Liver-targeting protein degrader conjugate and use thereof

Abstract

A liver-targeting protein degrader conjugate and a use thereof. Specifically, the conjugate is as represented by formula (A), wherein variates are defined herein.

Description

Liver-targeted protein degrader conjugate and use thereof TECHNICAL FIELD

[0001] The present application belongs to the field of medicine, and particularly relates to a liver-targeted protein degrader conjugate and use thereof. BACKGROUND

[0002] Liver cancer is a malignant disease that seriously threatens human life and health. Due to the lack of specific drugs, the five-year survival rate of liver cancer patients is only 10%, and the clinical treatment situation is very severe. At present, the main clinical intervention means is limited by drug efficacy and safety, and it is urgent to develop new drug intervention methods. BET family proteins play an important role in normal cell growth and cell cycle regulation. Studies have shown that liver cancer cells respond well to BET inhibitors, which makes it a potential target for treating liver cancer. However, unfortunately, there is no approved BET inhibitor at present, and the main defect is that the traditional inhibitor has a short drug efficacy duration and has certain on-target toxicity, especially the high incidence of platelet toxicity in clinical practice.

[0003] In summary, there is an urgent need in the art to develop new liver-targeted drugs with low toxicity. SUMMARY

[0004] The purpose of the present application is to provide a liver-targeted protein degrader conjugate and its use in treating liver cancer and liver fibrosis.

[0005] In one aspect of the present application, a conjugate or a pharmaceutically acceptable salt thereof is provided, wherein the conjugate is represented by formula (A),

[0006] wherein,

[0007] the subscript z is 1, 2 or 3;

[0008] X a and X b is CH or N, and the other is CH;

[0009] L 1 is a linker moiety;

[0010] L P is a cleavable or non-cleavable linking group;

[0011] R is absent or represents 1 or 2 modifying groups;

[0012] A is R E3 -R Linker -; wherein R E3 is an E3 ligase ligand moiety, R Linkera linker for connecting the E3 ligase ligand moiety and the BET family protein binding moiety of formula (IA);

[0013] L 2 selected from the group consisting of amide, carbonyl, Ci-8alkylene-amide, Ci-8alkylene-carbonyl and Ci-15alkylene;

[0014] Ar is an aromatic or heteroaromatic ring;

[0015] Bm is a ligand for ASGPR.

[0016] In another preferred embodiment, subscript z is 1 or 2.

[0017] In another preferred embodiment, when z is 2 or 3, each may be different or the same, preferably the same.

[0018] In another preferred embodiment, Bm, L P , X a , X b , A, L 2 and Ar are as defined in formula (I).

[0019] In another preferred embodiment, when z is 1, the conjugate is of formula (I);

[0020] wherein Bm, L 1 , L P , X a , X b , A, L 2 and Ar are as defined hereinafter.

[0021] In another preferred embodiment, the conjugate is of formula (I),

[0022] wherein,

[0023] X a and X b are CH or N, the other is CH;

[0024] L 1 is a linker moiety;

[0025] L P is a cleavable or non-cleavable linker;

[0026] R is absent or represents 1 or 2 modifying groups;

[0027] A is R E3 -R Linker -; wherein R E3For the E3 ligase ligand moiety, R Linker For use with or without the E3 ligase ligand moiety and the BET family protein binding moiety as shown in Formula IA;

[0028] L 2 Selected from the following group: amide, carbonyl, C1-8 alkylene amide, C1-8 alkylene carbonyl and C1-15 alkylene;

[0029] Ar is an aromatic ring or a heteroaromatic ring;

[0030] Bm is a ligand of ASGPR.

[0031] In another preferred embodiment, Bm is as shown in equation IB;

[0032] in,

[0033] R B1 It can be -NHAc or -OH;

[0034] R B2 It is -OH or -PO3H2;

[0035] W Bn It can be CO or NH;

[0036] L B Each independently as such-(W B1 ) q1 -W Ba -(W B2 ) q2 -W Bb -(W B3 ) q3 -W Bc -(W B4 ) q4 - The divalent group shown; wherein...

[0037] W Ba W Bb and W Bc Each is independently selected from the following groups: none, O, CO, NH, CONH, and NHCO;

[0038] W B1 W B2 W B3 and W B4 Each is independently a C1-3 alkylene (preferably -CH2-) or a C1-2 alkylene -O (preferably -CH2CH2O-);

[0039] q1, q2, q3 and q4 are each independent integers from 0 to 15 (preferably 0, 1, 2, 3, 4, 5 or 6);

[0040] a is 1, 2 or 3.

[0041] In another preferred embodiment, at least q1 and q2 are not 0.

[0042] In another preferred embodiment, W Ba , W Bb and W Bc are not nothing.

[0043] In another preferred embodiment, q1 + q2 + q3 + q4 > 4.

[0044] In another preferred embodiment, each L B is the same or different.

[0045] In another preferred embodiment, L B has a length of 5 to 20 chain atoms.

[0046] In another preferred embodiment, Bm is selected from Table B below:

[0047] Table B

[0048] In another preferred embodiment, X a and X b are both CH.

[0049] In another preferred embodiment, R is absent or represents 1 or 2 groups selected from the group consisting of nitro, deuterium, halogen (such as fluorine, chlorine), Ci-4alkyl (such as methyl), Ci-4alkoxy (such as methoxy).

[0050] In another preferred embodiment, L P is preferably wherein is the point of attachment to L 1 ; is the point of attachment to NH in ; Z 1 and Z 2 are each independently nothing (absent) or an amino acid residue, Z 3 and Z 4 are each independently an amino acid residue.

[0051] In another preferred embodiment, Z 1 is nothing or a glycine residue; and / or, Z 2 is nothing or an amino acid residue selected from the group consisting of an L-glutamine residue, a D-glutamine residue, an L-glutamic acid residue, a D-glutamic acid residue, an L-aspartic acid residue, a D-aspartic acid residue, an L-alanine residue, a D-alanine residue and a glycine residue; and / or, Z3 selected from the group consisting of an L-valine residue, a D-valine residue, an L- alanine residue, a D-alanine residue, an L-phenylalanine residue, a D-phenylalanine residue, and a glycine residue; and / or, Z 4 selected from the group consisting of an L-alanine residue, a D-alanine residue, an L-citrulline residue, a D-citrulline residue, an L-asparagine residue, a D- asparagine residue, an L-lysine residue, a D-lysine residue, an L-phenylalanine residue, a D-phenylalanine residue, and a glycine residue.

[0052] In another preferred embodiment, L P is selected from the following table:

[0053] wherein, is a point of attachment to L 1 ; and is a point of attachment to .

[0054] In another preferred embodiment, when subscript z is 1, L 1 is a bivalent linker. In another preferred embodiment, when subscript z is 1s, L 1 is a trivalent linker. In another preferred embodiment, when subscript z is 1, L 1 is a tetravalent linker.

[0055] In another preferred embodiment, L 1 is -W La -(W L1 ) q1 -W Lb -[(W L2 ) q2 -W Lc -(W L3 ) q3 -W Ld ] z1 -; wherein,

[0056] W La , W Lc , and W Ld are each independently selected from the group consisting of null, W, C1-2alkylene, C1-2alkylene-W-, -W-C1-2alkylene, and C1-2alkylene-W-C1-2alkylene;

[0057] W Lb is selected from the group consisting of null, W, C1-2alkylene, C1-2alkylene-W-, -W-C1-2alkylene, C1-2alkylene-W-C1-2alkylene, W 1 , C1-2alkylene-W 1 , -W 1(-C1-2alkylene-)2, -C1-2alkylene-W 1 (-C1-2alkylene-)2, W 2 , C1-2alkylene-W 2 , -W 2 (-C1-2alkylene-)3, and -C1-2alkylene-W 2 (-C1-2alkylene-)3;

[0058] wherein,

[0059] W is each independently selected from the group consisting of O, S, CO, NH, CONH, NHCO, -C≡C-, -CH=CH-, and -NHCONH-;

[0060] W 1 is selected from the group consisting of -N=, -CH=, -CON=, -NHCON=;

[0061] W 2 is selected from the group consisting of =C=;

[0062] W L1 , W L2 , and W L3 are each independently C1-3alkylene (preferably -CH2-), or C1-2alkylene-O-C1-2alkylene (preferably -CH2OCH2-);

[0063] q1, q2, and q3 are each independently an integer from 0 to 20 (preferably an integer from 1 to 16);

[0064] the subscript z1 is 1, 2, or 3 (preferably 1 or 2).

[0065] In another preferred embodiment, when z1 is 1, W Lb is defined as W La , W Lc , and W Ld .

[0066] In another preferred embodiment, when z1 is 1, W Lb is selected from the group consisting of none, W, C1-2alkylene, C1-2alkylene-W-, -W-C1-2alkylene, and C1-2alkylene-W-C1-2alkylene.

[0067] In another preferred embodiment, when z1 is 2, W Lb is selected from the group consisting of W 1 , C1-2alkylene-W 1 , -W 1 (-C1-2alkylene-)2, and -C1-2alkylene-W 1 (-C1-2alkylene-)2 is none.

[0068] In another preferred embodiment, when z1 is 3, W Lb is selected from the group consisting of W 2 , C1-2alkylene-W 2 , -W 2 (-C1-2alkylene-)3, and -C1-2alkylene-W 2 (-C1-2alkylene-)3.

[0069] In another preferred embodiment, subscript z1 is identical to subscript z.

[0070] In another preferred embodiment, when z1 is 1, L 1 is -W La -(W L1 ) q1 -W Lb -(W L2 ) q2 -W Lc -(W L3 ) q3 -W Ld -.

[0071] In another preferred embodiment, L 1 is -W La -(W L1 ) q1 -W Lb -(W L2 ) q2 -W Lc -(W L3 ) q3 -W Ld -; wherein,

[0072] W La , W Lb , W Lc , and W Ld are each independently selected from the group consisting of none, W, C1-2alkylene, C1-2alkylene-W-, -W-C1-2alkylene, and C1-2alkylene-W-C1-2alkylene; wherein each W is independently selected from the group consisting of O, S, CO, NH, CONH, NHCO, -C≡C-, -CH=CH-, and -NHCONH-;

[0073] W L1 , W L2 , and W L3 are each independently C1-3alkylene (preferably -CH2-), or C1-2alkylene-O-C1-2alkylene (preferably -CH2OCH2-);

[0074] q1, q2, and q3 are each independently an integer from 0 to 20 (preferably an integer from 1 to 16).

[0075] In another preferred embodiment, W La is the end for connection to Bm, and W La is selected from the group consisting of NH, CO, -NH-Ci-2alkylene, -CO-Ci-2alkylene, and CO or NH is connected to Bm.

[0076] In another preferred embodiment, W Ld is the end for connection to L P , and W Ld is selected from the group consisting of none, CO, CONH.

[0077] In another preferred embodiment, q1, q2, and q3 are each independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15

[0078] In another preferred embodiment, L 1 is -W La -(W L1 ) q1 -W Ld - or L 1 is -W La -(W L1 ) q1 -W Lb -(W L2 ) q2 -W Ld -.

[0079] In another preferred embodiment, L 1 has a length of 5 to 50 chain atoms; preferably 8 to 40 chain atoms.

[0080] In another preferred embodiment, L 1 is selected from the following table:

[0081] wherein n and m are defined as q1, q2, and q3; is the point of connection to L P ; is the point of connection to Bm.

[0082] In another preferred embodiment, L 1 is a monovalent linker, L 1 is selected from the following table:

[0083] In another preferred embodiment, L 1 is a divalent linker, L 1 is selected from the following table:

[0084] In another preferred embodiment, L 1 is a trivalent linker, L 1 is selected from the following table:

[0085] In another preferred embodiment, n and m are each independently an integer from 1 to 15.

[0086] In another preferred embodiment, n is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13.

[0087] In another preferred embodiment, m is 1, 2, 3, 4, or 5.

[0088] In another preferred embodiment, the BET family protein binding moiety of Formula IA is of Formula IA-1 or IA-2

[0089] In another preferred embodiment, the BET family protein binding moiety of Formula IA is of Formula IA-2

[0090] In another preferred embodiment, L 2 , the amide is -CONH-, -CON(C1-8alkyl)-, and / or the carbonyl is -CO-.

[0091] In another preferred embodiment, L 2 , the amine moiety of the amide is attached to A.

[0092] In another preferred embodiment, L 2 is selected from the group consisting of -NHCO-, -(CH2) m , and -CO-; wherein m is an integer from 1 to 12.

[0093] In another preferred embodiment, the aromatic or heteroaromatic ring is substituted or unsubstituted.

[0094] In another preferred embodiment, Ar is a C6-10aromatic ring or a 5- to 10-membered heteroaromatic ring (preferably, the heteroaromatic ring is a nitrogen-containing heteroaromatic ring, more preferably, the nitrogen-containing heteroaromatic ring contains only nitrogen atoms as heteroatoms); preferably, Ar is a benzene ring or a 5- or 6-membered nitrogen-containing heteroaromatic ring (such as pyridine).

[0095] In another preferred embodiment, the C6-10aromatic ring or the 5- to 10-membered heteroaromatic ring is substituted or unsubstituted.

[0096] In another preferred embodiment, the benzene ring or the 5- or 6-membered nitrogen-containing heteroaromatic ring is substituted or unsubstituted.

[0097] In another preferred embodiment, in Ar, the substitution refers to replacement of one or more hydrogens in the group with a substituent selected from the group consisting of halogen, C1-4alkyl.

[0098] In another preferred embodiment, Ar is

[0099] In another preferred embodiment, R Linker is a linker for connecting the E3 ligase ligand moiety and the BET family protein binding moiety as shown in Formula IA.

[0100] In another preferred embodiment, R Linker is selected from the group consisting of:

[0101] wherein,

[0102] represents the point of attachment to the intermediate methylene group;

[0103] * represents the point of attachment to R E3

[0104] n is an integer from 0 to 20 (preferably, an integer from 3 to 13, such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13; more preferably, 7, 8, 9, 10, or 11).

[0105] In another preferred embodiment, R Linker is

[0106] wherein,

[0107] represents the point of attachment to the intermediate methylene group;

[0108] * represents the point of attachment to R E3

[0109] n is an integer from 0 to 20 (preferably, an integer from 3 to 13, such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13; more preferably, 7, 8, 9, 10, or 11).

[0110] In another preferred embodiment, R E3 is selected from the group consisting of:

[0111] wherein, W E3 is selected from the group consisting of: NH, a divalent radical formed from a click chemistry reaction (such as ). In another preferred embodiment, R E3 is selected from the group consisting of:

[0112] wherein,

[0113] R​​1 H or C1-3alkyl;

[0114] represents the point of attachment to the central methylene group.

[0115] In another preferred embodiment, A is selected from the group consisting of:

[0116] wherein,

[0117] n is an integer from 0 to 20 (preferably, an integer from 3 to 13, such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13; more preferably, 7, 8, 9, 10, or 11);

[0118] represents the point of attachment to L 2 ; and

[0119] represents the point of attachment to the central methylene group.

[0120] In another preferred embodiment,

[0121] is selected from the group consisting of:

[0122] In another preferred embodiment, the conjugate is selected from Table A

[0123] Table A

[0124] In a second aspect of the present application, there is provided a pharmaceutical composition comprising (i) a conjugate as described in the first aspect, or a pharmaceutically acceptable salt thereof, and (ii) one or more pharmaceutically acceptable carriers.

[0125] In another preferred embodiment, the pharmaceutical composition further comprises one or more additional therapeutic agents.

[0126] In another preferred embodiment, the therapeutic agent is a drug for treating or preventing a liver disease or a complication thereof.

[0127] In another preferred embodiment, the additional therapeutic agent is a PD1 / PD-L1 inhibitor.

[0128] In another preferred embodiment, the additional therapeutic agent is a kinase inhibitor.

[0129] In another preferred embodiment, the kinase inhibitor is selected from the group consisting of a VEGFR2 inhibitor, a VEGFR3 inhibitor, a PDGFRbeta inhibitor, a FLT3 inhibitor, a c-Kit inhibitor, or a combination thereof.

[0130] In another preferred embodiment, the additional therapeutic agent is sorafenib.

[0131] In a third aspect of the present application, there is provided a pharmaceutical combination comprising: (1) a conjugate of the first aspect, or a pharmaceutically acceptable salt thereof; and (2) one or more additional therapeutic agents.

[0132] In another preferred embodiment, the pharmaceutical combination is for use in the treatment or prevention of a liver disease; wherein the liver disease is a liver cancer and a liver fibrosis disease.

[0133] In another preferred embodiment, the additional therapeutic agent is as previously defined.

[0134] In a fourth aspect of the present application, there is provided a kit comprising: (1) a conjugate of the first aspect, or a pharmaceutically acceptable salt thereof; and (2) one or more additional therapeutic agents.

[0135] In another preferred embodiment, the kit is for use in the treatment or prevention of a liver disease; wherein the liver disease is a liver cancer and a liver fibrosis disease.

[0136] In another preferred embodiment, the additional therapeutic agent is as previously defined.

[0137] In a fifth aspect of the present application, there is provided a use of a conjugate of the first aspect, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for the treatment or prevention of a liver disease; wherein the liver disease is a liver cancer and a liver fibrosis disease.

[0138] In another preferred embodiment, the conjugate is further combinable with an additional therapeutic agent.

[0139] In another preferred embodiment, the additional therapeutic agent is as previously defined.

[0140] In a sixth aspect of the present application, there is provided a method of treating or preventing a liver disease, the method comprising administering to a subject in need thereof a therapeutically effective amount of a conjugate of the first aspect, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a conjugate of the first aspect, or a pharmaceutically acceptable salt thereof.

[0141] In another preferred embodiment, the liver disease is as previously defined.

[0142] In another preferred embodiment, the method further comprises administering to the subject in need one or more additional therapeutic agents.

[0143] In another preferred embodiment, the one or more additional therapeutic agents can be administered prior to, simultaneously with, or following the protein binding conjugate of the first aspect, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the protein binding conjugate of the first aspect, or a pharmaceutically acceptable salt thereof.

[0144] In another preferred embodiment, the additional therapeutic agent is as previously defined.

[0145] It should be understood that, in the scope of the present application, all the technical features described above and in the following (e.g. in the examples) of the present application can be combined with each other to form new or preferred technical solutions. Due to the limited space, they are not listed one by one here. BRIEF DESCRIPTION OF DRAWINGS

[0146] Figure 1 shows the protein degradation activity of representative conjugates.

[0147] Figure 2 shows the difference in degradation activity of representative conjugates.

[0148] Figure 3 shows the difference in in vitro anti-tumor activity of representative conjugates.

[0149] Figure 4 shows the in vivo anti-tumor activity of representative conjugates.

[0150] Figure 5 shows the in vivo platelet toxicity of representative conjugates.

[0151] Figure 6 shows the in vitro anti-hepatic fibrosis activity of representative conjugates.

[0152] Figure 7 shows the in vivo anti-hepatic fibrosis activity of representative conjugates. DETAILED DESCRIPTION

[0153] After long-term and in-depth research, the present inventors have found a class of liver-targeting protein degrader conjugates with novel structures, which have good in vitro and in vivo stability. Based on this, the present inventors have completed the present application.

[0154] TERMS

[0155] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. As used herein, the term “about,” when used in reference to a particular recited numerical value, means that the value can vary from the recited value by not more than 1%. For example, the expression “about 100” includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0156] As used herein, the term “chain atom” refers to an atom in a chain-like group that is located on the main chain.

[0157] As used herein, the term "alkyl," by itself or as part of another substituent, means, unless otherwise indicated, a straight-chain or branched-chain hydrocarbon residue having the number of carbon atoms designated (i.e., C 1-6 Preferably, alkyl is specifically 1 to 4 carbons, i.e., C 1-4 alkyl. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, t-butyl, i-butyl, sec-butyl, n-pentyl, n-hexyl, n-heptyl, n-octyl, and the like.

[0158] As used herein, the term "alkylene," by itself or as part of another substituent, means a divalent group derived from an alkane as previously defined. Alkylene groups typically have from 1 to 24 (preferably 1 to 10) carbon atoms.

[0159] As used herein, the term "cycloalkyl" means a hydrocarbon ring that is fully saturated or has no more than one double bond between ring members (preferably a fully saturated hydrocarbon ring) having the number of ring atoms designated (e.g., C3-20 cycloalkyl, C4-6 cycloalkyl). The term also includes bicyclic and polycyclic hydrocarbon rings, which can be fused, bridged, spiro, and the like. The term "heterocycloalkyl" means a cycloalkyl group having the number of ring atoms designated (e.g., 4-20 membered heterocycloalkyl) and containing one to five heteroatoms selected from N, O, and S, wherein the nitrogen and sulfur atoms are optionally oxidized and the nitrogen atom(s) are optionally quaternized. Heterocycloalkyl groups can be monocyclic, bicyclic or polycyclic ring systems (which can be fused, bridged, spiro, and the like). Non-limiting examples of heterocycloalkyl groups include pyrrolidine, imidazoline, pyrazoline, butyrolactam, valerolactam, imidazolidinone, hydantoin, dioxolane, phthalimide, piperidine, 1,4-dioxane, morpholine, thiomorpholine, thiomorpholine-S-oxide, thiomorpholine-S,S-oxide, piperazine, pyran, pyridone, 3-pyrroline, thiopyran, pyrone, tetrahydrofuran, tetrahydrothiophene, quinuclidine, and the like. Heterocycloalkyl groups can be attached to the rest of the molecule by a ring carbon or heteroatom.

[0160] Unless otherwise indicated, the terms "aryl" or "aromatic ring" mean a polyunsaturated, (usually aromatic) hydrocarbon group having the specified number of ring atoms that is either a single ring (monocyclic) or multiple rings (fused or linked) that are either fused together or linked by covalent bonds (up to three rings). The term "heteroaryl" or "heteroaromatic ring" means an aryl group (or ring) that contains from one to five heteroatoms selected from N, O, and S, wherein the nitrogen and sulfur atoms are optionally oxidized and the nitrogen atom(s) are optionally quaternized. The heteroaryl group can be attached to the remainder of the molecule through a carbon or heteroatom. Non-limiting examples of aryl groups include phenyl, naphthyl, and biphenyl, while non-limiting examples of heteroaryl groups include pyridyl, pyridazinyl, pyrazinyl, pyrimidinyl, triazinyl, quinolinyl, quinoxalinyl, quinazolinyl, cinnolinyl, phthalazinyl, benzotriazinyl, purinyl, benzimidazolyl, benzopyrazolyl, benzotriazolyl, benzisoxazolyl, isobenzofuryl, isoindolyl, indolizinyl, benzotriazinyl, thienopyridyl, thienopyrimidyl, pyrazolo pyrimidyl, imidazopyridine, benzothiazolyl, benzofuranyl, benzothiophenyl, indolyl, quinolinyl, isoquinolinyl, isothiazolyl, pyrazolyl, indazolyl, pteridinyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, thiazolyl, pyrrolyl, thiazolyl, furanyl, thiophenyl, and the like.

[0161] In some embodiments, the above terms (such as alkyl, aryl / aromatic ring, and heteroaryl / heteroaromatic ring) will include both substituted and unsubstituted versions of the indicated radical. Preferred substituents for each type of radical are provided below. For brevity, the terms aryl and heteroaryl will refer to both substituted and unsubstituted versions as provided below, while the term "alkyl" and related aliphatic radicals refer to the unsubstituted versions, unless indicated otherwise.

[0162] Substituents for alkyl (including what is commonly referred to as alkylene, alkenyl, alkynyl and cycloalkyl groups) can be a diverse set of groups selected from: -halogen, -OR a , -NR a R b , -SR a , -SiR a R b R c , -OC(O)R a , -C(O)R a , -CO2R a , -CONR a R b , -OC(O)NR a R b , -NR b C(O)R a , -NR a -C(O)NR b R c , -NRb C(O)2R a -NH-C(NH2)=NH, -NR a C(NH2)=NH, -NH-C(NH2)=NR a -S(O)R a -S(O)2R a -S(O)2NR a R b -NR a S(O)2R b -CN and -NO2, in a number ranging from zero up to (2M'+l), where M' is the total number of carbon atoms in such radical. R a R b and R c each independently represent hydrogen, unsubstituted C 1-8 alkyl, unsubstituted heteroalkyl, unsubstituted aryl, aryl substituted with 1-3 halogens, unsubstituted C 1-8 alkyl, C 1-8 alkoxy or C 1-8 thioalkoxy, or unsubstituted aryl-C 1-4 alkyl. When R a and R b are attached to the same nitrogen atom, they can combine to form a 3-, 4-, 5-, 6- or 7-membered ring. For example, -NR a R b means including 1-pyrrolidinyl and 4-morpholinyl. The term "acyl", used alone or as part of another group, refers to a radical in which the substituent is =O attached to a carbon atom of the radical (for example, -C(O)CH3, -C(O)CH2CH2OR a and the like).

[0163] Similarly, substituents for aryl (aryl rings) and heteroaryl (heteroaryl rings) are diverse and are selected from: -halogen, -OR a , -OC(O)R a , -NR a R b , -SR a , -R a , -CN, -NO2, -CO2R a , -CONR a R b , -C(O)R a , -OC(O)NR a R b , -NR b C(O)R a , -NR b C(O)2Ra a b b a a a a a b a b a b b 1-8 3-6 2-8 2-8 1-4 1-4 Other suitable substituents include each of the above aryl substituents attached to a ring atom of the aryl group by an alkylene chain of 1 to 4 carbon atoms.

[0164] ​​​​​​​​​​​​​​​​​​​​As used herein, the term "amino acid residue" refers to the group formed by removal of a H from the N-terminal -NH2 and removal of -OH from the C-terminal -COOH of an amino acid. Generally, the segment of the amino acid (residue) including the N-terminal and C-terminal segments is referred to as the backbone, while the portion that determines the specific identity of the amino acid is referred to as the side chain. Unless otherwise defined, herein, amino acids include natural amino acids or non-natural amino acids, including D and / or L forms of the amino acids. Examples of amino acids include, but are not limited to, Ala (A), Arg I, Asn (N), Asp (D), Cys (C), Gin (Q), GIu (E), Gly (G), His (H), He (I), Leu (L), Lys (K), Met (M), Phe (F), Pro (P), Ser (S), Thr (T), Trp (W), Tyr (Y), Val (V). Preferably, herein, the amino acid is selected from the group consisting of L-Glycine (L-Gly), L-Alanine (L-Ala), β-Alanine (β-Ala), L-Glutamic acid (L-Glu), L-Aspartic acid (L-Asp), L-Histidine (L-His), L-Arginine (L-Arg), L-Lysine (L-Lys), L-Valine (L-Val), L-Serine (L-Ser), L-Threonine (L-Thr); and, in addition, when there are 2 or more amino groups and / or 2 or more carboxyl groups on the same carbon atom, the term also includes the group formed by removal of a H from -NH2 and removal of -OH from -COOH on different carbon atoms, such as the divalent group -C(O)-(CH2)2-C(COOH)-NH- formed by removal of a H from -NH2 and removal of -OH from the non-alpha -COOH of glutamic acid.

[0165] In the present text, unless otherwise defined, a bond represented by a dashed line or a bond marked with a wavy line symbolizes the position of attachment to other moieties in the molecule.

[0166] For the compounds provided herein, a bond from a substituent (typically an R group) to the center of a ring will be understood to mean a bond that provides attachment at any available vertex of an aromatic ring.

[0167] In the present text, the term "pharmaceutically acceptable" ingredient means a substance that is appropriate for use with humans and / or animals without undue adverse side effects (such as toxicity, irritation, and allergic response) commensurate with a reasonable benefit / risk ratio.

[0168] In the present application, the term "effective amount" or "therapeutically effective amount" refers to the amount of a therapeutic agent that treats, ameliorates, or prevents a target disease or condition, or that exhibits a detectable therapeutic or preventative effect. The precise effective amount for a subject will depend on the subject's size and health, the nature and extent of the condition, and the therapeutic or combination of therapeutics selected for administration. Thus, it is not useful to specify an exact effective amount. However, the effective amount for a given situation can be determined by routine experimentation and is within the judgment of the clinician.

[0169] Unless otherwise specified, all compounds appearing in the present application are intended to include all possible optical isomers, such as single enantiomers, or mixtures of different enantiomers (i.e., racemates). Each chiral carbon atom in all compounds of the present application can optionally be in the R configuration or the S configuration, or a mixture of the R and S configurations.

[0170] As used herein, the term "pharmaceutically acceptable salt" refers to a salt of a compound of the present application with an acid or a base which is suitable for use in medicine. Pharmaceutically acceptable salts include inorganic and organic salts. One preferred class of salts is salts of the compounds of the present application with acids. Suitable acids for salt formation include, but are not limited to, hydrochloric, hydrobromic, hydrofluoric, sulfuric, nitric, phosphoric, and the like inorganic acids, formic, acetic, propionic, oxalic, malonic, succinic, fumaric, maleic, lactic, malic, tartaric, citric, picric, methanesulfonic, benzenesulfonic, benzenesulfonic, and the like organic acids; and aspartic, glutamic, and the like acidic amino acids.

[0171] Unless otherwise specified, "amino acid" as used herein is intended to include any conventional amino acid, such as aspartic acid, glutamic acid, cysteine, asparagine, phenylalanine, glutamine, tyrosine, serine, methionine (met), tryptophan, glycine, valine, leucine, alanine, isoleucine, proline, threonine, histidine, lysine, arginine.

[0172] Conjugates of the present application, compositions containing them, and uses thereof

[0173] As used herein, the term "conjugate" (which can also be referred to herein as "conjugate of the present application" or "hepatotargeted protein degrader conjugate") refers to a conjugate as described in the first aspect.

[0174] Protein degradation technology can maintain long-term pharmacological effects due to its unique mechanism of action. However, protein degradation agents themselves do not have tissue targeting, and their related systemic toxicity is a major obstacle in the process of drug development. The present application develops a new type of liver-targeted protein degradation agent conjugate by coupling a protein degradation agent with a small molecule ligand of asialoglycoprotein receptor (ASGPR) through a linker fragment. By taking advantage of the highly specific expression of ASGPR in the liver, a more precise drug action mechanism than traditional drugs is achieved.

[0175] In some aspects, provided herein is a liver-targeted protein degradation agent conjugate of formula (I) or a pharmaceutically acceptable salt thereof,

[0176] wherein, L 1 , L P , L 2 , R, A, Ar and Bm are as defined in the first aspect.

[0177] As used herein, a protein degradation agent refers to a class of compounds that can target and induce protein degradation through the ubiquitination-proteasome pathway. Generally, such degradation agents are bifunctional small molecules formed by connecting a ligand (such as a group shown in formula IA) of a target protein (such as BET family proteins) to be degraded and a ligand (such as R E3 ) of an E3 ubiquitin ligase, for example, through a linker (such as R Linker ), which can simultaneously bind the target protein to be degraded and the E3 ubiquitin ligase, so that the target protein is close to the E3 ubiquitin ligase and is ubiquitinated, and then recognized and degraded by the proteasome in the cell.

[0178] In some embodiments, L 1 is a bridging moiety; L P is a polypeptide fragment; R is a modifying group; A is an E3 ligase ligand and a linker; L 2 is an amide, carbonyl or alkyl chain; Ar is an aromatic or heteroaromatic ring; and Bm is a ligand of ASGPR.

[0179] In some embodiments, L 1 is selected from the group consisting of, but not limited to, the following:

[0180] wherein: n and m are integers from 1 to 10; is a connection point of L P ; is a connection point of Bm.

[0181] In some embodiments, L P is selected from the group consisting of, but not limited to, the following:

[0182] Preferably, Z 1 , Z 2 , Z 3 , and Z 4 are each independently an amino acid residue in L- or D-configuration, provided that at least two of Z 1 , Z 2 , Z 3 , and Z 4 are amino acid residues; is a point of attachment to L 1 ; and is a point of attachment to the right aniline moiety.

[0183] In some embodiments, Z 1 is absent or is glycine; and / or Z 2 is absent or is selected from the group consisting of: and / or L-glutamine, D-glutamine, L-glutamic acid, D-glutamic acid, L-aspartic acid, D-aspartic acid, L-alanine, D-alanine, and glycine; and / or Z 3 is selected from the group consisting of: L-valine, D-valine, L-alanine, D-alanine, L-phenylalanine, D-phenylalanine, and glycine; and / or Z 4 is selected from the group consisting of: L-alanine, D-alanine, L-citrulline, D-citrulline, L-asparagine, D-asparagine, L-lysine, D-lysine, L-phenylalanine, D-phenylalanine, and glycine.

[0184] In some embodiments, L 2 is selected from the group consisting of, but not limited to, -(CH2) m - and -CO-; wherein m is an integer from 1 to 12.

[0185] In some embodiments, wherein R is absent or represents 1 or 2 groups selected from the group consisting of: nitro, deuterium, fluorine, chlorine, methyl, methoxy. (R is 1-2).

[0186] In some embodiments, A is selected from the group consisting of, but not limited to,:

[0187] Preferably: n is an integer from 0 to 10; is a point of attachment to L 2 ; and is a point of attachment to the left benzyl moiety.

[0188] In some embodiments, Ar is a substituted or unsubstituted aromatic or heteroaromatic ring.

[0189] In some embodiments, the ligand of the ASGPR is selected from Table B.

[0190] In some embodiments, the conjugate is selected from Table A.

[0191] In some embodiments, the conjugate is selected from Table A.

[0192] In some embodiments, z, L 1 , L P , L 2 , A, R, Ar and Bm are each independently the corresponding group in a specific conjugate shown in Table A or a specific compound prepared in the Examples.

[0193] In some embodiments, L 1 , L P , L 2 , A, R, Ar and Bm are each independently the corresponding group in a specific conjugate shown in Table A or a specific compound prepared in the Examples.

[0194] Pharmaceutical compositions and methods of administration

[0195] The conjugates provided herein (sometimes also referred to as protein degrader conjugates or liver-targeted protein degrader conjugates) have superior ability to target BET family proteins for degradation in liver diseases and anti-tumor activity, and the activity of the conjugates is highly correlated with ASGPR expression. Thus, the conjugate drugs of the present application can be used to treat or prevent various liver diseases (such as liver cancer, liver fibrosis disease, etc.).

[0196] The conjugates described above can be administered to a subject (e.g., a human) in a therapeutically effective amount by a suitable route. For conjugate drugs (or antibody conjugate drugs), the subject in need of treatment can be a patient at risk of, or suspected of having a disorder associated with the activity or expression level of a particular antigen. Such patients can be identified by routine physical examination.

[0197] Conventional methods, known to those of ordinary skill in the medical arts, can be used to administer the pharmaceutical composition to a subject, depending on the type of disease to be treated or the site of the disease. The composition can also be administered by other conventional routes, e.g., parenterally, orally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir can be used. The term "parenterally" as used herein includes subcutaneous, intracutaneous, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. In addition, it can be administered by means of an injectable reservoir, e.g., using a 1-, 3-, or 6-month reservoir injectable or biodegradable material and method of the subject.

[0198] The injectable compositions can contain various carriers such as vegetable oils, dimethylactamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethyl alcohol, polyhydric alcohols (glycerol, propylene glycol, liquid polyethylene glycol, and the like). For intravenous injection, water soluble antibodies can be administered by infusion techniques, whereby a pharmaceutical formulation containing the antibody and a physiologically acceptable excipient is infused into the patient. The physiologically acceptable excipient can include, for example, 5% dextrose, 0.9% saline, Ringer's solution or other suitable excipient. Intramuscular formulations, for example, a sterile formulation of a suitable soluble salt form of the antibody, can be dissolved and administered in a pharmaceutically acceptable excipient such as an aqueous injection, 0.9% saline, or 5% dextrose solution.

[0199] The pharmaceutical compositions of the present application comprise a safe and effective amount of the conjugate of the present application and a pharmaceutically acceptable carrier. Such carriers include, but are not limited to, saline, buffers, dextrose, water, glycerol, ethanol, and combinations thereof. Generally, the pharmaceutical formulation will be matched to the mode of administration, and the pharmaceutical compositions of the present application can be prepared by conventional procedures, e.g., by dissolving the active ingredient in physiologically acceptable saline or aqueous buffers, or other suitable excipients containing glucose or other carbohydrates. The pharmaceutical compositions are preferably manufactured under aseptic conditions. The active ingredient is administered in a therapeutically effective amount.

[0200] The effective amount of the conjugate of the present application can vary depending on the mode of administration, the severity of the disease to be treated, and the like. The selection of an optimal effective amount can be made by a person of ordinary skill in the art (e.g., by clinical trials) based on various factors. Such factors include, but are not limited to, the pharmacokinetic parameters of the antibody conjugate, such as bioavailability, metabolism, half-life, and the like; the severity of the disease to be treated, the weight of the patient, the immune status of the patient, the route of administration, and the like. Generally, satisfactory results are indicated to be obtained when the conjugate of the present application is administered at a dosage of from about 0.01 mg to 50 mg / kg, and preferably from 0.1 mg to 20 mg / kg, of animal body weight. For example, several divided doses can be administered daily, monthly, or proportionally reduced for doses in proportion to the weight of the patient, depending on the condition to be treated.

[0201] The compounds of the present application can be administered alone or in combination with other pharmaceutically acceptable therapeutic agents or adjuncts.

[0202] The pharmaceutical compositions are used in a safe and effective amount of the antibody conjugate of the present application for treating a mammal (e.g., a human) in need of such treatment, wherein the amount administered is a pharmaceutically effective amount, and the amount administered is typically from 1 to 2000 mg, and preferably from 5 to 500 mg, per single administration for a 60 kg body weight. Of course, the specific dose will also be determined by the route of administration, the health of the patient, and like factors, all within the skill of the skilled clinician.

[0203] The main advantages of the present application include:

[0204] (a) The conjugate of the present application has good stability in vitro and in vivo;

[0205] (b) The conjugate of the present application has significantly improved hydrophilicity, overcoming the bottleneck of the difficulty of administration of traditional protein degrading agents.

[0206] (c) In the in vitro anti-tumor experiment, the cell activity of the conjugate of the present application is positively correlated with the expression of ASGPR, indicating that the safety of the drug is improved.

[0207] (d) In vivo studies show that the conjugate of the present application alone or in combination with sorafenib for long-term administration not only effectively inhibits tumor growth, but also significantly relieves the blood toxicity related to BET inhibitors.

[0208] The present application will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. The experimental methods in the following examples, if not specified, are generally carried out according to the conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are weight percentages and weight parts.

[0209] Example 1: Synthesis of novel liver-targeting degrading agent conjugate

[0210] Scheme 1. Synthesis of key intermediates

[0211] General procedure 1: Compound 2 (1.0 eq), corresponding benzyl mono-carboxylate 1A-F (1.1 eq) and N,N-diisopropylethylamine (4.0 eq) were dissolved in dichloromethane (10 mL), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.05 eq) was added, and the reaction was carried out at room temperature overnight. After the reaction was completed by TLC monitoring, the mixture was poured into water, extracted with dichloromethane, and the organic phase was washed with saturated brine and dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was separated and purified by column chromatography (methanol / dichloromethane = 0-8%) to obtain the corresponding intermediate. The intermediate (1.0 eq) and 10% palladium-carbon (50 mg) were added to methanol (10 mL) and the reaction was carried out at room temperature overnight under hydrogen atmosphere. After the reaction was completed by LC-MS monitoring, the filter was extracted and concentrated under reduced pressure to obtain the corresponding title compound (yield 40-60%).

[0212] Step 2.1: Synthesis of compound 3A

[0213] Using compound 2 and 1A as starting material, the title compound was obtained (320 mg) using general procedure 2. 1 H NMR (400 MHz, DMSO-d6) δ 7.91 - 7.73 (m, 9 H), 6.78 (s, 1 H), 5.21 (d, J = 3.4 Hz, 3 H), 4.97 (dd, J = 11.3, 3.4 Hz, 3 H), 4.49 (d, J = 8.4 Hz, 3 H), 4.07 - 3.99 (m, 11 H), 3.93 - 3.78 (m, 5 H), 3.74 - 3.67 (m, 3 H), 3.61 - 3.53 (m, 20 H), 3.44 - 3.41 (m, 3 H), 3.07 - 3.00 (m, 12 H), 2.29 (t, J = 6.4 Hz, 6 H), 2.11 (s, 9 H), 2.05 (t, J = 7.1 Hz, 6 H), 2.00 (s, 9 H), 1.89 (s, 9 H), 1.78 (s, 9 H), 1.56 - 1.42 (m, 18 H).

[0214] Step 2.2: Synthesis of compound 3B

[0215] Using compound 2 and 1B as starting material, the title compound was obtained (307 mg) using general procedure 2. 1 H NMR (400 MHz, DMSO-d6) δ 7.91 - 7.73 (m, 9 H), 6.78 (s, 1 H), 5.21 (d, J = 3.4 Hz, 3 H), 4.97 (dd, J = 11.3, 3.4 Hz, 3 H), 4.49 (d, J = 8.4 Hz, 3 H), 4.07 - 3.99 (m, 11 H), 3.93 - 3.78 (m, 5 H), 3.74 - 3.67 (m, 3 H), 3.61 - 3.53 (m, 20 H), 3.44 - 3.41 (m, 3 H), 3.07 - 3.00 (m, 12 H), 2.29 (t, J = 6.4 Hz, 6 H), 2.11 (s, 9 H), 2.05 (t, J = 7.1 Hz, 6 H), 2.00 (s, 9 H), 1.89 (s, 9 H), 1.78 (s, 9 H), 1.56 - 1.42 (m, 18 H).

[0216] Step 2.3: Synthesis of compound 3C

[0217] Using compound 2 and 1C as starting material, the title compound was obtained (201 mg) using general procedure 2.

[0218] Step 2.4: Synthesis of compound 3D

[0219] The title compound was obtained as a yellow solid (1 12 mg) using general procedure 2 starting from compound 2 and 1C. 1 H NMR (400 MHz, DMSO-d6) δ 7.89 - 7.80 (m, 6H), 7.75 (t, J = 5.7 Hz, 3H), 7.00 (s, 1H), 5.22 (d, J = 3.4 Hz, 3H), 4.97 (dd, J = 11.2, 3.4 Hz, 3H), 4.49 (d, J = 8.5 Hz, 3H), 4.07 - 4.00 (m, 9H), 3.93 - 3.82 (m, 3H), 3.76 - 3.67 (m, 3H), 3.58 - 3.50 (m, 12H), 3.45 - 3.36 (m, 3H), 3.07 - 2.98 (m, 12H), 2.28 (t, J = 6.4 Hz, 6H), 2.18 (t, J = 7.4 Hz, 2H), 2.11 (s, 9H), 2.07 - 1.98 (m, 17H), 1.90 (s, 9H), 1.78 (s, 9H), 1.56 - 1.44 (m, 20H), 1.26 - 1.21 (m, 10H).

[0220] Step 2.5: Synthesis of compound 3E

[0221] The title compound was obtained as a yellow solid (1 12 mg) using general procedure 2 starting from compound 2 and 1C. 1 H NMR (400 MHz, DMSO-d6) δ 7.89 - 7.80 (m, 6H), 7.75 (t, J = 5.7 Hz, 3H), 7.00 (s, 1H), 5.22 (d, J = 3.4 Hz, 3H), 4.97 (dd, J = 11.2, 3.4 Hz, 3H), 4.49 (d, J = 8.5 Hz, 3H), 4.07 - 4.00 (m, 9H), 3.93 - 3.82 (m, 3H), 3.76 - 3.67 (m, 3H), 3.58 - 3.50 (m, 12H), 3.45 - 3.36 (m, 3H), 3.07 - 2.98 (m, 12H), 2.28 (t, J = 6.4 Hz, 6H), 2.18 (t, J = 7.4 Hz, 2H), 2.11 (s, 9H), 2.07 - 1.98 (m, 17H), 1.90 (s, 9H), 1.78 (s, 9H), 1.56 - 1.44 (m, 20H), 1.26 - 1.21 (m, 10H).

[0222] Step 2.6: Synthesis of compound 3F

[0223] The title compound was obtained as a yellow solid (1 12 mg) using general procedure 2 starting from compound 2 and 1C. 1H NMR (400 MHz, DMSO-d6) δ 7.88 - 7.82 (m, 6 H), 7.76 (t, J = 5.5 Hz, 3 H), 7.00 (s, 1 H), 5.22 (d, J = 3.4 Hz, 3 H), 4.97 (dd, J = 11.3, 3.4 Hz, 3 H), 4.49 (d, J = 8.4 Hz, 3 H), 4.07 - 3.99 (m, 9 H), 3.90 - 3.84 (m, 3 H), 3.73 - 3.69 (m, 3 H), 3.57 - 3.50 (m, 12 H), 3.44 - 3.41 (m, 2 H), 3.08 - 2.99 (m, 12 H), 2.28 (t, J = 6.4 Hz, 6 H), 2.18 (t, J = 7.4 Hz, 3 H), 2.11 (s, 9 H), 2.07 - 1.99 (m, 17 H), 1.90 (s, 9 H), 1.78 (s, 9 H), 1.56 - 1.38 (m, 24 H), 1.23 (s, 38 H).

[0224] Scheme 2. Synthesis of conjugates 13A, 13B, 13D, 13E, 13F

[0225] Step 1: Synthesis of compound 5

[0226] Compound 4 (2.00 g, 5.08 mmol) and N,N-diisopropylethylamine (1.68 mL, 10.2 mmol) were dissolved in acetonitrile (40 mL), ethylsulfonyl chloride (578 μL, 6.10 mmol) was added, and the reaction was allowed to proceed at room temperature for 2 hours. After the reaction was completed as monitored by LC-MS, it was concentrated under reduced pressure, and the residue was purified by column chromatography (ethyl acetate / dichloromethane = 0-40%) to give the title compound (1.47 g, yield 70%). 1 H NMR (400 MHz, DMSO-d6) δ 7.88 - 7.82 (m, 6 H), 7.76 (t, J = 5.5 Hz, 3 H), 7.00 (s, 1 H), 5.22 (d, J = 3.4 Hz, 3 H), 4.97 (dd, J = 11.3, 3.4 Hz, 3 H), 4.49 (d, J = 8.4 Hz, 3 H), 4.07 - 3.99 (m, 9 H), 3.90 - 3.84 (m, 3 H), 3.73 - 3.69 (m, 3 H), 3.57 - 3.50 (m, 12 H), 3.44 - 3.41 (m, 2 H), 3.08 - 2.99 (m, 12 H), 2.28 (t, J = 6.4 Hz, 6 H), 2.18 (t, J = 7.4 Hz, 3 H), 2.11 (s, 9 H), 2.07 - 1.99 (m, 17 H), 1.90 (s, 9 H), 1.78 (s, 9 H), 1.56 - 1.38 (m, 24 H), 1.23 (s, 38 H). 20 H 31 ClN3O4,[M+H] + ,412.1998, found 412.1998.

[0227] Step 2: Synthesis of compound 8

[0228] Compound 6 (1.50 g, 2.68 mmol), compound 7 (669 mg, 2.94 mmol), and N,N- diisopropylethylamine (1.77 mL, 10.7 mmol) were dissolved in dichloromethane (60 mL), 2-(7-azabenzotriazol-l-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.02 g, 2.68 mmol) was added, and the reaction was allowed to proceed at room temperature for 1 h. After the reaction was completed as monitored by LC-MS, the reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (1.40 g, 80% yield). 1 H NMR (400 MHz, DMSO-d6) δ 9.81 (s, 1H), 8.96 (s, 1H), 8.48 (t, J = 6.1 Hz, 1H), 7.86 (d, J = 9.4 Hz, 1H), 7.38 (d, J = 7.8 Hz, 1H), 6.91 (d, J = 1.8 Hz, 1H), 6.80 (dd, J = 7.8, 1.8 Hz, 1H), 5.13 (d, J = 3.6 Hz, 1H), 4.54 (d, J = 9.4 Hz, 1H), 4.45 (t, J = 8.0 Hz, 1H), 4.35 (s, 1H), 4.29 (dd, J = 16.2, 6.5 Hz, 1H), 4.12 (dd, J = 16.2, 5.5 Hz, 1H), 3.69 - 3.61 (m, 2H), 3.33 - 3.29 (m, 2H), 2.45 (s, 3H), 2.32 - 2.22 (m, 1H), 2.14 - 2.07 (m, 1H), 2.07 - 2.00 (m, 1H), 1.97 - 1.87 (m, 1H), 1.56 - 1.44 (m, 4H), 1.28 - 1.22 (m, 12H), 0.93 (s, 9H). HRMS (ESI-TOF): Calcd for C 33 H 50 N7O5S, [M+H] + ,656.3594, found 656.3592.

[0229] Step 3: Synthesis of compound 9

[0230] Compound 8 (1.00 g, 1.52 mmol) and compound 5 (691 mg, 1.68 mmol) were dissolved in N,N-dimethylformamide (20 mL), potassium carbonate (631 mg, 4.57 mmol) was added, and the reaction was allowed to proceed at room temperature for 1 hour. After the reaction was completed as monitored by LC-MS, the compound was poured into water, extracted with ethyl acetate, and the organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was separated and purified by column chromatography (methanol / dichloromethane = 0-10%) to obtain the title compound (610 mg, yield 39%). 1 H NMR (400 MHz, DMSO-d6) δ 10.06 (s, 1H), 8.99 (s, 1H), 8.48 (t, J = 6.1 Hz, 1H), 8.09 (d, J = 7.0 Hz, 1H), 7.88 (d, J = 9.3 Hz, 1H), 7.62 (d, J = 8.6 Hz, 2H), 7.49 (d, J = 7.8 Hz, 1H), 7.43 (d, J = 8.3 Hz, 2H), 7.10 (d, J = 1.7 Hz, 1H), 6.95 - 6.89 (m, 1H), 6.74 (d, J = 8.8 Hz, 1H), 5.17 - 5.12 (m, 2H), 4.59 - 4.31 (m, 5H), 4.19 (dd, J = 16.8, 5.4 Hz, 1H), 3.88 - 3.80 (m, 1H), 3.71 - 3.60 (m, 2H), 3.33 - 3.28 (m, 2H), 2.41 (s, 3H), 2.32 - 2.22 (m, 1H), 2.15 - 2.08 (m, 1H), 2.05 - 2.00 (m, 1H), 1.98 - 1.87 (m, 2H), 1.57 - 1.41 (m, 5H), 1.38 (s, 9H), 1.33 - 1.21 (m, 15H), 0.96 - 0.80 (m, 15H). LC-MS (ESI): m / z 1031.5 [M+H] + .

[0231] Step 4: Synthesis of compound 11

[0232] Compound 9 (600 mg, 0.58 mmol) and triphenylphosphine (458 mg, 1.75 mmol) were dissolved in tetrahydrofuran (15 mL) and water (1 mL) and reacted at room temperature overnight under nitrogen protection. After the reaction was completed by LC-MS monitoring, the residue was dissolved in dichloromethane (15 mL) and methanol (2 mL) with compound 10 (306 mg, 0.61 mmol) and N,N-diisopropylethylamine (288 μL, 1.75 mmol), and 2-(7-azabenzotriazol)-N,N,N',N'-tetramethyluronium hexafluorophosphate (243 mg, 0.64 mmol) was added, and the reaction was carried out at room temperature for 2 hours. After the reaction was completed by LC-MS monitoring, it was concentrated under reduced pressure, and the residue was separated and purified by column chromatography (methanol / dichloromethane = 0-12%) to obtain the title compound (476 mg, 55% yield for two steps). 1 H NMR (400 MHz, DMSO-d6) δ 11.93 (s, 1H), 10.06 (s, 1H), 8.98 (s, 1H), 8.48 (t, J = 6.0 Hz, 1H), 8.41 (t, J = 5.7 Hz, 1H), 8.12-8.05 (m, 2H), 7.92 (s, 1H), 7.87 (d, J = 9.3 Hz, 1H), 7.76 (s, 1H), 7.66-7.58 (m, 3H), 7.49 (d, J = 7.8 Hz, 1H), 7.43 (d, J = 8.3 Hz, 2H), 7.30-7.25 (m, 2H), 7.11-7.07 (m, 1H), 6.92 (d, J = 8.3 Hz, 1H), 6.74 (d, J = 8.9 Hz, 1H), 5.95 (s, 1H), 5.18-5.12 (m, 3H), 4.58-4.32 (m, 6H), 4.24-4.15 (m, 1H), 3.88-3.80 (m, 1H), 3.68-3.61 (m, 5H), 3.18-3.15 (m, 2H), 2.91 (s, 3H), 2.40 (s, 3H), 2.31-2.22 (m, 1H), 2.16-1.85 (m, 6H), 1.52-1.41 (m, 4H), 1.38 (s, 9H), 1.31 (d, J = 7.0 Hz, 3H), 1.26-1.19 (m, 12H), 0.92 (s, 9H), 0.88-0.80 (m, 6H). HRMS (ESI-TOF): Calcd for C 76 H 97 F2N 12 O 13 S2,[M+H] + ,1487.6702, found 1487.6701.

[0233] Step 5: Synthesis of compound 12

[0234] Compound 11 (400 mg, 0.27 mmol) was dissolved in dichloromethane (10 mL), trifluoroacetic acid (2 mL) was added, and the reaction was allowed to proceed at room temperature for 1 h. After the reaction was completed as monitored by LC-MS, the reaction mixture was concentrated under reduced pressure, and the residue was slurried with diethyl ether to give the title compound (396 mg, 98% yield). LC-MS (ESI): m / z 1387.7 [M+H] + .

[0235] General Step 6: Compound 12 (1.0 eq), compound 3A / 3B / 3D / 3E / 3F (1.0 eq) and N,N-diisopropylethylamine (4 eq) were dissolved in dimethyl sulfoxide (4 mL), and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.1 eq) was added. The reaction was allowed to proceed at room temperature for 30 min. After the reaction was completed as monitored by LC-MS, lithium hydroxide monohydrate (6.0 eq) and water (1.0 mL) were added to the reaction mixture, and the reaction was allowed to proceed at room temperature for 30 h. After the reaction was completed as monitored by LC-MS, the title compound was purified by Prep-HPLC (21 mg, 30-50% yield over two steps).

[0236] Step 6.1: Synthesis of compound 13A

[0237] The title compound (21 mg) was obtained from compound 12 and 3A following the general synthetic route. 1H NMR (400 MHz, DMSO-d6) δ 11.94 (s, 1H), 10.05 (s, 1H), 8.98 (s, 1H), 8.48 (d, J = 6.4 Hz, 1H), 8.42 (d, J = 6.2 Hz, 2H), 8.08 (d, J = 2.5 Hz, 1H), 7.92 (s, 1H), 7.91 - 7.82 (m, 4H), 7.78 - 7.72 (m, 4H), 7.63 (dd, J = 8.8, 4.2 Hz, 6H), 7.53 - 7.46 (m, 2H), 7.43 (d, J = 8.4 Hz, 2H), 7.31 - 7.25 (m, 2H), 7.09 (s, 1H), 6.95 - 6.88 (m, 1H), 6.79 (s, 1H), 5.95 (s, 1H), 5.18 - 5.11 (m, 3H), 4.63 - 4.28 (m, 18H), 4.22 (d, J = 8.4 Hz, 4H), 3.96 (s, 2H), 3.80 (s, 2H), 3.74 - 3.49 (m, 43H), 3.32 - 3.27 (m, 4H), 3.19 - 3.10 (m, 2H), 3.07 - 3.00 (m, 12H), 2.91 (s, 3H), 2.41 (s, 3H), 2.29 (t, J = 6.5 Hz, 7H), 2.17 - 1.88 (m, 12H), 1.80 (s, 9H), 1.54 - 1.41 (m, 22H), 1.32 (d, J = 7.1 Hz, 3H), 1.25 - 1.20 (m, 12H), 0.93 - 0.82 (m, 15H). LC-MS (ESI): m / z 1495.3 [(M+2H) / 2] + .

[0238] Step 6.2: Synthesis of compound 13B

[0239] The title compound (19 mg) was obtained from compound 12 and 3B by the general synthetic route. 1H NMR (600 MHz, DMSO-d6) δ 11.93 (s, 1H), 10.03 (s, 1H), 8.98 (s, 1H), 8.47 (s, 1H), 8.39 (d, J = 7.1 Hz, 2H), 8.07 (d, J = 2.5 Hz, 1H), 7.92 (s, 1H), 7.85 (t, J = 5.3 Hz, 4H), 7.78-7.71 (m, 4H), 7.63 (d, J = 8.8 Hz, 6H), 7.52-7.41 (m, 4H), 7.28 (d, J = 3.9 Hz, 2H), 7.09 (s, 1H), 6.92 (d, J = 7.8 Hz, 1H), 6.79 (s, 1H), 5.96 (s, 1H), 5.20-5.11 (m, 3H), 4.62-4.53 (m, 7H), 4.50-4.33 (m, 7H), 4.32-4.28 (m, 1H), 4.22 (d, J = 8.4 Hz, 4H), 3.95 (s, 2H), 3.80 (s, 2H), 3.74-3.39 (m, 62H), 3.29 (s, 4H), 3.15 (s, 2H), 3.08-3.00 (m, 12H), 2.91 (s, 3H), 2.41 (s, 3H), 2.29 (t, J = 6.6 Hz, 7H), 2.20-1.86 (m, 12H), 1.80 (s, 9H), 1.55-1.39 (m, 22H), 1.32 (d, J = 7.1 Hz, 3H), 1.27-1.19 (m, 12H), 0.95-0.81 (m, 15H). LC-MS (ESI): m / z 1583.3 [(M+2H) / 2] + .

[0240] Step 6.3: Synthesis of compound 13D

[0241] The title compound (14 mg) was obtained from compound 12 and 3D by the general synthetic route. 1H NMR (400 MHz, DMSO-d6) δ 11.94 (s, 1H), 9.99 (s, 1H), 8.98 (s, 1H), 8.49 (s, 1H), 8.41 (t, J = 5.6 Hz, 1H), 8.20 (d, J = 6.8 Hz, 1H), 8.07 (d, J = 2.5 Hz, 1H), 7.93 - 7.73 (m, 10H), 7.68 - 7.57 (m, 6H), 7.50 (d, J = 7.8 Hz, 1H), 7.43 (d, J = 8.2 Hz, 2H), 7.28 (d, J = 3.6 Hz, 2H), 7.09 (s, 1H), 7.02 (s, 1H), 6.91 (d, J = 7.9 Hz, 1H), 5.95 (s, 1H), 5.20 - 5.10 (m, 3H), 4.64 - 4.32 (m, 16H), 4.25 - 4.17 (m, 5H), 3.75 - 3.62 (m, 14H), 3.58 - 3.41 (m, 22H), 3.32 - 3.27 (m, 4H), 3.15 (d, J = 8.3 Hz, 2H), 3.08 - 3.01 (m, 12H), 2.91 (s, 3H), 2.40 (s, 3H), 2.28 (t, J = 6.3 Hz, 7H), 2.21 - 1.91 (m, 16H), 1.80 (s, 9H), 1.53 - 1.41 (m, 24H), 1.31 (d, J = 6.9 Hz, 3H), 1.22 (s, 22H), 0.94 - 0.82 (m, 15H). LC-MS (ESI): m / z 1485.3 [(M+2H) / 2] + .

[0242] Step 6.4: Synthesis of compound 13E

[0243] The title compound (26 mg) was obtained from compound 12 and 3E following the general synthetic route. 1H NMR (800 MHz, DMSO-d6) δ 11.92 (s, 1H), 9.96 (s, 1H), 8.97 (s, 1H), 8.46 (t, J = 6.2 Hz, 1H), 8.40 (t, J = 5.6 Hz, 1H), 8.17 (d, J = 6.9 Hz, 1H), 8.07 (d, J = 2.5 Hz, 1H), 7.92 (s, 1H), 7.87-7.80 (m, 5H), 7.77-7.73 (m, 4H), 7.65-7.59 (m, 6H), 7.49 (d, J = 7.7 Hz, 1H), 7.43 (d, J = 8.4 Hz, 2H), 7.27 (d, J = 2.6 Hz, 2H), 7.09 (d, J = 1.7 Hz, 1H), 6.99 (s, 1H), 6.92 (dd, J = 7.8, 1.6 Hz, 1H), 5.95 (s, 1H), 5.18-5.10 (m, 3H), 4.61-4.53 (m, 8H), 4.49-4.45 (m, 4H), 4.42-4.33 (m, 3H), 4.24-4.17 (m, 5H), 3.72-3.67 (m, 6H), 3.67-3.62 (m, 8H), 3.57-3.47 (m, 19H), 3.44-3.41 (m, 3H), 3.29 (t, J = 6.2 Hz, 3H), 3.15 (s, 2H), 3.06-3.02 (m, 12H), 2.91 (s, 3H), 2.40 (s, 3H), 2.28 (t, J = 6.5 Hz, 7H), 2.21-2.16 (m, 1H), 2.15-2.09 (m, 2H), 2.07-2.02 (m, 9H), 1.99-1.94 (m, 1H), 1.93-1.89 (m, 1H), 1.80 (s, 9H), 1.54-1.40 (m, 28H), 1.31 (d, J = 7.1 Hz, 3H), 1.26-1.18 (m, 34H), 0.92 (s, 9H), 0.87 (d, J = 6.8 Hz, 3H), 0.84 (d, J = 6.7 Hz, 3H). HRMS (ESI-TOF): Calcd for C 148 H 226 F2N 22 O 40 S2,[(M+2H) / 2] + ,1526.7863, found 1526.7860.

[0244] Step 6.5: Synthesis of compound 13F

[0245] The title compound (15 mg) was obtained by the general synthesis scheme, using compound 12 and 3F as starting materials. 1H NMR(400MHz,DMSO-d6)δ11.94(s,1H),9.97(s,1H),8.98(s,1H),8.48(s,1H),8.41(t ,J=5.6Hz,1H),8.17(d,J=6.9Hz,1H),8.08(d,J=2.5Hz,1H),7.92(s,1H),7.90-7.81( m,5H),7.75(d,J=7.2Hz,4H),7.64(d,J=9.0Hz,6H),7.49(d,J=7.8Hz,1H),7.43(d,J =8.4Hz,2H),7.28(d,J=3.8Hz,2H),7.09(s,1H),7.01(s,1H),6.92(d,J=7.9Hz,1H),5 .94(s,1H),5.17-5.12(m,3H),4.63-4.33(m,16H),4.24-4.15(m,5H),3.75-3.61(m, 14H),3.59-3.38(m,25H),3.30-3.28(m,4H),3.14(s,2H),3.09-2.98(m,12H),2.91(s ,3H),2.41(s,3H),2.28(t,J=6.4Hz,7H),2.23-1.93(m,16H),1.80(s,9H),1.57-1.33 (m,28H),1.32-1.30(m,3H),1.25-1.20(m,47H),0.94-0.82(m,15H).LC-MS(ESI):m / z 1597.4[(M+2H) / 2] + .

[0246] Scheme 3. Synthesis of couplings 19A / 19B / 19E

[0247] Step 1: Synthesis of Compound 15

[0248] Compound 14 (1.50 g, 3.13 mmol) and N,N-diisopropylethylamine (2.07 mL, 12.5 mmol) were dissolved in acetonitrile (30 mL), and ethylsulfonyl chloride (356 μL, 3.76 mmol) was added. The reaction was carried out at room temperature for 2 hours. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (ethyl acetate / dichloromethane = 0-60%) to give the title compound (1.09 g, 70% yield). 1H NMR (400 MHz, DMSO-d6) δ 10.20 (s, 1H), 8.04 (d, J = 7.6 Hz, 1H), 7.62 (d, J = 8.5 Hz, 2H), 7.42 - 7.33 (m, 2H), 6.77 (d, J = 9.0 Hz, 1H), 6.09 (t, J = 5.8 Hz, 1H), 5.46 (s, 2H), 4.72 (s, 2H), 4.48 - 4.38 (m, 1H), 3.87 - 3.79 (m, 1H), 2.97 (dh, J = 25.8, 6.4 Hz, 2H), 1.98 - 1.90 (m, 1H), 1.75 - 1.65 (m, 1H), 1.64 - 1.54 (m, 1H), 1.48 - 1.35 (m, 11H), 0.84 (dd, J = 16.7, 6.7 Hz, 6H). LC-MS (ESI): m / z 498.3 [M+H] + .

[0249] Step 2: Synthesis of compound 16

[0250] Compound 8 (650 mg, 0.99 mmol) and compound 15 (543 mg, 1.09 mmol) were dissolved in N,N-dimethylformamide (10 mL), potassium carbonate (410 mg, 2.97 mmol) was added, and the reaction was allowed to proceed at room temperature for 1 hour. After the reaction was completed as monitored by LC-MS, the mixture was poured into water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was separated and purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (472 mg, yield 41%). LC-MS (ESI): m / z 1117.6 [M+H] + .

[0251] Step 3: Synthesis of compound 17

[0252] Compound 16 (420 mg, 0.38 mmol) and triphenylphosphine (296 mg, 1.18 mmol) were dissolved in tetrahydrofuran (10 mL) and water (1 mL), and the reaction was allowed to proceed at room temperature overnight under nitrogen protection. After the reaction was completed as monitored by LC-MS, the residue was dissolved in dichloromethane (5 mL) and methanol (1 mL) along with compound 10 (190 mg, 0.38 mmol) and N,N-diisopropylethylamine (251 μL, 1.52 mmol). 2-(7-Azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (159 mg, 0.42 mmol) was added, and the reaction was allowed to proceed at room temperature for 2 hours. After the reaction was completed as monitored by LC-MS, the residue was separated and purified by column chromatography (methanol / dichloromethane = 0-12%) to give the title compound (471 mg, yield 79% for two steps).1 H NMR (400 MHz, DMSO-d6) δ 11.95 (s, 1H), 10.11 (s, 1H), 8.98 (s, 1H), 8.49 (d, J = 6.7 Hz, 1H), 8.42 (t, J = 5.6 Hz, 1H), 8.08 (d, J = 2.5 Hz, 1H), 8.02 (d, J = 7.6 Hz, 1H), 7.90 (d, J = 18.3 Hz, 2H), 7.77 (s, 1H), 7.66 - 7.59 (m, 3H), 7.50 (d, J = 7.8 Hz, 1H), 7.43 (d, J = 8.2 Hz, 2H), 7.30 - 7.26 (m, 2H), 7.09 (s, 1H), 6.92 (d, J = 7.9 Hz, 1H), 6.78 (d, J = 8.9 Hz, 1H), 5.99 (t, J = 5.8 Hz, 1H), 5.43 (s, 2H), 5.19 - 5.12 (m, 3H), 4.60 - 4.31 (m, 6H), 4.23 - 4.15 (m, 1H), 3.84 (t, J = 7.9 Hz, 1H), 3.64 (d, J = 8.5 Hz, 5H), 3.15 (s, 2H), 3.06 - 2.94 (m, 2H), 2.91 (s, 3H), 2.41 (s, 3H), 2.32 - 2.22 (m, 1H), 2.15 - 1.87 (m, 6H), 1.73 - 1.56 (m, 2H), 1.38 (s, 16H), 1.23 (d, J = 6.0 Hz, 12H), 0.94 - 0.81 (m, 15H). LC-MS (ESI): m / z 1573.7 [M+H] + .

[0253] Step 4: Synthesis of compound 18

[0254] Compound 17 (300 mg, 0.19 mmol) was dissolved in dichloromethane (5 mL), trifluoroacetic acid (1 mL) was added, and the reaction was allowed to proceed at room temperature for 1 hour. After the reaction was completed as monitored by LC-MS, it was concentrated under reduced pressure, and the residue was slurried with diethyl ether to give the title compound (295 mg, yield 98%). 1HNMR (400 MHz, DMSO-d6) δ 11.95 (s, 1H), 10.24 (s, 1H), 8.99 (s, 1H), 8.71 (d, J = 7.6 Hz, 1H), 8.50 (s, 1H), 8.42 (t, J = 5.8 Hz, 1H), 8.08 (d, J = 3.4 Hz, 4H), 7.92 (s, 1H), 7.88 (d, J = 9.2 Hz, 1H), 7.76 (s, 1H), 7.67-7.58 (m, 3H), 7.50 (d, J = 7.9 Hz, 1H), 7.44 (d, J = 8.3 Hz, 2H), 7.28 (d, J = 5.8 Hz, 2H), 7.10 (s, 1H), 6.92 (d, J = 8.0 Hz, 1H), 6.05 (s, 1H), 5.50 (s, 2H), 5.16 (s, 2H), 4.58-4.44 (m, 4H), 4.41-4.34 (m, 2H), 4.22-4.16 (m, 1H), 3.64 (d, J = 9.6 Hz, 6H), 3.15 (s, 2H), 2.98 (s, 3H), 2.91 (s, 3H), 2.40 (s, 3H), 2.31-2.22 (m, 1H), 2.15-1.99 (m, 4H), 1.95-1.87 (m, 1H), 1.78-1.58 (m, 3H), 1.42 (d, J = 25.7 Hz, 7H), 1.26-1.19 (m, 12H), 0.98-0.90 (m, 15H). LC-MS (ESI): m / z 1473.6 [M+H] + .

[0255] General Procedure 5: Compound 18 (1.0 eq), compound 3A / 3B / 3E (1.0 eq) and N,N- diisopropylethylamine (4 eq) were dissolved in dimethyl sulfoxide (4 mL), 2-(7-azabenzotriazol- 1 -yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.1 eq) was added and the reaction was allowed to proceed at room temperature for 30 min. After the reaction was completed by LC-MS, lithium hydroxide monohydrate (6.0 eq) and water (1.0 mL) were added to the reaction mixture and the reaction was allowed to proceed at room temperature for 30 min. After the reaction was completed by LC-MS, the title compound was purified by Prep-HPLC (two-step yield 30-50%).

[0256] Step 5.1: Synthesis of conjugate 19A

[0257] The title compound (17 mg) was obtained by general synthetic route using compound 18 and 3A as starting materials. 1H NMR (400 MHz, DMSO-d6) δ 11.95 (s, 1H), 10.10 (s, 1H), 8.98 (s, 1H), 8.51 (s, 1H), 8.46 - 8.35 (m, 2H), 8.08 (d, J = 2.5 Hz, 1H), 7.95 - 7.83 (m, 5H), 7.76 (d, J = 5.8 Hz, 4H), 7.69 - 7.57 (m, 6H), 7.50 (d, J = 7.8 Hz, 2H), 7.43 (d, J = 8.2 Hz, 2H), 7.31 - 7.25 (m, 2H), 7.10 (s, 1H), 6.91 (d, J = 7.9 Hz, 1H), 6.80 (s, 1H), 6.06 - 5.98 (m, 1H), 5.45 (s, 2H), 5.19 - 5.10 (m, 3H), 4.66 - 4.29 (m, 17H), 4.26 - 4.08 (m, 5H), 3.97 (s, 2H), 3.81 - 3.79 (m, 2H), 3.74 - 3.42 (m, 46H), 3.31 - 3.28 (m, 2H), 3.19 - 3.11 (m, 2H), 3.10 - 2.96 (m, 14H), 2.91 (s, 3H), 2.41 (s, 3H), 2.29 (t, J = 6.5 Hz, 7H), 2.16 - 1.86 (m, 12H), 1.80 (s, 9H), 1.62 - 1.35 (m, 26H), 1.23 (s, 12H), 0.95 - 0.81 (m, 15H). LC-MS (ESI): m / z 1538.3 [(M+2H) / 2] + .

[0258] Step 5.2: Synthesis of conjugate 19B

[0259] The title compound (21 mg) was obtained from compound 18 and 3B following the general synthetic route. 1H NMR (600 MHz, DMSO-d6) δ 11.93 (d, J = 2.7 Hz, 1H), 10.07 (s, 1H), 8.97 (s, 1H), 8.47 (s, 1H), 8.40 (t, J = 5.6 Hz, 1H), 8.34 (d, J = 7.5 Hz, 1H), 8.07 (d, J = 2.5 Hz, 1H), 7.91 (s, 1H), 7.88 - 7.81 (m, 4H), 7.78 - 7.70 (m, 4H), 7.65 - 7.58 (m, 6H), 7.50 - 7.45 (m, 2H), 7.42 (d, J = 8.5 Hz, 2H), 7.28 - 7.26 (m, 2H), 7.09 (d, J = 1.7 Hz, 1H), 6.91 (d, J = 7.8 Hz, 1H), 6.78 (s, 1H), 5.98 (s, 1H), 5.41 (s, 1H), 5.18 - 5.07 (m, 3H), 4.60 - 4.52 (m, 4H), 4.49 - 4.30 (m, 7H), 4.21 (d, J = 8.5 Hz, 4H), 3.95 (d, J = 2.5 Hz, 2H), 3.80 (s, 2H), 3.72 - 3.45 (m, 64H), 3.44 - 3.39 (m, 4H), 3.14 (s, 2H), 3.06 - 3.00 (m, 14H), 2.91 (s, 3H), 2.40 (s, 3H), 2.28 (t, J = 6.4 Hz, 7H), 2.13 - 1.83 (m, 12H), 1.80 (s, 9H), 1.72 - 1.58 (m, 2H), 1.54 - 1.39 (m, 26H), 1.22 (d, J = 8.9 Hz, 14H), 0.92 (s, 9H), 0.88 (d, J = 6.8 Hz, 3H), 0.82 (d, J = 6.8 Hz, 3H). LC-MS (ESI): m / z 1626.3 [(M+2H) / 2] + .

[0260] Step 5.3: Synthesis of conjugate 19E

[0261] The title compound (20 mg) was obtained from compound 18 and 3E following the general synthetic route. 1H NMR (400 MHz, DMSO-d6) δ 11.95 (s, 1H), 10.04 (s, 1H), 8.98 (s, 1H), 8.50 (s, 1H), 8.42 (t, J = 5.4 Hz, 1H), 8.12 (d, J = 7.2 Hz, 1H), 8.08 (d, J = 2.5 Hz, 1H), 7.94 - 7.81 (m, 7H), 7.77 (d, J = 5.9 Hz, 4H), 7.65 (d, J = 9.1 Hz, 5H), 7.50 (d, J = 7.7 Hz, 1H), 7.43 (d, J = 8.3 Hz, 2H), 7.30 - 7.26 (m, 2H), 7.09 (s, 1H), 7.02 (s, 1H), 6.92 (d, J = 8.0 Hz, 1H), 6.00 (s, 1H), 5.44 (s, 2H), 5.15 (s, 3H), 4.64 - 4.33 (m, 17H), 4.22 (d, J = 8.3 Hz, 6H), 3.77 - 3.59 (m, 16H), 3.58 - 3.46 (m, 20H), 3.31 - 3.27 (m, 2H), 3.09 - 2.98 (m, 14H), 2.91 (s, 3H), 2.40 (s, 3H), 2.32 - 1.94 (m, 24H), 1.80 (s, 9H), 1.59 - 1.36 (m, 30H), 1.27 - 1.17 (m, 34H), 0.92 (s, 9H), 0.85 (dd, J = 12.7, 6.6 Hz, 6H). LC-MS (ESI): m / z 1570.4 [(M+2H) / 2] + .

[0262] Scheme 4. Synthesis of conjugates 28B / 28D / 28E

[0263] Step 1: Synthesis of compound 21

[0264] Compound 20 (2.50 g, 8.92 mmol) and N,N-diisopropylethylamine (4.4 mL, 26.76 mmol) were dissolved in dichloromethane (80 mL), and methanesulfonyl chloride (1.04 g, 13.38 mmol) was added, and the reaction was allowed to proceed at room temperature for 1 hour. After the reaction was completed as monitored by TLC, it was concentrated under reduced pressure, and the residue was purified by column chromatography (ethyl acetate / dichloromethane = 0-10%) to give the title compound (1.47 g, yield 55%). 1H NMR (400 MHz, DMSO-d6) δ 10.01 (s, 1H), 7.63-7.54 (m, 2H), 7.41-7.34 (m, 2H), 7.05 (t, J = 6.1 Hz, 1H), 4.72 (s, 2H), 3.72 (d, J = 5.8 Hz, 2H), 1.40 (s, 9H). LC-MS (ESI): m / z 321.0 [M+Na] + .

[0265] Step 2: Synthesis of compound 22

[0266] Compound 8 (900 mg, 1.37 mmol) and compound 21 (492 mg, 1.64 mmol) were dissolved in acetonitrile (3 mL) and tetrahydrofuran (3 mL), cesium carbonate (1.34 g, 4.11 mmol) was added, and the reaction was allowed to proceed at room temperature for 30 minutes. After the reaction was completed by LC-MS monitoring, the filtrate was concentrated under reduced pressure, and the residue was separated and purified by column chromatography (methanol / dichloromethane = 0-7%) to give the title compound (832 mg, yield 63%). 1 H NMR (400 MHz, DMSO-d6) δ 9.97 (s, 1H), 8.98 (s, 1H), 8.47 (t, J = 6.1 Hz, 1H), 7.86 (d, J = 9.3 Hz, 1H), 7.62 (d, J = 8.5 Hz, 2H), 7.49 (d, J = 7.8 Hz, 1H), 7.46-7.41 (m, 2H), 7.10 (d, J = 1.6 Hz, 1H), 7.04 (t, J = 6.1 Hz, 1H), 6.92 (dd, J = 7.8, 1.6 Hz, 1H), 5.16 (s, 2H), 5.12 (d, J = 3.6 Hz, 1H), 4.55 (d, J = 9.4 Hz, 1H), 4.47 (t, J = 8.0 Hz, 1H), 4.43-4.33 (m, 2H), 4.26-4.16 (m, 1H), 3.76-3.62 (m, 4H), 2.41 (s, 3H), 2.32-2.22 (m, 1H), 2.16-2.00 (m, 2H), 1.97-1.88 (m, 1H), 1.57-1.45 (m, 4H), 1.40 (s, 9H), 1.26 (d, J = 13.7 Hz, 14H), 0.93 (s, 9H). LC-MS (ESI): m / z 918.5 [M+H] + .

[0267] Step 3: Synthesis of compound 23

[0268] Compound 22 (220 mg, 0.24 mmol) and triphenylphosphine (94 mg, 0.36 mmol) were dissolved in tetrahydrofuran (10 mL) and water (1 mL) and reacted at 50 °C under nitrogen protection overnight. After the reaction was completed by LC-MS monitoring, the residue was dissolved in dichloromethane (20 mL) and methanol (10 mL) with N,N-diisopropylethylamine (158 μL, 0.96 mmol), and 2-(7-azabenzotriazol)-N,N,N',N'-tetramethyluronium hexafluorophosphate (137 mg, 0.36 mmol) was added, and the reaction was carried out at room temperature for 2 hours. After the reaction was completed by LC-MS monitoring, it was concentrated under reduced pressure, and the residue was separated and purified by column chromatography (methanol / dichloromethane = 0-8%) to obtain the title compound (181 mg, 55% yield for two steps). 1 H NMR (600 MHz, DMSO-d6) δ 11.92 (d, J = 2.7 Hz, 1H), 9.97 (s, 1H), 8.97 (s, 1H), 8.46 (t, J = 6.1 Hz, 1H), 8.40 (t, J = 5.6 Hz, 1H), 8.07 (d, J = 2.5 Hz, 1H), 7.91 (s, 1H), 7.85 (d, J = 9.3 Hz, 1H), 7.75 (s, 1H), 7.64-7.58 (m, 3H), 7.48 (d, J = 7.8 Hz, 1H), 7.44-7.41 (m, 2H), 7.27 (d, J = 3.0 Hz, 2H), 7.09 (d, J = 1.7 Hz, 1H), 7.03 (t, J = 6.2 Hz, 1H), 6.91 (dd, J = 7.8, 1.6 Hz, 1H), 5.76 (s, 1H), 5.15 (s, 2H), 5.12 (d, J = 3.6 Hz, 1H), 4.54 (d, J = 9.4 Hz, 1H), 4.46 (t, J = 8.0 Hz, 1H), 4.40-4.33 (m, 2H), 4.20 (dd, J = 16.6, 5.4 Hz, 1H), 3.72 (d, J = 6.1 Hz, 2H), 3.65 (d, J = 5.2 Hz, 2H), 3.63 (s, 3H), 3.15 (s, 1H), 2.91 (s, 3H), 2.40 (s, 3H), 2.30-2.23 (m, 1H), 2.14-2.08 (m, 1H), 2.06-2.00 (m, 1H), 1.94-1.88 (m, 1H), 1.50 (d, J = 12.9 Hz, 1H), 1.45 (s, 3H), 1.39 (s, 9H), 1.35-1.31 (m, 1H), 1.29-1.16 (m, 15H), 0.92 (s, 9H). LC-MS (ESI): m / z 1373.5 [M+H] + .

[0269] Step 4: Synthesis of Compound 24

[0270] Compound 23 (170 mg, 0.12 mmol) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS, the solution was concentrated under reduced pressure. The residue was slurryed with diethyl ether to give the title compound (154 mg, 90% yield). LC-MS (ESI): m / z 1274.5 [M+H] + .

[0271] Step 5: Synthesis of Compound 26

[0272] Compound 24 (150 mg, 0.10 mmol), compound 25 (49 mg, 0.13 mmol), and N,N-diisopropylethylamine (66 μL, 0.4 mmol) were dissolved in dichloromethane (10 mL), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (57 mg, 0.15 mmol) were added. The reaction was carried out at room temperature for 1 hour. After the reaction was monitored by LC-MS until complete, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (124 mg, yield 76%). 1H NMR (600 MHz, DMSO-d6) δ 11.92 (s, 1H), 9.90 (s, 1H), 8.97 (s, 1H), 8.47 (t, J = 6.1 Hz, 1H), 8.44-8.38 (m, 2H), 8.19 (d, J = 8.0 Hz, 1H), 8.07 (d, J = 2.5 Hz, 1H), 7.95-7.90 (m, 2H), 7.85 (d, J = 9.3 Hz, 1H), 7.75 (s, 1H), 7.67-7.57 (m, 3H), 7.49 (d, J = 7.7 Hz, 1H), 7.47-7.42 (m, 2H), 7.28-7.24 (m, 6H), 7.22-7.15 (m, 1H), 7.09 (d, J = 1.7 Hz, 1H), 6.99 (t, J = 6.1 Hz, 1H), 6.92 (dd, J = 7.7, 1.6 Hz, 1H), 6.09-5.80 (m, 1H), 5.16 (s, 2H), 5.12 (d, J = 3.6 Hz, 1H), 4.57-4.51 (m, 2H), 4.46 (t, J = 8.0 Hz, 1H), 4.41-4.33 (m, 2H), 4.20 (dd, J = 16.6, 5.4 Hz, 1H), 3.96-3.84 (m, 2H), 3.77 (dd, J = 16.7, 5.8 Hz, 1H), 3.68-3.60 (m, 6H), 3.55 (d, J = 6.0 Hz, 2H), 3.14 (s, 2H), 3.08 (dd, J = 13.8, 4.5 Hz, 1H), 2.91 (s, 3H), 2.81 (dd, J = 13.9, 9.8 Hz, 1H), 2.40 (s, 3H), 2.30-2.22 (m, 1H), 2.14-2.06 (m, 1H), 2.06-2.00 (m, 1H), 1.94-1.87 (m, 1H), 1.54-1.42 (m, 4H), 1.37 (s, 9H), 1.32 (s, 1H), 1.29-1.15 (m, 14H), 0.92 (s, 9H). LC-MS (ESI): m / z 1635.6 [M+H] + .

[0273] Step 6: Synthesis of compound 27

[0274] Compound 26 (120 mg, 0.07 mmol) was dissolved in dichloromethane (5 mL), trifluoroacetic acid (1 mL) was added, and the reaction was allowed to proceed at room temperature for 1 hour. After the reaction was completed as monitored by LC-MS, it was concentrated under reduced pressure, and the residue was slurried with diethyl ether to give the title compound (119 mg, yield 98%). LC-MS (ESI): m / z 1535.6 [M+H] + .

[0275] General Procedure 7: Compound 27 (1.0 eq), compound 3B / 3D / 3E (1.0 eq) and N,N-diisopropylethylamine (4.0 eq) were dissolved in dimethyl sulfoxide (4 mL), and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.1 eq) was added. The reaction was allowed to proceed at room temperature for 30 min. After the reaction was completed as monitored by LC-MS, lithium hydroxide monohydrate (6.0 eq) and water (1 mL) were added to the reaction mixture, and the reaction was allowed to proceed at room temperature for 30 min. After the reaction was completed as monitored by LC-MS, the title compound was purified by Prep-HPLC (two-step yield 30-50%).

[0276] Step 7.1: Synthesis of conjugate 28B

[0277] The title compound (16 mg) was obtained from compound 27 and 3B via the general synthetic route. 1H NMR (600 MHz, DMSO-d6) δ 11.92 (s, 1H), 9.90 (s, 1H), 8.97 (s, 1H), 8.49-8.44 (m, 1H), 8.43-8.38 (m, 2H), 8.17 (d, J = 8.0 Hz, 1H), 8.10 (t, J = 5.7 Hz, 1H), 8.07 (d, J = 2.5 Hz, 1H), 7.92-7.89 (m, 2H), 7.87-7.82 (m, 4H), 7.76-7.72 (m, 4H), 7.66-7.59 (m, 6H), 7.49 (d, J = 7.7 Hz, 1H), 7.44 (d, J = 8.4 Hz, 2H), 7.27-7.25 (m, 6H), 7.20-7.17 (m, 1H), 7.09 (d, J = 1.7 Hz, 1H), 6.91 (d, J = 7.8 Hz, 1H), 6.78 (s, 1H), 5.15 (s, 2H), 5.12 (d, J = 3.5 Hz, 1H), 4.59 (t, J = 5.7 Hz, 4H), 4.55 (d, J = 6.4 Hz, 4H), 4.47 (d, J = 4.4 Hz, 4H), 4.21 (d, J = 8.4 Hz, 4H), 3.96-3.84 (m, 4H), 3.81-3.75 (m, 5H), 3.72-3.66 (m, 7H), 3.65-3.59 (m, 12H), 3.57-3.49 (m, 42H), 3.44-3.39 (m, 5H), 3.30-3.29 (m, 4H), 3.30 (s, 1H), 3.06-3.00 (m, 13H), 2.90 (s, 3H), 2.40 (s, 3H), 2.28 (t, J = 6.5 Hz, 7H), 2.13-2.00 (m, 8H), 1.80 (s, 9H), 1.54-1.38 (m, 24H), 1.22 (s, 13H), 0.91 (s, 9H). LC-MS (ESI): m / z 1657.2 [(M+2H) / 2] + .

[0278] Step 7.2: Synthesis of conjugate 28D

[0279] The title compound (21 mg) was obtained by the general synthetic route from compound 27 and 3D. 1H NMR (600 MHz, DMSO-d6) δ 11.92 (s, 1H), 9.90 (s, 1H), 8.98 (s, 1H), 8.48 (s, 1H), 8.40 (s, 2H), 8.17 (d, J = 7.9 Hz, 1H), 8.09 - 8.02 (m, 3H), 7.92 (s, 1H), 7.88 - 7.82 (m, 4H), 7.77 - 7.72 (m, 4H), 7.67 - 7.58 (m, 6H), 7.50 (d, J = 7.8 Hz, 1H), 7.45 (d, J = 8.4 Hz, 2H), 7.29 - 7.24 (m, 7H), 7.22 - 7.16 (m, 1H), 7.09 (s, 1H), 7.00 (s, 1H), 6.92 (d, J = 7.9 Hz, 1H), 5.19 - 5.11 (m, 3H), 4.59 (t, J = 5.7 Hz, 4H), 4.55 (t, J = 7.2 Hz, 5H), 4.48 (d, J = 4.5 Hz, 4H), 4.42 - 4.33 (m, 2H), 4.22 (d, J = 8.4 Hz, 4H), 3.74 - 3.62 (m, 17H), 3.57 - 3.48 (m, 18H), 3.46 - 3.39 (m, 3H), 3.30 - 3.29 (m, 4H), 3.15 (s, 3H), 3.04 (t, J = 6.6 Hz, 12H), 2.91 (s, 3H), 2.41 (s, 4H), 2.28 (t, J = 6.4 Hz, 7H), 2.12 (t, J = 7.4 Hz, 3H), 2.05 (t, J = 7.4 Hz, 9H), 1.80 (s, 9H), 1.54 - 1.40 (m, 30H), 1.22 (s, 24H), 0.92 (s, 9H). LC-MS (ESI): m / z 1559.3 [(M+2H) / 2] + .

[0280] Step 7.3: Synthesis of conjugate 28E

[0281] The title compound (22 mg) was obtained from compound 27 and 3E following the general synthetic route. 1H NMR (600 MHz, DMSO-d6) δ 11.92 (s, 1H), 9.89 (s, 1H), 8.97 (s, 1H), 8.47 (s, 1H), 8.42-8.36 (m, 2H), 8.17 (d, J = 8.0 Hz, 1H), 8.09-8.03 (m, 3H), 7.92 (s, 1H), 7.88-7.82 (m, 4H), 7.77-7.72 (m, 4H), 7.67-7.57 (m, 6H), 7.49 (d, J = 7.8 Hz, 1H), 7.44 (d, J = 8.3 Hz, 2H), 7.29-7.24 (m, 6H), 7.22-7.16 (m, 1H), 7.09 (d, J = 1.7 Hz, 1H), 7.00 (s, 1H), 6.92 (d, J = 7.9 Hz, 1H), 5.19-5.11 (m, 3H), 4.63-4.44 (m, 12H), 4.41-4.32 (m, 2H), 4.22 (d, J = 8.4 Hz, 4H), 3.98-3.83 (m, 1H), 3.80-3.74 (m, 1H), 3.73-3.61 (m, 17H), 3.58-3.47 (m, 20H), 3.44-3.39 (m, 8H), 3.29 (t, J = 6.2 Hz, 4H), 3.08-3.00 (m, 13H), 2.91 (s, 3H), 2.40 (s, 3H), 2.28 (t, J = 6.4 Hz, 6H), 2.12 (t, J = 7.4 Hz, 3H), 2.05 (t, J = 7.4 Hz, 9H), 1.96-1.85 (m, 1H), 1.80 (s, 9H), 1.55-1.39 (m, 27H), 1.21 (s, 35H), 0.92 (s, 9H). LC-MS (ESI): m / z 1601.3 [(M+2H) / 2] + .

[0282] Scheme 5. Synthesis of conjugate 36B

[0283] Step 1: Synthesis of compound 30

[0284] Compound 29 (450 mg, 1.04 mmol) was dissolved in dichloromethane (10 mL), and thionyl chloride (110 μL, 1.55 mmol) was added. The reaction was stirred at room temperature for 1 h. After the reaction was completed by LC-MS, it was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-8%) to give the title compound (390 mg, yield 83%). 1H NMR (400 MHz, DMSO-d6) δ 10.05 (s, 1H), 7.91 (d, J = 7.8 Hz, 1H), 7.61 (d, J = 8.2 Hz, 2H), 7.38 (d, J = 8.3 Hz, 2H), 6.06 - 5.91 (m, 1H), 5.68 - 5.24 (m, 2H), 4.73 (s, 2H), 4.50 - 4.40 (m, 1H), 4.16 - 4.09 (m, 2H), 3.08 - 2.88 (m, 2H), 2.48 - 2.32 (m, 3H), 2.01 - 1.57 (m, 5H), 1.51 - 1.32 (m, 2H), 1.18 (t, J = 7.1 Hz, 3H). LC-MS (ESI): m / z 453.2 [M+H] + .

[0285] Step 2: Synthesis of compound 31

[0286] Compound 8 (200 mg, 0.31 mmol) and compound 30 (152 mg, 0.34 mmol) were dissolved in acetonitrile (8 mL) and tetrahydrofuran (8 mL), cesium carbonate (397 mg, 1.22 mmol) was added, and the reaction was allowed to proceed at room temperature overnight. After the reaction was completed by LC-MS monitoring, the reaction mixture was filtered and the filtrate was purified by column chromatography (methanol / dichloromethane = 0-12%) to give the title compound (213 mg, yield 65%). 1H NMR (600 MHz, DMSO-d6) δ 10.00 (s, 1H), 8.98 (s, 1H), 8.47 (t, J = 6.0 Hz, 1H), 7.88 (dd, J = 20.7, 8.6 Hz, 2H), 7.64 (d, J = 8.4 Hz, 2H), 7.49 (d, J = 7.8 Hz, 1H), 7.44 (d, J = 8.4 Hz, 2H), 7.10 (d, J = 1.7 Hz, 1H), 6.94 - 6.90 (m, 1H), 5.98 (t, J = 5.8 Hz, 1H), 5.42 (s, 2H), 5.16 (s, 2H), 5.13 (d, J = 3.6 Hz, 1H), 4.55 (d, J = 9.4 Hz, 1H), 4.49 - 4.44 (m, 2H), 4.40 - 4.34 (m, 2H), 4.24 - 4.17 (m, 1H), 4.15 - 4.10 (m, 2H), 3.69 - 3.62 (m, 2H), 3.32 - 3.29 (m, 4H), 3.06 - 2.99 (m, 1H), 2.98 - 2.91 (m, 1H), 2.49 - 2.43 (m, 3H), 2.41 (s, 4H), 2.31 - 2.24 (m, 1H), 2.14 - 2.08 (m, 1H), 2.06 - 2.00 (m, 1H), 1.95 - 1.86 (m, 2H), 1.84 - 1.70 (m, 2H), 1.68 - 1.60 (m, 1H), 1.52 (p, J = 6.9 Hz, 3H), 1.45 (d, J = 8.2 Hz, 2H), 1.40 - 1.34 (m, 1H), 1.25 (s, 10H), 1.18 (t, J = 7.1 Hz, 3H), 0.93 (s, 9H). LC-MS (ESI): m / z 1072.5 [M+H] + .

[0287] Step 3: Synthesis of compound 32

[0288] Compound 31 (85 mg, 0.08 mmol) and triphenylphosphine (31 mg, 0.12 mmol) were dissolved in tetrahydrofuran (5 mL) and water (100 μL) and reacted at 50 °C under nitrogen protection overnight. After the reaction was completed by LC-MS monitoring, the reaction mixture was concentrated under reduced pressure, and the residue, compound 17 (40 mg, 0.08 mmol) and N,N-diisopropylethylamine (26 μL, 0.16 mmol) were dissolved in dichloromethane (5 mL), and 2-(7-azabenzotriazol-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (33 mg, 0.09 mmol) was added, and the reaction was allowed to proceed at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, the reaction mixture was concentrated under reduced pressure, and the residue was separated and purified by column chromatography (methanol / dichloromethane = 0-12%) to obtain the title compound (77 mg, 64% for two steps).1 H NMR (600 MHz, DMSO-d6) δ 11.93 (d, J = 2.7 Hz, 1H), 10.00 (s, 1H), 8.98 (s, 1H), 8.47 (t, J = 6.2 Hz, 1H), 8.40 (t, J = 5.7 Hz, 1H), 8.07 (d, J = 2.5 Hz, 1H), 7.93 - 7.75 (m, 6H), 7.66 - 7.59 (m, 3H), 7.49 (d, J = 7.8 Hz, 1H), 7.44 (d, J = 8.3 Hz, 2H), 7.28 (d, J = 3.4 Hz, 2H), 7.10 (s, 1H), 6.92 (d, J = 7.9 Hz, 1H), 5.99 (s, 1H), 5.16 (s, 2H), 4.55 (d, J = 9.4 Hz, 1H), 4.49 - 4.44 (m, 2H), 4.40 - 4.34 (m, 2H), 4.22 - 4.18 (m, 1H), 4.14 - 4.10 (m, 2H), 3.65 (s, 2H), 3.63 (s, 3H), 3.15 (s, 3H), 3.06 - 2.93 (m, 3H), 2.91 (s, 3H), 2.45 (t, J = 8.3 Hz, 3H), 2.41 (s, 4H), 2.29 - 2.24 (m, 1H), 2.14 - 1.60 (m, 9H), 1.50 (d, J = 8.5 Hz, 1H), 1.45 (t, J = 7.3 Hz, 4H), 1.39 - 1.35 (m, 1H), 1.25 - 1.16 (m, 18H), 0.92 (s, 9H). LC-MS (ESI): m / z 1528.6 [M+H] + .

[0289] Step 4: Synthesis of compound 33

[0290] Compound 32 (75 mg, 0.05 mmol) was dissolved in methanol (3 mL) and water (1 mL), and lithium hydroxide monohydrate (8 mg, 0.20 mmol) was added. The reaction was allowed to proceed at room temperature for 1 hour. After the reaction was completed as monitored by LC-MS, the pH was adjusted to be acidic, and the product was extracted with dichloromethane. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give the title compound (43 mg, yield 58%). 1H NMR (600 MHz, DMSO-d6) δ 12.88 (s, 1H), 11.93 (d, J = 2.7 Hz, 1H), 9.88 (s, 1H), 8.98 (s, 1H), 8.47 (t, J = 6.1 Hz, 1H), 8.40 (t, J = 5.6 Hz, 1H), 8.07 (d, J = 2.5 Hz, 1H), 7.95 (d, J = 7.8 Hz, 1H), 7.92 (s, 1H), 7.85 (d, J = 9.3 Hz, 1H), 7.76 (s, 1H), 7.67 - 7.59 (m, 3H), 7.49 (d, J = 7.8 Hz, 1H), 7.44 (d, J = 8.3 Hz, 2H), 7.28 (d, J = 3.4 Hz, 2H), 7.10 (s, 1H), 6.92 (d, J = 7.9 Hz, 1H), 5.98 (s, 1H), 5.16 (s, 2H), 4.55 (d, J = 9.4 Hz, 1H), 4.51 - 4.32 (m, 5H), 4.22 - 4.18 (m, 1H), 3.67 - 3.62 (m, 6H), 3.15 (s, 2H), 2.96 (s, 2H), 2.91 (s, 3H), 2.43 (d, J = 20.6 Hz, 8H), 2.30 - 2.23 (m, 1H), 2.15 - 2.00 (m, 2H), 1.96 - 1.87 (m, 2H), 1.82 - 1.75 (m, 2H), 1.68 - 1.59 (m, 1H), 1.55 - 1.33 (m, 7H), 1.30 - 1.15 (m, 15H), 0.92 (s, 9H). LC-MS (ESI): m / z 1500.5 [M+H] + .

[0291] Step 5: Synthesis of compound 34

[0292] Compound 33 (40 mg, 0.03 mmol), N-Boc-1,6-diaminohexane (12 mg, 0.05 mmol), and N,N-diisopropylethylamine (18 μL, 0.11 mmol) were dissolved in dichloromethane (5 mL), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (15 mg, 0.04 mmol) was added, and the reaction was allowed to proceed at room temperature for 30 min. After the reaction was completed as monitored by LC-MS, the reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-12%) to give the title compound (42 mg, yield 93%). LC-MS (ESI): m / z 1698.8 [M+H] + .

[0293] Step 6: Synthesis of compound 35

[0294] Compound 34 (40 mg, 0.02 mmol) was dissolved in dichloromethane (5 mL), trifluoroacetic acid (1 mL) was added, and the reaction was allowed to proceed at room temperature for 1 hour. After the reaction was completed as monitored by LC-MS, the reaction was concentrated under reduced pressure, and the residue was slurried with diethyl ether to give the title compound (31 mg, 77% yield). LC-MS (ESI): m / z 1598.7 [M+H] + .

[0295] Step 7: Synthesis of conjugate 36B

[0296] Compound 35 (1.0 eq), compound 3B (1 eq) and N,N-diisopropylethylamine (4.0 eq) were dissolved in dimethyl sulfoxide (4 mL), 2-(7-azabenzotriazol-1- yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.1 eq) was added, and the reaction was allowed to proceed at room temperature for 30 minutes. After the reaction was completed as monitored by LC-MS, lithium hydroxide monohydrate (6.0 eq) and water (1 mL) were added to the reaction, and the reaction was allowed to proceed at room temperature for 30 minutes. After the reaction was completed as monitored by LC-MS, the title compound was purified by Prep-HPLC (16 mg, 50% yield over two steps). 1 HNMR (600 MHz, DMSO-d6) δ 11.92 (s, 1H), 10.16 (s, 1H), 8.97 (s, 1H), 8.46 (s, 1H), 8.40 (t, J = 5.8 Hz, 1H), 8.07 (d, J = 2.5 Hz, 1H), 7.92 (s, 1H), 7.88-7.80 (m, 5H), 7.76 (s, 3H), 7.69-7.59 (m, 6H), 7.49 (d, J = 7.8 Hz, 1H), 7.43 (d, J = 8.3 Hz, 2H), 7.27 (s, 2H), 7.09 (s, 1H), 6.92 (d, J = 7.8 Hz, 1H), 6.79 (d, J = 6.0 Hz, 1H), 5.44 (s, 1H), 5.18-5.11 (m, 2H), 4.66-4.32 (m, 11H), 4.25-4.18 (m, 3H), 3.84 (s, 2H), 3.80 (s, 2H), 3.72-3.62 (m, 12H), 3.58-3.49 (m, 46H), 3.18-3.02 (m, 25H), 2.91 (s, 5H), 2.44-2.38 (m, 9H), 2.29 (t, J = 6.5 Hz, 7H), 2.13-1.99 (m, 9H), 1.95-1.89 (m, 1H), 1.80 (s, 12H), 1.60 (s, 4H), 1.54-1.38 (m, 30H), 1.24 (s, 22H), 0.92 (s, 9H). LC-MS (ESI): m / z 1688.9 [(M+2H) / 2] +.

[0297] Scheme 6. Synthesis of conjugate 45B

[0298] Step 1: Synthesis of compound 37

[0299] Compound 29 (300 mg, 0.69 mmol), di(p-nitrophenyl) carbonate (420 mg, 1.38 mmol) and N,N-diisopropylethylamine (455 mg, 2.76 mmol) were dissolved in dichloromethane (10 mL) and reacted at room temperature overnight. After the reaction was completed by LC-MS monitoring, it was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-8%) to give the title compound (362 mg, yield 88%).

[0300] Step 2: Synthesis of compound 39

[0301] Compound 8 (200 mg, 0.31 mmol) and compound 38 (104 mg, 0.37 mmol) were dissolved in N,N-dimethylformamide (10 mL), and potassium carbonate (128 mg, 0.93 mmol) was added. The reaction was carried out at 50°C under nitrogen protection overnight. After the reaction was completed by LC-MS monitoring, the mixture was poured into water, extracted with ethyl acetate, and the organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (121 mg, yield 47%).

[0302] Step 3: Synthesis of compound 40

[0303] Compound 39 (110 mg, 0.13 mmol) and triphenylphosphine (52 mg, 0.20 mmol) were dissolved in tetrahydrofuran (5 mL) and water (100 μL) and reacted at 50°C under nitrogen protection overnight. After the reaction was completed by LC-MS monitoring, it was concentrated under reduced pressure, and the residue, compound 10 (65 mg, 0.13 mmol), and N,N-diisopropylethylamine (86 μL, 0.52 mmol) were dissolved in dichloromethane (5 mL), and 2-(7-azabenzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (59 mg, 0.16 mmol) was added. The reaction was carried out at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, it was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-12%) to give the title compound (97 mg, yield 58% for two steps).

[0304] Step 4: Synthesis of compound 41

[0305] Compound 40 (90 mg, 0.07 mmol) was dissolved in dichloromethane (5 mL), trifluoroacetic acid (1 mL) was added, and the reaction was allowed to proceed at room temperature for 1 hour. After the reaction was completed as monitored by LC-MS, the reaction mixture was concentrated under reduced pressure, and the residue was slurried with diethyl ether to give the title compound (87 mg, 98% yield).

[0306] Step 5: Synthesis of compound 42

[0307] Compound 41 (85 mg, 0.07 mmol), compound 37 (47 mg, 0.08 mmol), and N,N- diisopropylethylamine (43 μL, 0.26 mmol) were dissolved in dichloromethane (10 mL) and the reaction was allowed to proceed at room temperature overnight. After the reaction was completed as monitored by LC-MS, the reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-8%) to give an intermediate. The intermediate and lithium hydroxide monohydrate (12 mg, 0.07 mmol) were dissolved in methanol (3 mL) and water (600 μL) and the reaction was allowed to proceed at room temperature for 1 hour. After the reaction was completed as monitored by LC-MS, the reaction mixture was purified by Prep-HPLC to give the title compound (107 mg, 94% yield over two steps).

[0308] Step 6: Synthesis of compound 43

[0309] Compound 42 (80 mg, 0.05 mmol), N-Boc-1,3-diaminopropane (9 mg, 0.05 mmol), and N,N-diisopropylethylamine (76 μL, 0.20 mmol) were dissolved in dichloromethane (5 mL), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (23 mg, 0.06 mmol) was added, and the reaction was allowed to proceed at room temperature for 30 minutes. After the reaction was completed as monitored by LC-MS, the reaction mixture was purified by Prep-HPLC to give the title compound (76 mg, 85% yield).

[0310] Step 7: Synthesis of compound 44

[0311] Compound 43 (76 mg, 0.04 mmol) was dissolved in dichloromethane (5 mL), trifluoroacetic acid (1 mL) was added, and the reaction was allowed to proceed at room temperature for 1 hour. After the reaction was completed as monitored by LC-MS, the reaction mixture was concentrated under reduced pressure, and the residue was slurried with diethyl ether to give the title compound (74 mg, 98% yield).

[0312] Step 8: Synthesis of conjugate 45

[0313] Compound 44 (1.0 eq), compound 3B (1.0 eq) and N,N-diisopropylethylamine (4.0 eq) were dissolved in dimethylsulfoxide (4 mL), 2-(7-azabenzotriazol)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.1 eq) was added, and the reaction was allowed to proceed at room temperature for 30 min. After the reaction was completed by LC-MS, lithium hydroxide monohydrate (6.0 eq) and water (1 mL) were added to the reaction solution, and the reaction was allowed to proceed at room temperature for 30 min. After the reaction was completed by LC-MS, the title compound was purified by Prep-HPLC (13 mg, 50% yield over two steps). 1 HNMR (600 MHz, DMSO-d6) δ 11.92 (s, 1H), 10.11 (s, 1H), 8.98 (s, 1H), 8.40 (s, 1H), 8.07 (d, J = 2.5 Hz, 1H), 7.92 (s, 1H), 7.84 (t, J = 6.1 Hz, 5H), 7.80-7.71 (m, 6H), 7.65-7.58 (m, 6H), 7.48 (d, J = 7.8 Hz, 1H), 7.32 (d, J = 8.2 Hz, 2H), 7.27 (s, 2H), 7.07 (s, 1H), 6.90 (d, J = 7.7 Hz, 0H), 6.78 (s, 1H), 5.42 (s, 2H), 5.13 (d, J = 3.5 Hz, 1H), 5.02 (s, 1H), 4.59 (t, J = 5.7 Hz, 4H), 4.55 (d, J = 6.2 Hz, 4H), 4.49-4.41 (m, 5H), 4.33 (d, J = 21.8 Hz, 2H), 4.22 (d, J = 8.4 Hz, 3H), 3.87 (s, 2H), 3.80 (s, 2H), 3.73-3.62 (m, 16H), 3.58-3.49 (m, 49H), 3.44-3.41 (m, 7H), 3.13 (t, J = 6.7 Hz, 4H), 3.03 (d, J = 6.6 Hz, 12H), 2.91 (s, 4H), 2.44 (d, J = 8.2 Hz, 8H), 2.29 (t, J = 6.5 Hz, 7H), 2.16-1.87 (m, 11H), 1.80 (s, 17H), 1.55-1.39 (m, 27H), 1.24 (s, 16H), 0.92 (s, 10H).

[0314] Scheme 7. Synthesis of conjugates 52B / 52C / 52E

[0315] Step 1: Synthesis of compound 46

[0316] Compound 10 (600 mg, 1.2 mmol) was dissolved in borane tetrahydrofuran complex (2 M, 15 mL) and reacted at 60 °C overnight. After the reaction was completed by LC-MS monitoring, it was quenched with methanol and concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-5%) to give an intermediate. The intermediate and Dess-Martin oxidizing agent (1.53 g, 3.6 mmol) were dissolved in dichloromethane (30 mL) and reacted at room temperature for 2 hours. After the reaction was completed by LC-MS monitoring, it was extracted with dichloromethane, washed with 10% aqueous sodium thiosulfate once, saturated brine once, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography (methanol / dichloromethane = 0-5%) to give the title compound (542 mg, yield 93%). LC-MS (ESI): m / z 485.2 [M+H] + .

[0317] Step 2: Synthesis of compound 48

[0318] Compound 46 (200 mg, 0.41 mmol), compound 47 (352 mg, 0.49 mmol), and N,N- diisopropylethylamine (203 μL, 1.23 mmol) were dissolved in dichloromethane (20 mL) and methanol (5 mL), stirred at room temperature overnight, and then sodium cyanoborohydride (84 mg, 1.23 mmol) was added to continue the reaction for 1 hour. Purification by Prep-HPLC gave the title compound (187 mg, yield 39%).

[0319] Step 3: Synthesis of compound 50

[0320] Compound 48 (180 mg, 0.15 mmol), compound 49 (118 mg, 0.18 mmol), and N,N- diisopropylethylamine (99 μL, 0.26 mmol) were dissolved in dichloromethane (10 mL) and reacted at room temperature overnight. After the reaction was completed by LC-MS monitoring, it was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (205 mg, yield 86%).

[0321] Step 4: Synthesis of compound 51

[0322] Compound 50 (200 mg, 0.13 mmol) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added to react at room temperature for 1 hour. After the reaction was completed by LC-MS monitoring, it was concentrated under reduced pressure, and the residue was slurried with diethyl ether to give the title compound (197 mg, yield 98%).

[0323] General Procedure 5: Compound 51 (1.0 eq), compound 3B / 3C / 3E (1 eq) and N,N- diisopropylethylamine (4.0 eq) were dissolved in dimethylsulfoxide (4 mL), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.1 eq) was added and the reaction was allowed to proceed at room temperature for 30 min. After the completion of the reaction as monitored by LC-MS, lithium hydroxide monohydrate (6.0 eq) and water (1 mL) were added to the reaction mixture and the reaction was allowed to proceed at room temperature for 30 min. After the completion of the reaction as monitored by LC-MS, the title compound was purified by Prep-HPLC (30-60% two step yield).

[0324] Step 5.1: Synthesis of conjugate 52B

[0325] The title compound (11 mg) was obtained using compound 51 and 3B as starting material following the general synthetic protocol. 1 H NMR (600 MHz, DMSO-d6) δ 11.88 (s, 1H), 10.06 (s, 1H), 8.98 (s, 1H), 8.56 (t, J = 6.1 Hz, 1H), 8.34 (s, 1H), 8.09 (s, 1H), 7.84 (t, J = 5.7 Hz, 5H), 7.73 (t, J = 5.8 Hz, 3H), 7.67 - 7.52 (m, 6H), 7.47 - 7.37 (m, 4H), 4.98 (s, 2H), 4.65 - 4.53 (m, 4H), 4.47 - 4.20 (m, 12H), 3.96 (s, 2H), 3.80 (s, 2H), 3.73 - 3.48 (m, 83H), 3.07 - 2.99 (m, 20H), 2.45 (s, 3H), 2.32 - 1.88 (m, 16H), 1.80 (s, 9H), 1.55 - 1.34 (m, 26H), 1.19 (t, J = 30.8 Hz, 14H), 0.93 (s, 9H), 0.88 (d, J = 6.7 Hz, 3H), 0.82 (d, J = 6.7 Hz, 3H).

[0326] Step 5.2: Synthesis of conjugate 52C

[0327] The title compound (12 mg) was obtained using compound 51 and 3C as starting material following the general synthetic protocol. 1H NMR (600 MHz, DMSO-d6) δ 11.88 (s, 1H), 10.02 (s, 1H), 8.98 (s, 1H), 8.56 (t, J = 6.1 Hz, 1H), 8.13 (s, 1H), 8.09 (s, 1H), 7.87 - 7.78 (m, 6H), 7.74 (t, J = 5.7 Hz, 3H), 7.68 - 7.51 (m, 6H), 7.44 - 7.37 (m, 4H), 7.26 - 7.14 (m, 2H), 7.00 (s, 1H), 4.97 (s, 1H), 4.55 (d, J = 9.4 Hz, 6H), 4.39 (d, J = 46.0 Hz, 6H), 4.22 (d, J = 8.4 Hz, 6H), 3.73 - 3.62 (m, 22H), 3.54 (d, J = 10.8 Hz, 23H), 3.08 - 3.00 (m, 21H), 2.45 (s, 3H), 2.31 - 1.89 (m, 22H), 1.80 (s, 9H), 1.55 - 1.32 (m, 33H), 1.23 (d, J = 13.8 Hz, 19H), 0.93 (s, 11H), 0.86 (d, J = 6.5 Hz, 3H), 0.83 (d, J = 6.7 Hz, 3H).

[0328] Step 5.3: Synthesis of conjugate 52E

[0329] The title compound (17 mg) was obtained by the general synthetic route from compound 51 and 3E. 1H NMR (600 MHz, DMSO-d6) δ 11.88 (s, 1H), 10.00 (s, 1H), 8.98 (s, 1H), 8.56 (t, J = 6.2 Hz, 1H), 8.09 (s, 2H), 7.84 (t, J = 5.7 Hz, 6H), 7.74 (t, J = 5.7 Hz, 3H), 7.67 - 7.55 (m, 6H), 7.44 - 7.37 (m, 4H), 7.26 - 7.13 (m, 2H), 6.99 (s, 1H), 4.97 (s, 1H), 4.55 (d, J = 9.4 Hz, 5H), 4.46 - 4.34 (m, 6H), 4.22 (d, J = 8.4 Hz, 6H), 3.73 - 3.61 (m, 20H), 3.57 - 3.47 (m, 32H), 3.18 (s, 2H), 3.07 - 3.00 (m, 20H), 2.45 (s, 3H), 2.31 - 1.90 (m, 21H), 1.80 (s, 9H), 1.51 (h, J = 7.1 Hz, 17H), 1.46 - 1.40 (m, 11H), 1.22 (s, 34H), 0.93 (s, 11H), 0.86 (d, J = 6.7 Hz, 3H), 0.83 (d, J = 6.8 Hz, 3H).

[0330] Scheme 8. Synthesis of conjugates 60A / 60B

[0331] Step 1: Synthesis of compound 54

[0332] Compound 12 (1.0 eq), compound 53 (0.5 eq), and N,N-diisopropylethylamine (6.0 eq) were dissolved in dichloromethane (5 mL), 2-(7-azabenzotriazol-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphate (2.0 eq) was added, and the reaction was allowed to proceed at room temperature for 1 h. After the reaction was completed by LC-MS monitoring, the reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-20%) to give the title compound (109 mg, yield 67%).

[0333] Step 2: Synthesis of compound 55

[0334] Compound 54 (1.0 eq) was dissolved in dichloromethane (5 mL), trifluoroacetic acid (1 mL) was added, and the reaction was allowed to proceed at room temperature for 1 h. After the reaction was completed by LC-MS monitoring, the reaction mixture was concentrated under reduced pressure, and the residue was slurried with diethyl ether to give the title compound (99 mg, yield 98%).

[0335] Step 3: Synthesis of conjugate 60A

[0336] Compound 55 (1.0 eq), compound 3E (1.0 eq) and N,N-diisopropylethylamine (4.0 eq) were dissolved in dimethylsulfoxide (4 mL), 2-(7-azabenzotriazol-1- yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.1 eq) was added and the reaction was allowed to proceed at room temperature for 30 min. After the reaction was completed by LC-MS, lithium hydroxide monohydrate (6.0 eq) and water (1 mL) were added to the reaction mixture and the reaction was allowed to proceed at room temperature for 30 min. After the reaction was completed by LC-MS, the title compound was purified by Prep-HPLC (two-step yield 31%). LC-MS (ESI): m / z 1522.8 [(M+3H) / 3] + .

[0337] Step 4: Synthesis of compound 56

[0338] Compound 27 (1.0 eq), compound 53 (0.5 eq), and N,N-diisopropylethylamine (6.0 eq) were dissolved in dichloromethane (5 mL), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'- tetramethyluronium hexafluorophosphate (2.0 eq) was added and the reaction was allowed to proceed at room temperature for 1 h. After the reaction was completed by LC-MS, the reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-20%) to give the title compound (91 mg, yield 51%).

[0339] Step 5: Synthesis of compound 57

[0340] Compound 56 (1.0 eq) was dissolved in dichloromethane (5 mL), trifluoroacetic acid (1 mL) was added and the reaction was allowed to proceed at room temperature for 1 h. After the reaction was completed by LC-MS, the reaction mixture was concentrated under reduced pressure, and the residue was slurried with diethyl ether to give the title compound (85 mg, yield 99%).

[0341] Step 6: Synthesis of conjugate 60B

[0342] Compound 57 (1.0 eq), compound 3C (1.0 eq) and N,N-diisopropylethylamine (4.0 eq) were dissolved in dimethylsulfoxide (4 mL), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'- tetramethyluronium hexafluorophosphate (1.1 eq) was added and the reaction was allowed to proceed at room temperature for 30 min. After the reaction was completed by LC-MS, lithium hydroxide monohydrate (6.0 eq) and water (1 mL) were added to the reaction mixture and the reaction was allowed to proceed at room temperature for 30 min. After the reaction was completed by LC-MS, the title compound was purified by Prep-HPLC (two-step yield 22%). LC-MS (ESI): m / z 1574.7 [(M+3H) / 3] + .

[0343] Scheme 9. Synthesis of conjugates 60C / 60E

[0344] Step 1: Synthesis of compound 59

[0345] Compound 10 (1.0 eq), compound 58 (1.1 eq), and N,N-diisopropylethylamine (4.0 eq) were dissolved in dichloromethane (5 mL), and 2-(7-azabenzotriazol-l-yl)-N,N,N',N'- tetramethyluronium hexafluorophosphate (1.1 eq) was added. The reaction was allowed to proceed at room temperature for 1 h. After the reaction was complete as monitored by LC-MS, the reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (178 mg, 53% yield).

[0346] Step 2: Synthesis of compound 61

[0347] Compound 6 (1.0 eq), 1 -imidazole sulfonyl azide hydrochloride (1.2 eq), and potassium carbonate (2.0 eq) were dissolved in methanol (10 mL) and allowed to react at room temperature overnight. After the reaction was complete as monitored by LC-MS, the reaction mixture was filtered, and the filtrate was concentrated under reduced pressure and purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (312 mg, 79% yield).

[0348] Step 3: Synthesis of compound 62

[0349] Compound 59 (1.0 eq), compound 61 (1.2 eq), copper sulfate pentahydrate (0.2 eq), and sodium ascorbate (0.5 eq) were dissolved in 1,4-dioxane (3 mL), tert-butanol (2 mL), and water (1 mL) and allowed to react at 50 °C for 1 h. After the reaction was complete as monitored by LC-MS, the reaction mixture was concentrated under reduced pressure and purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (168 mg, 83% yield).

[0350] Step 4: Synthesis of compound 63

[0351] Compound 62 (1.0 eq) and compound 21 (1.2 eq) were dissolved in acetonitrile (3 mL) and tetrahydrofuran (3 mL), and cesium carbonate (3.0 eq) was added. The reaction was allowed to proceed at room temperature for 30 min. After the reaction was complete as monitored by LC-MS, the reaction mixture was filtered, and the filtrate was concentrated under reduced pressure and purified by column chromatography (methanol / dichloromethane = 0-7%) to give the title compound (141 mg, 53% yield).

[0352] Step 5: Synthesis of compound 64

[0353] Compound 63 (1.0 eq) was dissolved in dichloromethane (5 mL), trifluoroacetic acid (1 mL) was added, and the reaction was allowed to proceed at room temperature for 1 h. After the reaction was complete as monitored by LC-MS, the reaction was concentrated under reduced pressure, and the residue was triturated with diethyl ether to afford the title compound (140 mg, 98% yield).

[0354] Step 6: Synthesis of compound 65

[0355] Compound 64 (1.0 eq), compound 25 (0.5 eq), and N,N-diisopropylethylamine (6.0 eq) were dissolved in dichloromethane (5 mL), 2-(7-azabenzotriazol-l-yl)-N,N,N',N'- tetramethyluronium hexafluorophosphate (2.0 eq) was added, and the reaction was allowed to proceed at room temperature for 1 h. After the reaction was complete as monitored by LC-MS, the reaction was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-20%) to afford the title compound (98 mg, 67% yield).

[0356] Step 7: Synthesis of compound 66

[0357] Compound 65 (1.0 eq) was dissolved in dichloromethane (5 mL), trifluoroacetic acid (1 mL) was added, and the reaction was allowed to proceed at room temperature for 1 h. After the reaction was complete as monitored by LC-MS, the reaction was concentrated under reduced pressure, and the residue was triturated with diethyl ether to afford the title compound (95 mg, 96% yield).

[0358] Step 8: Synthesis of compound 67

[0359] Compound 66 (1.0 eq), compound 53 (0.5 eq), and N,N-diisopropylethylamine (6.0 eq) were dissolved in dichloromethane (5 mL), 2-(7-azabenzotriazol-l-yl)-N,N,N',N'- tetramethyluronium hexafluorophosphate (2.0 eq) was added, and the reaction was allowed to proceed at room temperature for 1 h. After the reaction was complete as monitored by LC-MS, the reaction was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-20%) to afford the title compound (63 mg, 53% yield).

[0360] Step 9: Synthesis of compound 68

[0361] Compound 67 (1.0 eq) was dissolved in dichloromethane (5 mL), trifluoroacetic acid (1 mL) was added, and the reaction was allowed to proceed at room temperature for 1 h. After the reaction was complete as monitored by LC-MS, the reaction was concentrated under reduced pressure, and the residue was triturated with diethyl ether to afford the title compound (63 mg, 98% yield).

[0362] General Procedure 10: Compound 68 (1.0 eq), compound 3B / 3C (1 eq) and N, N- diisopropylethylamine (4.0 eq) were dissolved in dimethylsulfoxide (4 mL), 2-(7- azabenzotriazol-1 -yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.1 eq) was added and the reaction was allowed to proceed at room temperature for 30 min. After the completion of the reaction as monitored by LC-MS, lithium hydroxide monohydrate (6.0 eq) and water (1 mL) were added to the reaction mixture and the reaction was allowed to proceed at room temperature for 30 min. After the completion of the reaction as monitored by LC-MS, the title compound was purified by Prep-HPLC (20-30% yield over two steps).

[0363] Step 9.1 : Synthesis of conjugate 60C

[0364] The title compound (15 mg) was obtained from compound 68 and 3C following the general synthetic route. LC-MS (ESI): m / z 1590.8 [(M+3H) / 3] + .

[0365] Step 9.2: Synthesis of conjugate 60E

[0366] The title compound (7 mg) was obtained from compound 68 and 3B following the general synthetic route. LC-MS (ESI): m / z 1665.4 [(M+3H) / 3] + .

[0367] Scheme 10. Synthesis of conjugate 60D

[0368] Step 1 : Synthesis of compound 71

[0369] Compound 69 (1.0 eq), compound 70 (1.0 eq), and N, N-diisopropylethylamine (4.0 eq) were dissolved in dichloromethane (5 mL), 2-(7-azabenzotriazol-1 -yl)-N,N,N',N'- tetramethyluronium hexafluorophosphate (1.2 eq) was added and the reaction was allowed to proceed at room temperature for 1 h. After the completion of the reaction as monitored by LC-MS, the reaction mixture was concentrated under reduced pressure and the residue was purified by column chromatography (methanol / dichloromethane = 0-10%) to give the title compound (110 mg, 78% yield).

[0370] Step 2: Synthesis of compound 72

[0371] Compound 71 (1.0 eq) was dissolved in dichloromethane (5 mL), trifluoroacetic acid (1 mL) was added and the reaction was allowed to proceed at room temperature for 1 h. After the completion of the reaction as monitored by LC-MS, the reaction mixture was concentrated under reduced pressure and the residue was triturated with diethyl ether to give the title compound (105 mg, 96% yield).

[0372] Step 3: Synthesis of compound 73

[0373] Compound 72 (1.0 eq), 1 -imidazole sulfonyl azide hydrochloride (1.2 eq) and potassium carbonate (2.0 eq) were dissolved in methanol (10 mL) and reacted at room temperature overnight. After the reaction was completed by LC-MS, the filtrate was concentrated under reduced pressure and purified by column chromatography (methanol / dichloromethane = 0-10%) to obtain the title compound (118 mg, yield 76%).

[0374] Step 4: Synthesis of compound 74

[0375] Compound 59 (1.0 eq), compound 73 (1.2 eq), copper sulfate pentahydrate (0.2 eq) and sodium ascorbate (0.5 eq) were dissolved in 1,4-dioxane (3 mL), tert-butyl alcohol (2 mL) and water (1 mL) and reacted at 50°C for 1 hour. After the reaction was completed by LC-MS, it was concentrated under reduced pressure and purified by column chromatography (methanol / dichloromethane = 0-10%) to obtain the title compound (81 mg, yield 77%).

[0376] Step 5: Synthesis of compound 75

[0377] Compound 74 (1.0 eq) and compound 21 (1.2 eq) were dissolved in acetonitrile (3 mL) and tetrahydrofuran (3 mL), and cesium carbonate (3.0 eq) was added and reacted at room temperature for 30 minutes. After the reaction was completed by LC-MS, the filtrate was concentrated under reduced pressure and purified by column chromatography (methanol / dichloromethane = 0-7%) to obtain the title compound (57 mg, yield 56%).

[0378] Step 6: Synthesis of compound 76

[0379] Compound 75 (1.0 eq) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added and reacted at room temperature for 1 hour. After the reaction was completed by LC-MS, it was concentrated under reduced pressure, and the residue was slurried with diethyl ether to obtain the title compound (57 mg, yield 99%).

[0380] Step 7: Synthesis of compound 77

[0381] Compound 76 (1.0 eq), compound 25 (0.5 eq), and N,N-diisopropylethylamine (6.0 eq) were dissolved in dichloromethane (5 mL), and 2-(7-azabenzotriazol-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphate (2.0 eq) was added and reacted at room temperature for 1 hour. After the reaction was completed by LC-MS, it was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-20%) to obtain the title compound (62 mg, yield 61%).

[0382] Step 8: Synthesis of compound 78

[0383] Compound 77 (1.0 eq) was dissolved in dichloromethane (5 mL), trifluoroacetic acid (1 mL) was added, and the reaction was allowed to proceed at room temperature for 1 h. After the reaction was completed as monitored by LC-MS, the reaction mixture was concentrated under reduced pressure, and the residue was slurried with diethyl ether to give the title compound (60 mg, 96% yield).

[0384] Step 9: Synthesis of compound 79

[0385] Compound 78 (1.0 eq), compound 53 (0.5 eq), and N,N-diisopropylethylamine (6.0 eq) were dissolved in dichloromethane (5 mL), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'- tetramethyluronium hexafluorophosphate (2.0 eq) was added, and the reaction was allowed to proceed at room temperature for 1 h. After the reaction was completed as monitored by LC-MS, the reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography (methanol / dichloromethane = 0-20%) to give the title compound (32 mg, 47% yield).

[0386] Step 10: Synthesis of compound 80

[0387] Compound 79 (1.0 eq) was dissolved in dichloromethane (5 mL), trifluoroacetic acid (1 mL) was added, and the reaction was allowed to proceed at room temperature for 1 h. After the reaction was completed as monitored by LC-MS, the reaction mixture was concentrated under reduced pressure, and the residue was slurried with diethyl ether to give the title compound (31 mg, 98% yield).

[0388] Step 11: Synthesis of compound 60D

[0389] Compound 80 (1.0 eq), compound 3C (1 eq), and N,N-diisopropylethylamine (4.0 eq) were dissolved in dimethyl sulfoxide (4 mL), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'- tetramethyluronium hexafluorophosphate (1.1 eq) was added, and the reaction was allowed to proceed at room temperature for 30 min. After the reaction was completed as monitored by LC-MS, lithium hydroxide monohydrate (6.0 eq) and water (1 mL) were added to the reaction mixture, and the reaction was allowed to proceed at room temperature for 30 min. After the reaction was completed as monitored by LC-MS, the title compound was purified by Prep-HPLC (7 mg, 21% yield over two steps). LC-MS (ESI): m / z 1581.4 [(M+3H) / 3] + .

[0390] Example 2: In vitro anti-tumor activity test of liver-targeting protein degrader conjugates

[0391] In vitro anti-tumor activity assay: Huh-7 cells (4 x 10^3 cells / well) were seeded in 96-well plates containing 100 μL of 1 x DMEM, 10% fetal bovine serum, and 1% penicillin / streptomycin (15140-122, Gibco, Rockville, MD, USA). After 24 hours, the medium was replaced with 0.2 mL of the above medium containing the indicated doses of compounds and incubated at 37 °C for three days. Cell viability was measured using the CellTiter-Glo cell viability assay kit (G1111, Promega, Madison, WI, USA) following the manufacturer’s instructions. Dose response curves were generated and the half maximal inhibitory concentration (IC 50 ) was calculated using GraphPad v9.0.2 (San Diego, CA, USA). As shown in Table 1, the novel conjugates exhibited good in vitro anti-tumor activity, where “+++” indicates IC 50 less than or equal to 200 nM; “++” indicates IC 50 between 200 and 1000 nM; “+” indicates IC 50 greater than or equal to 1000 nM.

[0392] Table 1. In vitro anti-tumor activity of Huh7 cell line

[0393] Example 3: Protein degradation activity test of liver-targeting protein degrader conjugates

[0394] Western blotting: After treatment of cells with indicated concentrations and time, culture medium was removed, cells were washed with phosphate-buffered saline (PBS) and lysed in ice-cold RIPA lysis buffer with EDTA and EGTA (BP-115DG, Boston BioProducts, Ashland, MA, USA) (100 μL). Cells were immediately placed on ice, scraped and collected into 1.5 mL centrifuge tubes. After incubation of cell lysates on ice for 30 min, centrifugation was performed at 15 000 g and 4 °C for 15 min. Cell pellets were discarded and supernatants were collected for Western blot analysis. Supernatants were quickly frozen and stored at -80 °C for long-term storage. Protein concentration of cell lysates was determined using the bicinchoninic acid protein assay kit (P0010, Beyotime, Tianjin, China). After protein quantification, cell lysates containing one-fourth volume of 4x Laemmli sample buffer (1610747, Bio-Rad, Hercules, CA, USA) and 5% β-mercaptoethanol were heated at 95 °C for 5 min. Then, samples (20 μg) were electrophoretically transferred by a wet electroblotting system (Bio-Rad, Richmond, CA, USA) onto 0.22 μm polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA, USA). Membranes were blocked in TBS-T buffer (50 mM Tris base, 150 mM sodium chloride (NaCl), 0.1% (v / v) Tween-20) containing 5% (w / v) skim milk powder for 1 h at room temperature. Membranes were washed with TBS-T three times and incubated with primary antibodies at 4 °C overnight. Membranes were washed with TBS-T three times for 15 min each and incubated with secondary antibodies for 1 h at room temperature in the dark. Subsequently, membranes were washed with TBS-T three times for 5 min each. Protein bands were detected using a GeneGnome XRQ-NPC system (Synoptics, Fredrick, MD) and quantified using Image Studio software. Experiments showed that representative compounds degraded BET family proteins in a time- and concentration-dependent manner and effectively induced downregulation of downstream c-Myc (Figure 1).

[0395] Example 4: Activity of liver-targeting protein degrader conjugates is highly correlated with ASGPR expression

[0396] Construction of ASGPR knockdown cell lines: pCDH-MSCV-E2F-eGFP lentivirus vector was used to construct ASGPR knockdown plasmid. ASGPR shRNA (target sequence: GCAATGTGGGAAGAAAGAT and GCACCACATAGGCCCTGTGAA) plasmid was constructed using pLKO.1 lentivirus vector. The plasmid was transfected into HEK-293T cells, and the collected lentivirus was transfected into Huh-7 cells. Subsequently, the cells were cultured in selection medium containing 2 pg / mL puromycin (ant-pr-1, InvivoGen, USA) for three days. The efficiency of ASGPR knockdown was verified by Western blot analysis.

[0397] 4.1. Degradation activity of representative conjugates

[0398] First, the protein degradation activity of representative compounds was evaluated using the in vitro constructed ASGPR knockdown Huh7 cell line (non-knockdown as control). The results showed (Figure 2) that the protein degradation activity of conjugate 13E was greatly reduced after ASGPR knockdown, demonstrating that the activity of this type of conjugate is dependent on the expression of the receptor, with potential safety advantages.

[0399] 4.2. Differences in in vitro anti-tumor activity

[0400] Compared to normal Huh7 cells, the cell activity of compound 13E was greatly reduced in ASGPR knockdown Huh7 cells (Figure 3), further demonstrating that the cell activity of the conjugate is highly correlated with the expression of the receptor, suggesting that the conjugate is expected to improve the systemic tissue toxicity of ASGPR expression.

[0401] Example 4: Solubility test of representative conjugates

[0402] Solubility determination: Excess compound 13E and GNE-987 were added to deionized water, sonicated for 10 minutes, and then centrifuged at 10,000 rpm for 10 minutes. The supernatant was separated and the concentration of compound 13E and GNE-987 was determined by high performance liquid chromatography (HPLC).

[0403] Table 2. Solubility differences of representative conjugates

[0404] As shown in Table 2, traditional PROTAC drugs are generally less water-soluble, while the representative conjugate 13E has excellent water-solubility, more than 1000 times higher than GNE-987, and can be directly used as a physiological saline preparation for in vivo administration.

[0405] Example 5: In vivo anti-tumor activity of representative conjugates

[0406] In vivo tumor inhibition experiment: Four-week-old male BALB / c nude mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (China). The mice were housed under specific pathogen-free (SPF) conditions at an ambient temperature of 20-21 °C, relative humidity of 40-60%, 12-hour dark / 12-hour light cycle, and free access to standard food and water for two weeks. The experiment was performed when the mice reached approximately 22 grams in weight. This study was conducted in accordance with the Guide for the Care and Use of Laboratory Animals. All experimental parameters were kept consistent during data analysis. All experimental protocols were approved by the Animal Ethics Committee of the Kunming Institute of Zoology, Chinese Academy of Sciences (IACUC-RE-2023-04-007). All procedures were in accordance with the principles and relevant national guidelines for animal protection, welfare, and ethics. The tumor model was established by inoculating 5 x 106Huh-7 cells suspended in 100 μL of a DMEM and Matrigel (1:1) mixture into the right flank of each mouse to form Huh-7 cell implants. Matrigel (#356234, Corning, Inc., Corning, NY, USA) was thawed on ice overnight before use. After three weeks, the tumor volume reached approximately 150 mm3. The tumor volume (V) was calculated using the formula V = L / 2 x W2 by measuring the tumor length (L) and width (W). The mice were divided into two or four groups according to the tumor size to ensure that the average tumor size in each group was close, and each group corresponded to one administration method. Sorafenib (SOR) was prepared into an injection solution (5% DMSO + 40% PEG300 + 5% Tween-80 + 50% normal saline), while Compound 13E was dissolved in normal saline. The mice received intraperitoneal injections of the indicated drugs and solutions. After injection, the body weight and tumor size were measured every three days. To study the synergistic effect of Compound 13E and SOR, the mice were sacrificed when the tumor volume reached 1500 mm3.

[0407] The experimental results showed that conjugate 13E (administered once every 3 days) and sorafenib (administered once every 2 days) had comparable anti-tumor activity when administered as single agents, while the combination completely inhibited tumor growth (Figure 4A). In addition, long-term combination administration completely inhibited tumor growth for more than two months (Figure 4B) and significantly prolonged the survival of mice (Figure 4C), suggesting that the conjugate has good in vivo anti-tumor activity. In addition, neither the conjugate 13E alone nor the combination of 13E and sorafenib showed obvious toxic side effects.

[0408] Example 6: Preliminary in vivo safety evaluation of representative conjugates

[0409] Blood and tissue sampling: After the experiment in Example 5 was completed, the mice were fasted for 12 hours and then sacrificed by exsanguination under isopentane anesthesia. Whole blood samples were collected and divided into two parts: one was allowed to clot naturally at room temperature to obtain serum for biochemical analysis, and the other was placed in an EDTA tube and analyzed for complete blood count (CBC) within 4 hours using a Mindray BC-5000 Vet automatic blood analyzer (Mindray, Shenzhen, China). After weighing, the liver and tumor tissues were cut into three parts: one was fixed in 10% formalin for histopathological examination, and the other two were immediately frozen in liquid nitrogen for tissue extraction and Western blot analysis. These tissue samples were stored at -80°C until use.

[0410] The results showed that the conjugate 13E and sorafenib had no obvious damage to platelets after long-term combination administration (Figure 5), indicating good safety of the conjugate.

[0411] Example 7: In vitro stability evaluation of representative conjugates

[0412] An appropriate amount of conjugate 13E was dissolved in PBS (pH = 7.4) or cell culture medium, and observed at room temperature and 37°C, respectively, for one week. During the experiment, the samples were taken every 24 hours and the purity was detected by HPLC.

[0413] The results showed that the purity of conjugate 13E was greater than 90% at the end of the experiment, indicating that it had good stability.

[0414] Example 8: In vitro anti-hepatic fibrosis model evaluation of representative conjugates

[0415] Experimental method: We evaluated the effect of 13E on fibrosis markers in TGF-β activated LX-2 cells to study its potential anti-fibrosis effect. First, LX-2 cells were treated with different concentrations (5 and 10 ng / mL) of TGF-β to detect their effect on the expression of fibrosis-related proteins Col1A1 and Mmp2. Subsequently, quantitative PCR technique was used to analyze the expression changes of fibrosis markers to evaluate the effect of 13E on reversing TGF-β induced fibrosis gene expression.

[0416] The results showed that the mRNA expression levels of Col1A1 and Mmp2 in LX-2 cells were significantly up-regulated after TGF-β treatment, successfully establishing an in vitro hepatic fibrosis model. The results of quantitative PCR analysis showed that the mRNA levels of Col1A1 and Mmp2 were significantly decreased in the 13E treatment group, suggesting that 13E could effectively reverse TGF-β induced fibrosis gene expression (Figure 6).

[0417] Example 9: In vivo anti-hepatic fibrosis model evaluation of representative conjugates

[0418] Experimental Methods: To evaluate the anti-hepatic fibrosis effect of 13E in vivo, a high-fat choline-deficient diet (CDAA-HFD) mouse model was used to induce liver fibrosis, and the expression of fibrosis markers in the liver was analyzed by quantitative PCR. First, the mRNA levels of key fibrosis-related genes such as a-sma, Tgfβ, and Mmp2 were detected by qPCR to verify the anti-fibrosis effect of 13E.

[0419] The results showed that quantitative PCR analysis showed that the mRNA levels of a-sma, Tgfβ, and Mmp2 in the livers of CDAA-HFD group mice were significantly increased, suggesting that the progression of liver fibrosis was significantly aggravated. After 13E treatment, the mRNA expression of these genes was significantly decreased, indicating that 13E could effectively inhibit the expression of genes related to liver fibrosis (Figure 7).

[0420] All documents referred to in this disclosure are incorporated herein by reference as if each were individually incorporated by reference. In addition, it is to be understood that various modifications or alterations can be made to the above-disclosed invention without departing from the scope of the application.

Claims

1. A conjugate or a pharmaceutically acceptable salt thereof, characterized in that, The conjugate is shown as formula (A), wherein the subscript z is 1, 2, or 3; X a and one of X b is CH or N, the other is CH; L 1 for the linker moiety; L P is a cleavable or non-cleavable linker; R is absent or represents 1 or 2 modifying groups; A is R E3 -R Linker -; wherein R E3 is an E3 ligase ligand moiety, R Linker is nothing or a linker for connecting the E3 ligase ligand moiety and the BET family protein binding moiety as shown in Formula IA; L 2 selected from the group consisting of amide, carbonyl, Ci-8alkylene-amide, Ci-8alkylene-carbonyl, and Ci-15alkylene; Ar is an aromatic or heteroaromatic ring; Bm is a ligand for ASGPR.

2. The conjugate of claim 1, wherein, L 1 -W La -(W L1 ) q1 -W Lb -[(W L2 ) q2 -W Lc -(W L3 ) q3 -W Ld ] z1 -; wherein, W La , W Lc and W Ld are each independently selected from the group consisting of null, W, C1-2alkylene, C1-2alkylene-W-, -W-C1-2alkylene, and C1-2alkylene-W-C1-2alkylene; W Lb selected from the group consisting of: none, W, C1-2alkylene, C1-2alkylene-W-, -W-C1-2alkylene, C1-2alkylene-W-C1-2alkylene, W 1 , C1-2alkylene-W 1 , -W 1 (-C1-2alkylene-)2, -C1-2alkylene-W 1 (-C1-2alkylene-)2, W 2 , C1-2alkylene-W 2 , -W 2 (-C1-2alkylene-)3, and -C1-2alkylene-W 2 (-C1-2alkylene-)3; wherein each W is independently selected from the group consisting of O, S, CO, NH, CONH, NHCO, -CºC-, -CH=CH-, and -NHCONH-; W 1 selected from the group consisting of -N=, -CH=, -CON=, -NHCON=; W 2 selected from the group consisting of =C=; W L1 , W L2 and W L3 each independently is C1-3alkylene (preferably -CH2-) or C1-2alkylene-O-C1-2alkylene (preferably -CH2OCH2-); each of q1, q2, and q3 is independently an integer from 0 to 20; the subscript z1 is 1, 2, or 3.

3. The conjugate of claim 1, wherein L 1 selected from the following table:

4. The conjugate of claim 1, wherein The conjugate is shown as formula (I), wherein X a and one of X b is CH or N, the other is CH; L 1 is a linker moiety; L P is a cleavable or non-cleavable linker; R is absent or represents 1 or 2 modifying groups; A is R E3 -R Linker -; wherein R E3 is an E3 ligase ligand moiety, R Linker is nothing or a linker for connecting the E3 ligase ligand moiety and the BET family protein binding moiety as shown in Formula IA; L 2 selected from the group consisting of amide, carbonyl, Ci-8alkylene-amide, Ci-8alkylene-carbonyl, and Ci-15alkylene; Ar is an aromatic or heteroaromatic ring; Bm is a ligand for ASGPR.

5. The conjugate of claim 1 or 4, wherein Bm is as shown in formula IB; wherein R B1 is -NHAc or -OH; R B2 is -OH or -PO3H2; W Bn CO or NH; L B each independently is a divalent radical of the formula -(W B1 ) q1 -W Ba -(W B2 ) q2 -W Bb -(W B3 ) q3 -W Bc -(W B4 ) q4 - W Ba , W Bb , and W Bc are each independently selected from the group consisting of null, O, CO, NH, CONH, and NHCO; W B1 , W B2 , W B3 and W B4 are each independently C1-3alkylene or C1-2alkylene-O; each of q1, q2, q3, and q4 is independently an integer from 0 to 15; a is 1, 2, or 3.

6. The conjugate of claim 1 or 4, wherein Bm is selected from Table B below: Table B 7. The conjugate of claim 1 or 4, wherein X a and X b are each CH.

8. The conjugate of claim 1 or 4, wherein The conjugate has one or more features selected from the group consisting of: (a) L P To Preferably wherein, for connection to L 1 of the connection point; For use with NH; Z 1 and Z 2 each independently is nothing (absent) or an amino acid residue, Z 3 and Z 4 each independently is an amino acid residue; (c) L 2 selected from the group consisting of -NHCO-, -(CH2) m - and -CO-; wherein m is an integer from 1 to 12; (d) R is absent or represents 1 or 2 groups selected from the group consisting of nitro, deuterium, halogen, C1-4alkyl, C1-4alkoxy; (e) Ar is a C6-10aromatic ring or a 5- to 10-membered heteroaromatic ring.

9. The conjugate of claim 1 or 4, wherein, The conjugate has one or more features selected from the group consisting of: (a) Z 1 is nothing or a glycine residue; Z 2 is nothing or an amino acid residue selected from the group consisting of an L-glutamine residue, a D-glutamine residue, an L-glutamic acid residue, a D-glutamic acid residue, an L-aspartic acid residue, a D-aspartic acid residue, an L-alanine residue, a D-alanine residue, and a glycine residue; Z 3 is selected from the group consisting of an L-valine residue, a D-valine residue, an L-alanine residue, a D-alanine residue, an L-phenylalanine residue, a D-phenylalanine residue, and a glycine residue; and Z 4 is selected from the group consisting of an L-alanine residue, a D-alanine residue, an L-citrulline residue, a D-citrulline residue, an L-asparagine residue, a D-asparagine residue, an L-lysine residue, a D-lysine residue, an L-phenylalanine residue, a D-phenylalanine residue, and a glycine residue; (c) Ar is a benzene ring or a 5- or 6-membered nitrogen-containing heteroaromatic ring; (d) R Linker To wherein representative of the point of attachment of the methylene group; * represents the position of attachment to R E3 ; n is an integer from 0 to 20; (e) R E3 selected from the group consisting of: wherein R 1 is H or C1-3alkyl; representative of the point of attachment of the methylene group.

10. The conjugate of claim 1 or 4, wherein The conjugate has one or more features selected from the group consisting of: (a) L P selected from the following table: wherein for connection to L 1 and For use with the point of attachment of the methylene group; (c) Ar is (d) A is selected from the group consisting of: wherein n is an integer from 0 to 20; representing the connection point with L 2 ; and representative of the point of attachment of the methylene group.

11. The conjugate of claim 1 or 4, wherein selected from the group consisting of:

12. The conjugate of claim 1, wherein, the conjugate is selected from Table A Table A 13. A pharmaceutical composition comprising (i) the conjugate of claim 1 or 4, or a pharmaceutically acceptable salt thereof, and (ii) one or more pharmaceutically acceptable carriers.

14. A kit comprising: (1) the conjugate of claim 1 or 4, or a pharmaceutically acceptable salt thereof, and (2) one or more additional therapeutic agents.

15. The kit of claim 14, wherein The additional therapeutic agent is a PD1 / PD-L1 inhibitor or a kinase inhibitor, and the kinase inhibitor is selected from the group consisting of a VEGFR2 inhibitor, a VEGFR3 inhibitor, a PDGFRβ inhibitor, a FLT3 inhibitor, a c-Kit inhibitor, or a combination thereof.

16. Use of the conjugate or a pharmaceutically acceptable salt thereof according to claim 1 or 4 for the manufacture of a medicament for the treatment or prevention of liver diseases; wherein, The liver disease is a liver cancer and a liver fibrosis disease.

17. The use according to claim 16, characterized in that, The conjugate can also be used in combination with an additional therapeutic agent.

18. The use of claim 16, wherein, The additional therapeutic agent is a PD1 / PD-L1 inhibitor or a kinase inhibitor, and the kinase inhibitor is selected from the group consisting of a VEGFR2 inhibitor, a VEGFR3 inhibitor, a PDGFRβ inhibitor, a FLT3 inhibitor, a c-Kit inhibitor, or a combination thereof.

Images