Composition for detecting corynebacterium amycolatum SB-1 strain, and use thereof

A WGS-based molecular marker using a specific primer set for Corynebacterium amycolatum SB-1 strain enables rapid and accurate identification, overcoming the limitations of 16S rRNA gene-based NGS assays by providing high detection specificity and reducing analysis time and cost.

WO2026010085A1PCT designated stage Publication Date: 2026-01-08COSMAX INC
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/004895
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-02
Filing Date
2025-04-10
Publication Date
2026-01-08

AI Technical Summary

Technical Problem

Current 16S rRNA gene-based next-generation sequencing (NGS) assays for detecting microorganisms are time-consuming and expensive, and they cannot accurately identify specific strains of Corynebacterium amycolatum SB-1.

Method used

A molecular marker based on whole genome sequence (WGS) data is used to identify Corynebacterium amycolatum SB-1 strain through a nucleic acid amplification reaction, employing a primer set comprising a forward and reverse primer that specifically binds to a polynucleotide sequence (SEQ ID NO: 1 or its complementary polynucleotide) to detect the strain quickly and accurately.

Benefits of technology

The WGS-based molecular marker allows for rapid and specific detection of Corynebacterium amycolatum SB-1 strain, distinguishing it from closely related strains or species, reducing analysis time and cost compared to traditional NGS methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025004895_08012026_PF_FP_ABST
    Figure KR2025004895_08012026_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a composition and a primer set for detecting a Corynebacterium amycolatum SB-1 strain, and a detection method using same. The composition enables quickly and accurately detecting or discriminating a Corynebacterium amycolatum SB-1 strain with high detection specificity at the strain or species level.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for detecting Corynebacterium amicolatum SB-1 strain and use thereof

[0001] The present invention relates to a composition for identifying microorganisms at a specific strain level and to a use thereof.

[0002] The skin is the largest organ in the human body, directly exposed to the external environment. Its key function is to protect the body from external irritants and prevent moisture loss. Along with other bodily organs such as the intestines, the skin is home to a diverse array of microorganisms, including bacteria, fungi, small larvae, and viruses, all of which maintain specialized functions. These microorganisms and their entire genetic information (genome) are collectively referred to as the skin microbiome.

[0003] Skin microbiome research has become possible with the development of next-generation sequencing (NGS) analysis methods. Specifically, utilizing 16S rRNA gene primers allows for cataloging and processing the bacterial composition of the microbiome.

[0004] While these 16S rRNA gene-based NGS assays offer the advantage of detecting all microorganisms in a given environment, they currently require at least a week of analysis and have limitations in that the 16S rRNA gene alone cannot detect specific strains. Furthermore, using NGS to detect specific strains is expensive.

[0005] [Prior Art Literature]

[0006] [Patent Document]

[0007] (Patent Document 1) KR 10-2321536 B1

[0008] The present specification relates to a molecular marker based on whole genome sequence (WGS) data that can identify the Corynebacterium amycolatum SB-1 strain at the strain or species level. Using the molecular marker, the Corynebacterium amycolatum SB-1 strain can be identified relatively quickly and accurately through a nucleic acid amplification reaction such as polymerase chain reaction (PCR).

[0009] One aspect is to provide a composition for detecting Corynebacterium amycolatum SB-1 strain, deposited under accession number KCCM12689P, comprising an agent capable of specifically detecting a polynucleotide consisting of sequence number 1 or a complementary polynucleotide thereof.

[0010] Another aspect is to provide a primer set for the detection of Corynebacterium amycolatum SB-1 strain, deposited under accession number KCCM12689P, comprising a forward primer represented by sequence number 2 and a reverse primer represented by sequence number 3.

[0011] Another aspect is to provide a kit for detecting Corynebacterium amycolatum SB-1 strain, deposited under accession number KCCM12689P, comprising a composition according to one aspect.

[0012] Another aspect provides a method for detecting the Corynebacterium amycolatum SB-1 strain deposited under accession number KCCM12689P using a composition, primer set, or kit according to one aspect.

[0013] Another aspect provides the use of a formulation capable of specifically detecting a polynucleotide comprising sequence number 1 or a complementary polynucleotide thereof for the manufacture of a composition for detecting Corynebacterium amycolatum SB-1 strain deposited under accession number KCCM12689P.

[0014] One aspect provides a composition for detecting Corynebacterium amycolatum SB-1 strain, deposited under accession number KCCM12689P, comprising an agent capable of specifically detecting a polynucleotide consisting of sequence number 1 or a complementary polynucleotide thereof.

[0015] The Corynebacterium amycolatum SB-1 strain deposited under the above accession number KCCM12689P is known in Republic of Korea Patent No. 10-2321536.

[0016] The polynucleotide comprising the above sequence number 1 or a complementary polynucleotide thereof may be a partial sequence of the whole genome sequence of the Corynebacterium amicolatum SB-1 strain deposited under accession number KCCM12689P. The whole genome includes all genetic information of the microorganism, such as chromosomal DNA and plasmid DNA. The above sequence number 1 may be the sequence at positions 8,038 and 9,880 of the complete sequence of the chromosomal DNA of the SB-1 strain.

[0017] The polynucleotide comprising the above sequence number 1 or a complementary polynucleotide thereof may be a whole genome sequencing (WGS)-based molecular marker capable of identifying the Corynebacterium amicolatum SB-1 strain at the strain or species level. The "molecular marker" refers to a molecule having a characteristic that can confirm the presence or state of a certain living organism or substance. For example, a specific DNA base sequence can be used as a molecular marker capable of determining the presence or absence of a specific strain. When the sequence of the above sequence number 1 or a complementary sequence thereof is present in the nucleic acid sequence of the microorganism to be analyzed, the microorganism can be identified as the Corynebacterium amicolatum SB-1 strain.

[0018] In addition, since the polynucleotide comprising the above sequence number 1 or its complementary polynucleotide is a molecular marker based on whole genome sequencing (WGS), its detection specificity is significantly superior to that of the existing 16S rRNA gene-based NGS analysis method that cannot detect a specific strain. Therefore, by utilizing the above molecular marker, it is possible to distinguish the Corynebacterium amicolatum SB-1 strain from microorganisms belonging to closely related strains or closely related species that cannot be distinguished by general physiological or chemical differences.

[0019] In addition, by using a preparation capable of specifically detecting a polynucleotide consisting of the above sequence number 1 or a complementary polynucleotide thereof, a specific strain can be identified simply by detecting the presence or absence of a molecular marker of a specific length (e.g., 1,843 bp), and thus, time and cost can be significantly reduced compared to the existing NGS analysis method that requires sequencing a 16S rRNA gene of several hundred to several thousand bp in length and comparing and analyzing it with a reference sequence.

[0020] Accordingly, a formulation capable of specifically detecting a polynucleotide consisting of sequence number 1 or a complementary polynucleotide thereof may be a formulation capable of detecting or identifying the Corynebacterium amycolatum SB-1 strain. The formulation may specifically detect only the Corynebacterium amycolatum SB-1 strain, distinguishing it from microorganisms having different detailed lineages. Therefore, a composition according to the above aspect may be a composition for identifying the Corynebacterium amycolatum SB-1 strain deposited under accession number KCCM12689P.

[0021] The above formulation is not limited in type as long as it is a substance capable of specifically binding to the polynucleotide or its complementary polynucleotide. The formulation may be, but is not limited to, a primer or probe that specifically binds to the polynucleotide or its complementary polynucleotide.

[0022] The above "primer" is a short single-stranded oligonucleotide that serves as a starting point for the production of another polymer strand complementary to the template during DNA synthesis. The primer used in the nucleic acid amplification reaction may include a primer set consisting of a forward primer and a reverse primer. The length of the primer may be, but is not limited to, 15 to 40 nt, 15 to 30 nt, 15 to 25 nt, 17 to 40 nt, 17 to 30 nt, or 17 to 25 nt.

[0023] When a nucleic acid amplification reaction is performed using a primer that specifically binds to a polynucleotide consisting of sequence number 1 or a complementary polynucleotide thereof, the Corynebacterium amicolatum SB-1 strain can be specifically identified based on whether or not an amplification product is detected.

[0024] In one specific example, the primer may be a primer set consisting of a forward primer represented by SEQ ID NO: 2 and a reverse primer represented by SEQ ID NO: 3.

[0025] The above "probe" refers to a DNA or RNA fragment complementary to a specific base sequence of DNA or RNA, and is labeled with a radioactive element, dye, fluorescent substance, etc., so that the presence or absence of a specific base sequence can be confirmed. The length of the probe is 10 to 1500 bp, 10 to 1000 bp, 10 to 500 bp, 10 to 300 bp, 10 to 200 bp, 10 to 100 bp, 20 to 1500 bp, 20 to 1000 bp, 20 to 500 bp, 20 to 300 bp, 20 to 200 bp, 20 to 100 bp, 50 to 1500 bp, 50 to 1000 bp, 50 to 500 bp, 50 to 300 bp, 50 to 200 bp, 50 to 100 bp, 100 to 1500 bp, 100 to 1000 bp, 100 to It may be, but is not limited to, 500 bp, 100 to 300 bp, 100 to 200 bp, 200 to 1500 bp, 200 to 1000 bp, 200 to 500 bp, 200 to 300 bp, 250 to 1500 bp, 250 to 1000 bp, 250 to 500 bp, 250 to 350 bp, 250 to 300 bp, 500 to 1500 bp, or 500 to 1000 bp.

[0026] When hybridization is performed using a probe that specifically binds to a polynucleotide consisting of sequence number 1 or a complementary polynucleotide thereof, the Corynebacterium amicolatum SB-1 strain can be specifically identified by the presence or absence of hybridization.

[0027] In one specific embodiment, the probe may be an oligonucleotide consisting of a sequence of at least 10, at least 20, at least 30, at least 40, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, or at least 500 consecutive nucleotides complementary to part or all of a polynucleotide comprising SEQ ID NO: 1 or a complementary polynucleotide thereof.

[0028] In one specific example, the probe may be an oligonucleotide consisting of a nucleotide sequence of 1,843 nt in length complementary to a polynucleotide consisting of SEQ ID NO: 1 or a complementary polynucleotide thereof.

[0029] The above primer or probe can be chemically synthesized using a known method. The primer or probe may additionally include one or more labels selected from a radioactive element, a chromophore, a chemiluminescent phosphor, a fluorophore, and a magnetic particle linked to the 5'-end or 3'-end.

[0030] The above "label" or "detectable label" may refer to any chemical moiety bound to a nucleotide or a nucleotide polymer, wherein the binding may be a covalent bond or a non-covalent bond. The detectable labels are known in the art. Non-limiting examples of the detectable labels include, 32 P or 35Radioactive elements such as S; linker molecules such as biotin, avidin, streptavidin, horseradish peroxidase (HRP), protein A, protein G, antibodies or fragments thereof, FLAG tags, and myc tags; enzymes such as peroxidase and luciferase; electron donors and acceptors; dyes such as Cy5 and Cy3; and magnetic particles (MPs) such as iron oxide nanoparticles and gold nanoparticles.

[0031]

[0032] Another aspect provides a primer set for the detection of Corynebacterium amycolatum SB-1 strain, deposited under accession number KCCM12689P, comprising a forward primer represented by sequence number 2 and a reverse primer represented by sequence number 3.

[0033] The forward primer represented by the above sequence number 2 has a length of 17 bp, a Tm (melting temperature) of about 56.35°C, and a GC% of about 58.82%.

[0034] The reverse primer represented by the above sequence number 3 is 20 bp in length, has a Tm of about 59.76°C, and a GC% of about 50.00%.

[0035] When a nucleic acid amplification reaction is performed using the above primer set, an amplification product of 1,843 bp in size can be detected only when the Corynebacterium amycolatum SB-1 strain is present.

[0036] In one embodiment, when PCR was performed using the primer sets of SEQ ID NO: 2 and SEQ ID NO: 3, it was confirmed that under one condition with the same annealing temperature and time, no PCR product was synthesized for the Corynebacterium xerosis CX01, Corynebacterium urealyticum, and Corynebacterium propinquum CP33 strains belonging to the same genus but different species, and that a PCR product was synthesized only for the Corynebacterium amycolatum SB-1 strain. Through this, it was found that even if strains of the same genus are present in a sample, only the Corynebacterium amycolatum SB-1 strain can be specifically and clearly detected and identified at the species level.

[0037] In one embodiment, when PCR was performed using the primer sets of SEQ ID NO: 2 and SEQ ID NO: 3, it was confirmed that under one condition with the same annealing temperature and time, no PCR product was synthesized for the Corynebacterium amycolatum KCTC 3432 strain, which belongs to the same species but is a different strain, and that a PCR product was synthesized only for the Corynebacterium amycolatum SB-1 strain. Through this, it was confirmed that even if strains of the same species are present in a sample, only the Corynebacterium amycolatum SB-1 strain can be specifically and clearly detected and identified at the strain level.

[0038] In one embodiment, when PCR was performed using DNA from a skin sample in which the Corynebacterium amycolatum SB-1 strain was not present as a template and the primer sets of SEQ ID NO: 2 and SEQ ID NO: 3, it was confirmed that no PCR product was synthesized at all. This indicates that even if various Corynebacterium microorganisms are present in the sample, if the Corynebacterium amycolatum SB-1 strain is not present, no PCR product is synthesized.

[0039]

[0040] Another aspect provides a kit for detecting Corynebacterium amycolatum SB-1 strain, deposited under accession number KCCM12689P, comprising a composition according to one aspect.

[0041] The above kit may additionally include reagents required for nucleic acid amplification reaction.

[0042] The nucleic acid amplification reaction described above may be performed using any nucleic acid amplification technology known in the art without limitation. The nucleic acid amplification reaction may be, for example, PCR (polymerase chain reaction). The PCR may include, but is not limited to, real-time PCR, RT-PCR (Reverse Transcriptase Polymerase Chain Reaction), qRT-PCR (quantitative Real-Time Polymerase Chain Reaction), etc. Accordingly, the kit described above may be a PCR kit.

[0043] Reagents required for the above nucleic acid amplification reaction may include DNA polymerase, dNTP, buffer solution, etc.

[0044] The above kit may additionally include a user guide describing optimal reaction performance conditions.

[0045]

[0046] Another aspect provides a method for detecting the Corynebacterium amycolatum SB-1 strain deposited under accession number KCCM12689P using a composition, primer set, or kit according to one aspect.

[0047] The above detection may be performed by one or more methods selected from, but not limited to, PCR analysis, DNA sequencing, hybridization by microarray, DAF (DNA Amplification Fingerprinting), Northern blot, and Southern blot.

[0048] In one embodiment, the method comprises the steps of isolating nucleic acids from a sample;

[0049] A step of performing a nucleic acid amplification reaction using the above nucleic acid as a template and a primer set according to one aspect; and

[0050] It may include a step of detecting an amplification product generated by the above nucleic acid amplification reaction.

[0051] The above sample may be a strain to be analyzed or a material expected to contain the strain.

[0052] The nucleic acid may be DNA or RNA. The nucleic acid may be DNA. The DNA may include genomic DNA (gDNA). The DNA may include chromosomal DNA and plasmid DNA (pDNA). The genomic DNA may refer to chromosomal DNA.

[0053] A method known in the art can be used to isolate nucleic acids from the above sample.

[0054] The nucleic acid amplification reaction described above can be used without limitation as long as it is a nucleic acid amplification technique known in the art. The nucleic acid amplification reaction may be, for example, PCR. The PCR may include, but is not limited to, real-time PCR, RT-PCR, qRT-PCR, etc.

[0055] The annealing temperature of the nucleic acid amplification reaction may be 63 to 70°C, 63 to 69°C, 64 to 70°C, 64 to 69°C, 65 to 70°C, 65 to 69°C, 66 to 70°C, 66 to 69°C, 67 to 70°C, 67 to 69°C, or about 68°C.

[0056] Detection of the above amplification product can be performed through, but is not limited to, DNA chips, gel electrophoresis, radiometric measurement, fluorescence measurement, phosphorescence measurement, magnetic field measurement, etc.

[0057] In the above detection step, if an amplification product is detected, it may be determined that the sample is the Corynebacterium amycolatum SB-1 strain deposited with accession number KCCM12689P, or it may be determined that the strain is present in the sample.

[0058] Therefore, the above method may be a method for identifying the Corynebacterium amycolatum SB-1 strain deposited under accession number KCCM12689P.

[0059]

[0060] Another aspect provides the use of a formulation capable of specifically detecting a polynucleotide comprising SEQ ID NO: 1 or a complementary polynucleotide thereof for the manufacture of a composition for detecting Corynebacterium amycolatum SB-1 strain deposited under accession number KCCM12689P.

[0061]

[0062] Duplicate content is omitted in consideration of the complexity of this specification, and terms not otherwise defined herein have the meanings commonly used in the technical field to which the present invention belongs.

[0063] The composition according to the aspect utilizes a molecular marker based on whole genome sequencing (WGS), so that the Corynebacterium amycolatum SB-1 strain can be rapidly and accurately detected or identified with high detection specificity at the strain or species level.

[0064] Figure 1 shows the results of confirming the selected primer pair for detecting Corynebacterium amycolatum SB-1 using NCBI Primer Blast.

[0065] Figure 2 is an electrophoresis result confirming that the primer pair for detecting Corynebacterium amycolatum SB-1 can specifically detect only the target microorganism.

[0066] Figure 3 is an electrophoresis result confirming that the primer pair for detecting Corynebacterium amycolatum SB-1 does not detect other Corynebacterium microorganisms present in the skin sample.

[0067] The following examples are provided for more detailed description. However, these examples are provided solely to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.

[0068]

[0069] Example 1: Preparation of primer

[0070] Primers capable of specifically detecting Corynebacterium amycolatum SB-1 strain (accession number: KCCM12689P) were developed.

[0071] First, whole-genome sequences of microorganisms belonging to closely related strains or species that cannot be distinguished by general physiological or chemical differences were collected from the National Center for Biotechnology Information (NCBI). The target strains and comparison strains are shown in Table 1.

[0072] Genus Species Strain Target strain Corynebacterium amycolatum SB-1 Comparison strain 1 Corynebacterium amycolatum KCTC 3432 Comparison strain 2 Corynebacterium xerosis CX01 Comparison strain 3 Corynebacterium urealyticum - Comparison strain 4 Corynebacterium propinquum CP33

[0073] After fragmenting the whole genome information of the strains in Table 1 into 10-500 bp units, the fragmented sequences were numbered using Linux commands. Furthermore, sequence information was collected for the remaining regions after excluding regions with identical sequences using NCBI's Nucleotide Blast. Subsequently, candidate primers were designed using primer design systems such as NCBI Primer Blast among regions containing rare sequences.

[0074]

[0075] Example 2: In-silico PCR of candidate primers

[0076] Prior to producing the primers selected as candidates in Example 1, theoretical primer validation was performed through in-silico PCR using a server. The results of confirming the final selected primer pairs using NCBI Primer Blast are shown in Figure 1.

[0077] As a result, as shown in Fig. 1, the final selected primer pair can specifically detect a sequence of 1,843 bp in length from position 8,038 to position 9,880 of the full-length sequence of the genomic DNA of the Corynebacterium amicolatum SB-1 strain. The 1,843 bp sequence is shown in SEQ ID NO: 1.

[0078]

[0079] Example 3: Primer verification PCR performed at optimal temperature

[0080] For the primers finally selected in Example 2, a primer validation experiment was conducted via PCR using the genomic DNA (gDNA) of the target strain and comparison strain as templates at the optimal temperature. The sequences of the primer pairs are shown in Table 2 below.

[0081] Target strain direction sequence (5'->3') sequence number annealing temperature Corynebacterium amycolatum SB-1 forward GTCCCGGGTCTTTTCGT268℃ reverse CGCATCTGCAATTGGTGTGT3

[0082]

[0083] Example 4: Confirmation of specific reaction of primers

[0084] Experiments were conducted to confirm that the final selected primers specifically bind only to the target strain.

[0085] Specifically, PCR was performed using the corresponding primer pairs for gDNA of Corynebacterium amycolatum SB-1, Corynebacterium amycolatum KCTC 3432, Corynebacterium xerosis CX01, Corynebacterium urealyticum, and Corynebacterium propinquum CP33; DNA of environmental samples; and a negative control. Total soil DNA was used as the environmental sample DNA. Sterile distilled water (SDW) was used as the negative control. The electrophoresis results of the PCR products are shown in Fig. 2.

[0086] Additionally, PCR was performed using the corresponding primer pair using DNA from a skin sample in which the SB-1 strain was not present as a template. The electrophoresis results of the PCR products are shown in Figure 3.

[0087] As a result, as shown in Fig. 2, a DNA band of 1,843 bp was confirmed only in the PCR product using Corynebacterium amycolatum SB-1 as a sample.

[0088] Additionally, as shown in Fig. 3, even if various Corynebacterium microorganisms were present in the skin sample, no PCR product was synthesized unless the SB-1 strain was present.

[0089] Therefore, it was found that the final selected primers detected only the SB-1 strain in a species- or strain-specific manner.

[0090] The optimal PCR amplification conditions for detecting Corynebacterium amycolatum SB-1 strain are shown in Table 3 below.

[0091] Temperature Time Cycle Pre-denaturation 95℃ 3 minutes 1 cycle Denaturation 95℃ 30 seconds 30 cycles Annealing 68℃ 30 seconds Extension 72℃ 30 seconds Final Extension 72℃ 3 minutes 1 cycle Hold 4℃--

Claims

1. A composition for detecting Corynebacterium amycolatum SB-1 strain deposited under accession number KCCM12689P, comprising a preparation capable of specifically detecting a polynucleotide consisting of sequence number 1 or a complementary polynucleotide thereof.

2. A composition according to claim 1, wherein the polynucleotide or its complementary polynucleotide is a partial sequence of the whole genome sequence of the Corynebacterium amycolatum SB-1 strain.

3. A composition according to claim 1, wherein the agent is a primer or probe that specifically binds to the polynucleotide or its complementary polynucleotide.

4. A composition according to claim 3, wherein the primer is a primer set comprising a forward primer represented by sequence number 2 and a reverse primer represented by sequence number 3.

5. A primer set for detecting the Corynebacterium amycolatum SB-1 strain, deposited under accession number KCCM12689P, comprising a forward primer represented by sequence number 2 and a reverse primer represented by sequence number 3.

6. A kit for detecting Corynebacterium amycolatum SB-1 strain, deposited under accession number KCCM12689P, comprising the composition of claim 1.

7. A kit according to claim 6, further comprising a reagent necessary for a nucleic acid amplification reaction.

8. Step of isolating nucleic acid from the sample; A step of performing a nucleic acid amplification reaction using the above nucleic acid as a template and the primer set of claim 5; and Comprising a step of detecting an amplification product generated by the nucleic acid amplification reaction, A method for detecting the Corynebacterium amycolatum SB-1 strain deposited under accession number KCCM12689P.

9. A method according to claim 8, wherein the nucleic acid is DNA.

10. A method according to claim 8, wherein, when an amplification product is detected, the sample is determined to be the Corynebacterium amycolatum SB-1 strain deposited under accession number KCCM12689P, or the strain is determined to be present in the sample.

11. Use of a preparation capable of specifically detecting a polynucleotide comprising sequence number 1 or a complementary polynucleotide thereof for the production of a composition for detecting Corynebacterium amycolatum SB-1 strain deposited under accession number KCCM12689P.

Citation Information

Patent Citations

  • New nucleotide sequences which code for the pfk gene

    KR1020010051877A

  • Novel polypeptides

    KR1020010082585A

  • Corynebacterium Glutamicum Genes Encoding ProteinsInvolved in Membrane Synthesis and Membrane Transport

    KR1020030002295A

  • Capture of target DNA and RNA by probes comprising intercalator molecules

    KR1020130113476A

  • Corynebacterium amycolatum strain and skin condition improving uses of thereof

    KR102321536B1