium (this procedure was repeated twice). 7. The cells were suspended in NMM4 medium to a turbidity of 30, and 4 mL was dispensed into a 96-well deep plate. 8. The fluoroalkyl carboxylic acid to be evaluated was added to a concentration of 100 ppm. 9. After mixing well, 200 μL was immediately collected and heated at 98°C for 10 minutes to inactivate the enzyme. 10. The cells were filtered through a 0.22 μm membrane filter. 11. After 24 hours, the reaction solution was recovered in the same manner, and fluoride ions were measured using an electrode. (2) Decomposition activity evaluation results (after 24 hours): fluoride ion analysis (n=1). The results are shown in Table 3. 4. Evaluation of purified enzyme solution from heterologous expression system (E. coli) (1) Method for evaluating decomposition activity 1. The heterologous expression strain prepared in "3. Heterologous expression (E. coli)" was cultured in 15 mL of LB+Km medium for 17 hours at 37°C, then scaled up to 800 mL and cultured at 37°C for 17 hours. 2. The culture was centrifuged at 6,000 x g for 30 minutes at 4°C to recover the cells. 3. The cells were washed with 200 mL of Tris-H2SO4 (this procedure was repeated twice). 4. The cells were resuspended in 100 mL of Tris-H2SO4 and ultrasonically disrupted on ice for 5 minutes. 5. The cell lysate from 4. was centrifuged at 25,000 x g for 30 minutes at 4°C, and the supernatant was separated. 6. The supernatant from 5. was filtered through a 0.22 μm pore size membrane filter and purified using a HisTrap HP column. 7. 100% of each peak was removed. 100 μL of the reaction mixture was collected and immediately inactivated by adding 2 μL of 2M H2SO4. 11. After 118 hours, the same treatment as in 3. was carried out. 12. The reaction solutions from 2. and 3. were filtered through a 0.22 μm pore membrane filter, and the remaining amount of the fluoroalkyl carboxylic acid to be evaluated and the amount of glyoxylic acid produced, which is a dechlorinated and defluorinated product of chlorofluoroacetic acid, were evaluated by LC-MS. (2) Degradation activity evaluation results (after 118 hours): LCMS analysis (n=3) The results are shown in Table 4, Figures 5 and 6.
[0049] By using the enzyme of the present invention that defluorinates a fluoroalkane compound having a hydrophilic group, or a microorganism that produces the enzyme, the fluoroalkane compound can be defluorinated with low energy, low environmental load, and high efficiency. Therefore, the present invention is useful for environmental purification, environmental protection, health promotion, disease prevention, etc.
[0050] SEQ ID NO: 1 shows the amino acid sequence of an enzyme isolated from DYG4 that defluorinates fluoroalkane compounds containing a hydrophilic group. SEQ ID NO: 2 shows the base sequence of DNA encoding the enzyme isolated from DYG4 that defluorinates fluoroalkane compounds containing a hydrophilic group. SEQ ID NO: 3 shows the forward primer used in Example 2. SEQ ID NO: 4 shows the reverse primer used in Example 2.
Claims
1. A method for defluorinating a fluoroalkane compound which contains a hydrophilic group, for example, a sulfonic acid, carboxylic acid, phosphoric acid, or a salt thereof, and which may contain an oxygen atom and / or a halogen atom other than fluorine, said method comprising treating the fluoroalkane compound with an enzyme comprising any of the following amino acid sequences: (a) the amino acid sequence set forth in SEQ ID NO: 1; (b) an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 1; (c) the amino acid sequence set forth in SEQ ID NO: 1 in which 1 to 60 amino acids have been substituted, deleted, inserted, or added; (d) an amino acid sequence encoded by the base sequence set forth in SEQ ID NO: 2; (e) an amino acid sequence encoded by a base sequence having at least 80% identity to the base sequence set forth in SEQ ID NO: 2; or (f) an amino acid sequence encoded by a base sequence which hybridizes under stringent conditions to a base sequence complementary to the base sequence set forth in SEQ ID NO:
2.
2. The method according to claim 1, wherein the fluorine at the α-position of the fluoroalkane compound is defluorinated.
3. The method according to claim 1, wherein the fluorine at the β-position of the fluoroalkane compound is defluorinated.
4. The method of claim 1, wherein the fluoroalkane compound comprises a carboxylic acid or a salt thereof.
5. The method according to claim 4, wherein the fluoroalkane compound is a fluoroalkylcarboxylic acid represented by formula I: R1-COOH (I), wherein R1 represents a fluoroalkyl group having 1 to 2 carbon atoms which may contain an oxygen atom and / or a halogen atom other than fluorine, or a salt thereof.
6. The method according to any one of claims 1 to 5, wherein the defluorination activity of the enzyme on the fluoroalkane compound satisfies {(amount of fluorine ions contained in the aqueous fluoroalkane solution after defluorination treatment) - (amount of fluorine ions contained in the aqueous fluoroalkane solution before defluorination treatment)} / {fluorine atoms bonded to the fluoroalkane compound contained in the aqueous fluoroalkane solution before defluorination treatment} > 10%.
7. An enzyme capable of defluorinating a fluoroalkane compound which contains a carboxylic acid or its salt and which may contain an oxygen atom and / or a halogen atom other than fluorine, said enzyme comprising any of the following amino acid sequences: (a) the amino acid sequence set forth in SEQ ID NO: 1; (b) an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 1; (c) the amino acid sequence set forth in SEQ ID NO: 1 in which 1 to 60 amino acids have been substituted, deleted, inserted or added; (d) an amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO: 2; (e) an amino acid sequence encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence set forth in SEQ ID NO: 2; or (f) an amino acid sequence encoded by a nucleotide sequence which hybridizes under stringent conditions to a nucleotide sequence complementary to the nucleotide sequence set forth in SEQ ID NO:
2.
8. The enzyme according to claim 7, which defluorinates the fluorine at the α-position of the fluoroalkane compound.
9. The enzyme according to claim 7, which defluorinates the fluorine at the β-position of the fluoroalkane compound.
10. The enzyme according to claim 7, wherein the fluoroalkane compound is a fluoroalkylcarboxylic acid represented by formula I: R1-COOH (I), wherein R1 represents a fluoroalkyl group having 1 to 2 carbon atoms which may contain an oxygen atom and / or a halogen atom other than fluorine, or a salt thereof.
11. An expression vector comprising the following nucleotides: (a) a nucleotide set forth in SEQ ID NO: 2; (b) a nucleotide having at least 80% identity to the base sequence set forth in SEQ ID NO: 2; or (c) a nucleotide that hybridizes under stringent conditions with a base sequence complementary to the base sequence set forth in SEQ ID NO:
2.
12. A host cell comprising the expression vector of claim 11.
13. A method for producing an enzyme capable of defluorinating a fluoroalkane compound containing a carboxylic acid or its salt and which may contain an oxygen atom and / or a halogen atom other than fluorine, comprising culturing the host cell according to claim 12.
14. The method of claim 13, wherein the enzyme defluorinates the fluorine at the β-position of the fluoroalkane compound.
15. The method of claim 13, wherein the enzyme defluorinates the α-fluorine of the fluoroalkane compound.
16. The method according to claim 13, wherein the fluoroalkane compound is a fluoroalkylcarboxylic acid represented by formula I: R1-COOH (I), wherein R1 represents a fluoroalkyl group having 1 to 2 carbon atoms which may contain an oxygen atom and / or a halogen atom other than fluorine, or a salt thereof.
17. A microorganism deposited with NITE under accession number NITE BP-04122.
18. An enzyme capable of defluorinating fluoroalkylcarboxylic acids, produced by the microorganism according to claim 17.
19. A method for producing an enzyme capable of defluorinating a fluoroalkyl carboxylic acid, comprising culturing the microorganism of claim 17.
Citation Information
Patent Citations
Gene to code haloacetate dehalogenase
JP1990109981A