Microorganism of genus thraustochytrid with weakened tryptophan synthesis ability, recombinant vector for restoring function thereof, and uses thereof

Tryptophan auxotrophic mutant Thraustochytrid microorganisms with restored tryptophan synthesis function address the challenge of foreign gene insertion by using endogenous constructs, simplifying registration and enhancing omega-3 fatty acid production.

WO2025263922A1PCT designated stage Publication Date: 2025-12-26CJ CHEILJEDANG CORP
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/008189
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-20
Filing Date
2025-06-13
Publication Date
2025-12-26

AI Technical Summary

Technical Problem

Current microalgal transformation technologies involve inserting antibiotic resistance genes, leading to strains that require complex registration processes and hinder practical application, particularly in Thraustochytrid microalgae used for producing omega-3 fatty acids, as no method exists to develop strains without foreign genes.

Method used

Development of tryptophan auxotrophic mutant microorganisms of the Thraustochytrid family with impaired tryptophan synthesis ability, utilizing endogenous nucleic acid constructs and vectors to restore tryptophan synthesis function without foreign selection markers, enabling strain development without antibiotic resistance genes.

Benefits of technology

Enables strain development without foreign genes, simplifying registration processes and facilitating the production of omega-3 fatty acids in Thraustochytrid microalgae by using endogenous genetic components for selection and function restoration.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025008189_26122025_PF_FP_ABST
    Figure KR2025008189_26122025_PF_FP_ABST
Patent Text Reader

Abstract

The present application provides a Thraustochytrid sp. microorganism with weakened tryptophan synthesis ability, a recombinant vector for restoring the function of the microorganism, a recombinant microorganism obtained by introducing the recombinant vector into the microorganism, a composition comprising same, and a method using same.
Need to check novelty before this filing date? Find Prior Art

Description

Microorganisms of the genus Thraustochytrid with impaired tryptophan synthesis ability, recombinant vectors for restoring their function, and uses thereof

[0001] Cross-citation with related application(s)

[0002] This application claims the benefit of priority from Republic of Korea Patent Application No. 10-2024-0080510, dated June 20, 2024, the entire contents of which are incorporated herein by reference.

[0003] Numerous papers and patents are referenced and cited throughout this application. The disclosures of these cited papers and patents are incorporated herein by reference in their entirety to provide a clearer understanding of the state of the art and the scope of the present invention.

[0004] The present application relates to a microorganism of the genus Thraustochytrid with a weakened tryptophan synthesis ability, a recombinant vector for restoring the tryptophan synthesis function of the microorganism, a recombinant microorganism having the recombinant vector introduced into the microorganism, a composition comprising the same, and a method using the same.

[0005]

[0006] Current microalgal transformation technologies generally involve inserting antibiotic resistance genes into the microalgal genome, inevitably resulting in strains containing foreign genes, such as antibiotic resistance genes, that serve as selectable markers for confirming gene insertion. These strains, incorporating foreign genes like antibiotic resistance genes, require registration as genetically modified organisms. The process for obtaining production permits and product registration is often complex and challenging, hindering their practical application.

[0007] Chlamydomonas reinhardtii, known as a model strain of green algae among microalgae, and Phaeodactylum tricornutum, known as a model strain of diatoms, have been studied extensively compared to other strains, but no method has been developed to develop strains that do not contain effective antibiotic resistance genes.

[0008] Meanwhile, microorganisms in the Thraustochytrid family, unlike green algae or diatoms, are heterotrophic microalgae that cannot photosynthesize. However, they can produce omega-3 fatty acids such as DHA (Docosahexaenoic acid) and EPA (Eicosapentaenoic acid), which are useful fatty acids, and they are high-performance strains that can accumulate crude fat of more than 50% of the dry weight, so they have high utility. However, as with other microalgae, the current practice is to create transformed strains by inserting foreign genes such as antibiotic genes.

[0009] Therefore, it is necessary to develop strains without insertion of foreign genes such as antibiotic resistance genes.

[0010]

[0011] An example provides a tryptophan auxotrophic mutant microorganism of the Thraustochytrids family, which has a weakened tryptophan synthesis ability.

[0012] Another example provides a nucleic acid construct for screening transformants whose host cells are tryptophan auxotrophic mutants of the Thraustochytrid genus.

[0013] In one specific example, the nucleic acid construct may comprise a tryptophan synthase beta gene endogenous to the Thraustochytrid microorganism.

[0014] Another example provides a nucleic acid construct for selecting the transformant and a recombinant vector comprising a target gene. The recombinant vector may be an expression vector for expressing the target gene in a tryptophan auxotrophic mutant microorganism of the Thraustochytrid genus.

[0015] Another example provides a recombinant microorganism in which the nucleic acid structure or the recombinant vector is introduced into a tryptophan auxotrophic mutant microorganism of the Thraustochytrid genus. The recombinant microorganism may have restored tryptophan auxotrophy. Furthermore, the recombinant microorganism may not require an exogenous selection marker to confirm the introduction of the recombinant vector.

[0016] Another example is,

[0017] The above nucleic acid structure,

[0018] The above recombinant vector, and

[0019] A recombinant microorganism in which the above recombinant vector has been introduced into a tryptophan nutrient-requiring mutant microorganism of the Thraustochytrid family.

[0020] A composition for producing a target product comprising at least one selected from the group consisting of:

[0021] Another example provides a method for producing a desired product, comprising a step of culturing the recombinant microorganism. The culturing step may be performed in a medium that does not contain tryptophan.

[0022] Another example provides a nucleic acid construct for restoring tryptophan synthesis function in a tryptophan auxotrophic mutant microorganism of the Thraustochytrid genus.

[0023] In one specific example, the nucleic acid construct may comprise a tryptophan synthase beta gene endogenous to the Thraustochytrid microorganism.

[0024] Another example provides a method for producing a thraustochytrid microorganism with restored tryptophan synthesis function, or a method for restoring tryptophan synthesis function of a thraustochytrid microorganism with restored tryptophan synthesis function, comprising the step of introducing a nucleic acid structure for restoring tryptophan synthesis function into a thraustochytrid microorganism with a tryptophan auxotrophic mutant microorganism.

[0025]

[0026] In one embodiment of the present invention, a strain of microalgae in the Thraustochytrids genus that lacks a gene involved in tryptophan synthesis was created. The wild-type strain cannot grow in a medium containing 5-fluoroindole and does not require supplemental tryptophan because it can biosynthesize tryptophan. On the other hand, a strain lacking a gene involved in tryptophan synthesis cannot survive in a medium lacking tryptophan, but can survive in a medium containing 5-fluoroindole. Using this, it was confirmed that when an expression vector capable of expressing a gene involved in tryptophan synthesis is inserted into a strain lacking a gene involved in tryptophan synthesis, screening is easily possible even in a general medium lacking tryptophan. In other words, strain development is possible without the introduction of foreign genes such as antibiotic resistance genes, simply by combining genes, promoters, and terminators inherent to the Thraustochytrid strain.

[0027] Accordingly, the present application relates to a markerless strain development technology that does not involve the introduction of foreign selection marker genes such as antibiotic resistance genes, and provides a microorganism of the genus Thraustochytrid with a weakened tryptophan synthesis ability, a recombinant vector for restoring the tryptophan synthesis function of the microorganism, a recombinant microorganism in which the recombinant vector is introduced into the microorganism, a composition comprising the same, and a method using the same.

[0028] More specifically, one example of the present application provides a tryptophan auxotrophic mutant microorganism of the Thraustochytrids family, in which the tryptophan synthase β gene is inactivated.

[0029] Another example is a nucleic acid construct for the selection of transformants whose host cells are tryptophan auxotrophic mutants of the Thraustochytrid genus.

[0030] The nucleic acid structure comprises a tryptophan synthase beta gene,

[0031] The above-mentioned Thraustochytrid microorganism with a tryptophan nutrient requirement mutant microorganism is a Thraustochytrid microorganism with an inactivated tryptophan synthase β gene.

[0032] A nucleic acid structure for selecting transformants is provided.

[0033] Another example is,

[0034] A nucleic acid structure comprising a tryptophan synthase beta gene, and

[0035] target gene

[0036] The present invention provides a recombinant vector for expression of the target gene in a tryptophan auxotrophic mutant microorganism of the Thraustochytrid family, in which the tryptophan synthase β gene is inactivated.

[0037] Another example provides a recombinant microorganism in which the nucleic acid structure is introduced into a tryptophan auxotrophic mutant microorganism of the Thraustochytrid genus in which the tryptophan synthase β gene is inactivated.

[0038] Another example is,

[0039] A nucleic acid structure comprising the above tryptophan synthase beta gene,

[0040] The above recombinant vector, and

[0041] A recombinant microorganism in which the recombinant vector is introduced into a tryptophan auxotrophic microorganism of the Thraustochytrid family in which the tryptophan synthase β gene is inactivated.

[0042] A composition for producing a target product comprising at least one selected from the group consisting of: The target gene included in the recombinant vector may be involved in the production of the target product.

[0043] Another example provides a method for producing a target product, the production of which is involved in a target gene included in the recombinant microorganism, comprising a step of culturing the recombinant microorganism.

[0044] Another example is a nucleic acid structure for restoring the tryptophan synthesis function of a tryptophan auxotrophic mutant microorganism of the Thraustochytrid family.

[0045] Contains the tryptophan synthase beta gene,

[0046] The above-mentioned microorganism of the Thraustochytrid family, which is a microorganism of the Thraustochytrid family with an inactivated tryptophan synthase beta gene, provides a nucleic acid structure for restoring the tryptophan synthesis function.

[0047] Another example provides a method for producing a Thraustochytrid microorganism with restored tryptophan synthesis function, comprising the step of introducing the nucleic acid structure or a recombinant vector containing the same into a tryptophan auxotrophic mutant microorganism of the Thraustochytrid microorganism in which the tryptophan synthase β gene is inactivated.

[0048]

[0049]

[0050] Definition of Terms

[0051] In the present application, the phrase “a polynucleotide (which may be used interchangeably with “nucleic acid molecule” or “gene”) or a polypeptide (which may be used interchangeably with “protein”) “has or includes, or consists of or is expressed by, a specific nucleic acid sequence (base sequence) or amino acid sequence” may mean that the polynucleotide or polypeptide essentially includes the specific nucleic acid sequence (base sequence) or amino acid sequence, and may be interpreted as including (or not excluding) a “substantially equivalent sequence” in which a mutation (deletion, substitution, modification, and / or addition) is added to the specific nucleic acid sequence (base sequence) or amino acid sequence to the extent that the original function and / or the desired function of the polynucleotide or polypeptide is maintained.

[0052] In one example, the nucleic acid sequence or amino acid sequence provided herein may include a modification by conventional mutagenesis, such as directed evolution and / or site-directed mutagenesis, to the extent that it maintains its original function or desired function.

[0053] In one example, a polynucleotide or polypeptide "comprises or consists of or is represented by a particular nucleic acid sequence (base sequence) or amino acid sequence" means that the polynucleotide or polypeptide (i) essentially comprises the particular nucleic acid sequence (base sequence) or amino acid sequence, or (ii) consists of or essentially comprises a nucleic acid sequence or amino acid sequence that has at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% homology or identity with the particular nucleic acid sequence (base sequence) or amino acid sequence and that performs its original function and / or its intended function. It can mean to maintain.

[0054] For example, in the case of the coding gene of Tryptophan synthase β represented by sequence number 1, the gene is

[0055] (a) a gene consisting of the nucleic acid sequence of the above sequence number 1, and / or

[0056] (b) a nucleic acid sequence having a homology or identity of at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% (the upper limit may be 100% or less than 100%) with the nucleic acid sequence of the above sequence number 1, or an amino acid sequence encoded by the above nucleic acid sequence having a homology or identity of at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98%, at least 99%, A gene that expresses a protein having the original function of tryptophan synthase β, i.e., the function of synthesizing tryptophan, and is composed of a nucleic acid sequence encoding an amino acid sequence having a homology or identity of 99.5% or more, or 99.9% or more.

[0057] may include.

[0058] In this application, "homology" means the percentage of identity between two polynucleotides or polypeptide moieties. The sequence homology from one moiety to another moiety can be determined by known techniques. For example, homology can be determined by directly aligning sequence information and parameters such as score, identity, and similarity between two polynucleotide molecules or two polypeptide molecules using readily available computer programs. The computer programs may be BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlign™ (DNASTAR Inc), etc. In addition, homology between polynucleotides can be determined by hybridizing polynucleotides under conditions that form a stable duplex between homologous regions, then digesting them with a single-strand-specific nuclease and determining the size of the digested fragments.

[0059] In this application, 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0060] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0061] Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.

[0062] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or in, for example, Needleman et al. (1970), J Mol Biol. 48:443. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a quantile matrix, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), and (3) a quantile matrix, as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443. 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0063] In this application, the term “about” described before a numerical value may be used to comprehensively mean a numerical value in a range equal to or similar to the numerical value described later, and in one example, the equal to or similar range may mean a range of ±20%, ±15%, ±10%, ±5%, ±3%, ±2%, ±1%, etc. of the described numerical value, but is not limited thereto.

[0064] In this application, even when only a numerical value is described, it can be interpreted as being used to comprehensively mean a numerical value in a range equal to or similar to the described numerical value, and in one example, the equal to or similar range can mean a range of ±20%, ±15%, ±10%, ±5%, ±3%, ±2%, ±1%, etc. of the described numerical value, but is not limited thereto.

[0065]

[0066] Hereinafter, the present application will be described in more detail.

[0067]

[0068] Variants of tryptophan auxotrophy in microorganisms of the Thraustochytrid family

[0069] An example of the present application provides a tryptophan auxotrophic mutant microorganism of the Thraustochytrids family, which has a weakened tryptophan synthesis ability.

[0070]

[0071] The above Thraustochytrids microorganisms refer to heterotrophic microalgae of the order Thraustochytriales. The above-mentioned thraustochytrid microorganisms are microalgae belonging to the genus Schizochytrium (or genus Schizochytrium) and the family Thraustochytriaceae, such as the genus Thraustochytrium (or genus Thraustochytrium), the genus Aurantiochytrium (or genus Aurantiochytrium), the genus Thraustochytriidae (or genus Thraustochytriidae), the genus Hondaea (or genus Hondaea), the genus Japonochytrium (or genus Japonochytrium), the genus Monorhizochytrium (or genus Monorhizochytrium), and the genus Schizochytrium It may be at least one species of microalgae selected from the group consisting of genus Sicyoidochytrium sp. or genus Sicyoidochytrium, genus Ulkenia sp. or genus Ulkenia, genus Parietichytrium sp. or genus Parietichytrium, genus Botryochytrium sp. or genus Botryochytrium, and genus Labyrinthulochytrium sp. or genus Labyrinthulochytrium. In one specific example, the thraustochytrid microorganism may be, but is not limited to, genus Schizochytrium sp. or genus Schizochytrium.

[0072] The above "auxotrophic mutant microorganism" refers to a microorganism that has been modified to eliminate or reduce the ability to produce a specific substance required for growth and metabolism. A "tryptophan auxotrophic mutant microorganism" refers to a microorganism that has a weakened (eliminated or reduced) ability to synthesize tryptophan, and thus has the selectivity to grow in a tryptophan-deficient medium but can grow in a tryptophan-containing medium.

[0073] The above "weakening of tryptophan synthesis ability" may be a concept encompassing all cases in which the tryptophan synthesis ability is reduced or eliminated compared to the tryptophan synthesis ability (e.g., tryptophan production amount, yield, etc.) of the original microorganism (parent strain) before mutation. In the present specification, "weakening of tryptophan synthesis ability" may mean, but is not limited to, the elimination (lack) of tryptophan synthesis ability.

[0074] The weakening (elimination, absence) of the above tryptophan synthesis ability may mean, but is not limited to, inactivation (e.g., full or partial mutation (deletion, substitution, insertion, etc.)) of a gene encoding a protein involved in tryptophan synthesis (e.g., tryptophan synthetase) (hereinafter referred to as “gene involved in tryptophan synthesis” or “tryptophan synthesis gene”).

[0075] More specifically, the weakening may include cases where the activity of the tryptophan synthesis protein itself encoded by a mutation in the tryptophan synthesis gene is reduced or eliminated compared to the activity of the protein originally possessed by the microorganism, cases where the activity level and / or concentration (expression amount) of the tryptophan synthesis protein in the microorganism is lower than that of the original microorganism due to inhibition of expression or translation of the tryptophan synthesis gene, cases where the gene is not expressed at all, and / or cases where the protein has no activity even if the gene is expressed.

[0076] Attenuation of the activity of such polypeptides can be accomplished by any method known in the art, including but not limited to, and can be achieved by application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).

[0077] In one example, the weakening (elimination, absence) of the tryptophan synthesis ability may mean inactivation of a tryptophan synthesis gene encoding a protein involved in tryptophan synthesis inherent in the Thraustochytrid microorganism, and the protein involved in tryptophan synthesis may be a tryptophan synthesis enzyme, for example, tryptophan synthase β, and the tryptophan synthesis gene may be a gene encoding the tryptophan synthesis enzyme, for example, tryptophan synthase β (hereinafter, “tryptophan synthase beta gene”). The tryptophan synthase beta gene may be represented by a nucleic acid sequence of SEQ ID NO: 1, but is not limited thereto.

[0078] Additionally, inactivation of the tryptophan synthesis gene may be due to mutation of all or part of the gene, such as deletion, substitution, and / or insertion. Gene mutations such as deletion, substitution, and / or insertion may be performed by conventional methods.

[0079] For example, the genetic mutation can be performed by the CRISPR / Cas9 system. The CRISPR / Cas9 system includes the Cas9 protein (CRISPR associated protein 9), which is an RNA-guided endonuclease, or a gene encoding the same, and a guide RNA, and can perform a gene correction / editing function by cleaving a target sequence targeted by the guide RNA within the gene.

[0080] The above Cas9 protein is a Cas9 protein derived from a Streptococcus sp., e.g., Streptococcus pyogenes (e.g., SwissProt Accession number Q99ZW2 (NP_269215.1)), a Cas9 protein derived from a Campylobacter genus, e.g., Campylobacter jejuni. The Cas9 protein may be at least one selected from the group consisting of, but is not limited to, a Cas9 protein derived from the genus Streptococcus, such as Streptococcus thermophiles or Streptococcus aureus, a Cas9 protein derived from Neisseria meningitidis, a Cas9 protein derived from the genus Pasteurella, such as Pasteurella multocida, a Cas9 protein derived from the genus Francisella, such as Francisella novicida, etc. The Cas9 protein may be isolated from a microorganism or may be non-naturally occurring, produced recombinantly or synthetically. Additionally, the Cas9 protein may be wild-type or may have additional mutations added thereto for the desired function, which will be readily apparent to those skilled in the art to which this invention pertains. The endonuclease may additionally comprise elements commonly used for delivery into the nucleus of eukaryotic cells (e.g., a nuclear localization signal (NLS), etc.), but is not limited thereto.The sequence information of the above Cas9 protein or gene can be obtained from a known database such as GenBank of NCBI (National Center for Biotechnology Information).

[0081] The above guide RNA is an RNA molecule that includes a sequence (targeting sequence) complementary to a specific sequence (target sequence) of a gene (target gene) to be corrected / edited, and is a general term for a nucleic acid molecule that binds to the Cas9 protein and helps the Cas9 protein cleave the target site. The guide RNA includes crRNA and tracrRNA, and may be in a single-stranded or double-stranded form, and may be, for example, a single guide RNA (single guide RNA; sgRNA).

[0082] In this specification, the expression “targeting a gene” means that it is capable of specific binding (hybridization) with a specific sequence (target sequence) of a gene (target gene) to be corrected / edited, and “guide RNA targeting a gene” means a guide RNA that is capable of specific binding with a target gene, including a sequence complementary to a target site sequence within the target gene.

[0083] The specific sequence of the above guide RNA can be appropriately selected depending on the type (derived microorganism) of the Cas9 protein, and this is something that can be clearly known to a person of ordinary skill in the technical field to which this invention belongs.

[0084] For example, if the RNA-guided endonuclease is Cas9 (e.g., Cas9 from Streptococcus pyogenes), the single guide RNA (sgRNA) may have the following structure:

[0085] 5'-(targeting moiety)-(sgRNA scaffold)-3' (general formula 1)

[0086] In the above general formula 1,

[0087] The targeting moiety (also called a targeting sequence) is a site capable of binding (hybridizing) to a target site (including a PAM sequence unique to each Cas9 protein at the 3' end) in a target gene (e.g., Tryptophan synthase β gene), and is 15 to 30, 15 to 27, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 17 to 30, 17 to 27, 17 to 25, 17 to 23, 17 to 22, 17 to 21, 17 to 20, or 17 to 19. (e.g., 17, 18, 19, 20, 21, 22 or 23) nucleotides;

[0088] The sgRNA scaffold is a backbone structure excluding the targeting region in the sgRNA, for example, (GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU; SEQ ID NO: 12) or one having at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto, but is not limited thereto. The oligonucleotide may include 3 to 5, for example, 4 nucleotides (each independently selected from A, T, C, and G).

[0089] The targeting sequence of the above guide RNA may be expressed as a nucleic acid sequence having a sequence complementarity of 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% with a nucleic acid sequence of a strand complementary to a DNA strand (a strand where a PAM sequence is located) in which the target sequence is located among the double strands of the target gene, and the guide RNA may be capable of complementary binding (hybridization) with the nucleic acid sequence of the complementary strand at the target site.

[0090] Therefore, the targeting sequence of the guide RNA is

[0091] Has the same sequence as the target sequence (nucleic acid sequence of the strand where PAM is located) in the target gene, or

[0092] has an acceptable range of mismatches in the target sequence (e.g., 1 to 4, 1 to 3, 2, or 1 mismatch), or

[0093] It may have an identity of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, or about 95% or more with the target sequence (provided that T of the target sequence is converted to U).

[0094] The above PAM sequence is a site on the target gene that the Cas9 protein specifically recognizes, and varies depending on the type of Cas9 protein, and the PAM sequence according to the Cas9 protein is well known. For example, if the Cas9 protein is Cas9 derived from Streptococcus pyogenes (SpCas9), the PAM sequence can be expressed as “NGG” (N represents any nucleotide, and can be adenine, guanine, thymine, or cytosine). In this specification, the PAM sequence of SpCas9 is exemplified as a representative example, but is not limited thereto.

[0095] The above CRISPR / Cas9 system can be used in the following forms:

[0096] Ribonucleoprotein (RNP) containing Cas9 protein and guide RNA,

[0097] a mixture of Cas9 protein and guide RNA, or

[0098] A nucleic acid structure (vector) comprising a Cas9 protein coding gene and a guide RNA, either individually or together.

[0099]

[0100] The tryptophan auxotrophic mutant microorganism of the Thraustochytrid family provided herein can be usefully used as a host cell for producing a target substance without using (introducing) a foreign gene such as an antibiotic resistance gene, when used together with a nucleic acid structure for restoring tryptophan synthesis function described below.

[0101]

[0102] Nucleic acid construct for selecting transformants and / or restoring tryptophan synthesis function and use thereof

[0103] One example provides a nucleic acid construct for selecting a transformant whose host cell is a tryptophan auxotrophic mutant microorganism of the Thraustochytrid genus. Another example provides a nucleic acid construct for restoring the tryptophan synthesis function of a tryptophan auxotrophic mutant microorganism of the Thraustochytrid genus.

[0104] The nucleic acid structure may include a tryptophan synthase beta gene endogenous to the Thraustochytrid microorganism.

[0105] The nucleic acid construct may further comprise a promoter, terminator, or a combination thereof inherent in the Thraustochytrid microorganism. The promoter and / or terminator may be operably linked to the tryptophan synthase beta gene.

[0106]

[0107] The nucleic acid structure may not include a foreign gene (e.g., an antibiotic resistance gene, etc.) for a Thraustochytrid microorganism (a tryptophan auxotrophic mutant microorganism of a Thraustochytrid microorganism) which is a host cell of a transformant to be selected or a tryptophan auxotrophic mutant microorganism of a Thraustochytrid microorganism whose tryptophan synthesis function is to be restored.

[0108] The above-described endogenous promoter and / or terminator may be selected from among all promoters and / or terminators present in the genome of the microorganism of the Thraustochytrid family, for example, a microorganism of the genus Schizochytrium, and may be selected from among promoters and / or terminators of housekeeping genes, for example.

[0109] More specifically, the endogenous promoter may be selected without particular limitation from promoters endogenous to microorganisms of the Thraustochytrid family, for example, microorganisms of the genus Schizochytrium, and may be selected from the group consisting of, for example, a beta-tubulin promoter, an alpha-tubulin promoter, an actin promoter, etc. endogenous to the microorganism, but is not limited thereto.

[0110] The above-mentioned endogenous terminator can be selected without particular limitation from among terminators endogenous to microorganisms of the Thraustochytrid family, for example, microorganisms of the genus Schizochytrium, and may be selected from the group consisting of, for example, an HSP70 terminator, a CBLP (G-protein beta subunit-like polypeptide) terminator, an actin terminator, etc. endogenous to the microorganism, but is not limited thereto.

[0111]

[0112] Another example provides a method for producing a Thraustochytrid microorganism with restored tryptophan synthesis function, or a method for restoring the tryptophan synthesis function of a tryptophan auxotrophic mutant microorganism, comprising the step of introducing the nucleic acid structure into a tryptophan auxotrophic mutant microorganism of the Thraustochytrid microorganism.

[0113] Another example provides a use for producing a Thraustochytrid microorganism having restored tryptophan synthesis function of the nucleic acid structure or a use for restoring tryptophan synthesis function of the tryptophan auxotrophic mutant microorganism.

[0114] Another example provides a method for screening a transformant using a tryptophan auxotrophic mutant microorganism of the Thraustochytrid genus as a host cell, the method comprising a step of culturing the tryptophan auxotrophic mutant microorganism of the Thraustochytrid genus into which the nucleic acid structure has been introduced in a tryptophan-deficient medium. The method may further comprise a step of introducing the nucleic acid structure into the tryptophan auxotrophic mutant microorganism of the Thraustochytrid genus prior to the culturing step.

[0115] Another example provides a use for screening transformants having a tryptophan auxotrophic mutant microorganism of the Thraustochytrid genus as a host cell of the nucleic acid structure.

[0116]

[0117] The tryptophan nutrient requirement mutant microorganisms of the above-mentioned Thraustochytrid family of microorganisms are as described above.

[0118] The transformants to be selected and / or the microorganisms to be restored in function by the nucleic acid construct are all Thraustochytrid microorganisms, and the nucleic acid construct may be specifically configured to not contain a foreign gene for the Thraustochytrid microorganisms. In the present specification, the term “foreign gene” may refer to a gene derived from a heterologous microorganism or a heterologous strain, and more specifically, may refer to a gene derived from a microorganism other than a Thraustochytrid microorganism, for example, a microorganism of the genus Schizochytrium sp.

[0119] The nucleic acid structure includes a tryptophan synthase beta gene endogenous to a Thraustochytrid microorganism, or includes the gene together with an endogenous promoter and / or terminator in an operable form, and when the nucleic acid structure is used to transform a tryptophan auxotrophic mutant microorganism of a Thraustochytrid microorganism, the transformant successfully transformed has the tryptophan synthesis function inactivated by the tryptophan synthase beta gene included in the nucleic acid structure restored, and is thus capable of growing when cultured in a tryptophan-deficient medium, thereby enabling selection of the transformant without introduction of an exogenous antibiotic resistance gene and without antibiotic treatment of the medium.

[0120] Therefore, the nucleic acid construct can be used for selection of transformants and / or restoration of tryptophan synthesis function.

[0121] As used herein, a nucleic acid construct refers to a construct comprising a given nucleic acid molecule (e.g., a tryptophan synthase beta gene, a promoter, and / or a terminator, etc.). More specifically, the nucleic acid construct may be in the form of an expression cassette comprising a tryptophan synthase beta gene, or in which a tryptophan synthase beta gene and a promoter and / or a terminator are operably linked to enable self-replication, and may optionally be inserted into an appropriate vector and used in the form of an expression vector.

[0122] The nucleic acid construct may further include a gene (endogenous gene) derived from the host cell microorganism. More specifically, the nucleic acid construct may further include, in addition to the tryptophan synthase beta gene, promoter and / or terminator, elements necessary for self-expression and / or insertion into the genome of the microorganism (host cell), such as a ribosome binding site, a DNA fragment for homologous recombination (e.g., a site connected to the 3' end of the tryptophan synthase beta gene, a site connected to the 5' end, or both), and the elements additionally included in this case may be endogenous to the Thraustochytrid microorganism.

[0123] In one example, the nucleic acid construct may further comprise a target gene. The nucleic acid construct itself may be introduced into a microorganism (host cell) and used for the expression of the target gene, in addition to selecting transformants and / or restoring tryptophan synthesis function. In one specific example, if the nucleic acid construct comprises an endogenous terminator, the target gene may be linked to the 3' end of the terminator. If the nucleic acid construct comprises a target gene, it may further comprise an endogenous promoter and / or terminator operably linked to the target gene.

[0124] The above target gene may be a gene involved in the production of a predetermined target product, for example, a gene encoding a protein involved in the production of the target product. The target product may be selected from all biologically active substances that can be produced based on cells (microorganisms of the Thraustochytrid family). For example, the target substance may be at least one selected from the group consisting of proteins (e.g., antibodies, enzymes, hormones, various growth factors, various receptors, various ligands, etc.), peptides, metabolites (e.g., amino acids, lipids, fatty acids, sugars, etc.), small molecule compounds (e.g., antibiotics, cytotoxic substances, etc.), etc., but is not limited thereto. The target gene may encode the target product (when the target product is a protein or peptide) or encode a protein (enzyme) involved in the production (metabolism) of the target product.

[0125]

[0126] Production of recombinant vectors, recombinant microorganisms, and target products

[0127] Another example provides a recombinant vector comprising the nucleic acid construct and a target gene. The recombinant vector may be an expression vector for expressing the target gene in a tryptophan auxotrophic mutant microorganism belonging to the Thraustochytrid genus. In one specific embodiment, when the nucleic acid construct comprises an endogenous terminator, the target gene may be linked to the 3' end of the terminator. The recombinant vector may further comprise an endogenous promoter and / or terminator operably linked to the target gene.

[0128] Another example provides a recombinant microorganism comprising the nucleic acid structure or the recombinant vector. The recombinant microorganism may be a tryptophan auxotrophic mutant microorganism of the Thraustochytrid genus, into which the nucleic acid structure or the recombinant vector has been introduced. The recombinant microorganism may have a tryptophan synthesis function restored by the tryptophan synthase beta gene included in the nucleic acid structure. In addition, the recombinant microorganism is characterized in that it does not require an exogenous selection marker, such as an antibiotic resistance gene, to confirm whether the nucleic acid structure or the recombinant vector has been introduced, since the tryptophan synthesis function has been restored and the microorganism can grow in a tryptophan-deficient medium.

[0129] Another example provides a composition for producing a target product comprising at least one selected from the group consisting of the nucleic acid structure, the recombinant vector, and the recombinant microorganism.

[0130] Another example provides a method for producing a target product, the production of which is mediated by a target gene contained in the recombinant microorganism, comprising a step of culturing the recombinant microorganism. The culturing step may be performed in a medium that does not contain tryptophan. The method may further comprise, after the culturing step, a step of recovering, isolating, and / or purifying the target product.

[0131] Another example provides a use for producing at least one target product selected from the group consisting of the nucleic acid construct, the recombinant vector, and the recombinant microorganism. The target product may be a product in which the target gene contained in the recombinant vector and / or the recombinant microorganism is involved in production.

[0132]

[0133] The tryptophan nutrient requirement mutant microorganism and nucleic acid structure of the above-mentioned thraustochytrid microorganism are as described above.

[0134]

[0135] In the composition and / or manufacturing method for producing the above target product, the target product may be any biosynthetic substance encoded by the target gene included in the recombinant vector, or a protein encoded by the target gene involved in the production. In other words, the target gene included in the recombinant vector may encode a protein involved in the production of the target product.

[0136] In one example, the target product may be selected from all biologically active substances that can be produced based on cells (microorganisms of the Thraustochytrid family). For example, the target substance may be at least one selected from the group consisting of proteins (e.g., antibodies, enzymes, hormones, various growth factors, various receptors, various ligands, etc.), peptides, metabolites (e.g., amino acids, lipids, fatty acids, sugars, etc.), small molecule compounds (e.g., antibiotics, cytotoxic substances, etc.), etc., but is not limited thereto. The target gene may encode the target product (if the target product is a protein or peptide) or encode a protein (enzyme) involved in the production (metabolism) of the target product.

[0137]

[0138] As used herein, the term "operably linked" may mean that the promoter is functionally linked to the gene so that the promoter can perform transcriptional regulation of the gene. The operable linkage may be performed using genetic recombination techniques known in the art, including, but not limited to, conventional site-specific DNA cleavage and ligation.

[0139] In this specification, a recombinant vector may refer to a DNA construct that includes a nucleic acid structure including the tryptophan synthase beta gene and promoter described above and a target gene, and that can be replicated / expressed (transcribed) in a host cell. The vector may further include a promoter operably linked to the target gene. The vector is not particularly limited as long as it can be replicated / transcribed in a host cell, and may be selected from all commonly used vectors. In one example, the vector may exist in the form of a plasmid in a host cell, or may be in the form of a vector that can be inserted into the genome (chromosome) of the host cell, but is not limited thereto.

[0140] The vector may comprise a suitable regulatory sequence operably linked to the target gene so as to enable expression of the target gene in a suitable host cell. The regulatory sequence may comprise a promoter capable of initiating transcription of the target gene, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence (terminator) for regulating the termination of transcription and / or translation. After being transformed into a host cell, the vector may be expressed independently of the genome (chromosome) of the host cell, or may be integrated into the genome of the host cell.

[0141]

[0142] The method for introducing (transforming) the above nucleic acid structure and / or recombinant cell into a host cell can be performed by any method for introducing a nucleic acid into a cell (microorganism), and can be performed by appropriately selecting a transformation technique known in the art depending on the host cell. Examples of the above known transformation methods include, but are not limited to, electroporation, electeopulse, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) precipitation (polyethylene glycol-mediated uptake), DEAE-dextran, cationic liposome, lipofection, and lithium acetate-DMSO.

[0143] In the above method, the step of culturing the microorganism is not particularly limited thereto, but may be performed by a known batch culture method, continuous culture method, fed-batch culture method, etc. At this time, the culture conditions are not particularly limited thereto, but may be adjusted to an appropriate pH (e.g., pH 5 to 9, specifically pH 6 to 8, most specifically pH 7.2) using a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid, sulfuric acid, phosphate, sulfate, etc.), and an aerobic condition may be maintained by introducing oxygen or an oxygen-containing gas mixture into the culture. The culture temperature may be maintained at 20 to 45°C, or 25 to 40°C, and the culture may be performed for about 10 to 160 hours, but is not limited thereto. The L-isoleucine produced by the culture may be secreted into the medium or may remain within the cells.

[0144] The medium usable for the above culture may be selected from the group consisting of sugars and carbohydrates (e.g., glucose, sucrose, lactose, fructose, maltose, molasses, starch, and cellulose), oils and fats (e.g., soybean oil, sunflower seed oil, peanut oil, and coconut oil), fatty acids (e.g., palmitic acid, stearic acid, and linoleic acid), alcohols (e.g., glycerol and ethanol), and organic acids (e.g., acetic acid) as a carbon source, and may be used individually or in combination of two or more, but is not limited thereto. The medium may be selected from the group consisting of nitrogen-containing organic compounds (e.g., peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea), inorganic compounds (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate), and may be used individually or in combination of two or more, but is not limited thereto. As a phosphorus source, one or more selected from the group consisting of potassium phosphate, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and corresponding sodium-containing salts may be used individually or in combination of two or more, but is not limited thereto. In addition, the medium may include essential growth-promoting substances such as other metal salts (e.g., magnesium sulfate, iron sulfate, manganese sulfate, etc.), amino acids, and / or vitamins.

[0145] The step of recovering the target product may be to collect the target product from a medium, culture solution, or microorganism and / or medium using a suitable method known in the art, depending on the type of the target product and / or the culture method. For example, the step of recovering may be performed using one or more methods selected from centrifugation, filtration, anion exchange chromatography, crystallization, HPLC, etc. The method of recovering the target product may additionally include a purification step before, simultaneously with, or after the step.

[0146]

[0147] The present application provides a strain with a defective gene involved in tryptophan synthesis and an expression vector for restoring tryptophan synthesis function capable of expressing a gene involved in tryptophan synthesis, thereby enabling easy screening of transformants even in a general medium lacking tryptophan, without the need for foreign genes such as antibiotic resistance genes or antibiotic treatment. In other words, since strain development is possible without the introduction of foreign genes such as antibiotic resistance genes using only a combination of genes, promoters, and terminators inherent to Thraustochytrid strains, it is expected to contribute to the expansion and acceleration of strain development technology for Thraustochytrid microalgae in the future.

[0148]

[0149] Figure 1 is a photograph showing the degree of colony formation according to the concentration of 5-Fluoroorotic acid (5-FOA) of Schizochytrium sp. CD01-2147 strain.

[0150] Figure 2 is a photograph showing the degree of colony formation according to the concentration of 2-Fluoroadenine (2-FA) of the Schizochytrium sp. CD01-2147 strain.

[0151] Figure 3 is a photograph showing the degree of colony formation according to the concentration of 5-fluoroindole (5-FI) of the Schizochytrium sp. CD01-2147 strain.

[0152] Figure 4 schematically shows the intracellular tryptophan synthesis metabolic pathway.

[0153] Figure 5 is a photograph showing the degree of colony formation evaluated by counter-selection of the Schizochytrium sp. CD01-2147 strain lacking the tryptophan synthase β gene in media containing and excluding 5-FI and tryptophan.

[0154] Figure 6 shows the sequence analysis results of a tryptophan auxotrophic mutant strain of Schizochytrium sp. CD01-2147 strain.

[0155] Figure 7 schematically shows a 519 bp deletion site in the Tryptophan synthase β gene of a mutant strain (named ΔT1 strain) according to one embodiment.

[0156] Figure 8 shows the PCR results of the Tryptophan synthase β gene of a Schizochytrium sp. tryptophan auxotrophic transformant with restored tryptophan synthesis function.

[0157]

[0158] The present invention will be described in more detail below through examples. However, these are merely illustrative and are not intended to limit the scope of the present invention. It will be apparent to those skilled in the art that modifications to the examples described below may be made without departing from the essential spirit of the invention.

[0159]

[0160] Example 1. Evaluation of selection conditions for nutrient-requiring strains of the Thraustochytrids family of microorganisms.

[0161] Example 1-1: Selection of Uracil Auxotrophic Strains

[0162] In this example, the possibility of application as a markerless strain in the transformation of a uracil auxotrophic strain was evaluated by evaluating the resistance of a Thraustochytrid strain to 5-Fluoroorotic acid (5-FOA).

[0163] More specifically, 50 mL of sterilized GYPS medium (Glucose 20 g / L, Peptone 6 g / L, Yeast extract 2 g / L, Sea Salt 12.5 g / L, Sucrose 17.1 g / L) was added to a 250 mL flask, and the strain Schizochytrium sp. CD01-2147 (accession number KCTC14661BP; see KR 10-2023-0066972 A) belonging to the Thraustochytrids microalgae was inoculated and cultured for 48 h. 1 mL of the culture was centrifuged, and the supernatant was removed. The precipitated cells were lysed with 1X BSS aqueous solution (10 mM KCl, 10 mM NaCl, 3 mM CaCl2), and then centrifuged. After removing the supernatant again, the precipitated cells were dissolved in a 50 mM sucrose solution, and the centrifugation process was repeated three times. After removing the supernatant, the cell precipitate was dissolved again in 0.1 mL of a 50 mM sucrose solution to prepare a strain culture for testing.

[0164] The prepared strain culture solution was spread on GYPS solid medium (Glucose 20 g / L, Peptone 6 g / L, Yeast extract 2 g / L, Sea salt 12.5 g / L, Sucrose 17.1 g / L, Agar 15 g / L) containing 5-Fluoroorotic acid (5-FOA) at a concentration of 3 g / L, 4 g / L, or 5 g / L. After culturing the spread strain at 28°C for one week, the number of colonies formed was counted to evaluate the 5-FOA resistance of the strain.

[0165] The results obtained above are shown in Fig. 1. As shown in Fig. 1, the Schizochytrium sp. CD01-2147 strain had a very high resistance to 5-FOA, and the strain was killed at a high concentration of 5 g / L or higher of 5-FOA. This means that 5-FOA is required at a high concentration of 5 g / L or higher for the selection of uracil auxotrophic strains of the Schizochytrium sp. CD01-2147 strain. In general, yeasts that use 5-FOA as a selection pressure mostly die in the range of 1-2 g / L, whereas the Schizochytrium sp. CD01-2147 strain requires a considerably high concentration of 5-FOA for the selection of uracil auxotrophic transgenic strains. Considering the characteristics of Thraustochytrid strains, which have significantly lower transformation efficiency compared to yeast, and the need for large amounts of expensive 5-FOA for transformation of uracil auxotrophic strains and screening of mutant strains, it can be concluded that uracil auxotrophic strains are difficult to apply to markerless strain development.

[0166]

[0167] Example 1-2: Selection of Adenine-Auxotrophic Strains

[0168] In this example, the possibility of application as a markerless strain in the transformation of an adenine auxotrophic strain was evaluated by evaluating the resistance of a Thraustochytrid strain to 2-Fluoroadenine (2-FA).

[0169] More specifically, a culture medium of Schizochytrium sp. CD01-2147 (accession number KCTC14661BP) was prepared in the same manner as in Example 1, and spread on GYPS solid medium (Glucose 20 g / L, Peptone 6 g / L, Yeast extract 2 g / L, Sea salt 12.5 g / L, Sucrose 17.1 g / L, Agar 15 g / L) containing 1 g / L, 2 g / L, 3 g / L, and 4 g / L of 2-Fluoroadenine (2-FA). After culturing the spread strain at 28°C for one week, the number of colonies formed was counted to evaluate the 2-FA resistance of the strain.

[0170] The results obtained above are shown in Fig. 2. As shown in Fig. 2, the 2-FA resistance of the Schizochytrium sp. CD01-2147 strain was very high, and many colonies were observed to survive even at high concentrations of 2-FA exceeding 4 g / L. This indicates that a very high concentration of 2-FA is required for the selection of adenine auxotrophic strains of the Schizochytrium sp. CD01-2147 strain. Considering the price and amount of reagent consumed, it can be concluded that adenine auxotrophic strains are difficult to apply to the development of markerless strains.

[0171]

[0172] Example 1-3: Selection of a tryptophan auxotrophic strain

[0173] In this example, the possibility of application as a markerless strain in the transformation of a tryptophan auxotrophic strain was evaluated by evaluating the resistance of the Thraustochytrid strain to 5-fluoroindole (5-FI).

[0174] More specifically, a culture medium of Schizochytrium sp. CD01-2147 (accession number KCTC14661BP) was prepared in the same manner as in Example 1, and spread on GYPS solid medium (Glucose 20 g / L, Peptone 6 g / L, Yeast extract 2 g / L, Sea salt 12.5 g / L, Sucrose 17.1 g / L, Agar 15 g / L) containing 5 mg / L, 25 mg / L, 30 mg / L, and 40 mg / L of 5-fluoroindole (5-FI). After culturing the spread strain at 28°C for one week, the number of colonies formed was counted to evaluate the 5-FI resistance of the strain.

[0175] The results obtained above are shown in Fig. 3. As shown in Fig. 3, the Schizochytrium sp. CD01-2147 strain showed that all cells died even when the 5-FI concentration was as low as 30 mg / L. These results show that the resistance to 5-FI is very low compared to the resistance to 5-FOA or 2-FA evaluated in the previous Examples 1-1 and 1-2.

[0176] Based on the results of Examples 1-1 to 1-3 above, a tryptophan auxotrophic strain was selected as a markerless strain, and a tryptophan auxotrophic strain capable of surviving in a medium containing 5-FI was produced and used in the following examples.

[0177]

[0178] Example 2. Production of Thraustochytrids strains lacking genes involved in tryptophan synthesis.

[0179] To create a tryptophan auxotrophic Thraustochytrid strain, genes involved in the tryptophan synthesis pathway were searched. The generally known tryptophan synthesis pathway is shown in Figure 4. In a normal medium without 5-fluoroindole (5-FI), indole is normally biosynthesized into tryptophan by tryptophan synthase β. However, tryptophan synthase β can also use 5-FI, a substance similar to indole, as a substrate. Therefore, in an environment where 5-FI is present, 5-fluorotryptophan, a substance that induces cell death, is biosynthesized, and as a result, cells cannot survive.

[0180] Through the above Examples 1-3, it was confirmed that the Schizochytrium sp. CD01-2147 strain has very low resistance to 5-FI. Therefore, in order to screen for a tryptophan auxotrophic strain using 5-FI, it is necessary to delete the tryptophan synthase β gene. If other genes involved in tryptophan synthesis (e.g., tryptophan synthase α, etc.) are deleted, problems may occur in the early stages of indole biosynthesis, allowing the creation of a tryptophan auxotrophic strain. However, since the tryptophan synthase β gene is still expressed and can function normally, it cannot survive in the presence of 5-FI. In addition, since intermediate metabolites are involved in various other reactions in organisms as you go to the earlier stages of the biosynthesis, if a gene is deleted or not expressed normally, there is a high possibility that problems will occur in functions other than tryptophan synthesis. Accordingly, in Schizochytrium sp. The Tryptophan synthase β gene was identified through BLAST in the genome of the CD01-2147 strain (SEQ ID NO: 1) and selected as the target gene for the construction of a tryptophan auxotrophic strain:

[0181]

[0182] To delete the Tryptophan synthase β gene based on the CRISPR / Cas9 system, sgRNA was synthesized by specifying the sgRNA target site in SEQ ID NO: 1 (underlined, PAM sequence is bold + underlined; SEQ ID NO: 2) and stored at -70°C.

[0183] The above Cas9 protein was a Cas9 protein derived from Streptococcus pyogenes (spCas9; EnGen® Spy Cas9 NLS (Cas9 gene from Streptococcus pyogenes with nuclear localization signals (NLS) (https: / www.neb.com / en / products / m0646-engen-spy-cas9-nls); NEB), and the sgRNA was designed to target the above sequence number 2 with a structure for use with spCas9.

[0184] Schizochytrium sp. CD01-2147 strain was inoculated into GYPS medium, cultured for 48 hours, centrifuged for 1 minute to remove the supernatant, and the cell pellet was washed with 1X BSS solution (10 mM KCl, 10 mM NaCl, 3 mM CaCl2) and centrifuged again to remove the supernatant. The cell pellet was washed three times with 50 mM sucrose solution, and 0.1 mL of 50 mM sucrose solution was added to the final cell pellet to prepare a cell suspension. The pre-synthesized sgRNA was thawed, mixed with Cas9 protein (spCas9; EnGen® Spy Cas9 NLS; NEB), and left at room temperature for 10 minutes. After that, it was added to the prepared cell suspension and transformation was performed by electroporation. The transformed strain was plated on GYPS solid medium containing 30 mg / L of 5-FI and 0.1 mg / L of tryptophan, and surviving colonies were selected. The same test was performed on general GYPS solid medium (excluding 5-FI and tryptophan) to evaluate the tryptophan auxotrophy of the transformed strain.

[0185] The results obtained above are shown in Fig. 5. As shown in Fig. 5, the counter-selection results showed that a tryptophan auxotrophic strain was obtained that could grow in GYPS medium containing 5-FI and tryptophan, but could not grow in the existing GYPS medium without tryptophan supplementation.

[0186] The results of analyzing the sequences of some strains among the tryptophan auxotrophic strains obtained as described above are shown in Fig. 6. As shown in Fig. 6, various types of sequence mutations were confirmed at the sgRNA target site (SEQ ID NO: 2), and in the case of some strains (named ΔT1 strain), it was confirmed that a 519 bp deletion occurred after the middle of the target site (SEQ ID NO: 2) in the Tryptophan synthase β gene (SEQ ID NO: 1) (see Fig. 7).

[0187]

[0188] Example 3. Production of a vector to restore tryptophan synthesis function in a strain lacking tryptophan synthase β.

[0189] To restore tryptophan synthesis function, a vector containing a tryptophan synthase β gene expression cassette for insertion into the Schizochytrium sp. ΔT1 strain was constructed. Since the purpose of the present invention is to restore the trait without introducing a foreign gene using only a combination of endogenous genes, promoters, and terminators inherent to Thraustochytrid strains, the tryptophan synthase β gene (SEQ ID NO: 1), the beta-tubulin promoter, and the HSP70 terminator were cloned from the genomic DNA of the Schizochytrium sp. CD01-2147 strain through a PCR reaction.

[0190] Each of the cloned Tryptophan synthase β genes (SEQ ID NO: 1), beta-tubulin promoter, and HSP70 terminator were inserted into the pUC19 vector (Addgene) using the Gibson assembly method to create a vector for restoring the tryptophan synthesis function.

[0191] The primers used for cloning of the above beta-tubulin promoter and HSP70 terminator by PCR are as follows:

[0192] (1) Primers for cloning the endogenous beta-tubulin promoter of Schizochytrium sp. CD01-2147 strain

[0193] Forward (5'-3') primer: GACCTGCAGCTGTCA (SEQ ID NO: 3)

[0194] Reverse (5'-3') primer: GATTAATTAAAGTTTGTTAACTTGTTTGC (SEQ ID NO: 4)

[0195] (2) Primers for cloning the endogenous HSP70 terminator of Schizochytrium sp. CD01-2147 strain

[0196] Forward (5'-3') primer: GTGGTTGATAGTTAAATTTTATG (SEQ ID NO: 5)

[0197] Reverse (5'-3') primer: CTCTTCTATATTTGTAAAATTTGC (SEQ ID NO: 6)

[0198]

[0199] Example 4. Production of a strain with restored tryptophan synthesis function

[0200] In order to restore the tryptophan synthesis function, the beta-tubulin promoter, the coding sequence of Tryptophan synthase β, and the HSP70 terminator portion were amplified by PCR from the vector prepared in Example 3 to prepare a PCR product (Forward (5'-3') primer: GACCTGCAGCTGTCA (SEQ ID NO: 7); Reverse (5'-3') primer: CTCTTCTATATTTGTAAAATTTGC (SEQ ID NO: 8)).

[0201] Schizochytrium sp. ΔT1 strain (Example 2) with tryptophan auxotrophy was inoculated onto GYPS medium, cultured for 48 hours, centrifuged for 1 minute to remove the supernatant, and the cell pellet was washed with 1X BSS solution (10 mM KCl, 10 mM NaCl, 3 mM CaCl2) and centrifuged again to remove the supernatant. The cell pellet was washed three times with 50 mM sucrose solution, and 0.1 mL of 50 mM sucrose solution was added to the final cell pellet to dissolve it, thereby preparing a cell suspension.

[0202] 1-2 μg of the prepared PCR product was added to the prepared cell suspension and transformed by electroporation. After electroporation, the cell suspension was spread on GYPS solid medium without tryptophan and cultured at 28°C for 5 days. The grown colonies (indicated as “ΔT_Complementation”) were subcultured and PCR of the coding sequence of the Tryptophan synthase β gene was performed together with the Schizochytrium sp. CD01-2147 strain and the Schizochytrium sp. ΔT1 strain (Forward (5'-3') primer: ATGAGCAAGCCTGTTAGG (SEQ ID NO: 9); Reverse (5'-3') primer: TTAGAGGGACTTCACATAGGC (SEQ ID NO: 10)).

[0203] The PCR results are shown in Fig. 9. As shown in Fig. 9, when the Schizochytrium sp. CD01-2147 strain is subjected to PCR for the coding sequence portion of the Tryptophan synthase β gene, a single band is observed at approximately 1.5 kb, whereas in the case of the ΔT1 strain, which has a deletion of 519 bp of the Tryptophan synthase β gene, a single band is observed at approximately 1.0 kb.

[0204] Meanwhile, in the case of colonies grown in a general medium without tryptophan (indicated as “ΔT_Complementation”), it can be confirmed that bands appear at both locations. Since Thraustochytrid strains are diploid, the same gene exists in two copies within the cell. Therefore, it can be confirmed that the ΔT_Complementation colonies are heterozygous, having one copy of the defective gene and one copy of the restored normal gene, as one of the two copies was restored by homologous recombination.

[0205] That is, it was confirmed that the traits of a tryptophan auxotrophic Thraustochytrid strain can be restored to their original state without introducing a foreign gene using the vector composition presented in the present application.

[0206]

[0207] Example 5. Application of Tryptophan synthase β for introduction of target gene

[0208] Tryptophan synthase β was used as an application example for introducing a target gene. To produce a target gene insertion vector, a nucleic acid construct for target gene expression was introduced at a position 3' after the HSP70 terminator sequence of the vector shown in Example 3. The nucleic acid construct was introduced into the vector by linking it to a promoter and terminator endogenous to a Thraustochytrid microorganism so that the target gene could be operated, in order to express other target genes other than the tryptophan synthase beta gene.

[0209] For example, to enhance acetyl-CoA carboxylase expression, the acetyl-CoA carboxylase gene (SEQ ID NO: 11) endogenous to a thraustochytrid microorganism was made operable by linking it to a promoter (beta-tubulin promoter or alpha-tubulin promoter or actin promoter) and terminator (HSP70 terminator, CBLP terminator) endogenous to a thraustochytrid microorganism using the method of Example 3, and then introduced into a vector to restore the tryptophan synthesis function.

[0210] After PCR was performed to secure a nucleic acid construct that included both a nucleic acid construct capable of expressing the tryptophan synthase beta gene and a nucleic acid construct capable of expressing the target gene, the nucleic acid construct was transformed into a tryptophan auxotrophic strain using the method of Example 4. Since growth is possible in a medium not supplied with tryptophan only when the nucleic acid construct is normally introduced, a transformant can be secured by spreading it on a medium not supplied with tryptophan.

[0211]

[0212] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

Claims

1. A tryptophan auxotrophic mutant microorganism of the Thraustochytrid family with an inactivated tryptophan synthase β gene.

2. A tryptophan auxotrophic mutant microorganism in the first paragraph, wherein the tryptophan synthase β gene is represented by the nucleic acid sequence of sequence number 1.

3. A tryptophan auxotrophic mutant microorganism in the first paragraph, wherein the inactivation of the tryptophan synthase β gene is due to a genetic mutation including deletion, substitution, insertion, or a combination of one or more of the nucleotides in the tryptophan synthase β gene.

4. A tryptophan auxotrophic mutant microorganism in the third paragraph, wherein the genetic mutation is induced by a Cas9 protein and a guide RNA targeting the tryptophan synthase beta gene.

5. A tryptophan auxotrophic mutant microorganism according to any one of claims 1 to 4, wherein the thraustochytrid microorganism is a microorganism of the genus Schizochytrium sp.

6. A nucleic acid structure for selecting a transformant using a tryptophan nutrient-requiring mutant microorganism of the Thraustochytrid family as a host cell, The nucleic acid structure comprises a tryptophan synthase beta gene, The above-mentioned Thraustochytrid microorganism with a tryptophan nutrient requirement mutant microorganism is a Thraustochytrid microorganism with an inactivated tryptophan synthase β gene. Nucleic acid structure for screening transformants.

7. A nucleic acid structure for selecting a transformant, wherein the tryptophan synthase β gene in paragraph 6 is expressed by a nucleic acid sequence of sequence number 1.

8. A nucleic acid structure for selecting transformants, further comprising a promoter, terminator, or both endogenous to a Thraustochytrid microorganism in paragraph 6.

9. A nucleic acid structure for selecting transformants, wherein the thraustochytrid microorganism in paragraph 6 is a microorganism of the genus Schizochytrium sp.

10. A nucleic acid structure for selecting a transformant according to any one of claims 6 to 9, wherein the nucleic acid structure further comprises a gene derived from the host cell microorganism.

11. A nucleic acid structure comprising a tryptophan synthase beta gene, and target gene including, A recombinant vector for expression of the above target gene in a tryptophan auxotrophic mutant microorganism of the Thraustochytrid family in which the tryptophan synthase β gene is inactivated.

12. A recombinant vector according to claim 11, wherein the tryptophan synthase β gene is represented by the nucleic acid sequence of sequence number 1.

13. A recombinant vector according to claim 11, wherein the nucleic acid structure further comprises a promoter, terminator, or both endogenous to a Thraustochytrid microorganism.

14. A recombinant vector according to claim 11, wherein the thraustochytrid microorganism is a Schizochytrium sp. microorganism.

15. A recombinant vector according to any one of claims 11 to 14, wherein the nucleic acid structure further comprises a gene derived from the thraustochytrid microorganism.

16. A recombinant microorganism, wherein a tryptophan auxotrophic mutant microorganism of the Thraustochytrid family in which the tryptophan synthase β gene is inactivated, is introduced with a nucleic acid structure according to any one of claims 6 to 9.

17. A recombinant microorganism in claim 16, wherein the thraustochytrid microorganism is a microorganism of the genus Schizochytrium sp.

18. In claim 16, the recombinant microorganism has a restored tryptophan synthesis function.

19. A recombinant microorganism in claim 16, wherein the recombinant microorganism does not require a foreign antibiotic resistance gene to confirm whether the recombinant vector has been introduced.

20. A recombinant vector according to any one of clauses 11 to 14, A recombinant microorganism in which the recombinant vector is introduced into a tryptophan auxotrophic microorganism of the Thraustochytrid family in which the tryptophan synthase β gene is inactivated, or All of these As a composition for producing a target product including: A composition for producing a target product, wherein the target gene included in the above recombinant vector is involved in the production of the target product.

21. A composition for producing a target product, wherein the thraustochytrid microorganism in paragraph 20 is a microorganism of the genus Schizochytrium sp.

22. A method for producing a target product in which a target gene included in the recombinant microorganism is involved in production, comprising a step of culturing the recombinant microorganism of Article 16.

23. A method for producing a target product in claim 22, wherein the culturing step is performed in a medium that does not contain tryptophan.

24. A nucleic acid structure for restoring the tryptophan synthesis function of a microorganism that requires tryptophan as a nutritional requirement for a microorganism of the Thraustochytrid family. Contains the tryptophan synthase β gene, The above-mentioned Thraustochytrid microorganism with a tryptophan nutrient requirement mutant is a Thraustochytrid microorganism with an inactivated tryptophan synthase beta gene. Nucleic acid structure for restoring tryptophan synthesis function.

25. A nucleic acid structure for restoring tryptophan synthesis function, wherein the tryptophan synthase β gene is expressed by the nucleic acid sequence of sequence number 1.

26. A nucleic acid structure for restoring tryptophan synthesis function, further comprising a promoter, terminator, or both endogenous to a thraustochytrid microorganism in paragraph 24.

27. A nucleic acid structure for restoring tryptophan synthesis function, wherein the thraustochytrid microorganism is a microorganism of the genus Schizochytrium sp. in the 24th paragraph.

28. A method for producing a Thraustochytrid microorganism with restored tryptophan synthesis function, comprising the step of introducing a nucleic acid structure of any one of claims 24 to 27 or a recombinant vector containing the same into a tryptophan auxotrophic microorganism of a Thraustochytrid microorganism in which the tryptophan synthase β gene is inactivated.

29. A manufacturing method according to claim 28, wherein the thraustochytrid microorganism is a Schizochytrium sp. microorganism.

Citation Information

Patent Citations

  • Selective Marker of Transformant Using Mutant Gene Encoding Ribosomal Proteinof Microalgae Thraustochytrid

    KR1020130123247A

  • Bose and liner assembly apparatus of hydrogen tank

    KR1020250076044A