Genetically edited maize
Genetic modification of the ZmAN3 gene in maize with expression enhancers addresses the need for larger leaf size and heavier kernels, improving photosynthesis and yield.
Patent Information
- Application Number
- PCT/US2025/033985
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-03-06
- Filing Date
- 2025-06-17
- Publication Date
- 2025-12-26
AI Technical Summary
Existing maize plants lack enhanced leaf size and kernel weight traits, which are crucial for improved canopy photosynthesis, planting density, and grain yield.
Genetically modify the ZmAN3 gene in maize plants by introducing a heterologous expression enhancing element, such as a transcription enhancer, intron, or translational enhancer, to increase the expression of the ZmAN3 gene, resulting in larger leaf size and heavier kernel weight.
The modified ZmAN3 gene leads to significant increases in leaf length, width, area, and fraction dry weight, as well as 1000 kernel weight, enhancing photosynthetic capacity and grain yield.
Smart Images

Figure US2025033985_26122025_PF_FP_ABST
Abstract
Description
TITLE: GENETICALLY EDITED MAIZECROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority under 35 U.S.C. § 119 to provisional patent applications U.S. Serial No. 63 / 661,150, filed June 18, 2024, and U.S. Serial No. 63 / 767,771, filed March 6, 2025. The provisional patent applications are herein incorporated by reference in their entirety, including without limitation, the specification, claims, and abstract, as well as any figures, tables, appendices, or drawings thereof.INCORPORATION OF SEQUENCE LISTING
[0002] The sequence listing contained in the file named ■‘P14737WOOO_SequenceListing.XML’’ which is 64,538 bytes (measured in MS-Windows®), comprises 56 biological sequences, and was created on June 10, 2025, is electronically filed herewith and is incorporated herein by reference in its entirety'.BACKGROUND
[0003] Leaves are a significant component of the shoot system in maize, functioning in light capture and photosynthesis. In maize, canopy photosynthesis, planting density, and grain yield are strongly impacted by leaf architecture, including leaf width, leaf length, leaf area, leaf fraction fresh weight, leaf fraction dry weight, stem fraction dry weight, and / or 1000 kernel weight. Thus, increased leaf size is a useful commercial trait and there is a need in the art for maize plants having increased leaf width, leaf length, leaf area, leaf fraction fresh weight, leaf fraction dry weight, stem fraction dry' weight, and / or 1000 kernel weight.SUMMARY
[0004] Maize plants comprising a modified ZmAN3 gene wherein a heterologous expression enhancing element is located in the modified gene, and wherein the unmodified ZmAN3 gene comprises the DNA molecule of SEQ ID NO: 1 or an allelic variant thereof are provided. Maize plant parts comprising the modified ZmAN3 gene are also provided.
[0005] Methods of producing maize seed, comprising growing any of the aforementioned maize plants and harvesting seed therefrom are provided. Methods of producing hybrid maize seed comprising crossing an aforementioned maize plant which is homozygous for themodified ZmAN3 gene to a maize plant homozygous for the unmodified ZmAN3 gene and harvesting seed from a pollen recipient of the cross, optionally wherein the maize plant homozygous for the modified ZmAN3 gene is the pollen donor are provided. Methods of producing hybrid maize seed comprising crossing an aforementioned maize plant which is homozygous for the modified ZmAN3 gene to a maize plant homozy gous for the unmodified ZmAN3 gene and harvesting seed from a pollen recipient of the cross, optionally wherein the maize plant homozygous for the modified ZmAN3 gene is the pollen recipient are provided. Methods of producing hybrid maize seed comprising crossing an aforementioned maize plant which is homozy gous for the modified ZmAN3 gene to another maize plant homozygous for the modified ZmAN3 gene and harvesting seed from a pollen recipient of the cross are provided. Methods of producing inbred maize seed comprising selfing a maize plant homozygous for the modified ZmAN3 gene are also provided.
[0006] Methods of producing a commodity maize plant product, said method comprising: (i) processing any of the aforementioned maize plants or a maize seed obtained therefrom; and (ii) recovering the commodity maize plant product from the processed maize plant or maize seed are provided.
[0007] Methods of producing a maize plant comprising an added desired trait, said method comprising introducing a transgene, a targeted genetic change, and / or a genetic locus conferring the desired trait into any of the aforementioned maize plants are provided.
[0008] Biological samples comprising a detectable amount of a DNA molecule comprising a heterologous transcription enhancer, a heterologous intron, and / or heterologous translational enhancing element located in a DNA fragment of a modified ZmAN3 gene are provided.
[0009] Methods of making an aforementioned maize plant, comprising: (a) contacting a maize plant genome with gene editing molecules comprising a first site-specific nuclease which introduces a double stranded DNA break in a promoter region, a 5’ UTR. a coding region, a 3’ UTR, or a 3’ flanking region in an unmodified ZmAN3 gene comprising the DNA molecule of SEQ ID NO: 1 or an allelic variant thereof and a donor DNA template or other DNA template comprising a heterologous expression enhancing element; and (b) selecting a maize plant comprising a modified ZmAN3 gene, wherein the modified ZmAN3 gene comprises an insertion of the heterologous expression enhancing element in the promoter region, the 5’ UTR, the coding region, the 3’ UTR, or the 3’ flanking region of the gene, wherein expression of the modified ZmAN3 gene is increased in at least one tissue, and wherein leaf length, leaf width,leaf area, leaf fraction fresh weight, leaf fraction dry weight, stem fraction dry weight, and / or 1000 kernel weight of the maize plant comprising the modified ZmAN3 gene is increased in comparison to a control maize plant lacking the modified ZmAN3 gene are provided.BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIG. 1A, B, C, and D show the Zm00001d033905 wild-type (WT) Sequence from 500bp upstream of the gene's 5’ untranslated region (5’ UTR) up to and including the entire coding of the gene (SEQ ID NO: 3). The ZmAN3 gene (SEQ ID NO: 1) is denoted with a directional arrow under the sequence labeled ZmAN3 with the SEQ ID NO. A guide RNA (SEQ ID NO: 5) is denoted with a directional arrow under the sequence labeled with the SEQ ID NO. The enhancer insertion site is denoted with a triangle.
[0011] FIG. 2A, B, C, and D show a mutated Zm00001d033905 sequence from 500bp upstream of the gene’s 5’ untranslated region (5’ UTR) up to and including the entire coding region of the gene (SEQ ID NO: 4). The ZmAN3 gene (SEQ ID NO: 1) is denoted with a directional arrow under the sequence labeled ZmAN3 with the SEQ ID NO. The enhancer insertion (SEQ ID NO: 6) is denoted with a black line under the sequence. Deletions are denoted with a triangle and the number of bases deleted.
[0012] FIG. 3 Illustrates expression of the ZmAN3 gene transcript levels (i.e., "Exp. Fold increase of ZmAN3”) in maize plant lines heterozygous for the enhancer insertion in SEQ ID NO: 7 compared to the control (null) plant lines which lack the enhancer insertion in the ZmAN3 gene. The expression data shows an approximately 3-fold increase of the ZmAN3 transcript encoded by SEQ ID NO: 1.
[0013] FIG. 4A and B illustrates leaf length and width in ZmAN3 heterozygous seedlings (i.e., seedlings heterozygous for an enhancer insertion in ZmAN3 labelled “Het”) and ZmAN3 null seedlings (i.e., seedlings lacking an enhancer insertion in ZmAN3 labelled “Null”). The 4thleaf length when counting from the base of the plant was measured daily 12-17 days after sowing. A significant difference between ZmAN3 heterozygous seeding leaf length relative to the null control (p-value < 0.05) is shown. Leaf width of the 4thleaf was measured on the 17thday. A significant difference between ZmAN3 heterozygous seedling leaf width containing the enhancer insertion relative to the null controls lacking the enhancer insertion (p-value < 0.05) is shown.
[0014] FIG. 5 A and B illustrates the average leaf area in ZmAN3 plants calculated by sampling the second leaf below the top ear and the nineth unfolded leaf from the top and measuring the leaf area of each individual leaf. FIG 5A illustrates average leaf area in ZnAN3 enhancer insertion homozygous inbred plants (z.e., plants homozygous for an enhancer insertion in ZmAN3 labeled “Homozygous'’) compared with null inbred plants (i.e., plants lacking an enhancer insertion in ZmAN3 labelled “Null”). FIG 5B illustrates leaf area in ZmAN3 enhancer insertion heterozygous hybrid plants (i.e.. plants heterozygous for an enhancer insertion in ZmAN3 labeled “Heterozygous”) and their null control plants (i.e., plants lacking an enhancer insertion in ZmAN3 labelled “Null”). There is a significant increase (+7%) in leaf area in ZmAN3 enhancer insertion homozygous inbred plants compared to their null control. There is no significant difference in the leaf area between ZnAN3 enhancer insertion heterozygous hybrid plants and their null control lacking an enhancer insertion.
[0015] FIG 6A, B, and C illustrates total weight (mg) per plant split into three fractions: cob, stem, and leaves before and after drying. FIG 6A illustrates total fresh weight (weighed before drying) of ZmAN3 enhancer insertion homozygous inbred plants (i.e., plants homozygous for an enhancer insertion in ZmAN3 labeled "Homozygous”) compared with ZmAN3 enhancer insertion null inbred plants (i.e., plants lacking an enhancer insertion in ZmAN3 labelled “Null”). FIG 6B illustrates the total dty weight (weighed after drying) of ZmAN3 enhancer insertion homozy gous inbred plants compared with ZmAN3 enhancer insertion null inbred plants. FIG 6C illustrates the percent dry matter (dry weight divided by fresh weight) of ZmAN3 enhancer insertion homozygous inbred plants compared with ZmAN3 enhancer insertion null inbred plants. There is a significant increase in leaf fraction fresh weight (+22.5%), leaf fraction dry' weight (+16.7%), and stem fraction dry weight (+9%) in ZmAN3 enhancer insertion homozygous inbred plants compared to their enhancer insertion null control plants.
[0016] FIG 7A, B, and C illustrates total weight (mg) per plant split into three fractions: cobs, stem, and leaves before and after dry ing. FIG 7 A illustrates total fresh weight (weighed before drying) of ZmAN3 enhancer insertion heterozy gous hybrid plants (i.e., plants heterozygous for an enhancer insertion in ZmAN3 labeled “Heterozygous”) compared with ZmAN3 enhancer insertion null hybrid plants (i.e., plants lacking an enhancer insertion in ZmAN3 labelled “Null”). FIG 7B illustrates the total dry weight (weighed after drying) of heterozygous hybrid plants compared with null hy brid plants. FIG 6C illustrates the percentage dry' matter (dryweight divided by fresh weight) of ZmAN3 enhancer insertion heterozygous hybrid plants compared with ZmAN3 enhancer insertion null hybrid plants. There is no significant change in fresh weight, dry weight, or percentage dry matter in ZmAN3 heterozygous hybrid plants compared to their null control plants.
[0017] FIG 8A and B illustrates the yield per plot (kg / ha) in ZmAN3 enhancer insertion plants. FIG 8A illustrates the yield per plot of ZmAN3 enhancer insertion homozygous inbred plants (i.e., plants homozygous for an enhancer insertion in ZmAN3 labeled "Homozygous”) compared with ZmAN3 enhancer insertion null inbred plants (i.e.. plants lacking an enhancer insertion in ZmAN3 labelled “Null”). FIG 8B illustrates the yield per plot of ZmAN3 enhancer insertion heterozygous hybrid plants (i.e., plants heterozygous for an enhancer insertion in ZmAN3 labeled “Heterozygous”) compared with ZmAN3 enhancer insertion null hybrid plants (i.e., plants lacking an enhancer insertion in ZmAN3 labelled “Null”). There is no significant difference in the yield per plot between ZmAN3 enhancer insertion homozygous inbreds or ZmAN3 enhancer insertion heterozygous hybrids and their respective null control lines lacking the enhancer insertion.
[0018] FIG 9A and B illustrates the 1000 kernel weight (g) of ZmAN3 enhancer insertion plants. FIG 9A illustrates 1000 kernel weight (g) of ZmAN3 enhancer insertion homozygous inbred plants (i.e., plants homozygous for an enhancer insertion in ZmAN3 labeled “Homozygous”) compared with ZmAN3 enhancer insertion null inbred plants (i.e., plants lacking an enhancer insertion in ZmAN3 labelled “Null”). FIG 9B illustrates 1000 kernel weight (g) of ZmAN3 enhancer insertion heterozygous hybrid plants (i.e., plants heterozygous for an enhancer insertion in ZmAN3 labeled “Heterozygous”) compared with ZmAN3 enhancer insertion null hybrid plants (i.e., plants lacking an enhancer insertion in ZmAN3 labelled "Null”). There is a significant increase (+16%) in 1000 kernel weight in ZmAN3 enhancer insertion homozygous inbreds compared with their null control line. There is no significant difference in 1000 kernel weight between ZmAN3 enhancer insertion heterozygous hybrids and their null control line lacking an enhancer insertion.
[0019] FIG 10A and B illustrates ear properties of ZmAN3 enhancer insertion dried cobs. FIG 10A illustrates the number of round kernels and long kernels of ZmAN3 enhancer insertion homozygous inbred plants (i.e., plants homozygous for an enhancer insertion in ZmAN3 labeled “Homozygous”) compared with ZmAN3 enhancer insertion null inbred plants (i.e., plants lacking an enhancer insertion in ZmAN3 labelled “Null”). FIG 10B illustrates thenumber of round kernels and long kernels of ZmAN3 enhancer insertion heterozy gous hybrid plants (i.e., plants heterozygous for an enhancer insertion in ZmAN3 labeled ’ Heterozygous") compared with ZmAN3 null hybrid plants (i.e., plants lacking an enhancer insertion in ZmAN3 labelled “Null”). There is a significant decrease (-14%) in long kernels in ZmAN3 enhancer insertion homozygous inbred lines compared to their enhancer insertion null control lines. There is no significant difference between ZmAN3 enhancer insertion heterozy gous lines compared to their null control lines lacking the enhancer insertion.
[0020] FIG 11 A and B illustrates the digestibility coefficient of maize material from ZmAN3 enhancer insertion lines estimated by near-infrared reflectance spectroscopy (NIRS). FIG 11A illustrates the digestibility coefficient of organic matter (%) from ZmAN3 enhancer insertion homozygous inbred plants (i.e., plants homozygous for an enhancer insertion in ZmAN3 labeled “Homozygous’’) compared with ZmAN3 enhancer insertion null inbred plants (i.e., plants lacking an enhancer insertion in ZmAN3 labelled “Null”). FIG 11B illustrates the digestibility' coefficient of organic matter (%) from ZmAN3 enhancer insertion heterozy gous hybrid plants (i.e., plants heterozygous for an enhancer insertion in ZmAN3 labeled “Heterozygous”) compared with ZmAN3 enhancer insertion null hybrid plants (i.e.. plants lacking an enhancer insertion in ZmAN3 labelled “Null”). There is no significant difference in the digestibility7coefficient between ZmAN3 enhancer insertion homozygous inbreds and heterozygous enhancer insertion hybrids and their respective enhancer insertion null control lines.DETAILED DESCRIPTION
[0021] The phrase “allelic variant” as used herein refers to a polynucleotide or polypeptide sequence variant that occurs in a particular gene at particular locus in a different strain, variety, or isolate of a given organism.
[0022] The term "and / or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as "A and / or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and / or" as used in a phrase such as "A, B, and / or C" is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[0023] As used herein, the phrase “biological sample’' refers to either intact or non-intact (e.g., milled maize seed or maize plant tissue, chopped maize plant tissue, lyophilized tissue) maize plant tissue. It may also be an extract comprising intact or non-intact seed or maize plant tissue. The biological sample can comprise flour, meal, syrup, oil, starch, and cereals manufactured in whole or in part to contain maize plant products or by-products. In certain embodiments, the biological sample is “non-regenerable” (z.e., incapable of being regenerated into a maize plant or maize plant part).
[0024] As used herein, the terms “correspond,” “corresponding,” and the like, when used in the context of an nucleotide position, mutation, and / or substitution in any given polynucleotide (e.g., an allelic variant of SEQ ID NO: 1) with respect to the reference polynucleotide sequence (e.g., SEQ ID NO: 1) all refer to the position of the polynucleotide residue in the given sequence that has identity to the residue in the reference nucleotide sequence when the given polynucleotide is aligned to the reference polynucleotide sequence using a pairwise alignment algorithm (e.g., CLUSTAL O 1.2.4 with default parameters).
[0025] As used herein, the terms “Cpfl” and “Cast 2a” are used interchangeably to refer to the same RNA dependent DNA endonuclease (RdDe).
[0026] As used herein, the phrases “endogenous promoter,” “endogenous gene,” “endogenous plant transcription unit” and the like refer to the native form of a promoter, gene, or plant transcription unit in its natural location in the organism or in the genome of an organism.
[0027] As used herein, the term “exemplary” refers to an example, an instance, or an illustration, and does not indicate a preferred embodiment unless otherwise stated.
[0028] The term “heterologous” as used herein with regards to a DNA molecule, nucleotides, or polynucleotides inserted into a plant genome refer to any DNA molecule, nucleotide, or polynucleotide that is synthetic or that has been removed from its native location and that has been inserted into a new genomic location.
[0029] As used herein, the terms “include,” “includes,” and “including” are to be construed as at least having the features to which they refer while not excluding any additional unspecified features.
[0030] As used herein, the phrase "operably linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression. In another non-limiting example, an “expressionenhancing element” (e.g., a transcription enhancer element) is operably linked to a promoter if the expression increasing element increases activity of the promoter (e.g., as measured by promoter-driven accumulation of a transcript or protein encoded by the transcript). In certain embodiments provided herein, a heterologous “expression enhancing element” (e.g., a transcription enhancer element) is operably linked to an endogenous plant promoter (e.g., a maize ZmAN3 gene promoter associated with the endogenous maize gene) which is located in a plant chromosome.
[0031] As used herein, the term “plant” includes a whole plant and any descendant, cell, tissue, or part of a plant. The term “plant parts” include any part(s) of a plant, including, for example and without limitation: seed (including mature seed and immature seed); a plant cutting; a plant cell; a plant cell culture; or a plant organ (e.g.. pollen, embryos, flowers, fruits, shoots, leaves, roots, stems, and explants). A plant tissue or plant organ may be a seed, protoplast, callus, or any other group of plant cells that is organized into a structural or functional unit. A plant cell or tissue culture may be capable of regenerating a plant having the physiological and morphological characteristics of the plant from which the cell or tissue was obtained, and of regenerating a plant having substantially the same genotype as the plant. Regenerable cells in a plant cell or tissue culture may be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, flowers, or stalks. In contrast, some plant cells are not capable of being regenerated to produce plants and are referred to herein as “non-regenerable” plant cells.
[0032] As used herein, the terms “unmodified ZmAN3 gene” and “ZmAN3 protein” respectively refer to either the gene of SEQ ID NO: 1 and allelic variants thereof or the protein of SEQ ID NO: 2 and allelic variants thereof.
[0033] To the extent to which any of the preceding definitions is inconsistent with definitions provided in any patent or non-patent reference incorporated herein by reference, any patent or non-patent reference cited herein, or in any patent or non-patent reference found elsewhere, it is understood that the preceding definition will be used herein.
[0034] Maize plants comprising a modified ZmAN3 gene wherein a heterologous expression enhancing element is located in the modified gene and provides for increased expression of a ZmAN3 gene product (e.g., a ZmAN3 protein or RNA transcript encoding the protein) are disclosed. An endogenous and unmodified ZmAN3 gene allele (SEQ ID NO: 1) is set forth in the “MaizeGDB” (maize genome database world wide web internet site “maizegdb.org”) underaccession number Zm00001d033905 (based on maize genome assembly Zm-B73- REFERENCE-GRAMENE-4.0) and encodes the ZmAN3 protein (SEQ ID NO: 2). ZmAN3 gene allele is alternatively set forth in the “MaizeGDB” (maize genome database world wide web internet site “maizegdb.org’’) under accession number Zm00001eb056300 (based on maize genome assembly Zm-B73-REFERENCE-NAM-5.0).
[0035] Allelic variants of an endogenous ZmAN3 gene (SEQ ID NO: 1) include sequence variants of both non-coding regions (e.g., promoter. 5' UTR, and 3’ UTR set forth in SEQ ID NO: 3) and coding regions (regions of the genes encoding the proteins of SEQ ID NO: 2). Allelic variants of an endogenous ZmAN3 gene include variants which encode ZmAN3 proteins having at least 95%, 96%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO: 2. Allelic variants of an endogenous ZmAN3 gene also include variants having at least 95%, 96%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO: 1.
[0036] To obtain maize plants with increased leaf length, leaf width, leaf area, leaf fraction fresh weight, and / or leaf fraction dry weight, and improved performance as both inbred parents and as a hybrids, it is desirable in certain embodiments to obtain an allelic series of maize plants comprising different modified ZmAN3 genes. In the allelic series, distinct expression levels of the different modified ZmAN3 genes are obtained to produce plants with distinct increase in leaf length, leaf width, leaf area, leaf fraction fresh weight, and / or leaf fraction dry weight ranging from about 1% or 5% to about 7%, 10%, 12%, 15%, 30%, or 50% in comparison to control plants lacking the modified ZmAN3 gene. In certain contexts, maize plants having a given ZmAN3 gene results in an increase in leaf length, leaf width, leaf area, leaf fraction fresh weight, and / or leaf fraction dry weight (e.g., from about 1% to about 10% in comparison to control plants) are selected from the allelic series in order to obtain plants having a desired increase in leaf length, leaf width, leaf area, leaf fraction fresh weight, and / or leaf fraction dry weight. In certain contexts, maize plants having a given ZmAN3 gene with results in an increase in leaf length, leaf width, leaf area, leaf fraction fresh weight, and / or leaf fraction dry weight (e.g., from about 5%, 7%, or 10% to about 7%, 10%, 12%, 15%, or 30% in comparison to control plants) are selected from the allelic series in order to obtain plants having a desired increase in leaf length, leaf width, leaf area, leaf fraction fresh weight, and / or leaf fraction dry weight. In certain embodiments, maize plants having a given modified ZmAN3 gene exhibit increases in expression of the ZmAN3 gene in one or more maize tissues of about 10%, 15%, or 20% to about 30%, 40%, 50%, 60%, 70%, 80%, or 100% in comparison to a control maizeplant lacking the modified ZmAN3 are obtained in the allelic series. In certain embodiments, maize plants having a given modified ZmAN3 gene exhibit increases of expression of a ZmAN3 gene of about 1.2-fold or 1.5 -fold to about 2-fold, 3 -fold, or 5 -fold in at least one maize tissue in the maize plant in comparison to a control maize plant lacking the modified ZmAN3 gene. In certain embodiments, the desired increase in leaf length, leaf width, leaf area, leaf fraction fresh weight, leaf fraction dry weight and / or expression level can be selected based on performance characteristics (e.g, inbred and / or hybrid seed yield) for particular germplasms and / or for use in certain target geographies.
[0037] To obtain maize plants with increased stem fraction dry weight, and / or 1000 kernel weight and improved performance as both inbred parents and as a hybrids, it is desirable in certain embodiments to obtain an allelic series of maize plants comprising different modified ZmAN3 genes. In the allelic series, distinct expression levels of the different modified ZmAN3 genes are obtained to produce plants with distinct increase in stem fraction dry weight, and / or 1000 kernel weight ranging from about 1% or 5% to about 7%, 10%, 12%, 15%, 30%, or 50% in comparison to control plants lacking the modified ZmAN3 gene. In certain embodiments, maize plants having a given modified ZmAN3 gene resulting in an increase in stem fraction dry weight, and / or 1000 kernel weight (e.g., from about 1% to about 10% or more in comparison to control plants) are selected from the allelic series in order to obtain plants having a desired increase in stem fraction dry' weight, and / or 1000 kernel weight. In certain embodiments, maize plants having a given modified ZmAN3 gene resulting in an increase in stem fraction dry weight, and / or 1000 kernel weight (e.g. from about 1%, 5%, or 10% to about 12%, 15%, 30%, or 50% in comparison to control plants) are selected from the allelic series in order to obtain plants having a desired increase in stem fraction dry weight, and / or 1000 kernel weight. In certain embodiments, maize plants having a given modified ZmAN3 gene resulting in a decrease in the number of long kernels (e.g.. from about 1%, 5%. or 10% to about 12%. 15%, 30%, or 50% in comparison to control plants) are selected from the allelic series in order to obtain plants having a desired decrease in the number of long kernels. In certain embodiments, maize plants having a given modified ZmAN3 gene exhibit increases in expression of the ZmAN3 gene in one or more maize tissues of about 10%. 15%, or 20% to about 30%, 40%, 50%, 60%, 70%, 80%, or 100% in comparison to a control maize plant lacking the modified ZmAN3 are obtained in the allelic series. In certain embodiments, maize plants having a given modified ZmAN3 gene exhibit increases of expression of a ZmAN3 geneof about 1.2-fold or 1.5-fold to about 2-fold, 3-fold, or 5 -fold in at least one maize tissue in the maize plant in comparison to a control maize plant lacking the modified ZmAN3 gene. In certain embodiments, the desired increase in stem fraction dry weight, 1000 kernel weight, and / or expression level can be selected based on performance characteristics (e.g., inbred and / or hybrid seed yield) for particular germplasms and / or for use in certain target geographies.
[0038] In certain embodiments, an allelic series of different modified ZmAN3 genes can be obtained by insertion or formation of a transcription enhancer in the unmodified ZmAN3 gene such that the transcription enhancer is operably linked to the promoter of the gene but placed at different positions relative to the transcriptional start site (TSS). The TSS of the ZmAN3 gene is located at nucleotide 511 of In certain embodiments, the allelic series can be obtained by locating the transcription enhancer at different positions from about 10, 20, 30, 35, 40, 45, or 50 base pairs (bp) to about 60, 65, 70, 75, 80, 90, 100, 150, or 200 bp 5’ of the transcriptional start site (TSS) of the ZmAN3 gene. In certain embodiments, operable linkage to the endogenous promoter is achieved by insertion or formation of an enhancer in one or more of an endogenous promoter, 5’ untranslated region (5’UTR), intron, and / or 3’ untranslated region of an endogenous ZmAN3 gene located at its native chromosomal location (e.g.. by CRISPR, TALEN, or artificial Zinc Finger mediated gene editing). Transcriptional enhancer elements that can be inserted or formed in the ZmAN3 gene promoter, 5’ UTR, intron, or 3’ UTR can comprise one or more DNA molecules set forth in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10-SEQ ID NO: 56. and / or an enhancer set forth in Table 1. In certain embodiments, two distinct enhancers independently selected from SEQ ID NO:8, SEQ ID NO: 9, SEQ ID NO: 10-SEQ ID NO: 56, and / or an enhancer set forth in Table 1 are inserted or formed in the gene promoter, 5’ UTR, intron, or 3" UTR. In certain embodiments, a distinct enhancer independently selected from SEQ ID NO: 8, SEQ ID NO: 9. SEQ ID NO: 10-SEQ ID NO: 56, and / or an enhancer set forth in Table 1 are inserted or formed in the ZmAN3 gene promoter. 5’ UTR, intron, or 3’ UTR. In certain embodiments, members of a modified ZmAN3 gene allelic series can comprise insertions of a transcription enhancer (e.g., one or more DNA molecules set forth in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10-SEQ ID NO: 56, and / or an enhancer set forth in Table 1) at: (i) about 76 to about 36 base pairs or about 74. 72. 70, 68, 66, 64, 62, 60, 58, 56, 54, 52, 50, 48, 46, 44, 42, 40, or 38 base pairs 5’ to the TSS of the ZmAN3 gene; or (ii) in a double stranded break introduced in the ZmAN3 promoter with a Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 5; or (iii) in a double stranded breakintroduced in the ZmAN3promoter with a Casl2 nuclease and a Casl2 guide RNA comprising a spacer encoded by SEQ ID NO: 5. In certain embodiments, insertions of the transcription enhancer at any of the aforementioned positions in the ZmAN3 promoter is accompanied by the deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more base pairs of DNA in the ZmAN3 promoter either 5’ and / or 3’ to the transcription enhancer insertion in the corresponding DNA of SEQ ID NO: 3 or an allelic variant thereof. In certain embodiments, any of the aforementioned transcription enhancer insertions can be combined with an insertion of a heterologous translational enhancing element and / or a heterologous intron in the ZmAN3 gene. A list of useful transcriptional enhancer elements that can be used to obtain an allelic series of different modified ZmAN3 genes is provided in Table 1.
[0039] Table 1. Transcriptional enhancer elements.1Y= T or C; W= A or T; S=C or G; M= A or C; N= A, G, C, or T; K= G or T; R=A or G; K= G or T; D= A, G, or T; B=C, G, or T; H=A, C, or T
[0040] The transcriptional enhancer element of SEQ ID NO: 8 comprises 3 copies of a 12- nucleotide core element nucleotide sequence of SEQ ID NO: 9. The 12 nucleotide core element nucleotide sequence of SEQ ID NO: 9 is present at several locations in the maize genome. For example, it can be found at several chromosomal locations of the maize variety7B73.According to the B73v4 version of the genomic sequences (available on the https world wide web internet site maizegdb.org / genome / assembly / Zm-B73-REFERENCE-GRAMENE-4.0 and hereinafter referred to as “B73v4 maize genome’7). SEQ ID NO: 9 can be found on Chr3 coordinates 1,063,395.. 1,063,406 (intron of Zm00001d039287), on Chr3 coordinates12.253.969.. 12,253,980 (immediately downstream of Zm00001d039695), on Chr3 coordinates12.265.615..12.265.626 (intron of Zm00001d039695), on Chr3 coordinates12.277.428..12,277,439 (intron of Zm00001d039695), on Chr3 coordinates147.698.750.. 147,698,761 (not within 2 kb of an annotated gene model), on Chr6, coordinates107.132.183..107.132.194. (about 2 kb downstream of Zm00001d036949), on ChrlO, coordinates 53.761, 662..53, 761, 673 (not within 2 kb of an annotated gene model).
[0041] A 35 bp variant of the transcriptional enhancer element of SEQ ID NO: 8 that can also be used in certain embodiments is disclosed herein in SEQ ID NO: 6. The 35 bp variant enhancer of SEQ ID NO: 6 comprises a duplication of the 12 nucleotide core element nucleotide sequence of SEQ ID NO: 9 followed by an 11 bp sequence comprising the first 11 nucleotides of SEQ ID NO: 9. Maize plants comprising the 35 bp variant enhancer of SEQ ID NO: 6 inserted in the promoter of the ZmAN3 gene can exhibit increased expression of ZmAN3. In certain embodiments, the maize plants and parts thereof comprising the 35 bp variant enhancer of SEQ ID NO: 6 inserted in the promoter of the ZmAN3 gene contain the edited ZmAN3 gene set forth in SEQ ID NO: 4. A DNA molecule which is diagnostic for the edited ZmAN3 gene set forth in SEQ ID NO: 4 include the DNA sequence of SEQ ID NO: 7.
[0042] In certain embodiments, a modified ZmAN3 gene with increased expression that provides for increased leaf length, leaf width, leaf area, leaf fraction fresh weight, leaf fraction dry weight, stem fraction dry weight, and / or 1000 kernel weight is obtained by inserting a heterologous intron in the 5’ UTR and / or within the coding region of a ZmAN3 gene. Materials and methods for intron mediated enhancement (1ME) of plant gene expression described previously (Laxa, M. Front. Plant Sci., 06 January 2017 doi.org / 10.3389 / fpls.2016.01977; Rose, AB. Plant J. 17 November 2004 doi.org / 10.1111 / j.l365-313X.2004.02247.x; Parra, G. et al. Nucleic Acids Research, Volume 39, Issue 13, 1 July 2011, 5328-5337, doi.org / 10.1093 / nar / gkr043) can be adapted for use in enhancing expression of ZmAN3gene. Heterologous introns that can be used to increase expression of plant genes include an Actin, Hsp70, PEPC, UBQ (e.g., UBQ1, UBQ10), EF-la, EF-lp, Histone H3, ATPK1, RHD3, or MHX intron (e.g., a rice or maize Actin, Hsp70, PEPC, UBQ1, UBQ10, EF-la, EF-ip, HistoneH3, ATPK1, RHD3, or MHX intron). In certain embodiments, the intron is inserted within or at about 500, 200, 100. 50, 30, or 20 base pairs of the transcriptional start site (TSS). In certain embodiments, the intron is inserted in the 5‘ UTR and / or in the coding region within at about 500, 200, 100, 50, 30, 20, or 10 base pairs of the transcriptional start site (TSS) of a ZmAN3 gene. In certain embodiments, the intron is inserted in the 5’ UTR and / or in the coding region within at about 10 to about 60 or 100 base pairs of the transcriptional start site (TSS) of a ZmAN3 gene.
[0043] In certain embodiments, a modified ZmAN3 gene with increased expression that provides for increased leaf length, leaf width, leaf area, leaf fraction fresh weight, leaf fraction dry weight, stem fraction dry weight, and / or 1000 kernel weight is obtained by inserting a heterologous translational enhancer in the 5’ UTR and / or within the coding region of the ZmAN3 gene. Translational enhancers can comprise 5’ UTRs and / or 5’ UTR and one or more codons of a coding region. Translational enhancers include 5’ UTRs of various rice genes that can enhance translation of linked heterologous reporter genes (e.g, a 5’ UTR of a rice Adh gene (Sugio et al. J. Biosci. Bioengin. 105(3), 300-302 (2008) doi.org / 10.1263 / jbb.105.300; glutathione transferase U50, glutathione peroxidase 1, 20S proteasome alphal subunit, pathogenesis-related protein 4b, glycine-rich cell-wall structural protein 1, or UspA domain containing protein; Yamasaki et al. Plant Biotechnology735, 365-373 (2018) DOI: 10.5511 / plantbiotechnology.18.0903a). In certain embodiments, the translational enhancer is encoded by7a DNA molecule comprising the DNA sequence of any aforementioned 5’ UTR and all or part of the 5’UTR is substituted for all or part of the ZmAN35’ UTR in the modified ZmAN3 gene.
[0044] Expression of a modified ZmAN3 gene can be increased in comparison to a control maize plant comprising the unmodified ZmAN3 gene. Such increases in expression can be measured by a variety of methods. In certain embodiments, an increased leaf length, leaf width, leaf area, leaf fraction fresh weight, leaf fraction dry weight, stem fraction dry w7eight, and / or 1000 kernel weight trait conferred by increased expression of a modified ZmAN3 gene is measured in maize plants comprising the expression increasing element and compared to control maize plants comprising the unmodified ZmAN3 gene. Increased leaf length and / or leaf width traits can be assessed by comparing any measure of the trait itself (e.g., total leaf length, total leaf width, leaf surface area, etc.) or a proxy for the trait (e.g., yield of seed and / or other biomass in kg / hectare) in maize plants comprising the modified ZmAN3 gene can beincreased in comparison to a control maize plant comprising the unmodified ZmAN3 gene. In certain embodiments, increased expression of the encoded transcript itself is directly measured by determining amounts of the ZmAN3 gene-encoding transcript (e.g., an mRNA or noncoding RNA) in maize plants comprising the modified ZmAN3 gene and compared to amounts of the transcript-encoding polynucleotide in control maize plants comprising the unmodified ZmAN3gene. Amounts of the ZmAN3 gene-encoding transcript can be determined by a variety of techniques including PCR (e.g.. quantitative reverse-transcriptase PCR; qRT-PCR), hybridization, CRISPR-, and / or sequencing- based techniques (Khodakov et al., doi.org / 10.1016 / j.addr.2016.04.005; Gootenberg, et al. doi: 10.1126 / science.aaq0179). In certain embodiments, expression of a ZmAN3 gene-encoding polynucleotide can also be determined by measuring amounts of a ZmAN3 protein encoded by the transcript in maize plants comprising the transcription enhancer and compared to amounts of the ZmAN3 protein in control maize plants comprising the unmodified ZmAN3 gene. Amounts of the ZmAN3 protein can be determined by a variety of techniques including immunoassays for the protein, and mass spectroscopy-based techniques (Chen et al. doi: 10.1186 / sl2967-015-0537-6; Bruce et al. doi: 10. 1002 / 0471250953. bil321s41). The magnitude of the increase in transcript production may depend on the baseline expression level of the unmodified endogenous ZmAN3 transcript-encoding polynucleotide in the respective cells or tissues. By way of a nonlimiting example, the magnitude of the increase in expression of an endogenous ZmAN3 gene modified by insertion or formation of SEQ ID NO: 6 or 8 in an endogenous ZmAN3 promoter over baseline expression levels of the unmodified endogenous ZmAN3 gene will be greatest where baseline ZmAN3 expression levels are low. In certain embodiments, expression of the endogenous ZmAN3 gene modified by insertion of a heterologous expression enhancer (e.g., the transcription enhancer of SEQ ID NO: 6 or 8) can be increased by at least 1.2-, 1.5-, 2-, 3- , 4-, or 5-fold over baseline expression levels of the unmodified endogenous ZmAN3 gene. In certain embodiments, expression of the endogenous ZmAN3 gene modified by insertion or formation of the heterologous expression enhancer (e.g. , the transcription enhancer of SEQ ID NO: 8) can be increased by at least about 1.2- or 1.5-fold to about 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, or 10- fold or more over baseline expression levels of the unmodified endogenous ZmAN3 gene in unmodified control plants.
[0045] In certain embodiments, it will be desirable to use genome editing molecules to introduce or form a heterologous expression enhancing element (e.g., a heterologoustranscription enhancer, a heterologous translational enhancing element, and / or a heterologous intron) in an endogenous ZmAN3gene. Gene editing molecules of use in methods provided herein include molecules capable of introducing a double-strand break (“DSB”) or singlestrand break (‘ SSB’’) at a specific site or sequence in a double-stranded DNA, such as in genomic DNA or in a target gene located within the genomic DNA as well as accompanying guide RNA or donor or other DNA template polynucleotides. Examples of such gene editing molecules include: (a) a nuclease comprising an RNA-guided nuclease, an RNA-guided DNA endonuclease or RNA directed DNA endonuclease (RdDe), a class 1 CRISPR type nuclease system, a type II Cas nuclease, a Cas9, a nCas9 nickase, a type V Cas nuclease, a Casl2a nuclease, a nCasl2a nickase, a Casl2d (CasY), a Casl2e (CasX), a Casl2b (C2cl), a Casl2c (C2c3), a Casl2i, a Casl2j, a Casl4, an engineered nuclease, a codon-optimized nuclease, a zinc-finger nuclease (ZFN) or nickase, a transcription activator-like effector nuclease (TAL- effector nuclease or TALEN) or nickase (TALE-nickase), an Argonaute, and a meganuclease or engineered meganuclease; (b) a polynucleotide encoding one or more nucleases capable of effectuating site-specific alteration (including introduction of a DSB or SSB) of a target nucleotide sequence; (c) a guide RNA (gRNA) for use with an RNA-guided nuclease, or a DNA encoding a gRNA for use with an RNA-guided nuclease; (d) donor DNA template polynucleotides suitable for insertion at a break in genomic DNA by homology -directed repair (HDR) or microhomology -mediated end joining (MMEJ); and (e) other DNA templates (e.g, dsDNA, ssDNA. or combinations thereof) suitable for insertion at a break in genomic DNA (e.g., by non-homologous end joining (NHEJ).
[0046] CRISPR technology for editing the genes of eukaryotes is disclosed in US Patent Application Publications 2016 / 0138008A1 and US2015 / 0344912A1, and in US Patents 8,697,359, 8,771,945, 8,945,839. 8,999,641, 8,993.233, 8,895,308, 8.865,406, 8,889,418, 8,871,445, 8,889.356. 8.932,814, 8,795,965. and 8,906,616. Cpfl endonuclease and corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication 2016 / 0208243 Al. Plant RNA promoters for expressing CRISPR guide RNA and plant codon optimized CRISPR Cas9 endonuclease are disclosed in International Patent Application PCT / US2015 / 018104 (published as WO 2015 / 131101 and claiming priority to US Provisional Patent Application 61 / 945,700). Methods of using CRISPR technology for genome editing in plants are disclosed in US Patent Application Publications US 2015 / 0082478A1 and US 2015 / 0059010A1 and in International Patent Application PCT / US2015 / 038767 Al (publishedas WO 2016 / 007347 and claiming priority to US Provisional Patent Application 62 / 023,246). In certain embodiments, an RNA-guided endonuclease that leaves a blunt end following cleavage of the target site is used. Blunt-end cutting RNA-guided endonucleases include Cas9. In certain embodiments, an RNA-guided endonuclease that leaves a staggered single stranded DNA overhanging end following cleavage of the target site following cleavage of the target site is used. Staggered-end cutting RNA-guided endonucleases include Casl2a, Casl2b, Casl2d, Casl2e. and Casl2i. The target Cas nuclease cleavage site in the promoters of the endogenous ZmAN3 gene is set forth in SEQ ID NO: 3. All of the patent publications referenced in this paragraph are incorporated herein by reference in their entirety7.
[0047] CRISPR-type genome editing can be adapted for use in the plant cells and methods provided herein in several ways. CRISPR elements, e.g., gene editing molecules comprising CRISPR endonucleases and CRISPR guide RNAs including single guide RNAs or guide RNAs in combination with tracrRNAs or scoutRNA, or polynucleotides encoding the same, are useful in effectuating genome editing without remnants of the CRISPR elements or selective genetic markers occurring in progeny. In certain embodiments, the CRISPR elements are provided directly to the eukaryotic cell (e.g., maize plant cells), systems, methods, and compositions as isolated molecules, as isolated or semi-purified products of a cell free synthetic process (e.g., in vitro translation), or as isolated or semi-purified products of in a cell-based synthetic process (e.g., such as in a bacterial or other cell lysate). In certain embodiments, maize plants or maize plant cells used in the systems, methods, and compositions provided herein can comprise a transgene that expresses a CRISPR endonuclease (e.g., a Cas9, a Cpfl-type or other CRISPR endonuclease). In certain embodiments, one or more CRISPR endonucleases with unique PAM recognition sites can be used. Guide RNAs (sgRNAs or crRNAs and a tracrRNA) can form an RNA-guided endonuclease / guide RNA complex which can specifically bind sequences in the gDNA target site that are adjacent to a protospacer adjacent motif (PAM) sequence. Such guide RNAs comprise a spacer RNA which is complementary to a target site in the DNA which is adjacent to the PAM sequence. The type of RNA-guided endonuclease typically informs the location of suitable PAM sites and design of crRNAs or sgRNAs. G-rich PAM sites, e.g., 5’-NGG are typically targeted for design of crRNAs or sgRNAs used with Cas9 proteins. Examples of PAM sequences include 5’-NGG (Streptococcus pyogenes), 5’- NNAGAA (Streptococcus thermophilus CRISPR1), 5’-NGGNG (Streptococcus thermophilus CRISPR3), 5’-NNGRRT or 5'-NNGRR (Staphylococcus aureus Cas9, SaCas9), and 5’-NNNGATT (Neisseria meningitidis . T-rich PAM sites (e.g., 5’-TTN or 5’-TTTV, where "V" is A, C, or G) are typically targeted for design of crRNAs or sgRNAs used with Cast 2a proteins. In some instances. Casl2a can also recognize a 5’-CTA PAM motif. Other examples of potential Casl2a PAM sequences include TTN, CTN, TCN, CCN, TTTN, TCTN, TTCN, CTTN, ATTN, TCCN, TTGN, GTTN, CCCN, CCTN, TTAN, TCGN, CTCN, ACTN, GCTN, TCAN. GCCN, and CCGN (wherein N is defined as any nucleotide). Cpfl endonuclease and corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication 2016 / 0208243 Al, which is incorporated herein by reference for its disclosure of DNA encoding Cpfl endonucleases and guide RNAs and PAM sites.
[0048] In certain embodiments, zinc finger nucleases or zinc finger nickases can also be used in the methods provided herein. Zinc-finger nucleases are site-specific endonucleases comprising two protein domains: a DNA-binding domain, comprising a plurality of individual zinc finger repeats that each recognize between 9 and 18 base pairs, and a DNA-cleavage domain that comprises a nuclease domain (typically Fokl). The cleavage domain dimerizes in order to cleave DNA; therefore, a pair of ZFNs are required to target non-palindromic target polynucleotides. In certain embodiments, zinc finger nuclease and zinc finger nickase design methods which have been described (Umov et al. (2010) Nature Rev. Genet., 11 :636 - 646; Mohanta et al. (2017) Genes vol. 8,12: 399; Ramirez et al. Nucleic Acids Res. (2012); 40(12): 5560-5568; Liu et al. (2013) Nature Communications, 4: 2565) can be adapted for use in the methods set forth herein. The zinc finger binding domains of the zinc finger nuclease or nickase provide specificity and can be engineered to specifically recognize any desired target DNA sequence. The zinc finger DNA binding domains are derived from the DNA-binding domain of a large class of eukaryotic transcription factors called zinc finger proteins (ZFPs). The DNA- binding domain of ZFPs typically contains a tandem array of at least three zinc “fingers" each recognizing a specific triplet of DNA. A number of strategies can be used to design the binding specificity of the zinc finger binding domain. One approach, termed “modular assembly’’, relies on the functional autonomy of individual zinc fingers with DNA. In this approach, a given sequence is targeted by identifying zinc fingers for each component triplet in the sequence and linking them into a multi-finger peptide. Several alternative strategies for designing zinc finger DNA binding domains have also been developed. These methods are designed to accommodate the ability of zinc fingers to contact neighboring fingers as well as nucleotide bases outside their target triplet. Typically, the engineered zinc finger DNA bindingdomain has a novel binding specificity, compared to a naturally occurring zinc finger protein. Engineering methods include, for example, rational design and various types of selection. Rational design includes, for example, the use of databases of triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, e.g., US Patents 6.453,242 and 6,534,261, both incorporated herein by reference in their entirety. Exemplary selection methods (e g., phage display and yeast two-hybrid systems) can be adapted for use in the methods described herein. In addition, enhancement of binding specificity for zinc finger binding domains has been described in US Patent 6,794,136. incorporated herein by reference in its entirety. In addition, individual zinc finger domains may be linked together using any suitable linker sequences. Examples of linker sequences are publicly known, e.g., see US Patents 6,479,626; 6,903,185; and 7,153,949, incorporated herein by reference in their entirety. The nucleic acid cleavage domain is non-specific and is typically a restriction endonuclease, such as Fokl. This endonuclease must dimerize to cleave DNA. Thus, cleavage by Fokl as part of a ZFN requires two adjacent and independent binding events, which must occur in both the correct orientation and with appropriate spacing to permit dimer formation. The requirement for two DNA binding events enables more specific targeting of long and potentially unique recognition sites. Fokl variants with enhanced activities have been described and can be adapted for use in the methods described herein; see, e.g., Guo et al. (2010) J. Mol. Biol., 400:96 - 107.
[0049] Transcription activator like effectors (TALEs) are proteins secreted by certain Xanthomonas species to modulate gene expression in host plants and to facilitate the colonization by and survival of the bacterium. TALEs act as transcription factors and modulate expression of resistance genes in the plants. Recent studies of TALEs have revealed the code linking the repetitive region of TALEs with their target DNA-binding sites. TALEs comprise a highly conserved and repetitive region consisting of tandem repeats of mostly 33 or 34 amino acid segments. The repeat monomers differ from each other mainly at amino acid positions 12 and 13. A strong correlation between unique pairs of amino acids at positions 12 and 13 and the corresponding nucleotide in the TALE-binding site has been found. The simple relationship between amino acid sequence and DNA recognition of the TALE binding domain allows for the design of DNA binding domains of any desired specificity. TALEs can be linked to a non-specific DNA cleavage domain to prepare genome editing proteins, referred to as TAL-effector nucleases or TALENs. As in the case of ZFNs, a restriction endonuclease, such as Fokl, can be conveniently used. Methods for use of TALENs in plants have been described and can be adapted for use in the methods described herein, see Mahfouz et al. (2011) Proc. Natl. Acad. Sci. USA, 108:2623 - 2628; Mahfouz (2011) GM Crops, 2:99 - 103; and Mohanta et al. (2017) Genes vol. 8,12: 399). TALE nickases have also been described and can be adapted for use in methods described herein (Wu et al.; Biochem Biophys Res Commun. (2014);446(l):261-6; Luo et al; Scientific Reports 6, Article number: 20657 (2016)).
[0050] In certain embodiments where heterologous expression enhancing element (<?.g., a heterologous transcription enhancer, a heterologous translational enhancing element, and / or a heterologous intron) is inserted into the genome at a site of a double stranded break in the endogenous ZmAN3gene introduced by one or more nucleases or nickases (e.g., a CRISPR / guide RNA complex with site-specific endonuclease or nickase, an artificial zinc finger (aZF) nuclease or nickase, and / or a TALE nuclease or nickase), the donor DNA template or other DNA template comprises the heterologous expression enhancing element (e.g., a heterologous transcription enhancer, a heterologous translational enhancing element, and / or a heterologous intron). In certain embodiments where the heterologous expression enhancing element is formed in the genome at a site of a double stranded break in the maize plant genome introduced by a nuclease, the donor DNA template or other DNA template can comprise less than the complete set of nucleotides or base pairs of the transcription enhancer (e.g, less than the entire 36 nucleotides or base pairs of SEQ ID NO: 8 sequence) and genomic DNA at the site of integration can contribute the nucleotides or base pairs of the transcription enhancer that are absent from the donor DNA template or other DNA template. In certain embodiments where SEQ ID NO: 8 is formed in the genomic DNA. the donor DNA template or other DNA template can comprise up to 35 contiguous nucleotides or base pairs of SEQ ID NO: 8, the genomic DNA at the site of integration can contribute 1 or more nucleotides or base pairs of the SEQ ID NO:8 sequence which are lacking from the donor DNA template or other DNA template, and the complete 36 base pair sequence of SEQ ID NO: 8 is formed at the site of integration in the genome. In certain embodiments, the donor DNA template or other DNA template can comprise a containing less than the complete set of nucleotides or base pairs of the transcription enhancer (e.g., less than the entire 36 nucleotides or base pairs of SEQ ID NO: 8 sequence) and can be inserted as is into the genome such that genomic DNA at the site ofintegration does not contribute the nucleotides or base pairs of the transcription enhancer that are found in SEQ ID NO: 8). Alternatively, such variants of the 36 nucleotide enhancer sequence which can be inserted can comprise the entire 36 nucleotides or base pairs of SEQ ID NO: 8 sequence and an insertion event in the target maize gene comprising less than the entire 36 nucleotides or base pairs of SEQ ID NO: 8 sequence (e.g., the 35 bp variant enhancer sequence of SEQ ID NO: 6) can be recovered and used. Donor DNA template molecules used in the methods provided herein include DNA molecules comprising, from 5’ to 3’. a first homology arm, a replacement DNA, and a second homology arm, wherein the homology arms containing sequences that are partially or completely homologous to genomic DNA (gDNA) sequences flanking a target site-specific endonuclease cleavage site in the gDNA. In certain embodiments, the replacement DNA can comprise an insertion, deletion, or substitution of 1 or more DNA base pairs relative to the target gDNA. In one embodiment, the donor DNA template molecule is double-stranded and perfectly base-paired through all or most of its length, with the possible exception of any unpaired nucleotides at either terminus or both termini. In another embodiment, the donor DNA template molecule is double-stranded and includes one or more non-terminal mismatches or non-terminal unpaired nucleotides within the otherwise double-stranded duplex. In an embodiment, the donor DNA template molecule that is integrated at the site of at least one double-strand break (DSB) includes between 2-20 nucleotides in one (if single-stranded) or in both strands (if double-stranded), e. g., 1, 2. 3, 4, 5, 6, 7, 8. 9, 10, 11, 12, 13, 14. 15. 16. 17. 18, 19, or 20 nucleotides on one or on both strands, each of which can be base-paired to a nucleotide on the opposite strand of the targeted integration site (in the case of a perfectly base-paired double-stranded polynucleotide molecule). Such donor DNA templates can be integrated in genomic DNA containing blunt and / or staggered double stranded DNA breaks by homology-directed repair (HDR) or microhomology-mediated end joining (MMEJ). In certain embodiments, a donor DNA template homology arm can be about 20, 50, 100, 200, 400, or 600 to about 800, or 1000 base pairs in length. In certain embodiments, integration of the donor DNA templates by HDR can be facilitated by use of an exonuclease (e.g., bacteriophage lambda exonuclease), a singlestranded DNA annealing protein (SSAP; e.g.. bacteriophage lambda beta SSAP protein), and a single-stranded DNA binding protein (SSB; e.g, an E. coli SSB) essentially as set forth in US Patent Application Publication 20200407754, which is incorporated herein by reference in its entirety. In certain embodiments, a donor DNA template molecule can be delivered to amaize plant cell in a circular (e.g., a plasmid or a viral vector including a gemini virus vector) or a linear DNA molecule. In certain embodiments, a circular or linear DNA molecule that is used can comprise a modified donor DNA template molecule comprising, from 5’ to 3’, a first copy of the target sequence-specific endonuclease cleavage site sequence, the first homology arm, the replacement DNA, the second homology arm, and a second copy of the target sequence-specific endonuclease cleavage site sequence. In other embodiments, DNA templates suitable for NHEJ insertion will lack homology arms that are partially or completely homologous to genomic DNA (gDNA) sequences flanking a target site-specific endonuclease cleavage site in the gDNA. In certain embodiments, the DNA template comprising all of an expression enhancing element (e.g., dsDNA, ssDNA, or combinations thereof) can be inserted at a double-stranded break in gDNA by non-homologo us end joining (NHEJ). In certain embodiments, the DNA template (e.g., dsDNA, ssDNA, or combinations thereof) comprising less than the complete set of nucleotides of the expression enhancing element (e.g.. a transcription enhancer less than 36 nucleotides or base pairs of SEQ ID NO: 8 sequence) can be inserted at a double-stranded break in gDNA by non-homologo us end joining (NHEJ), gDNA at the site of insertion can contribute the nucleotides or base pairs of the expression enhancing element (e.g., SEQ ID NO:8) that are absent from the DNA template, and the expression enhancing element (e.g., SEQ ID NO:8) can be formed at the site of the doublestranded break in the gDNA.
[0051] In some embodiments, the expression enhancing element (e.g, a heterologous transcription enhancer, a heterologous translational enhancing element, and / or a heterologous intron) replaces or largely replaces a corresponding sequence in a gene, such as in a promoter, a 5’ UTR, or an intron. Accordingly, a replacement rather than an insertion leaves the positioning of other elements unchanged. A replacement target site may be chosen by similarity to the expression enhancing element or a portion thereof. A replacement template could be used in an HDR process, and / or DNA base editing and / or genome editing could be used to produce the desired replacement region that corresponds to the expression enhancing element or a portion thereof. Base editors include for example, a site-specific base edit mediated by a C*G to T A or an A T to G*C base editing deaminase enzymes (Gaudelli et al.. Programmable base editing of A T to G*C in genomic DNA without DNA cleavage." Nature (2017); Nishida et al. "Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems." Science 353 (6305) (2016); Komor et al. "Programmable editingof a target base in genomic DNA without double-stranded DNA cleavage." Nature 533 (7603) (2016):420-4. Catalytically dead dCas9 fused to a cytidine deaminase or an adenine deaminase protein becomes a specific base editor that can alter DNA bases without inducing a DNA break. Base editors convert C->T (or G->A on the opposite strand) or an adenine base editor that would convert adenine to inosine, resulting in an A->G change within an editing window specified by the gRNA.
[0052] Various treatments can be used for delivery of gene editing molecules and / or other molecules to a plant cell. In certain embodiments, one or more treatments is employed to deliver the gene editing or other molecules (e.g., comprising a polynucleotide, polypeptide, or combination thereof) into a eukaryotic or plant cell, e.g., through barriers such as a cell wall, a plasma membrane, a nuclear envelope, and / or other lipid bilayer. In certain embodiments, a polynucleotide-, polypeptide-, or RNP (ribonucleoprotein) -containing composition comprising the molecules are delivered directly, for example by direct contact of the composition with a plant cell. Aforementioned compositions can be provided in the form of a liquid, a solution, a suspension, an emulsion, a reverse emulsion, a colloid, a dispersion, a gel, liposomes, micelles, an injectable material, an aerosol, a solid, a powder, a particulate, a nanoparticle, or a combination thereof can be applied directly to a plant, plant part, plant cell, or plant explant (e.g., through abrasion or puncture or otherwise disruption of the cell wall or cell membrane, by spraying or dipping or soaking or otherwise directly contacting, by microinjection). For example, a plant cell or plant protoplast is soaked in a liquid genome editing molecule-containing composition, whereby the agent is delivered to the plant cell. In certain embodiments, the agent-containing composition is delivered using negative or positive pressure, for example, using vacuum infiltration or application of hydrodynamic or fluid pressure. In certain embodiments, the agent-containing composition is introduced into a plant cell or plant protoplast, e.g., by microinjection or by disruption or deformation of the cell wall or cell membrane, for example by physical treatments such as by application of negative or positive pressure, shear forces, or treatment with a chemical or physical delivery agent such as surfactants, liposomes, or nanoparticles; see. e.g., delivery' of materials to cells employing microfluidic flow through a cell-deforming constriction as described in US Published Patent Application 2014 / 0287509, incorporated by reference in its entirety herein. Other techniques useful for delivering the agent-containing composition to a eukaryotic cell, plant cell or plant protoplast include: ultrasound or sonication; vibration, friction, shear stress, vortexing,cavitation; centrifugation or application of mechanical force; mechanical cell wall or cell membrane deformation or breakage; enzymatic cell wall or cell membrane breakage or permeabihzation; abrasion or mechanical scarification (e.g.. abrasion with carborundum or other particulate abrasive or scarification with a file or sandpaper) or chemical scarification (e.g., treatment with an acid or caustic agent); and electroporation. In certain embodiments, the agent-containing composition is provided by bacterially mediated (e.g. , Agrobacterium sp., Rhizobium sp.. Sinorhizobium sp., Mesorhizobium sp., Bradyrhizobium sp., Azobacter sp.. Phyllobacterium sp.) transfection of the plant cell or plant protoplast with a polynucleotide encoding the genome editing molecules (e.g., RNA dependent DNA endonuclease, RNA dependent DNA binding protein, RNA dependent nickase, ABE, or CBE. and / or guide RNA); see, e.g, Broothaerts et al. (2005) Nature. 433:629 - 633). Any of these techniques or a combination thereof are alternatively employed on the plant explant, plant part or tissue or intact plant (or seed) from which a plant cell is optionally subsequently obtained or isolated; in certain embodiments, the agent-containing composition is delivered in a separate step after the plant cell has been isolated.
[0053] Commodity plant products obtained from maize plants or maize plant parts comprising at least one modified ZmAN3 gene as well as methods for making such products are provided. In certain embodiments, the commodity products are processed products are made from the maize plant or its seeds, including: (a) maize seed meal (defatted or non-defatted); (b) extracted maize proteins, oils, sugars, syrups, and starches; (c) soy fermentation products; (d) maize based animal feed or human food products (e.g., feed and food comprising maize seed meal (defatted or non-defatted) and other ingredients (e.g. , other cereal grains, other seed meal, other protein meal, other oil, other starch, other sugar, a binder, a preservative, a humectant, a vitamin, and / or mineral); (e) a pharmaceutical; (!) raw or processed biomass (e.g., cellulosic and / or lignocellulosic material; silage); and (g) various industrial products.
[0054] Also provided herein are methods for detecting a DNA fragment comprising a modified ZmAN3 gene comprising a detectable amount of a DNA molecule comprising a heterologous transcription enhancer, a heterologous intron, and / or heterologous translational enhancing element located in a DNA fragment of a modified ZmAN3 gene in any of the aforementioned biological samples and commodity products. Non-limiting and illustrative examples of such DNA fragments include those wherein the SEQ ID NO: 6 or 8 enhancer is inserted. In certain embodiments, the DNA fragment that is detected in the biological samples and commodityproducts comprises the sequence of SEQ ID NO: 7. Detection of the DNA molecules comprising insertions and / or substitutions of the enhancer in the transcriptional regulatory region can be achieved by any combination of nucleic acid amplification (e.g, PCR amplification), hybridization, sequencing, and / or mass-spectrometry based techniques. Methods set forth for detecting foreign nucleic acids in transgenic loci set forth in US 20190136331 and US 9,738.904, both incorporated herein by reference in their entireties, can be adapted for use in detection of the nucleic acids provided herein. In certain embodiments, such detection is achieved by amplification and / or hybridization-based detection methods using a method (e.g., selective amplification primers) and / or probe (e.g., capable of selective hybridization or generation of a specific primer extension product) which specifically recognizes the target DNA molecule (e.g., a heterologous transcription enhancer, a heterologous intron, and / or heterologous translational enhancing element located in a DNA fragment of a modified ZmAN3 gene) but does not recognize DNA from an unmodified ZmAN3 gene. In certain embodiments, the hybridization probes (e.g, polynucleotides comprising at least about 18 to 30 base pairs) can comprise detectable labels (e.g., fluorescent, radioactive, epitope, and chemiluminescent labels). In certain embodiments, a single nucleotide polymorphism detection assay can be adapted for detection of the target DNA molecule (e.g, a heterologous transcription enhancer, a heterologous intron, and / or heterologous translational enhancing element located in a DNA fragment of a modified ZmAN3 gene).
[0055] In certain embodiments, maize plant cells, plant parts (e.g.. seeds), and plants comprising the at least one modified ZmAN3 gene and at least one mutation in a distinct maize gene are provided. Non-limiting examples of mutations in distinct maize genes that may be combined with the at least one modified ZmAN3 gene include a mutation in any one or a combination of the maize Decl gene, Zmm28 gene. ZmCle7 gene, ZmClele5 gene, and / or ZmFCPl gene(s). In certain embodiments, the at least one modified ZmAN3 gene or an allelic variant thereof is combined with a mutation in the maize Decl gene, optionally wherein the mutation in the Decl gene comprises an enhancer insertion in the Decl promoter. An endogenous and unmodified Decl gene allele, also identified as the Zmld31079 gene allele, is set forth in the “MaizeGDB” (maize genome database world wide web internet site “mai zegdb.org") under accession number Zm00001d031079 and encodes the Decl protein. Mutations of the maize Decl gene which include enhancer insertions in the Decl promoter arefurther described in International Pub. No. WO2023 / 136966, which is herein incorporated byreference in its entirety.
[0056] In certain embodiments, the at least one modified ZmAN3 gene or an allelic variant thereof is combined with a mutation in the maize Zmm28 gene, optionally wherein the mutation in the Zmm28 gene comprises an enhancer insertion in the Zmm28 promoter or modulation of the promoter. In certain embodiments, modulation of the promoter comprises replacement of the endogenous promoter with a heterologous promoter element, such as aZmGOS2 promoter. Modulation of the Zmm28 promoter is described in US Pub. No. 2021 / 0155949, which is herein incorporated by reference in its entirety'. An endogenous and unmodified Zmm28 gene allele is set forth in the “MaizeGDB” (maize genome database world wide web internet site “maizegdb.org”) under accession number Zm00001d022088 and encodes the Zmm28 protein.
[0057] In certain embodiments, the at least one modified ZmAN3 gene or an allelic variant thereof is combined with a mutation in the maize ZmCle7 gene and / or maize ZmFCPl gene, optionally wherein the mutation in the ZmCle7 gene and / or ZmFCPl gene comprises a mutation in the ZmCle7 promoter and / or the ZmFCPl promoter. In some embodiments, the mutation results in the generation of a weak allele. Mutation of the ZmCle7 gene and / or maize ZmFCPl gene is described in US Pub. No. 2020 / 0199604, which is herein incorporated by reference in its entirety-. An endogenous and unmodified ZmCle7 gene allele is set forth in the “MaizeGDB” (maize genome database world wide web internet site “maizegdb.org”) under accession number GRMZM2G372364 and encodes the ZmCle7 protein. The ZmCle7 gene promoter is located at nucleotides 8,335,426 to 8,337,739 of chromosome 4 of the Zea Mays B73 v4 genome assembly. An endogenous and unmodified ZmFCPl gene allele is set forth in the “MaizeGDB” (maize genome database world w ide w eb internet site “maizegdb.org”) under accession number Zm00001eb079890 and encodes the ZmFCPl protein. The ZmFCPl gene promoter is located at nucleotides 40, 125,200 to 40.126.537 of chromosome 2 of the Zea Mays B73 v4 genome assembly.
[0058] In certain embodiments, the at least one modified ZmAN3 gene or an allelic variant thereof is combined w ith a mutation in the maize ZmClele5 gene, optionally wherein the mutation in the ZmClele5 gene comprises a mutation in the ZmClele5 coding region. In some embodiments, the mutation generates a null ZmClele5 allele. An endogenous and unmodified ZmClele5 gene allele is set forth in the “MaizeGDB” (maize genome database world wide w ebinternet site “maizegdb.org”) under accession number GRMZM2G434380 and encodes the ZmClele5 protein.
[0059] Inbred and hybrid maize plants and seeds comprising a modified ZmAN3 gene are provided herein along with methods for making and using such hybrid and inbred seed. Methods for inbred seed production include selfing inbred maize plants and restricting crosspollination by any maize plants other than the inbred maize plant. Methods for production of such hybrid seed can comprise crossing elite crop maize plant lines where at least one of the pollen donor or recipient comprises the modified ZmAN3 gene comprising an expression enhancing element (e.g. transcriptional enhancer). In certain embodiments, methods of making hybrid seed can comprise crossing elite crop maize plant lines where the pollen recipient comprises the modified ZmAN3 gene comprising an expression enhancing element (e.g. transcriptional enhancer) and where the pollen recipient is homozygous for the modified ZmAN3 gene. In certain embodiments, methods of making hybrid seed can comprise crossing elite crop maize plant lines where both the pollen donor and recipient comprise the modified ZmAN3 gene comprising an expression enhancing element (e.g. transcriptional enhancer) and where both the pollen donor and pollen recipient are homozygous for the modified ZmAN3 gene. Methods for hybrid seed production have been disclosed (MacRobert, J.F., P S. Setimela, J. Gethi, and M. Worku. 2014. Maize Hybrid Seed Production Manual. Mexico, D.F.: CIMMYT) and can be adapted to the production of hybrids disclosed herein. In certain embodiments, the inbred maize plant, the hybrid maize plant, the pollen donor and / or the pollen recipient can each comprise a transgenic locus which confers a trait (e.g., herbicide tolerance or insect resistance such as coleopteran or lepidopteran insects). Transgenes that can be introduced into the maize plant lines comprising a modified ZmAN3 gene by breeding or bydirect transformation include: (i) transgenes that confer insect resistance (e.g., transgenes that produce Bacillus thuringiensis proteins including Cry 1 Ab, Cry 1 Ac, Cry IF, Cry 2 Ab. Cry2Ae. Cry3A, Cry3Bb, Cry9c, Cry34, Cry35, VIP3A, and variants thereof; transgenes that induce insect-inhibitory RNAi responses); and (ii) transgenes that confer tolerance to distinct herbicides (e.g., CP4-EPSPS or other EPSPS genes which confer glyphosate tolerance; PAT or BAR genes which confer resistance to glufosinate herbicides; aad-1 genes which confer resistance to 2,4-D and aryloxyphenoxypropionate herbicides; DM0 genes which confer resistance to dicamba herbicide). Examples of selected transgenic maize plant events which contain transgenes that confer traits such as herbicide tolerance and / or pest tolerance aredisclosed in U.S. Patent Nos. 6342660, 7956246, 8575434, 7314970, 8759618, 6852915, 10316330, 8618358. 8450561, 8686230, 9428765, 8455720, 7897748. 8273959, 8093453, 8502047. and 8466346, which are each incorporated herein by reference in their entireties.
[0060] In certain embodiments, maize plants provided herein which comprise a modified ZmAN3 gene can further comprise one or more targeted genetic changes introduced by one or more of gene editing molecules or systems. Such targeted genetic changes include those conferring traits such as improved yield, improved food and / or feed characteristics (e.g, improved oil, starch, protein, or amino acid quality or quantity), improved nitrogen use efficiency, improved biofuel use characteristics, herbicide tolerance (e.g.. by targeting endogenous ALS, EPSPS, HPPD, or other herbicide target genes), delayed flowering, nonflowering, increased biotic stress resistance (e.g., resistance to insect, nematode, bacterial, or fungal damage), increased abiotic stress resistance (e.g, resistance to drought, cold, heat, metal, or salt), enhanced lodging resistance, enhanced growth rate, enhanced biomass, enhanced branching, delayed flowering time, delayed senescence, increased flower number, improved architecture for high density planting, improved photosynthesis, increased root mass, increased cell number, improved seedling vigor, improved seedling size, increased rate of cell division, improved metabolic efficiency, and increased meristem size in comparison to a control maize plant lacking the targeted genetic change. Types of targeted genetic changes that can be introduced include insertions, deletions, and substitutions of one or more nucleotides in the maize plant genome. Sites in endogenous maize plant genes for the targeted genetic changes include promoter, coding, and non-coding regions (e.g., 5’ UTRs, introns, splice donor and acceptor sites and 3’ UTRs). In certain embodiments, the targeted genetic change comprises an insertion of a regulatory or other DNA sequence in an endogenous maize plant gene. Non-limiting examples of regulatory sequences which can be inserted into endogenous maize plant genes with gene editing molecules to effect targeted genetic changes which confer useful phenotypes include those set forth in US Patent Application Publication 20190352655, which is incorporated herein by reference in its entirety, such as: (a) auxin response element (AuxRE) sequence; (b) at least one Dl-4 sequence (Ulmasov et al. (1997) Plant Cell, 9: 1963- 1971), (c) at least one DR5 sequence (Ulmasov et al. (1997) Plant Cell, 9: 1963-1971); (d) at least one m5-DR5 sequence (Ulmasov et al. (1997) Plant Cell, 9: 1963-1971); (e) at least one P3 sequence; (I a small RNA recognition site sequence bound by a corresponding small RNA (e.g., an siRNA, a microRNA (miRNA), a trans-acting siRNA as described in U.S. Patent No.8,030,473, or a phased sRNA as described in U.S. Patent No. 8,404,928; both of these cited patents are incorporated by reference herein); (g) a microRNA (miRNA) recognition site sequence; (h) a microRNA (miRNA) recognition sequence for an engineered miRNA wherein the specific binding agent is the corresponding engineered mature miRNA; (i) a transposon recognition sequence; (j) a sequence recognized by an ethylene-responsive element bindingfactor-associated amphiphilic repression (EAR) motif; (k) a splice site sequence (e.g., a donor site, a branching site, or an acceptor site; see, for example, the splice sites and splicing signals set forth in the internet site lemur[dot]amu[dot]edu[dot]pl / share / ERISdb / home.html); (1) a recombinase recognition site sequence that is recognized by a site-specific recombinase; (m) a sequence encoding an RNA or amino acid aptamer or an RNA riboswitch, the specific binding agent is the corresponding ligand, and the change in expression is upregulation or downregulation; (n) a hormone responsive element recognized by a nuclear receptor or a hormone-binding domain thereof; (o) a transcription factor binding sequence; and (p) a poly comb response element (see Xiao et al. (2017) Nature Genetics, 49: 1546-1552, doi: 10.1038 / ng.3937). Non-limiting examples of target maize genes that can be subjected to targeted gene edits to confer useful traits include quality and herbicide tolerance traits. In certain embodiments, such targeted genetic changes can be combined with plants which comprise the modified ZmAN3 gene by breeding techniques. Such breeding techniques include crossing and / or introgression by backcrossing to a recurrent parent. In such crosses, the plants which comprise the modified ZmAN3 gene can be either a pollen donor or recipient. In certain embodiments, plants which comprise the modified ZmAN3 gene can be used as the recunent parent in such backcrosses to introgress the targeted genetic change into plant germplasm comprising the modified ZmAN3 gene. In certain embodiments, plants which comprise the target genetic change(s) can be used as the recunent parent in such backcrosses to introgress the genomic region comprising the modified ZmAN3 gene into plant germplasm comprising the target genetic change(s).
[0061] In certain embodiments, plants provided herein which comprise a modified ZmAN3 gene can further comprise one or more genetic loci conferring traits such as improved yield, improved food and / or feed characteristics (e.g.. improved oil, starch, protein, or amino acid quality or quantity), improved nitrogen use efficiency, improved biofuel use characteristics (e.g., improved ethanol production), tolerance to herbicides (e.g., by targeting endogenous ALS, EPSPS, HPPD, or other herbicide target genes), delayed flowering, non-flowering,increased biotic stress resistance (e.g., resistance to insect, nematode, bacterial, or fungal damage), increased abiotic stress resistance (e.g., resistance to drought, cold, heat, metal, or salt), enhanced lodging resistance, enhanced growth rate, enhanced biomass, enhanced tillering, enhanced branching, delayed flowering time, delayed senescence, increased flower number, improved architecture for high density planting, improved photosynthesis, increased root mass, increased cell number, improved seedling vigor, improved seedling size, increased rate of cell division, improved metabolic efficiency, and increased meristem size in comparison to a control plant lacking the targeted genetic change. Sources of such genetic loci include elite cultivars, sexually compatible wild or other relatives (e.g., Zea sp.), plant germplasm which has been subjected to random mutagenesis (e.g., with a chemical mutagen such as EMS or with gamma-ray mutagenesis), and the like. In certain embodiments, such genetic loci can be combined with plants which comprise the modified ZmAN3 gene by breeding techniques. Such breeding techniques include crossing and / or introgression by backcrossing to a recurrent parent. In such crosses, the plants w hich comprise modified ZmAN3 gene can be either a pollen donor or recipient. In certain embodiments, plants which comprise the modified ZmAN3 gene can be used as the recurrent parent in such backcrosses to introgress the genetic locus into plant germplasm comprising the genetically altered transcriptional regulatory region. In certain embodiments, plants which comprise the genetic locus or loci can be used as the recurrent parent in such backcrosses to introgress the genomic region comprising modified ZmAN3 gene into plant germplasm comprising the genetic locus or loci.
[0062] Also provided herein are methods for producing a commodity plant product or plant material comprising growing any of the aforementioned plants comprising the modified ZmAN3 gene or growing plants from seeds comprising the modified ZmAN3 gene. In certain embodiments, such plants and / or seeds are irrigated, fertilized, and / or treated with a biological agent (e.g.. a plant beneficial microorganism including a Bacillus sp.. a Rhizobium sp., a Bradyrhizobium sp., and the like), nematicide (e.g., a carbamate or organophosphate insecticide), insecticide (e.g., a neonicotinoid, pyrethroid, carbamate, or organophosphate insecticide) and / or fungicide (e.g., a benzimidazole, imidazole, or strobilurin fungicide). Plants can be treated with such fertilizers, biological agents, nematicides, insecticides, and fungicides by methods including spraying, fumigating, and / or soil drenching. Seeds can be treated with such fertilizers, biological agents, nematicides, insecticides, and fungicides by methods including in-furrow' applications or by coating (e.g., with a drum coater, rotary coater, tumblingdrum, fluidized bed, and / or spouted bed apparatus). Methods and compositions including various binders, fillers, film coats, and active ingredients such as fertilizers, surfactants, plant growth regulators, crop desiccants, fungicides, bactenocides, bacteriostats, insecticides, and insect repellants for coating seeds that can be adapted for use with seeds provided herein are disclosed in US Patent No. 10745578, which is incorporated herein by reference in its entirety.Embodiments
[0063] Various embodiments of the DNA molecules, plants, plant parts, genomes, chromosomes, methods, biological samples, and other compositions described herein are set forth in the following set of numbered embodiments.
[0064] 1. A maize plant comprising a modified ZmAN3 gene wherein a heterologous expression enhancing element is located in the modified gene, and wherein the unmodified ZmAN3 gene comprises the DNA molecule of SEQ ID NO: 1 or an allelic variant thereof.
[0065] 2. The maize plant of embodiment 1, wherein the modified ZmAN3 gene and / or the unmodified ZmAN3 gene encode the ZmAN3 protein of SEQ ID NO: 2 or an allelic variant thereof.
[0066] 3. The maize plant of embodiment 1 or 2, wherein the heterologous expression enhancing element comprises: (i) a heterologous transcription enhancer, a heterologous translational enhancing element, and / or a heterologous intron; or (ii) a heterologous promoter, heterologous 5’ UTR, and / or heterologous intron.
[0067] 4. The maize plant of embodiment 3, wherein the heterologous transcription enhancer is located in the promoter, the 5’ untranslated region (5’ UTR), an intron, a 3’ untranslated region (3’ UTR), or a 3’ flanking region of the modified ZtnAN3 gene.
[0068] 5. The maize plant of embodiment 3 or 4, wherein the heterologous transcription enhancer comprises a DNA molecule set forth in SEQ ID NO: 6. 8-56. and / or an enhancer set forth in Table 1.
[0069] 6. The maize plant of any one of embodiments 3-5, wherein the transcription enhancer is located about 10, 20, 30, 35, 40, 45, or 50 base pairs (bp) to about 60, 65, 70, 75, 80, 90, 100, 150. or 200 bp 5’ of the translation start site (TSS) of the ZmAN3.
[0070] 7. The maize plant of any one of embodiments 3-6, wherein the transcription enhancer comprises SEQ ID NO: 8 or 9 and the insertion is located: (i) about 76 to about 36 base pairs or about 56 base pairs 5’ to the TSS of the ZmAN3 gene; or (ii) in a double strandedbreak introduced in the ZmAN3 promoter with a Casl2 nuclease and a Casl2 guide RNA comprising a spacer encoded by SEQ ID NO: 5.
[0071] 8. The maize plant of any one of embodiments 3-7. wherein the heterologous intron is located in the 5’ UTR and / or within the coding region of the modified ZmAN3 gene, optionally wherein the intron is located within about 500, 200, 100, 50, 30, or 20 base pairs of the translation start site (TSS).
[0072] 9. The maize plant of any one of embodiments 3-8, wherein the heterologous intron comprises a UBQ, EF-la, EF-1J3, Histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ, EF-la, EF-ip, Histone H3, ATPK1, RHD3, or MHX intron comprises a rice or maize intron.
[0073] 10. The maize plant of any one of embodiments 3-9, wherein the modified ZmAN3 gene comprises the heterologous transcription enhancer insertion of SEQ ID NO: 7.
[0074] 11. The maize plant of any one of embodiments 3-10, wherein the heterologous translational enhancer is located in the 5’ UTR and / or within the coding region of the modified ZmAN3 gene and optionally wherein translational enhancer is encoded by a DNA molecule comprising the DNA sequence of a rice alcohol dehydrogenase (OsAdh), glutathione transferase U50 (Os Gst U50), glutathione peroxidase 1 (Os Gsp 1), 20S proteasome alphal subunit (Os20Sal), pathogenesis-related protein 4b (OsPrp4b), glycine-rich cell-wall structural protein 1 (Os Grcwpl), or UspA domain containing protein (Os UspA) 5’UTR and wherein all or part of said OsAdh, Os GstU50, Os20Sal, OsPrp4b, Os Grcwpl. or Os UspA 5’UTR is substituted for all or part of the ZmAN3 5’ UTR in the modified ZmAN3 gene.
[0075] 12. The maize plant of any one of embodiments 1 to 11, wherein expression of the ZmAN3 is increased in at least one tissue of the maize plant in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein expression of the ZmAN3 is increased in at least leaf tissue or stem tissue.13. The maize plant of any one of embodiments 1 to 11, wherein;(i) leaf length, leaf area, and / or leaf width of the maize plant is increased in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein the leaf length and / or leaf width is increased by about 1% or 5% to about 7%, 10%, 12%, 15%, 30%, or 50% in comparison to a control maize plant lacking the modified ZmAN3 gene;(ii) leaf biomass of the maize plant is increased in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein the leaf biomass is increased by about1% or 5% to about 7%, 10%, 12%, 15%, 30%, or 50% in comparison to a control maize plant lacking the modified ZmAN3 gene;(iii) the leaf fraction fresh weight is increased in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein the leaf fraction fresh weight is increased by about 1% or 5% to about 10%, 15%, 22%, 30%, or 50% in comparison to a control maize plant lacking the modified ZmAN3 gene;(iii) the leaf fraction dry weight is increased in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein the leaf fraction dry weight is increased by about 1% or 5% to about 10%, 15%, 17%, or 22%, 30%, or 50% in comparison to a control maize plant lacking the modified ZmAN3 gene;(iv) the stem fraction dry weight is increased in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein the stem fraction dry weight is increased by about 1% or 5% to about 10%, 15%, or 30% in comparison to a control maize plant lacking the modified ZmAN3 gene;(v) the 1000 kernel weight is increased in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein the 1000 kernel weight is increased by about 1% or 5% to about 10%, 15%, 20%, 30%, or 50% in comparison to a control maize plant lacking the modified ZmAN3 gene; and / or(vi) wherein the number of long kernels is decreased in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein the number of long kernels is decreased by about 1% or 5% to 10%, 15%, or 20%.
[0076] 14. The maize plant of any one of embodiments 1 to 13, wherein the maize plant is a hybrid maize plant which is heterozygous or homozy gous for the modified ZmAN3 gene.
[0077] 15. The maize plant of any one of embodiments 1 to 14, wherein expression of a ZmAN3 gene product in a plant having the modified ZmAN3 gene is increased by about 20% to 80% in at least one tissue in the maize plant in comparison to a control maize plant lacking the modified ZmAN3 gene.
[0078] 16. The maize plant of any one of embodiments 1 to 15, wherein expression of a ZmAN3 gene product in a plant having the modified ZmAN3 gene is increased by about 1.2- fold or 1.5-fold to about 2-fold, 3-fold, or 5 -fold in at least one maize tissue in the maize plant in comparison to a control maize plant lacking the modified ZmAN3 gene and / or wherein the maize plant further comprises a second modified endogenous gene, optionally wherein thesecond modified endogenous gene is a maize Decl gene comprising an enhancer insertion in the Decl gene promoter, a maize Zmm28 gene comprising a replacement of the endogenous Zmm28 gene promoter with a heterologous promoter, a maize ZmCle7 gene comprising a mutation in the ZmCle7 gene promoter, a maize ZmClele5 gene comprising a mutation in the ZmClele5 coding region, and / or a maize ZmFCPl gene comprising a mutation in the ZmFCPl gene promoter.
[0079] 17. A maize plant part comprising the modified ZmAN3 gene of any one of embodiments 1 to 16.
[0080] 18. The maize plant part of embodiment 17, wherein the part is a seed, stalk, stem, or leaf.
[0081] 19. The maize plant part of embodiment 18, wherein the seed further comprises at least a partial coating of a composition comprising a biological agent, nematicide, insecticide, or fungicide.
[0082] 20. The maize plant part of any one of embodiments 17-20, wherein the maize plant seed is a hybrid maize plant seed which is heterozygous or homozygous for the modified ZmAN3 gene.
[0083] 21. A method of producing maize seed, comprising growing the maize plant of any one of embodiments 1 to 16 and harvesting seed therefrom.
[0084] 22. A method of producing hybrid maize seed comprising crossing a maize plant homozygous for the modified ZmAN3 gene set forth in any one of embodiments 1 to 16 to another maize plant homozygous for the modified ZmAN3 gene and harvesting seed from a pollen recipient of the cross.
[0085] 23. A method of producing a maize plant comprising an added desired trait, said method comprising introducing a transgene, a targeted genetic change, and / or a genetic locus conferring the desired trait into the maize plant of any one of embodiments 1 to 16.
[0086] 24. A method of producing a commodity maize plant product, said method comprising: (i) processing a maize plant of any one of embodiments 1 to 16 or a maize seed obtained therefrom; and (ii) recovering the commodity maize plant product from the processed maize plant or maize seed.
[0087] 25. The method of embodiment 24, wherein the commodity maize plant product is seed meal, starch, syrup, silage, oil, or protein.
[0088] 26. The method of embodiment 24 or 25, wherein the commodity maize plant product comprises a detectable amount of a DNA molecule comprising the heterologous transcription enhancer, the heterologous translational enhancing element, and / or the heterologous intron located in a DNA fragment of the modified ZmAN3 gene.
[0089] 27. A biological sample comprising a detectable amount of a DNA molecule comprising a heterologous transcription enhancer, a heterologous intron, and / or heterologous translational enhancing element located in a DNA fragment of a modified ZmAN3 gene.
[0090] 28. The biological sample of embodiment 27, wherein the biological sample comprises material obtained from the maize plant of any one of embodiments 1 to 16 or a part thereof, wherein the part is optionally a seed.
[0091] 29. The biological sample of embodiment 27 or 28, wherein the biological sample is non-regenerable.
[0092] 30. The biological sample of any one of embodiments 27-29, wherein the biological sample comprises maize seed meal.
[0093] 31. A method of making a maize plant of any one of embodiments 1 to 16, comprising: (a) contacting a maize plant genome with gene editing molecules comprising a first site-specific nuclease which introduces a double stranded DNA break in a promoter region, a 5’ UTR, a coding region, a 3’ UTR, or a 3’ flanking region in an unmodified ZmAN3 gene comprising the DNA molecule of SEQ ID NO: 1 or an allelic variant thereof; and a donor DNA template or other DNA template comprising a heterologous expression enhancing element; and (b) selecting a maize plant comprising a modified ZmAN3 gene, wherein the modified ZmAN3 gene comprises an insertion of the heterologous expression enhancing element in the promoter region, the 5’ UTR, the coding region, the 3’ UTR, or the 3’ flanking region of the gene, wherein expression of the modified ZmAN3 gene is increased in at least one tissue, and wherein leaf length, leaf width, leaf area, leaf fraction fresh weight, leaf fraction dry weight, stem fraction dry weight, and / or 1000 kernel weight of the maize plant comprising the modified ZmAN3 gene is increased in comparison to a control maize plant lacking the modified ZmAN3 gene.
[0094] 32. The method of embodiment 31. wherein the heterologous expression enhancing element comprises a heterologous transcription enhancer, a heterologous translational enhancing element, and / or a heterologous intron.
[0095] 33. The method of embodiment 31 or 32, wherein the double stranded break is introduced in the promoter, the 5' untranslated region (5’ UTR), an intron, a 3' untranslated region (3’ UTR). or a 3’ flanking region of the unmodified ZmAN3 gene and the donor DNA template or other DNA template comprises the heterologous transcription enhancer.
[0096] 34. The method of any one of embodiments 32-33, wherein the transcription enhancer comprises a DNA molecule set forth in SEQ ID NO: 6, 8-56, and / or an enhancer set forth in Table 1.
[0097] 35. The method of any one of embodiments 32-34, wherein the double stranded break is introduced about 10, 20, 30, 35, 40, 45, or 50 base pairs (bp) to about 60, 65, 70, 75, 80, 90, 100, 150, or 200 bp 5’ of the translation start site (TSS) of the ZmAN3.
[0098] 36. The method of any one of embodiments 32-35, wherein the transcription enhancer comprises SEQ ID NO: 8 or 9 and the double stranded break is introduced: (i) about 76 to about 36 base pairs or about 56 base pairs 5’ to the TSS of the ZmAN3 gene; or (ii) in a double stranded break introduced in the ZmAN3 promoter with a Casl2 nuclease and a Casl2 guide RNA comprising a spacer encoded by SEQ ID NO: 5.
[0099] 37. The method of any one of embodiments 31-36, wherein the donor DNA template or other DNA template comprises a heterologous translational enhancer and the double stranded break is introduced in the 5’ UTR and / or within the coding region of the unmodified ZmAN3 gene.
[0100] 38. The method of embodiment 37, wherein the translational enhancer is encoded by a DNA molecule comprising the DNA sequence of a rice alcohol dehydrogenase (OsAdh), glutathione transferase U50 (OsGst U50), glutathione peroxidase 1 (OsGsp 1), 20S proteasome alphal subunit (Os20Sal), pathogenesis-related protein 4b (OsPrp4b), glycine-rich cell-wall structural protein 1 (OsGrcwpl), or UspA domain containing protein (OsUspA) 5'UTR and wherein all or part of said OsAdh, OsGstU50. Os20Sal, OsPrp4b. OsGrcwpl, or OsUspA 5 ’UTR is substituted for all or part of the ZmAN3 5’ UTR in the modified ZmAN3 gene.
[0101] 39. The method of any one of embodiments 31-38, wherein the DNA donor template or other DNA template comprises a heterologous intron and the double stranded break is introduced in the 5’ UTR and / or within the coding region of the modified ZmAN3 gene, optionally wherein the double stranded break is introduced within about 500, 200, 100, 50, 30, or 20 base pairs of the TSS.
[0102] 40. The method of embodiment 39, wherein the heterologous intron comprises a UBQ10, EF-la, EF-1J3, Histone H3, ATPK1, RHD3. or MHX intron, optionally wherein the UBQ10, EF-la, EF-ip, Histone H3. ATPK1, RHD3, or MHX intron comprises a rice or maize intron.
[0103] 41. A maize plant made by the method of any of embodiments 31-40.EXAMPLESExample 1. Generation of maize with an insertion of a transcription enhancer in the ZmAN3 promoter
[0104] Maize gene ZmAN3 (Zm00001d033905; SEQ ID NO: 1) was targeted for insertion of a transcription enhancer (SEQ ID NO: 8) to increase expression of the genes and increase maize plant leaf size. The plasmid pIN1184 was created to transform maize plants and insert a transcription enhancer upstream of the ZmAN3 gene through CRISPR-mediated gene editing (Figures 1 & 2).
[0105] Immature embryos of a transgenic Bl 04 ‘"editor” maize line constitutively overexpressing a Cas nuclease polypeptide were harvested 13 days after pollination and transformed by biolistics with: a plasmid containing herbicide and visual selection markers (p35S::pat::tNOS and pZmUbi::mScarlet::tZmUbi), a single guide RNA for the CasB nuclease (SEQ ID NO: 5), and DNA of the 3x enhancer( / 5Phos / G*T*AAGCGCTTACGTAAGCGCTTACGTAAGCGCTT*A*C; SEQ ID NO: 8; * is a phosphorothioate bond) for NHEJ insertion. The Cas / gRNA complex results in a doublestranded break in the DNA 56 bp upstream of the transcription start site of ZmAN3. The guide RNA and DNA were from Integrated DNA Technologies (Coralville, IA, USA). Callus was induced, the transformed cells selected, and transformed TO generation plants regenerated by conventional methods. Hybrid plants were regenerated in TO and selected for further characterization.Example 2. Analysis of plants comprising an insertion of a transcription enhancer in the ZmAN3 promoters
[0106] TO plants such as those described in Example 1 were backcrossed to a B 104 wild type. The resulting T1 plants were analyzed for the presence / absence of the enhancer at the target site and T1 plants were grown in a greenhouse and subjected to phenotypic analysis, usingsiblings lacking the enhancer insertion as controls and focusing on plant leaf length and width and general plant development.
[0107] To assess the effect of the inserted enhancer sequence on the expression level of ZmAN3, bulk RNA was extracted from harvested protoplasts, and converted to cDNA. Using qRT-PCR, the expression level of ZmAN3 was measured relative to that of ZmGADPH, a well-known reference gene; the data is summarized in Figure 3. In maize plant lines heterozygous for the ZmAN3 enhancer insertion the expression level of ZmAN3 was about 3- fold higher compared to control (null) plant lines lacking the enhancer insertion.
[0108] The 4th leaf length when counting from the base of the plant was measured daily for two weeks. FIG 4A shows measurements for 12-17 days after sowing. A significant difference between ZmAN3 enhancer insertion heterozygote seedling leaf length relative to the null control lacking the enhancer insertion (p-value < 0.05) is shown when statistically corrected for table effect (FIG. 4A).
[0109] Leaf width of the 4thleaf was measured on the 17thday after sowing. A significant difference between ZmAN3 enhancer insertion heterozygote seedling leaf width containing the enhancer insertion relative to the null controls lacking the enhancer insertion (p-value < 0.05) is shown when statistically corrected for table effect (FIG. 4B).Example 3. Further Analysis of plants comprising an insertion of a transcription enhancer in the ZmAN3 promoters
[0110] Plants such as those described in Example 2 will be backcrossed to a Bl 04 wild ty pe. The resulting T2 plants will be analyzed for the presence / absence of the enhancer at the target site and T2 plants will be grown in the field and subjected to phenoty pic analysis, using siblings lacking the enhancer insertion as controls and focusing on plant leaf length and width and general plant development.
[0111] Example 4. Field evaluation of plants comprising an insertion of a transcription enhancer in the ZmAN3 promoters
[0112] Homozygous Bl 04 inbred T4 plants were generated by crossing T3 ZmAN3 enhancer insertion Bl 04 plants descended from plants such as those described in Example 2. Heterozygous hybrid T4 plants were generated by crossing female T3 ZmAN3 enhancer insertion Bl 04 heterozygous plants descended from plants such as those described in Example 1 with male WT PHR03 plants lacking the enhancer insertion. Plants w ere grown in fields with their null counterparts in a randomized block design. Each line had four plots containing 4 row swith 45 plants per a row. These plants were subjected to phenoty pe analysis using their null siblings (lacking the enhancer insertion) as controls using two to four samples from each of the four plots.
[0113] Final plant height was measured as the distance between the soil level and the ligule of the flag leaf in ZmAN3 enhancer insertion homozygous inbreds and ZmAN3 enhancer insertion heterozy gous hybrids and their respective null controls lacking the enhancer insertion. There was no significant difference in plant height between ZmAN3 enhancer insertion homozygous inbreds and ZmAN3 enhancer insertion heterozygous hybrids and their respective null controls (Table 2).
[0114] Table 2. Average Final Plant Height.*EI =Enhancer Insertion
[0115] Final ear height was measured as the distance between the soil level and the base of the top ear in ZmAN3 enhancer insertion homozygous inbreds and ZmAN3 enhancer insertion heterozygous hybrids and their respective null controls lacking the enhancer insertion. There was no significant difference in ear height between ZmAN3 enhancer insertion homozy gous inbreds and ZmAN3 enhancer insertion heterozy gous hy brids and their respective null controls lacking the enhancer insertion (Table 3).
[0116] Table 3. Average Final Ear Height.*EI =Enhancer Insertion
[0117] Stalk diameter was measured for both the long and short axis in the middle of the first internode above the brace roots of ZmAN3 enhancer insertion homozygous inbreds and ZmAN3 enhancer insertion heterozygous hybrids and their respective null controls. There was no significant difference in stalk diameter between ZmAN3 enhancer insertion homozygousinbreds and ZmAN3 enhancer insertion heteroz gous hybrids and their respective null controls lacking the enhancer insertion (Table 4).
[0118] Table 4. Average Stalk Diameter*EI ^Enhancer Insertion
[0119] Flowering time was measured by recording the date of silking (date when approximately 50% of the plot has visible silk) and date of anthesis (date when approximately 50% of a plot has pollen flowing from at least 1.5” of main spike of tassel) ofZmAN3 enhancer insertion homozy gous inbreds and ZmAN3 enhancer insertion heterozygous hybrids and their respective null controls which lack the enhancer insertion. There was no significant difference in the date of silking or date of anthesis between ZmAN3 enhancer insertion homozygous inbreds and ZmAN3 heterozygous hybrids and their respective null controls lacking the enhancer insertion (Table 5).
[0120] Table 5. Average Flowering Date*EI =Enhancer Insertion
[0121] Average leaf area was calculated in ZmAN3 plants by sampling the second leaf below the top ear and the nineth unfolded leaf from the top and measuring the leaf area of each individual leaf. There was a significant increase (+7%) in leaf area in homozygous ZmAN3 enhancer insertion inbreds compared to their null controls lacking the enhancer insertion (FIG 5A & Table 6). There was no significant difference in the leaf area between heterozygous ZnAN3 enhancer insertion hybrids and their null controls lacking the enhancer insertion (FIG 5B & Table 6).
[0122] Table 6. Average Leaf Size*EI =Enhancer Insertion
[0123] Sixteen samples for each line (four plants from each of the four plots) were split into three fractions: cob, stem, and leaves. Each fraction was measured before (fresh weight) and after (dry weight) drying. The fresh weight was divided by the dry weight to calculate the percent dry matter. There was a significant increase in leaf fraction fresh weight (+22.5%) in homozygous ZmAN3 enhancer insertion plants compared to their null control plants lacking the enhancer insertion (FIG 6A & Table 7). There was also a significant increase in leaf fraction dry weight (+16.7%) and an increase in stem fraction dry weight (+9%) in ZmAN3 enhancer insertion homozygous inbred plants compared to their null control plants lacking the enhancer insertion (FIG 6B and Table 7). There was no significant change in any other fractions in ZmAN3 homozygous inbred lines (FIG 6A-B, Table 7). There was no significant change in any fresh weight or dry weight fractions in ZmAN3 enhancer insertion heterozygote hybrid plants compared to their null control plants lacking the enhancer insertion (FIG 7A-B & Table 8). There was no significant change in average percent dry matter in either the ZmAN3 enhancer insertion homozygous inbred or ZmAN3 enhancer insertion heterozygous hybrid lines compared to their respective null controls lacking the enhancer insertion (FIG 6C, FIG 7C, Table 7, & Table 8)
[0124] Table 7. Average Fractional Weights in ZmAN3 El Inbred Lines*EI =Enhancer Insertion
[0125] Table 8. Average Fractional Weights in ZmAN3 El Hybrid Lines*EI =Enhancer Insertion
[0126] The two middle rows (45 plants / row) of each of plot were manually harvested, threshed, cleaned, and weighed. There was no significant difference in yield per plot between ZmAN3 enhancer insertion (El) homozygous inbreds and ZmAN3 enhancer insertion heterozygous hybrids and their respective null control lines lacking the enhancer insertion (FIG 8A-B & Table 9).
[0127] Table 9. Average Yield Per Plot*EI =Enhancer Insertion
[0128] The two middle rows (45 plants / row) of each plot were manually harvested, threshed, and 100 seeds were weighed three times. These weights were converted to 1000 kernel weight for each plot. There was a significant increase (+16%) in 1000 kernel weight in ZmAN3 El homozygous inbreds compared with their null control line (FIG 9A & Table 10). There was no significant difference in 1000 kernel weight between ZmAN3 El heterozygous hybrids and their null control line (FIG 9B & Table 10).
[0129] Table 10. Average 1000 Kernel Weight*EI =Enhancer Insertion
[0130] Four cobs per a plot were dried and phenotyped. The number of round kernels and the number of long kernels were counted. There is a significant decrease (-14%) in the number oflong kernels in ZmAN3 enhancer insertion homozygous inbred lines compared to their null control lines (FIG 10A & Table 11). There is no significant difference in the kernels between ZmAN3 heterozygous lines compared to their null control lines (FIG 10B & Table 11).
[0131] Table 11. Average Com Ear Properties*EI =Enhancer Insertion
[0132] Four plants per a plot of ZmAN3 El homozygous inbreds and their respective null siblings and two plants per a plot of ZmAN3 El heterozygous hybrids and their respective null siblings were divided into three fractions: cob, stem, and leaves then chopped. Near-infrared reflectance spectroscopy (NIRS) was used to calculate the digestibility coefficient of organic matter. There was no significant difference in digestibility of plant material derived from ZmAN3 El homozygous inbreds and ZmAN3 El heterozygous hybrids compared with their respective null control lines (FIG 11A-B & Table 12).
[0133] Table 12. Average Digestibility Coefficient of Organic Matter*EI =Enhancer Insertion
[0134] Example 5. Evaluation of ZmAN3 expression levels
[0135] ZmAN3 expression levels were measured in ZmAN3 enhancer insertion (El) T4 inbred homozygous plants, ZmAN3 El T1 inbred heterozygous plants - segregating inbreds, and ZmAN3 El Fl hybrid heterozy gous plants as compared to null control plants (z.e.. plants containing a wild-type ZmAN3 gene lacking the enhancer insert).
[0136] Expression was measured in leaf samples. Plants were sampled 14 days after sowing, with 6 leaf punches of the 6th leaf of 2-week-old plants. RNA expression was measured based on qRT-PCR. RNA levels of two housekeeping genes. ZmGaPDh and ZmElFl. were measured in the samples to ensure that expression levels were consistent and stable across the samples. Results are shown in Tables 13 and 14.
[0137] Table 13. Inbred Expression LevelHetZ = heterozygous for ZmAN3 El; HZ = homozygous for ZmAN3 El; Ct = qRT-PCR cycle threshold; SE = standard error; Expression average: 2‘(Delta Ct); Expression fold change: 2'(Deltadelta ct (vs null))was usejca|cu|a(ethe expression fold change
[0138] Table 14. Hybrid Expression LevelHetZ = heterozygous for ZmAN3 El; HZ = homozygous for ZmAN3 El; Ct = qRT-PCR cycle threshold; SE = standard error; Expression average: 2'(Delta Ct); Expression fold change: 2'(Deltadelta ct (vs null))was usejca]CLl]atethe expression fold change
[0139] In conclusion, inbred expression levels display a dosage effect in the segregating T1 population and T4 population. Expression levels of ZmAN3 in plants homozy gous for the ZmAN3 enhancer insertion edit (two copies) is larger than for plants heterozygous for the ZmAN3 enhancer insertion edit (single copy), both of which are higher than for null edit control plants. In hybrids, expression levels in the Fl population heterozygous for the for ZmAN3 El enhancer insertion edit (single copy) is higher than control plants null for the enhancer insertion edit. The expression of an unedited ZmAN3 endogenous gene in leaf tissue is too low to reliably quantify fold change expression by enhancer insertion.
[0140] The breadth and scope of the present disclosure should not be limited by any of the above-described exemplary' embodiments but should be defined only in accordance with the following claims and their equivalents.
Claims
CLAIMSWhat is claimed is:1 . A maize plant comprising a modified ZmAN3 gene wherein a heterologous expression enhancing element is located in the modified gene, and wherein the unmodified ZmAN3 gene comprises the DNA molecule of SEQ ID NO: 1 or an allelic variant thereof.
2. The maize plant of claim 1 , wherein the modified ZmAN3 gene and / or the unmodified ZmAN3 gene encode the ZmAN3 protein of SEQ ID NO: 2 or an allelic variant thereof.
3. The maize plant of claim 1, wherein the heterologous expression enhancing element comprises: (i) a heterologous transcription enhancer, a heterologous translational enhancing element, and / or a heterologous intron; or (ii) a heterologous promoter, heterologous 5’ UTR, and / or heterologous intron.
4. The maize plant of claim 3, wherein the heterologous transcription enhancer is located in the promoter, the 5’ untranslated region (5’ UTR), an intron, a 3’ untranslated region (3’ UTR), or a 3’ flanking region of the modified ZmAN3 gene.
5. The maize plant of claim 3, wherein the heterologous transcription enhancer comprises a DNA molecule set forth in SEQ ID NO: 6, 8-56, and / or an enhancer set forth in Table 1.
6. The maize plant of claim 3, wherein the transcription enhancer is located about 10, 20, 30, 35, 40, 45, or 50 base pairs (bp) to about 60, 65, 70, 75, 80, 90, 100, 150, or 200 bp 5’ of the translation start site (TSS) of the ZmAN3.
7. The maize plant of claim 3, wherein the transcription enhancer comprises SEQ ID NO: 8 or 9 and the insertion is located:(i) about 76 to about 36 base pairs or about 56 base pairs 5’ to the TSS of the ZmAN3 gene; or(ii) in a double stranded break introduced in the ZmAN3 promoter with a Cast 2 nuclease and a Casl2 guide RNA comprising a spacer encoded by SEQ ID NO: 5.
8. The maize plant of claim 3, wherein the heterologous intron is located in the 5’ UTR and / or within the coding region of the modified ZmAN3 gene, optionally wherein the intron is located within about 500, 200, 100, 50, 30, or 20 base pairs of the translation start site (TSS).
9. The maize plant of claim 8, wherein the heterologous intron comprises a UBQ, EF-la, EF- ip, Histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ, EF-la, EF-ip, Histone H3, ATPK1. RHD3, or MHX intron comprises a rice or maize intron.
10. The maize plant of claim 3, wherein the modified ZmAN3 gene comprises the heterologous transcription enhancer insertion of SEQ ID NO: 7.
11. The maize plant of claim 3, wherein the heterologous translational enhancer is located in the 5’ UTR and / or within the coding region of the modified ZmAN3 gene and optionally wherein translational enhancer is encoded by a DNA molecule comprising the DNA sequence of a rice alcohol dehydrogenase (OsAdh), glutathione transferase U50 (Os Gst U50), glutathione peroxidase 1 (Os Gsp 1), 20S proteasome alphal subunit (Os20Sal), pathogenesis- related protein 4b (OsPrp4b), glycine-rich cell-wall structural protein 1 (Os Grcwpl). or UspA domain containing protein (Os UspA) 5 ’UTR and wherein all or part of said OsAdh, Os GstU50, Os20Sal, OsPrp4b, Os Grcwpl, or Os UspA 5’UTR is substituted for all or part of the ZmAN3 5’ UTR in the modified ZmAN3 gene.
12. The maize plant of any one of claims 1 to 11, wherein expression of the ZmAN3 is increased in at least one tissue of the maize plant in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein expression of the ZmAN3 is increased in at least leaf tissue or stem tissue.
13. The maize plant of any one of claims 1 to 11, wherein;(i) leaf length, leaf area, and / or leaf width of the maize plant is increased in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein the leaf lengthand / or leaf width is increased by about 1% or 5% to about 7%, 10%, 12%, 15%, 30%, or 50% in comparison to a control maize plant lacking the modified ZmAN3 gene;(ii) leaf biomass of the maize plant is increased in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein the leaf biomass is increased by about 1% or 5% to about 7%, 10%, 12%, 15%, 30%, or 50% in comparison to a control maize plant lacking the modified ZmAN3 gene;(hi) the leaf fraction fresh weight is increased in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein the leaf fraction fresh weight is increased by about 1% or 5% to about 10%, 15%, 22%, 30%, or 50% in comparison to a control maize plant lacking the modified ZmAN3 gene;(hi) the leaf fraction dry weight is increased in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein the leaf fraction dry weight is increased by about 1% or 5% to about 10%, 15%, 17%, 22%, 30%, or 50% in comparison to a control maize plant lacking the modified ZmAN3 gene;(iv) the stem fraction dry’ weight is increased in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein the stem fraction dry weight is increased by about 1% or 5% to about 10%, 15%, or 30% in comparison to a control maize plant lacking the modified ZmAN3 gene;(v) the 1000 kernel weight is increased in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein the 1000 kernel weight is increased by about 1% or 5% to about 10%, 15%, 20%, 30%, or 50% in comparison to a control maize plant lacking the modified ZmAN3 gene; and / or(vi) wherein the number of long kernels is decreased in comparison to a control maize plant lacking the modified ZmAN3 gene, optionally wherein the number of long kernels is decreased by about 1% or 5% to 10%. 15%. or 20%.
14. The maize plant of any one of claims 1 to 11, wherein the maize plant is a hybrid maize plant which is heterozygous or homozygous for the modified ZmAN3 gene.
15. The maize plant of any one of claims 1 to 11, wherein expression of a ZmAN3 gene product in a plant having the modified ZmAN3 gene is increased by about 20% to 80% in atleast one tissue in the maize plant in comparison to a control maize plant lacking the modified ZmAN3 gene.
16. The maize plant of any one of claims 1 to 11, wherein expression of a ZmAN3 gene product in a plant having the modified ZmAN3 gene is increased by about 1.2-fold or 1.5-fold to about 2-fold, 3-fold, or 5 -fold in at least one maize tissue in the maize plant in comparison to a control maize plant lacking the modified ZmAN3 gene and / or wherein the maize plant further comprises a second modified endogenous gene, optionally wherein the second modified endogenous gene is a maize Decl gene comprising an enhancer insertion in the Decl gene promoter, a maize Zmm28 gene comprising a replacement of the endogenous Zmm28 gene promoter with a heterologous promoter, a maize ZmCle7 gene comprising a mutation in the ZmCle7 gene promoter, a maize ZmClele5 gene comprising a mutation in the ZmClele5 coding region, and / or a maize ZmFCPl gene comprising a mutation in the ZmFCPl gene promoter.
17. A maize plant part comprising the modified ZmAN3 gene of any one of claims 1 to 11.
18. The maize plant part of claim 17, wherein the part is a seed, stalk, stem, or leaf.
19. The maize plant part of claim 18, wherein the seed further comprises at least a partial coating of a composition comprising a biological agent, nematicide, insecticide, or fungicide.
20. The maize plant part of claim 17, wherein the maize plant seed is a hybrid maize plant seed which is heterozygous or homozygous for the modified ZmAN3 gene.
21. A method of producing maize seed, comprising growing the maize plant of any one of claims 1 to 11 and harvesting seed therefrom.
22. A method of producing hybrid maize seed comprising crossing a maize plant homozygous for the modified ZmAN3 gene set forth in any one of claims 1 to 11 to another maize plant homozy gous for the modified ZmAN3 gene and harvesting seed from a pollen recipient of the cross.
23. A method of producing a maize plant comprising an added desired trait, said method comprising introducing a transgene, a targeted genetic change, and / or a genetic locus conferring the desired trait into the maize plant of any one of claims 1 to 11.
24. A method of producing a commodity maize plant product, said method comprising: (i) processing a maize plant of any one of claims 1 to 11 or a maize seed obtained therefrom; and (ii) recovering the commodity maize plant product from the processed maize plant or maize seed.
25. The method of claim 24, wherein the commodity maize plant product is seed meal, starch, syrup, silage, oil, or protein.
26. The method of claim 25, wherein the commodity maize plant product comprises a detectable amount of aDNA molecule comprising the heterologous transcription enhancer, the heterologous translational enhancing element, and / or the heterologous intron located in a DNA fragment of the modified ZmAN3 gene.
27. A biological sample comprising a detectable amount of a DNA molecule comprising a heterologous transcription enhancer, a heterologous intron, and / or heterologous translational enhancing element located in a DNA fragment of a modified ZmAN3 gene.
28. The biological sample of claim 27, wherein the biological sample comprises material obtained from the maize plant of any one of claims 1 to 11 or a part thereof, wherein the part is optionally a seed.
29. The biological sample of claim 27, wherein the biological sample is non-regenerable.
30. The biological sample of claim 29, wherein the biological sample comprises maize seed meal.
31. A method of making a maize plant of any one of claims 1 to 11 , comprising:(a) contacting a maize plant genome with gene editing molecules comprising a first sitespecific nuclease which introduces a double stranded DNA break in a promoter region, a 5' UTR. a coding region, a 3’ UTR, or a 3’ flanking region in an unmodified ZmAN3 gene comprising the DNA molecule of SEQ ID NO: 1 or an allelic variant thereof; and a donor DNA template or other DNA template comprising a heterologous expression enhancing element; and(b) selecting a maize plant comprising a modified ZmAN3 gene, wherein the modified ZmAN3 gene comprises an insertion of the heterologous expression enhancing element in the promoter region, the 5’ UTR, the coding region, the 3’ UTR, or the 3’ flanking region of the gene, wherein expression of the modified ZmAN3 gene is increased in at least one tissue, and wherein leaf length, leaf width, leaf area, leaf fraction fresh weight, leaf fraction dry weight, stem fraction dry weight, and / or 1000 kernel weight of the maize plant comprising the modified ZmAN3 gene is increased in comparison to a control maize plant lacking the modified ZmAN3 gene.
32. The method of claim 31, wherein the heterologous expression enhancing element comprises a heterologous transcription enhancer, a heterologous translational enhancing element, and / or a heterologous intron.
33. The method of claim 32, wherein the double stranded break is introduced in the promoter, the 5' untranslated region (5' UTR), an intron, a 3’ untranslated region (3’ UTR), or a 3’ flanking region of the unmodified ZmAN3 gene and the donor DNA template or other DNA template comprises the heterologous transcription enhancer.
34. The method of claim 33, wherein the transcription enhancer comprises a DNA molecule set forth in SEQ ID NO:
6. 8-56. and / or an enhancer set forth in Table 1.
35. The method of claim 33, wherein the double stranded break is introduced about 10, 20, 30, 35, 40, 45, or 50 base pairs (bp) to about 60, 65, 70, 75, 80, 90, 100, 150, or 200 bp 5’ of the translation start site (TSS) of the ZmAN3.
36. The method of claim 35, wherein the transcription enhancer comprises SEQ ID NO: 8 or 9 and the double stranded break is introduced:(i) about 76 to about 36 base pairs or about 56 base pairs 5’ to the TSS of the ZmAN3 gene; or(ii) in a double stranded break introduced in the ZmAN3 promoter with a Casl2 nuclease and a Casl2 guide RNA comprising a spacer encoded by SEQ ID NO: 5.
37. The method of claim 31, wherein the donor DNA template or other DNA template comprises a heterologous translational enhancer and the double stranded break is introduced in the 5' UTR and / or within the coding region of the unmodified ZmAN3 gene.
38. The method of claim 37, wherein the translational enhancer is encoded by a DNA molecule comprising the DNA sequence of a rice alcohol dehydrogenase (OsAdh), glutathione transferase U50 (OsGst U50), glutathione peroxidase 1 (OsGsp 1), 20S proteasome alphal subunit (Os20Sal), pathogenesis-related protein 4b (OsPrp4b), glycine-rich cell-wall structural protein 1 (OsGrcwpl), or UspA domain containing protein (OsUspA) 5’UTR and wherein all or part of said OsAdh, OsGstU50, Os20Sal, OsPrp4b, OsGrcwpl, or OsUspA 5 UTR is substituted for all or part of the ZmAN3 5?UTR in the modified ZmAN3 gene.
39. The method of claim 31, wherein the DNA donor template or other DNA template comprises a heterologous intron and the double stranded break is introduced in the 5’ UTR and / or within the coding region of the modified ZmAN3 gene, optionally wherein the double stranded break is introduced within about 500, 200, 100, 50, 30, or 20 base pairs of the TSS.
40. The method of claim 39, wherein the heterologous intron comprises a UBQ10, EF-la, EF-ip, Histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ10, EF-la, EF- 113. Histone H3, ATPK.
1. RHD3. or MHX intron comprises a rice or maize intron.
41. A maize plant made by the method of any of the claims 31-40.
Citation Information
Patent Citations
Chimeric proteins which enhance the activity of DNA binding domains (DBD) and transcription factors in plants
US20170362601A1