Method for reproducing new species by means of grafting between hybridization incompatible sorghum and maize
By grafting maize and sorghum under sterile conditions and then screening and regenerating them on a specific culture medium, the grafting problem of incompatible hybridization of monocotyledonous plants has been solved, and the regeneration of maize-sorghum hybrids has been achieved, resulting in higher yields, better stress resistance, and improved economic value.
Patent Information
- Application Number
- PCT/CN2025/098283
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-07
- Filing Date
- 2025-05-30
- Publication Date
- 2025-12-11
AI Technical Summary
Grafting between monocotyledonous plants such as maize and sorghum is difficult to succeed, especially in incompatible hybridization, resulting in hybrids that cannot be successfully obtained through sexual hybridization or grafting, thus limiting the potential for improvement in genetic variation and agronomic traits.
By grafting maize and sorghum under sterile conditions, and screening and regenerating on a specific culture medium, different marker gene screening agents are used to select and induce callus growth at the graft union, and finally hybrids are obtained on a selection medium.
The successful grafting and regeneration of hybrid plants with maize and sorghum heterozygous genomes among monocotyledons demonstrated improved yield, stress resistance, and economic value, while also providing the possibility of genetic variation.
Smart Images

Figure CN2025098283_11122025_PF_FP_ABST
Abstract
Description
Method for regenerating new species between cross-incompatible sorghum and maize by grafting TECHNICAL FIELD
[0001] The present invention relates to the field of biotechnology, in particular to a method for regenerating new species between cross-incompatible sorghum and maize by grafting. BACKGROUND
[0002] In sexual cross, due to reproductive barrier, cross-incompatible parent species cannot be cross-pollinated and set seeds because of gametic incompatibility (before fertilization) or cross failure (post-fertilization incompatibility). Like sexual cross, incompatibility also exists between grafted species. Most species can be grafted within the species, fewer plants can be grafted with closely related species, and very few plants can be successfully grafted with distantly related species.
[0003] In the process of heterograft compatibility at the graft junction, the ruptured cells collapse and the intact cells adhere to the corresponding tissues immediately after grafting. The cells at the junction divide to produce phloem and xylem, and then intercellular plasmodesmata and cytoplasmic channels are formed across the junction between the cells. In dicotyledonous plants, when grafting is incompatible, the cells at the junction may not differentiate into phloem and xylem although they divide. In both cases, aligning the vascular cambium between the scion and the stock can improve the success rate of grafting. Although grafting in dicotyledonous plants is common, grafting between monocotyledonous plants is very difficult because monocotyledonous plants do not have a vascular cambium and the vascular bundles are scattered.
[0004] Monocotyledonous plants such as maize and sorghum are important economic crops. Improving the agronomic traits of these commercially valuable plants through grafting can increase economic benefits. Successful grafting can provide genetic variation for monocotyledonous plants, thereby improving traits such as growth rate, size, yield, stress resistance, etc., which is of great significance. SUMMARY
[0005] The purpose of the present invention is to provide a method for grafting between cross-incompatible sorghum and maize and regenerating new species, which aligns the vascular cambium between the scion and the stock by grafting the maize and sorghum plants, and regenerates the hybrid between the two species from the graft junction on the selection medium, obtaining plants with the phenotype of sorghum and maize hybrid: i.e. a seed-producing "ear" at the top of the stem.
[0006] The purpose of the present invention can be achieved by the following measures: a method for grafting between cross-incompatible sorghum and maize and regenerating new species, comprising the following steps:
[0007] (1) In a sterile environment at 25℃, corn and sorghum with different marker genes are cultured under light for 15-17 hours and in darkness for 7-9 hours, germinate into seedlings in 5-10 days, and are grafted at the stem meristem of the corn and sorghum seedlings, and then cultured under light for 16 hours and in darkness for 8 hours at 25℃ in a humid and sterile environment for 5-10 days (MS medium);
[0008] (2) The grafted joint of the survived grafted plant is cut off and transferred to an induction medium containing 2 different marker gene screening agents, and then cultured under light for 16 hours and in darkness for 8 hours at 25℃ for 1-2 weeks, and the growth of callus indicates that the hybridization successful cells are screened;
[0009] (3) The hybridized callus screened in step (2) is transferred to a regeneration medium containing 2 different parent marker gene screening agents, and then cultured under light for 16 hours and in darkness for 8 hours at 25℃ for 1-2 weeks, and the callus regenerates seedlings;
[0010] (4) After the callus regenerates seedlings, the seedlings are transferred to a rooting medium containing 2 different parent marker gene screening agents, and then cultured under light for 16 hours and in darkness for 8 hours at 25℃ for 2-4 weeks to make the seedlings root, and the seedlings are cultured into complete plants, and a hybrid plant with a corn and sorghum hybrid genome is obtained.
[0011] In step (1) of the present application, the corn and sorghum with different marker genes refer to that before grafting, different screening marker genes can be used for labeling, and the marker genes can be selected from the commonly used genes or other markers in the art, such as morphological markers, resistance to different antibiotics or other chemical resistance markers, etc., and the labeling method can use the conventional method in the art.
[0012] In step (1) of the present application, the medium used for germination into seedlings is MS medium.
[0013] In step (1) of the present application, the medium used for culture after grafting is MS medium.
[0014] In step (1) of the present application, the corn and sorghum are grafted by using one species as a scion and the other species as a stock, and the tender buds or germ buds of the two species are respectively taken by using a razor blade or a biopsy punch, and then the taken tender buds or germ buds are transplanted to the cut of the other species, so as to be grafted together. The scion is the tender bud or germ bud (the upper half of the embryo) of one species, and the stock is the stem or radicle (the lower half of the embryo) of the other species.
[0015] The induction medium in step (2) of the present application is MS medium added with 30 g / L sucrose, a screening agent and 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D).
[0016] The regeneration medium in step (3) of the present application is MS medium added with 3.5 mg / L of 6-benzylaminopurine (BAP), 0.2 mg / L of indolebutyric acid (IBA) and 0.2 mg / L of 6-furfurylaminopurine, a screening agent.
[0017] The rooting medium in step (4) of the present application is MS medium added with 30 g / L of sucrose, 1 μmol / L of copper sulfate pentahydrate, 1 mg / L of IBA, 1 mg / L of IAA (indoleacetic acid), 1 mg / L of NAA (naphthaleneacetic acid), 8 g / L of agar, a screening agent.
[0018] The screening agent in the medium used in steps (2)-(4) of the present application can be selected according to the different genes marked in step (1), for example, if the marked glufosinate ammonium gene is selected, the glufosinate ammonium screening agent is used. In a specific example, the two different marker genes marked in step (1) are the glufosinate ammonium marker gene and the hygromycin marker gene, and the corresponding screening agents used in the medium in steps (2)-(4) are the glufosinate ammonium screening agent and the hygromycin screening agent. The specific amount can be selected according to the conventional method in the art. In a specific example, the glufosinate ammonium screening agent is 2-5 mg / L, preferably 3 mg / L, and the hygromycin screening agent is 40-60 mg / L, preferably 50 mg / L. The present application also provides the use of the method in culturing monocotyledonous new species.
[0019] The plant obtained by the method of the present application is a new species of heterologous tetraploid combining the genotypes of two species of corn and sorghum. If the parent carries a dominant marker allele, and the dominant allele is heterozygous, the hybrid will be double heterozygous. If the dominant alleles in the two parent species are represented by A and B, respectively, and the parents are both diploid, the genotype of the hybrid will be AaBb. The hybrid offspring will segregate into 15 (A_B_, A_bb, aaB_):1aabb. If the heterozygosity of the two parents is initially expressed as a single transgene insertion of dominant alleles, then aabb represents a non-transgenic hybrid. If two homozygous non-transgenic parents resistant to different chemicals are grafted, the hybrid produced by them will be non-transgenic.
[0020] Unless otherwise specified, the terms in the present application are defined as follows:
[0021] Scion: In grafting, the plant part used as the stem, which can be an embryo.
[0022] Embryo: The primary bud of an embryonic plant that can develop into a seedling.
[0023] Stem meristem: The stem tip region.
[0024] Stock: In grafting, the plant that serves as the scion, which can be root or stem.
[0025] Radicle: The lower part of the embryo that develops into the primary root.
[0026] Grafting: The process of placing freshly cut scion on freshly cut stock, the resulting plant combination is called a grafted plant. In vitro grafting or micrografting does not require special conditions for aseptic.
[0027] Selection marker: Plants can be genetically transformed to carry antibiotic or herbicide or other chemical resistance genes. Alternatively, plants can have biochemical markers such as, but not limited to, color or metabolite, or morphological markers such as, but not limited to, hair or stem / leaf hair.
[0028] Hybrid: The hybrid is produced after in vitro grafting regeneration. It can be an intergeneric hybrid or a hybrid between cross-incompatible parents. These hybrids can have hybrid vigor (better than one or both parents) or hybrid weakness (not grow as well as normal plants). If both parents are diploid, the hybrid can be tetraploid (combining the chromosomes of both parents) or aneuploid (chromosome number between tetraploid and diploid, such as one of the parents). The hybrid is a new plant variety of great significance to agricultural or horticultural production. Due to cross-incompatibility of parents, the hybrid is propagated vegetatively by in vitro grafting or micrografting.
[0029] Cross-incompatibility: Sexually reproducing plants cannot cross with each other, or one cannot cross with the other, and cannot produce fertile offspring containing the genomes of both parents.
[0030] Natural herbicide resistance: Existing plants or plants modified by mutation and their offspring can contain genes resistant to certain herbicides. These resistances to different herbicides can be used as selection agents in grafting to produce hybrids resistant to both herbicides.
[0031] Advantages of the present invention:
[0032] The hybrids of the present invention have the potential for higher yield, the potential for improved resistance to plant pathogens and environmental stresses, the potential for improved nutritional value, the potential for increased economic value, and the potential to create environmentally friendly plants. Even if hybrid weakness occurs, there are ways to avoid this problem, such as selecting morphologically normal or more desirable plants from the hybrid offspring population, or producing more hybrids for selection. After screening and field trials, these hybrids can be used for commercial production. BRIEF DESCRIPTION OF DRAWINGS
[0033] Figure 1 shows the results of PCR amplification of corn detection primers and sorghum detection primers;
[0034] Figure 2 shows the method of meristem grafting and regenerating intergeneric hybrids using maize (A) and sorghum (B) as examples. Stem meristems can be grafted by a "V" cut (indicated by thick dashed line) or a "T" cut (indicated by thin dashed line). The scion cut is "V" shaped. The triangle at the bottom of the "V" indicates the stem meristem.
[0035] Figure 3 shows sorghum-maize hybrid plants at different growth stages: A. grown in soil for one week; B. grown in soil for two weeks; C. grown in soil for four weeks; D. grown in soil for seven weeks (mature). DETAILED DESCRIPTION
[0036] The following examples are intended to better illustrate the present application and are not intended to limit the same. The experimental materials used in the following examples are conventional biochemical reagents, unless otherwise specified.
[0037] Unless otherwise specified, the maize used in the examples of the present application is B101 (disclosed in Hallauer, A.R., & Wright, A.D. Registration of B101 Maize Germplasm. Crop Science, 1995. 35, 1238-1239.) and the sorghum is Tx430 (disclosed in Liu G, Godwin ID. Highly efficient sorghum transformation. Plant Cell Rep. 2012 Jun; 31(6): 999-1007. doi: 10.1007 / s00299-011-1218-4). The relevant seeds are preserved in the laboratory and are committed to permanent public disclosure.
[0038] The maize and sorghum used in the present application are labeled before the experiment. Specifically, the maize is labeled with the glufosinate ammonium gene and the sorghum is labeled with the hygromycin gene. The maize containing the glufosinate ammonium marker gene and the sorghum containing the hygromycin marker gene can be constructed according to conventional methods in the art. In the following examples, the specific labeling methods are as follows:
[0039] Construction of maize containing hygromycin marker gene: plasmid pCAMBIA1305.1 (purchased from Shanghai Huwu Biotechnology Co., Ltd.) is introduced into maize B101 to obtain, and the introduction method is conventional operation.
[0040] Construction of sorghum containing glufosinate ammonium marker gene: plasmid pCAMBIA3301 (purchased from Shanghai Huwu Biotechnology Co., Ltd.) is introduced into sorghum Tx430 to obtain, and the introduction method is conventional operation.
[0041] The T0 generation plants of corn and sorghum were identified, and total DNA of leaves of the plants to be tested was extracted, and corn detection primer and sorghum detection primer were used for PCR amplification, and plants with a target band were transgenic positive plants, and the results are shown in Figure 1. Corn containing glufosinate ammonium marker gene and sorghum containing hygromycin marker gene were obtained, which were used in subsequent example experiments.
[0042] Corn detection primer: F: TGTAGTGTATTGACCGATTCCTTGC
[0043] R: GTTCGACAGCGTCTCCGACCTGAT
[0044] Sorghum detection primer: F: ACGCAACGCCTACGAC
[0045] R: GCTGCCAGAAACCCAC.
[0046] Example 1
[0047] In the present application, the meristems of corn and sorghum are grafted to produce hybrid species, and the parents for obtaining grafted hybrid species are B101 for corn and Tx430 for sorghum (Figure 2). The corn containing glufosinate ammonium marker gene and the sorghum containing hygromycin marker gene are germinated into seedlings under sterile conditions at 25°C with 16 hours of light and 8 hours of darkness (MS medium).
[0048] Grafting: The grafting experiment is carried out under sterile conditions with good growth of the plants. In the seedling stage (seedlings for about 2 weeks), the stem meristems are grafted, and the stems of transgenic corn B101 and sorghum Tx430 plants with similar sizes are cut at a 45-degree angle. The plants used as rootstocks are cut into "T" or "V" shapes. The seedling plants used as scions are cut into "V" shapes. The scions are inserted into the rootstocks and fixed together by sterile silicone tubes. Each plant can serve as a rootstock and a scion at the same time, and the grafting is exchanged to produce two grafting combinations. In this example, since the corn stem is thicker than the sorghum, most of the corn is used as a rootstock, and the sorghum is used as a scion, and a total of 850 grafting plants are grafted. The grafted plants are grown in MS medium with the addition of 30 g / L sucrose, and are grown under sterile conditions at 25°C with 16 hours of light and 8 hours of darkness. After 5-10 days of growth, a total of 358 surviving grafted plants are obtained.
[0049] Induction of callus: To select the grafted regenerated cells containing two parental genomes, the survived grafted plants were cut at the grafted junction and transferred to the induction medium containing the selection agents (MS medium with 30 g / L sucrose, 50 mg / L hygromycin and 3 mg / L phosphinotricin selection agents and 1 mg / L 2,4-D). Only the hybrid cells containing both parental genomes have the resistance to both selection agents and can induce callus. In this example, 358 survived grafted plants were obtained, and their grafted junctions were grown for 1-2 weeks at 25 °C with 16 hours light and 8 hours dark. The callus growth indicates the selection of hybrid cells. After 2 weeks, 30 grafted junctions survived and can induce callus under the double selection of hygromycin and phosphinotricin.
[0050] Regeneration of hybrid: The callus of hybrid cells selected in the previous step was transferred to the regeneration medium containing 50 mg / L hygromycin and 3 mg / L phosphinotricin (MS medium with 3.5 mg / L BAP, 0.2 mg / L IBA and 0.2 mg / L kinetin). The callus was grown for 1-2 weeks at 25 °C with 16 hours light and 8 hours dark. The callus regenerated shoots. Out of 30 calli, only 6 calli regenerated shoots.
[0051] After the callus regenerated shoots, the shoots were transferred to the rooting medium containing 50 mg / L hygromycin and 3 mg / L phosphinotricin (MS medium with 30 g / L sucrose, 1 μmol / L copper sulfate pentahydrate, 1 mg / L IBA, 1 mg / L IAA, 1 mg / L NAA, 8 g / L agar). The shoots were grown for 1-2 weeks at 25 °C with 16 hours light and 8 hours dark. Two rooted shoots were obtained, which were identified as the hybrid plants of sorghum and maize.
[0052] The rooted hybrid plants were transplanted to soil and then acclimated for 3 days in the open air. The plants were moved to the greenhouse and grown at 30 °C under natural light, with regular watering and fertilization. After 3 days of acclimation, the plants were transferred to soil and grown in the greenhouse.
[0053] Induction of callus: To select the grafted regenerated cells containing two parental genomes, the survived grafted plants were cut at the grafted junction and transferred to induction medium containing selection agents (MS medium with 30 g / L sucrose, 50 mg / L hygromycin and 3 mg / L phosphinotricin selection agent and 1 mg / L 2,4-D). Only the hybrid cells containing both parental genomes have resistance to both selection agents and can induce callus. In this example, 358 survived grafted plants were obtained and their grafted junctions were grown in 25 °C with 16 hours light and 8 hours dark for 1-2 weeks. The growth of callus indicates the selection of hybrid cells. After 2 weeks, 30 grafted junctions survived and can induce callus under the double selection of hygromycin and phosphinotricin.
[0054] Regeneration of hybrid: The callus of hybrid cells selected in the previous step was transferred to regeneration medium containing 50 mg / L hygromycin and 3 mg / L phosphinotricin (MS medium with 3.5 mg / L BAP, 0.2 mg / L IBA and 0.2 mg / L kinetin). The callus was grown in 25 °C with 16 hours light and 8 hours dark for 1-2 weeks. The callus regenerated shoots. Only 6 calli regenerated shoots out of 30 calli.
[0055] After the callus regenerated shoots, the shoots were transferred to rooting medium containing 50 mg / L hygromycin and 3 mg / L phosphinotricin (MS medium with 30 g / L sucrose, 1 μmol / L copper sulfate pentahydrate, 1 mg / L IBA, 1 mg / L IAA, 1 mg / L NAA, 8 g / L agar). The shoots were grown in 25 °C with 16 hours light and 8 hours dark for 1-2 weeks. Two rooted shoots were obtained and identified as hybrid plants of sorghum and maize.
[0056] The hybrid plants were transplanted to soil and then acclimated in the open air for 3 days. The plants were moved to a greenhouse and grown in 30 °C natural light, with regular watering and fertilization. After 3 days of acclimation, the plants were transferred to soil and grown in the greenhouse.
[0057] As shown in Figure 3, the hybrid plant initially looked like sorghum: it had smooth green leaves and thin stems. But after 3 weeks, the growth stopped, and after another week, new stems started to grow. At this point, the plant started to show corn leaf characteristics, and the original thin stems had died. After a month, the plant grew to about 10 cm tall. We noticed that a seed-bearing ear was growing on the top of the stem. This indicated that the plant, although small, was mature enough to grow a "corn ear" in the stem, rather than a "ear" that was differentiated alone on the stem (Figure 3D).
[0058] In our study, the graft junction between two monocot plants grew a new hybrid plant, which has a very important biological significance. It means that the genomic DNA was transferred between two incompatible plants and a new hybrid species was generated. The hybrid plant was resistant to both hygromycin and glufosinate, although the hybrid grew weakly, but its scientific significance showed that the plant existed DNA of maize and sorghum genomes.
[0059] This study proved that different species of monocot plants not only can be grafted, but also their nuclear genomes can be combined by grafting to produce hybrids by generating hybrids from graft junction in vitro. The results also showed that the incompatibility of hybrid sorghum and maize has graft compatibility. We have cultivated a plant that is phenotypically between sorghum and maize. This hybrid produces a seed-bearing "ear" at the top of the stem. This is the first case of monocot graft hybridization in the world.
Claims
1. A method of grafting between hybrid incompatibility of sorghum and maize and regenerating a new species, characterized in that, The method comprises the following steps: (1) under the condition of constant temperature of 25℃ and sterile environment, corn and sorghum with different marker genes are cultured under light for 15-17 hours and in dark for 7-9 hours, and are germinated into seedlings for 5-10 days, and then the seedlings are grafted at the stem meristem, and are cultured under light for 16 hours and in dark for 8 hours at constant temperature of 25℃ for 5-10 days; (2) the grafting joint part of the survived grafted plants is cut off and is transferred to an induction medium containing 2 different marker gene screening agents, and is cultured under light for 16 hours and in dark for 8 hours at 25℃ for 1-2 weeks, and the growth of callus indicates that the hybridization successful cells are screened; (3) the hybridized callus screened in step (2) is transferred to a regeneration medium containing 2 different parent marker gene screening agents, and is cultured under light for 16 hours and in dark for 8 hours at 25℃ for 1-2 weeks, and the callus regenerates seedlings; (4) after the callus regenerates seedlings, the seedlings are transferred to a rooting medium containing 2 different parent marker gene screening agents to make the seedlings root, and the seedlings are cultured into complete plants, and the hybrid plants with corn and sorghum hybrid genome are obtained.
2. The method of claim 1, wherein, The medium used in step (1) for germination is MS medium.
3. The method of claim 1, wherein, The medium used in step (1) after grafting is MS medium.
4. The method of claim 1, wherein, In step (1), the corn and sorghum are grafted by using one species as scion and the other species as stock, and the tender buds or germ buds of the two species are respectively taken by using a razor blade or a biopsy punch, and then the taken tender buds or germ buds are transplanted to the cut part of the other species, so as to be grafted together.
5. The method of claim 1, wherein, The induction medium in step (2) is MS medium added with 30 g / L sucrose, screening agent and 1 mg / L 2,4-dichlorophenoxyacetic acid.
6. The method of claim 5, wherein, The 2 different marker genes in step (1) are glufosinate ammonium marker gene and hygromycin marker gene, and the screening agents in the induction medium in step (2) are glufosinate ammonium screening agent and hygromycin screening agent.
7. The method of claim 6, wherein, The dosages of the screening agents in the induction medium in step (2) are as follows: the glufosinate ammonium screening agent is 2-5 mg / L, preferably 3 mg / L, and the hygromycin screening agent is 40-60 mg / L, preferably 50 mg / L.
8. The method of claim 1, wherein, The regeneration medium in step (3) is MS added with 3.5 mg / L 6-benzylaminopurine, 0.2 mg / L indolebutyric acid and 0.2 mg / L 6-furfurylaminopurine, and screening agent; preferably, the screening agents are glufosinate ammonium screening agent and hygromycin screening agent, and preferably, the glufosinate ammonium screening agent is 2-5 mg / L, preferably 3 mg / L, and the hygromycin screening agent is 40-60 mg / L, preferably 50 mg / L.
9. The method of claim 1, wherein, The rooting medium in step (4) is MS added with 30 g / L sucrose, 1 μmol / L copper sulfate pentahydrate, 1 mg / L indolebutyric acid, 1 mg / L indoleacetic acid, 1 mg / L NAA, 8 g / L agar, and screening agent; preferably, the screening agents are glufosinate ammonium screening agent and hygromycin screening agent, and preferably, the glufosinate ammonium screening agent is 2-5 mg / L, preferably 3 mg / L, and the hygromycin screening agent is 40-60 mg / L, preferably 50 mg / L.
10. Use of the method according to claims 1 to 9 for culturing monocotyledonous new species.
Citation Information
Patent Citations
Agrobacterium-mediated genetic transformation method using mature embryo ofsorghum as explant to induce callus
CN110699379A
Graft-mediated hybridization of monocotyledonous plants
CN113194711A
Method for creating tobacco interspecific allopolyploid new germplasm by using horizontal genome transfer
CN113498738A
Method for regenerating new species between hybrid incompatible sorghum and corn through grafting
CN118592222A
Method of producing interspecific hybrids between cross-incompatible plants
US20230413734A1