Method for targeting and mapping of essential phage genes and uses therefor

The use of CPP-ASO combinations enables targeted modulation of phage replication in bacterial hosts, overcoming genetic manipulation barriers by specifically binding to phage or bacterial mRNAs, thus facilitating the identification and manipulation of essential genes.

WO2026027637A1PCT designated stage Publication Date: 2026-02-05HELMHOLTZ ZENTRUM FUER INFEKTIONSFORSCHUNG GMBH +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/071986
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-30
Filing Date
2025-07-30
Publication Date
2026-02-05

AI Technical Summary

Technical Problem

Current methods for targeting and mapping essential phage genes in bacterial hosts are hindered by genetic manipulation challenges, particularly in species like Pseudomonas aeruginosa, due to defense systems that neutralize CRISPR systems and anti-CRISPR proteins, making it difficult to inhibit phage replication effectively.

Method used

A combination of cell-penetrating peptides (CPPs) and antisense oligonucleotides (ASOs) is used to specifically target and bind to phage or bacterial mRNAs, modulating phage replication by inhibiting or promoting phage progeny formation.

Benefits of technology

This approach allows for effective modulation of phage replication with minimal off-target effects, enabling the identification and manipulation of essential phage and bacterial genes, even in hosts previously considered difficult to transform.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000069_0000
    Figure 00000069_0000
  • Figure 00000069_0001
    Figure 00000069_0001
  • Figure 00000069_0002
    Figure 00000069_0002
Patent Text Reader

Abstract

This invention relates to a novel method for the targeting and mapping of phage genes that are essential or important for phage replication in their bacterial host cells, to novel methods for preventing or inhibiting the formation of progeny particles of a phage from a bacterium infected with said phage, and to novel methods for promoting the formation of phage progeny particles from a bacterium.
Need to check novelty before this filing date? Find Prior Art

Description

120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung METHOD FOR TARGETING AND MAPPING OF ESSENTIAL PHAGE GENES AND USES THEREFOR FIELD OF THE INVENTION

[0001] This invention relates to a novel method for the targeting and mapping of phagegenes that are essential or important for phage replication in their bacterial host cells,to novel methods for preventing or inhibiting the formation of progeny particles of aphage from a bacterium infected with said phage, and to novel methods for promotingthe formation of phage progeny particles from a bacterium. BACKGROUND OF THE INVENTION

[0002] Bacteriophages have become important study systems in molecular biology,biotechnology and medicine. This growing interest is driven by the richness of unexplored genes that emerge in the phage-host conflict (Bernheim & Sorek 2020,Mayo-Muñoz et al. 2024). Targeted mapping and characterization of genes that act atthe phage-host interface is key to understanding the major molecular players in a phage’s infection cycle and its ability to counter host defense, but the diversity and genetic intractability of phages and their hosts creates a major challenge. While early work involved temperature-sensitive or other conditional mutants (Pires et al. 2016, Ofir & Sorek 2018, Mahler et al.2022), chemical mutagenesis (Robins et al.2013) and small RNAs (Sturino & Klaenhammer 2002), recent studies increasingly used CRISPR- Cas technology to inhibit phage gene expression (McDonnell et al.2018, Piya et al. 2023, Adler et al.2023, Sprenger et al.2024). Notwithstanding the success of these techniques, a main barrier remains: most of these approaches require genetic manipulation of the bacterial hosts. Yet, many phage hosts cannot be transformed or conjugated (Marsh et al. 2023) due to defence systems that target foreign DNA (Bernheim & Sorek 2022, Mayo-Muñoz et al.2023). In addition, phages encode anti- CRISPR proteins or non-coding RNAs that can neutralise Cas enzymes (Bondy- Denomy et al.2013, Camara-Wilpert et al.2023). As a result, it remains difficult to map and characterise genes in the vast majority of phages, among them as a particularlyinteresting example the intensely studied jumbo phages, in particular jumbo phageΦKZ, which infects the major human pathogen Pseudomonas aeruginosa. Thus, up to120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung now this knockdown approach was only used to target the Chimallivirus Goslar, whichinfects E. coli via the expression of dead-Cas nucleases that requires genetic tools(Adler et al.2023), and application to Pseudomonas-infecting phages has not beenpossible due to the above-mentioned challenge of transferring the Cas system to thisbacterial species. Moreover, bacteria frequently encode anti-CRISPR proteins that neutralize Cas enzymes (Katz et al.2024).

[0003] An alternative approach to silence transcripts is provided by short antisenseoligomers (ASOs) that interfere with translation through the binding of the ribosome binding site (RBS) or start codon are (reviewed in Kole & Krainer & Altman 2012, Pifer & Greenberg 2020). ASOs have previously been used in cell-free systems to manipulate phage production (Vogele et al. 2021), but they have not been appliedbefore to inhibit phage replication in their bacterial hosts.

[0004] In that context, a number of phage biology-specific features are of particularconcern. First, in contrast to the translation of the bacterial mRNA reservoir, theproduction of individual phage-derived mRNA during phage infection and replication issubstantially higher than the one from the host, thus rendering it less likely thatsufficient amounts of inhibitor or modifier molecules, such as ASOs, could be madeavailable for inhibition or modification of phage-derived mRNA translation. Second, the tight regulation and rapid and concerted handover between transcription andtranslation of the newly formed phage-derived mRNA in phage-infected cells rendersit less likely that an inhibitor can efficiently attach to its target on the mRNA and thus block, or at least modulate, translation, and ultimately phage replication. Third, phageshave developed a number of mechanisms that block bacterial control mechanisms andrender phage-infected cells unpredictable in their responses, for example, at the levelof mRNA surveillance that aim at degradation of e.g. not translated mRNAs, so that even if a temporary stay of translation could be envisaged for phage-derived mRNAsby using an ASO-based inhibition approach, a medium- to long-term success appearsto be rather unlikely because the mRNAs may accumulate over time and exceed theinhibitory capacity of ASOs.

[0005] Thus, there is an unmet need for the development of methods for identifyinggenes and / or proteins that are essential or important for the replication of phages inbacteria, and methods for addressing and influencing the replication of phages in120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschungbacteria by inhibiting phage genes. In this context, it is particularly important to developa method, which is target-specific with strongly limited off-target effects. OBJECTS OF THE INVENTION

[0006] It was thus an object of the invention to provide a novel method for the targetingand mapping of phage and / or bacterial genes that are essential or important for phagereplication in their bacterial host cells, to novel methods for preventing or inhibiting theformation of progeny particles of a phage from a bacterium infected with said phage,and to novel methods for promoting the formation of phage progeny particles from abacterium. SUMMARY OF THE INVENTION

[0007] Surprisingly, it was found that by using a combination of a cell-penetratingpeptide and a short antisense oligonucleotide, and by identifying and optimizing certain parameters for performing the use of such combinations, genes and proteins that areessential or important for phage replication in a bacterial host cell can be targeted sothat phage replication can be modulated.

[0008] Thus, in a first aspect, the present invention relates to a method for assaying forthe relevance of a protein of a phage for the replication of said phage in a bacterium,comprising the steps of (a) contacting said bacterium either before, concomitant with or after infection with said phage, in particular before infection with said phage, with at least one compound CPP-ASOp, wherein CPP is a cell-penetrating peptide and ASOpis an antisense construct that is specifically binding to an mRNA coding for said protein, and (b) evaluating at least one parameter that is a measure for said replication.

[0009] In a second aspect, the present invention relates to a method for assaying forthe relevance of a protein of a bacterium for the replication of a phage in saidbacterium, comprising the steps of (a) contacting said bacterium either before, concomitant with or after infection with said phage with at least one compound CPP- ASOb, wherein CPP is a cell-penetrating peptide and ASOb is an antisense construct that is specifically binding to an mRNA coding for said protein, and (b) evaluation atleast one parameter that is a measure for said replication.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung

[0010] In a third aspect, the present invention relates to a method for inhibiting theformation of progeny particles of a phage from a bacterium infected with said phage, comprising the step of contacting said bacterium with at least one compound CPP- ASOp, wherein CPP is a cell-penetrating peptide and ASOpis an antisense construct that is specifically binding to an mRNA coding for a protein of said phage that is essential or important for phage replication, and / or at least one compound CPP-ASOb,wherein ASOb is an antisense construct that is specifically binding to an mRNA codingfor a protein of said bacterium that is essential or important for phage replication.

[0011] In a fourth aspect, the present invention relates to a method for preventing theformation of phage progeny particles from a bacterium at risk of being infected with said phage, comprising the step of contacting said bacterium with at least one compound CPP-ASOp, wherein CPP is a cell-penetrating peptide and ASOpis an antisense construct that is specifically binding to an mRNA coding for a protein of said phage that is essential or important for phage replication, and / or at least onecompound CPP- ASOb, wherein ASOb is an antisense construct that is specificallybinding to an mRNA coding for a protein of said bacterium that is essential or important for phage replication.

[0012] In a fifth aspect, the present invention relates to a method for promoting theformation of phage progeny particles from a bacterium comprising the steps of (a)contacting said bacterium with at least one compound CPP- ASOb, wherein CPP is acell-penetrating peptide and ASObis an antisense construct that is specifically binding to an mRNA coding for a protein essential or important for said bacterium’s defencesystem directed against replication of said phage in said bacterium; and (b) infectingsaid bacterium with said phage.

[0013] In a sixth aspect, the present invention relates to a method for promoting theformation of phage progeny particles from a bacterium infected with, or otherwise comprising, a phage, in particular a prophage, comprising the steps of (a) contacting said bacterium with at least one compound CPP-ASOp, wherein CPP is a cell- penetrating peptide and ASOpis an antisense construct that is specifically binding toan mRNA coding for a protein repressing, preventing or delaying replication of saidphage in said bacterium.

[0014] In a seventh aspect, the present invention relates to a compound CPP-ASOp,wherein CPP is a cell-penetrating peptide and ASOp is an antisense construct that is120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung specifically binding to an mRNA coding for a protein repressing, preventing or delayingreplication of a phage, in particular a lytic phage, in a bacterium for use in the treatmentof a patient suffering from an infection with said bacterium. FIGURES

[0015] Figure 1 shows that ASOs silence ΦKZ phage transcripts in Pseudomonas. a.Antisense oligomers (ASOs) are taken up by the bacterial cell mediated by cell penetrating peptides (CPPs). After phage infection, ASOs bind specific phage transcripts at the ribosome binding site (RBS) or the start codon (AUG) and prevent translation. If the protein encoded by the target phage transcript is essential for phage propagation, no phage progeny is formed and the bacterium is protected (red shield).PNA, peptide nucleic acid. b. chmA locus and translation initiation region. ASOtargeting the RBS and the non-targeting control ASO (ctrl.) are depicted. c. PAO1 cells were pretreated with 6 µM ASO targeting chmA or a non-targeting control ASO (ctrl.) for 30 min and infected with ΦKZ at an MOI=5. Cells were harvested at the indicated time points post infection (p.i.) and ChmA levels were determined by immunoblotting. A Coomassie stained gel served as loading control. One representative example offour independent experiments is shown. d. PAO1 cells were pretreated for 30 min with6 µM ASO against chmA or the non-targeting control. After ΦKZ infection at anMOI=0.0001, cells were incubated to allow three rounds of replication (180 min). The resulting phage-cell suspension was spotted on LB plates to assess colony forming units (CFUs) and on LB plates with a lawn of PAO1 cells to assess plaque forming units (PFUs). A high number of phages leads to lysis of nearby bacterial cells after spotting, leading to complete lack of CFUs at low dilutions in the control. A representative result of two independent experiments is shown. e. PAO1 cells werepretreated with 8 µM ASOs against chmA or a non-targeting control ASO for 30 minand infected with ΦKZ at an MOI=10, followed by chemical crosslinking and stainingof membranes with FM4-64 and DNA with DAPI at either 5 min or 30 min p.i.. f. PAO1cells were pretreated with 8 µM ASO against the phage spindle apparatus gene phuZor a control ASO for 30 min, infected with an MOI=10 and imaged similarly to (e). Inparallel, PAO1 cells were infected with a phuZ deletion phage at MOI=0.001 and were120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschungimaged. The infection rate with the phuZ deletion phage was low compared to the ΦKZwildtype phage due to a low titer. g. The distance of the phage nucleus from the cellcentre (d) was measured. Quantitation is based on one representative example of two independent experiments for the ASO-knockdown and on one experiment for theΔphuZ phage. The number of counted cells is indicated in brackets. Bar indicates themedian, error bars indicate ±1.5 SD, * p<0.05, **** p<0.0001, two-tailed Mann-Whitney test.

[0016] Figure 2 shows ASO applications for the study of phage-host interplay. (Left)Schematic representation of potential ASO applications, such as targeting clinical isolates (a), sensitising bacteria to phage infection by silencing a bacterial anti-phage defence system (b), protecting bacteria from phage infection by silencing phage genes that might affect anti-phage defence systems (c), targeting RNA phages (d), targeting different phage-host pairs (e). Anti-phage defence systems are depicted as shields,phage proteins that overcome bacterial defence as swords (Right) a. PaLo44 cellswere pretreated with 6 µM ASO against chmA for 30 min. Cells were infected with ΦKZat an MOI=0.0001 and incubated for 180 min followed by CFU / PFU determination.b. PA14 cells were inoculated and grown for 30 min, pretreated with 6 µM ASO againstjukA for 150 min to ensure JukA depletion prior to infection. Cells were infected withΦKZ at an MOI=0.0001 and incubated for 180 min followed by CFU / PFUdetermination. c. PAO1 and PaLo44 cells were pretreated with 6 µM ASO againstΦKZ014 for 30 min. Cells were infected with ΦKZ at an MOI=0.0001 and incubated for180 min followed by CFU / PFU determination. d. PAO1 cells were pretreated with 0.05µM ASO against replication (rep) and lysis (lys) transcripts for 30 min. Cells were infected with ΦKZ at an MOI=0.00001. 0.05 µM ASO was added again with theinfection and every 30 min thereafter. Cells were incubated for 180 min after infectionfollowed by CFU / PFU determination. e. Pantoea agglomerans cells were pretreatedwith 6 µM ASO against gp206 (chmA) for 30 min. Cells were infected with RAY at anMOI=0.0001 and incubated for 300 min followed by CFU / PFU determination.f. B. subtilis 168 cells were pretreated with 6 µM ASO against the transcript of gene 31(DNA polymerase) for 30 min. Cells were infected with SPO1 at an MOI=0.0001 and incubated for 180 min followed by CFU / PFU determination. For panels a, b, d-f, arepresentative result of two independent experiments is shown. g. Escherichia coli K12cells were treated with ASOs against the replication (rep) and anti-termination (anti-120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschungterm.) genes of the λvir phage (DNA phage) followed by infection with λvir and CFU / PFUdetermination. h. PAO1 cells were treated with ASOs followed by incubation for 3 hand CFU / PFU determination. ASOs induced prophages that resulted in lysis ofPseudomonas and plaque formation. i. PAO1 cells were treated with ASOs followedby incubation for 3 h and CFU / PFU determination. ASOs promoted plaque formation.

[0017] Figure 3 shows that a screen for essential phage genes reveals factors that areimportant for ΦKZ plaque efficiency. PAO1 cells were pretreated with 6 µM ASOagainst the listed transcripts for 30 min. Cells were infected with ΦKZ at an MOI=0.0001 and incubated for 180 min followed by CFU / PFU determination and immunoblot detection of ChmA. The association of target transcripts to Chimalliviridae core genome blocks (Prichard et al. 2023), transcript abundance at 10 min p.i. and protein abundance (average values at 10, 20, 30 min p.i.) based on Gerovac et al. 2024 are indicated. The PFU / CFU effect of each respective knockdown is depicted as no effect ( ), weak (+), effective (++), very effective plaque reduction (+++) and increased plaque levels (-); for details see Fig.9a. A minimum of two ASOs were tested per gene, the stronger effect is shown. Toxic ASOs were omitted. n.d. not determined, e.g. if both ASOs were toxic. *ΦKZ014 knockdown caused an abrogation of plaques only in the PaLo44 strain.

[0018] Figure 4 shows the transcriptional response after knockdown of ΦKZ coregenes. a. PAO1 cells were pretreated with 6 µM ASO against chmA for 30 min. Cellswere infected with ΦKZ at an MOI=5 and incubated for the indicated times post infection followed by RNA extraction and sequencing of the transcriptome. To reduce the dimensionality of the dataset, we projected the data based on transcript abundance of each annotated gene on two dimensions via principal component (PC) analysis.Each dot represents an independent experiment; time points are shaded in grey. ctrl.,non-targeting control ASO. b. Volcano plot of the log2fold-change (Log2FC) oftranscripts of samples treated with the ASO against chmA versus the non-targetingcontrol ASO (ctrl.) at the indicated time points. Two independent replicates were merged by geometrical averaging and p-values were calculated by the Wald test usingDESeq2. c. PAO1 cells were pretreated with 6 µM ASO against the indicatedtranscripts for 30 min. Cells were infected with ΦKZ at an MOI=5 and incubated for 30min followed by RNA extraction and sequencing of the transcriptome. Bars indicate the RPKM counts of ΦKZ (top) or PAO1 transcripts (bottom) that were affected in120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung abundance (Log2FC>2, <-2, >100 reads in sum over all knockdown experiments at 30 min p.i.). For each target gene one replicate was sequenced. The PFU / CFU effect for each knockdown is depicted as no effect ( ), weak (+), effective (++), very effectiveplaque reduction (+++) and increased plaque levels (-), as in Fig.3, Fig.11. *Indicatesthe three genes whose knockdown led to a strong reduction in plaque formation but had no effect on the phage transcriptome.

[0019] Figure 5 shows that ΦKZ155 is important for phage nucleus maturation andphage genome amplification. a. Log2FC values for each ΦKZ gene from Fig.4c wereclustered by t-SNE. Discussed clusters are indicated by a dashed line. b. Structureprediction of ΦKZ155 (wheat) and the ΦPA3 homolog Gp176 (orange) by AlphaFold3. The RNase HI domain (AF-A0A2A2IBB4-F1) is overlaid in blue. N-terminus and C- terminus are coloured in green and red, respectively, magnesium ions are representedas green spheres. c. PAO1 cells were pre-treated with 8 µM ASO against ΦKZ155(ΦKZ) or gp176 (ΦPA3) for 30 min. Cells were infected with ΦKZ or ΦPA3 at an MOI=5and incubated for 35 or 50 min, respectively, followed by chemical crosslinking and staining with DAPI to visualise DNA and FM4-64 to visualize membranes. Sequencesof the targeted transcripts and ASOs are indicated on top. d. (Top) Scheme illustratescomplementation after ASO-knockdown with a plasmid-encoded gene (blue) that is insensitive to the ASO in trans (red). The sequence of the translation initiation region of plasmid-encoded ΦKZ155, the endogenous locus and the corresponding ASOs are depicted. (Bottom) PAO1 cells were transformed with a complementation plasmid encoding ΦKZ155 or the empty vector. PAO1 cells were pretreated with 6 µM ASOagainst ΦKZ155 for 30 min. The expression of plasmid-encoded ΦKZ155 was inducedwith 0.2% arabinose, cells were infected with ΦKZ at an MOI=0.0001 and incubatedfor 180 min followed by CFU / PFU determination. A representative result of twoindependent experiments is shown. e. PAO1 cells were transformed as in (d). Thesecells were pretreated with 8 µM ASO against ΦKZ155 for 30 min and the expressionof the complementation gene was induced with 0.2% arabinose. Cells were infected with ΦKZ at an MOI=10 and incubated for 30 min, followed by chemical crosslinkingand staining with DAPI to visualise DNA and FM4-64 to visualize membranes. f. PAO1cells were pretreated with 6 µM ASO against chmA or KZ155 for 30 min. Cells wereinfected with ΦKZ at an MOI=5 and incubated for the indicated times post infection followed by quantification of ChmA levels by immunoblotting. Coomassie stained gels120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung served as loading control. n.i., non-infected control. A representative result of threeindependent experiments is shown. g. PAO1 cells were pretreated with 6 µM ASOagainst ΦKZ155 for 30 min. Cells were infected with ΦKZ at an MOI=5 and incubatedfor the indicated times post infection followed by DNA extraction and dot blotting, RNA was eliminated by alkaline treatment. Phage genomic DNA was detected with the radiolabelled oligo probe JVO-23213 (complementary to the chmA open reading frame) followed by autoradiography. A representative result of two independentexperiments is shown. h. Model of ΦKZ155 function. (Top) The ΦKZ155 protein isimported into the nucleus where it plays a role in phage nucleus maturation, which is likely linked to phage genome amplification. After genome amplification, the phagegenome is loaded into virions at the phage nucleus. (Bottom) Upon knockdown ofΦKZ155, the initial phage nucleus remains immature, although ChmA is expressed. The phage genome is not amplified, and phage infection is halted.

[0020] Figure 6 shows the optimization of ASO treatment (part 1). a. Effective mediaconditions for ASO treatment were determined by pretreatment of cells for 30 min withdifferent ASOs in LB and MH media. Subsequently, cells were infected with ΦKZ, andincubated for 30 min, which was followed by CFU / PFU readout. b. Effective ASOconcentration was determined by pretreating cells for 30 min with different ASOconcentrations as indicated. Subsequently, cells were infected with ΦKZ, andincubated for 30 min, which was followed by CFU / PFU readout. c. Effective ASOconcentration was determined by pretreating cells for 30 min with different ASO concentrations as indicated. Subsequently, cells were infected with ΦKZ, allowed toreplicate for 3 h, which was followed by CFU / PFU readout. d. ASOs of different lengthsand scrambled variants were tested. For the scrambled variants, two (2x) or four (4x) nucleotides were changed in their position, 3x represents 2x with one additionalmutation; all changes were made in the central part of the ASO-sequence. ASOs wereadded at 6 µM. Subsequently, cells were infected with ΦKZ, allowed to replicate for 3 h, which was followed by CFU / PFU readout. SD Shine-Dalgarno sequence; AUG startcodon. e. ASO pre-treatment time was tested at 5, 10, 15, and 30 min. f. Samplingtime after infection was tested at below one replication round (30 min) and at one (70 min), two (140 min), and three (210 min) replication rounds, followed by CFU / PFUreadout. g. MOI used for infection was tested at 1, 0.1, 0.01, and 0.001.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung

[0021] Figure 7 shows the optimization of ASO treatment (part 2). a. Replication cycleof ΦKZ. b. Scheme depicting the optimisation for the CFU / PFU assay (top) andassessment of ASO toxicity (bottom). c. PAO1 cells were pretreated with 6 µM ASO against chmA linked to the carrier peptides (RXR)4XB, (KFF)3K or TAT for 30 min. Cells were infected with ΦKZ at an MOI=0.0001 and incubated for 180 min followed byCFU / PFU determination. d. PAO1 cells were pretreated with 6 µM ASO with indicatedlengths and target sequences against RBS and AUG of chmA for 30 min. Cells wereinfected with ΦKZ at an MOI=0.0001 and incubated for 180 min followed by CFU / PFU determination. SD, Shine-Delgarno sequence. Representative result of twoindependent experiments. e. PAO1 cells were pretreated with 6 µM ASO against chmAfor 30, 15, 10 or 5 min. Cells were infected with ΦKZ at an MOI=0.0001 and incubatedfor 180 min followed by CFU / PFU determination. f. PAO1 cells were pretreated with 6µM ASO against chmA for 30 min. Cells were infected with ΦKZ at an MOI=0.0001and incubated for 30, 70, 140, and 210 min followed by CFU / PFU determination.g. PAO1 cells were pretreated with 3 to 18 µM ASO against chmA for 30 min. Cellswere incubated for 180 min followed by CFU / PFU determination. h. PAO1 cells werepretreated with 0.25 to 6 µM ASO against chmA for 30 min. Cells were infected withΦKZ at an MOI=5 and incubated for 180 min followed by CFU / PFU determination.i. PAO1 cells were pre-treated with 6 µM ASO against chmA for 30 min. Cells wereinfected with ΦKZ at an MOI between 0.001 and 1 and incubated for 30, 70, 210 min followed by CFU / PFU determination.

[0022] Figure 8 shows that central mismatches disrupt ASO function but tiling identifiesmultiple effective ASOs per target transcript. a. Mismatches (mm, red) were introducedto the ASO targeting chmA. PAO1 cells were pretreated with 6 µM of the indicated ASOs for 30 min. Cells were infected with ΦKZ at an MOI=0.0001 and incubated for 180 min followed by CFU / PFU determination. Representative result of twoindependent experiments. b. ASOs were tiled along the RBS and AUG window of thechmA transcript. PAO1 cells were pretreated with 6 µM indicated ASOs against chmAfor 30 min. Cells were infected with ΦKZ at an MOI=0.0001 and incubated for 180 min followed by CFU / PFU determination. For the quantification of ChmA, PAO1 cells werepretreated with 6 µM indicated ASOs against chmA for 30 min. Cells were infected withΦKZ at an MOI=5 and incubated for 30 min followed by quantification of ChmA via immunoblotting with an antibody against ChmA. Representative result of two120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung independent experiments. ASO self-complementarity (SC), melting temperature (Tm), purine percentage (pur_perc), and off-targets (OT) with 0 and 1 miss-match (mm) in the phage and host are indicated as heatmaps. ASO parameters were determined with the ASO checker tool of MASON (mason.helmholtz-hiri.de / ASO_checker).

[0023] Figure 9 shows that ASO knockdown specifically downregulates targets. PAO1cells were pretreated with 6 µM ASO against chmA, ΦKZ055 (nvRNAP), and picA for30 min. Cells were infected with ΦKZ at an MOI=5 and incubated for 2.5, 5.0, 7.5, and 10 min followed by harvesting in non-reducing SDS-PAGE loading dye. Subsequently, proteomics was performed on the samples and proteins were quantified by label-freequantification (LFQ). a. Counts for host proteins at all timepoints were pooled tocalculate enrichment and log10 p-value (calculated with MaxQuant Perseus). Filter criteria were applied (only one protein in protein group, >=4 unique peptides, >40 peptide posterior error probabilities score, sum of average LFQ intensity was filtered at >1E8 counts), n=1,130 host proteins were considered. Host protein levels were not altered in the range log2FC <-2 or >2 and a –log10 p-value >2. b. Counts for phage proteins at 7.5 and 10 min p.i. timepoints were pooled to calculate enrichment and log10 p-value (calculated with MaxQuant Perseus). Filter criteria were applied (sum of log2LFQ counts for all three ASO treatments >25 counts); n=95 phage proteins were considered. Log2FC was calculated based on average counts. When a protein was not detected, we set a pseudo-count=1. ΦKZ016 and ΦKZ165 were lower in the non- targeting ASO control sample and therefore omitted. The structural protein ΦKZ094was only detected in the sample treated with an ASO targeting chmA at 7.5 min p.i.but not at 10 min or in the control sample and was also omitted. c-e. Left, Schematicoverview of the transcriptional units (TU) of the targeted transcripts, based on Putzeys et al.2024. The position of ASO is indicated. Right, Log2FC of protein levels at 10 min p.i. based on LFQ counts.

[0024] Figure 10 shows that ASOs can target diverse clinical Pseudomonas isolates.a. PaLo8 / 9 / 39 / 44 cells were pretreated with 6 µM ASO against chmA. Cells were infected with ΦKZ at an MOI=0.0001 and incubated for 180 min followed by CFU / PFU determination. A representative result of two independent experiments is shown. b. PaLo8 / 9 / 39 / 44 cells were pretreated with 6 µM ASO against chmA. Cells were infected with ΦKZ at an MOI=5 and incubated for 20 min followed by quantification ofChmA levels via immunoblotting with an antibody against ChmA. c. PaLo8 / 9 / 39 / 44120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung cells were pre-treated with 8 µM ASO against chmA. Cells were infected with ΦKZ at an MOI=10 and incubated for 40 min followed by chemical crosslinking and staining with DAPI to visualise DNA and FM4-64 to visualize membranes.

[0025] Figure 11 shows a screen scoring scheme, top hits and other effects causedby ASOs. a. Schematic representation of possible effects of ASO treatment onCFU / PFU readouts and ChmA levels accumulated after multiple replication rounds. ASOs can be toxic to the host causing reduced CFU counts even without phage infection. ASOs can also induce a prophage, visible as PFUs. ASOs that showed one log reduction in PFUs and / or reduced ChmA levels were scored as weak (+). ASO that reduced PFUs by multiple logs, rescued CFUs in the first dilution, and / or depleted ChmA levels were scored as effective (++). ASOs that diminished PFUs down to the first dilution or completely abrogated PFUs, and / or depleted ChmA levels by more than 10-fold were scored as very effective (+++). Some ASOs caused increased plaquecounts (-) and / or increased ChmA levels. b. CFU / PFU and ChmA levels upon ASO-mediated knockdown of top candidates that showed a strong effect on phage plaque efficiency in our screen. PAO1 cells were pretreated with 6 µM ASO against the indicated transcripts. Cells were infected with ΦKZ at an MOI=0.0001 and incubated for 180 min followed by CFU / PFU determination. Scoring as described in (a). c. Examples of pleiotropic effects of ASO treatment. Experiment as in (b). ASOs that were toxic to the host are denoted by their internal reference number because this effect is likely to be unspecific and not related to the intended phage target gene. ASO treatment can result in more phage plaques (-) and ASOs can induce prophages (prophage).

[0026] Figure 12 shows that Early-middle / late gene classification and effects uponinhibition of ChmA. a. Log2FC in transcript levels based on RPKM counts 35 vs. 10min post infection in the samples treated with a non-targeting control ASO. Phage genes were classified as early (blue) upon depletion, and as middle / late (red) upon enrichment in the Log2FC plot 35 vs.10 min. Other phage transcripts (blue) remained unaltered in the comparison of these two timepoints and were likely expressed by the vRNAP. Two independent replicates were merged by geometrical averaging and the p-values were calculated by the Wald test using DESeq2. b. PAO1 cells were pretreated with 6 µM ASO against chmA. Cells were infected with ΦKZ at an MOI=5 and incubated for the indicated times followed by RNA extraction and sequencing of120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung the transcriptomes. Relative quantification of protein-coding transcript (CDS) reads tototal reads (RPKM) is shown. c. Relative read counts to total counts for phage tRNAsin the tRNA fraction in the samples treated with the non-targeting control ASO and the ASO targeting chmA; results are depicted as an overlay of two independentexperiments. d. Transcript levels in samples treated with a non-targeting control ASOor an ASO targeting chmA were normalised over the course of infection and clusteredby t-SNE. Individual clusters are represented together with genomic locations, core genes and blocks.

[0027] Figure 13 shows that ASO-treatment has effects on host and phage transcriptlevels. PAO1 cells were pretreated with 6 µM ASO against indicated transcripts. Cellswere infected with ΦKZ at an MOI=5 and incubated for 15 or 30 min followed by RNA extraction, sequencing of the transcriptomes, and quantification of fold-changecompared to the non-targeting control ASO. a., c. Heatmap for Log2FC for ΦKZtranscripts at 15 min (a) and 30 min (c) p.i.. d., f. Heatmap for Log2FC for PAO1transcripts at 15 min (d) and 30 min (f) p.i.. b., e., g. t-SNE clustering of the Log2FC oftranscript levels of ΦKZ 15 min (b) or of PAO115 min (e) and 30 min (g) min upon knockdown of ΦKZ transcripts. Phage proteins whose knockdown led to a strong phenotype (+++) in the CFU / PFU assay (in Fig.3) are labelled. h. Read coverage of the Pf4 prophage locus in PAO1 upon knockdown of ΦKZ082.

[0028] Figure 14 shows that ΦKZ155 involvement in the phage replication cycle. a.PAO1 cells were pretreated with 6 µM ASO against chmA. Cells were infected with ΦKZ at an MOI=5 and incubated for the indicated times followed by RNA extraction and sequencing of the transcriptomes. Relative quantification of protein-codingtranscript (CDS) reads and normalisation to the maximum for ΦKZ155 over allconditions. (analysis based on data described in Fig. 4a,b). b. RNA was 5´- [32P]phosphorylated and left single-stranded (top) or duplexed with complementary DNA (bottom). ΦKZ155 and the catalytically dead D102N mutant (CDM) wereproduced by in vitro translation and added to the oligomer for the cleavage reaction.Subsequently, the oligomers were analysed on an Urea-PAGE gel andautoradiographed. Commercially available E. coli RNase H protein was used ascontrol. Representative result of two independent experiments. c. PAO1 cells weretransformed with a complementation plasmid encoding ΦKZ155 or the catalyticallydead mutant. PAO1 cells were pretreated with 6 µM ASO against ΦKZ155 for 30 min.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung Cells were infected with ΦKZ at an MOI=0.0001, plasmid-encoded ΦKZ155 was induced with 0.2% arabinose, and cells were incubated for 180 min followed by CFU / PFU determination. Representative result of two independent experiments. Datafor pempty and pΦKZ155 are reproduced from Fig.5d. d. PAO1 cells were transformedas in (c). PAO1 cells were pre-treated with 8 µM ASO against ΦKZ155 for 30 min.Cells were infected with ΦKZ at an MOI=10, plasmid-encoded ΦKZ155 was inducedwith 0.2% arabinose, and the cells were incubated for 30 min followed by chemical crosslinking and staining with DAPI to visualise DNA and FM4-64 to visualize membranes. Data for pempty and pΦKZ155 reproduced from Fig.5e. For gel sourcedata, see Figures 6 and 7. e. C-terminally GFP-tagged ΦKZ155 (ΦKZ155GFP) wasectopically expressed from a plasmid in PAO1. PAO1 cells were infected with ΦKZ at an MOI=10, the expression of ΦKZ155GFPwas induced with 0.2% arabinose, and incubated for 30 min followed by chemical crosslinking and staining with DAPI to visualise DNA and FM4-64 to visualize membranes. Representative result of twoindependent experiments. f. PAO1 cells were pretreated with 6 µM ASO againstΦKZ155 for 30 min. Cells were infected with ΦKZ at an MOI=5 and incubated for theindicated times post infection followed by DNA extraction and dot blotting, RNA was eliminated by alkaline treatment. Phage genomic DNA was detected with the radiolabelled oligo probe JVO-23213 (complementary to the chmA open readingframe) and JVO-15848 (complementary to the rRNA gene of PAO1) followed byautoradiography. A representative result of two independent experiments is shown. g. PAO1 cells were pre-treated with 8 µM ASO against gp176 (ΦPA3). Cells were infected with ΦPA3 at an MOI=5 and incubated for the indicated times followed by DNA extraction and dot-blotting. RNA was eliminated by alkaline treatment. The phage genomic DNA was detected with the radiolabelled oligo probe JVO-23279 followed byautoradiography. No host, no phage, and the non-targeting control ASO served ascontrols. Representative result of two independent experiments. DETAILED DESCRIPTION OF THE INVENTION

[0029] The present invention may be understood more readily by reference to thefollowing detailed description of the invention and the examples included therein.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung

[0030] Thus, in a first aspect, the present invention relates to a method for assaying forthe relevance of a protein of a phage for the replication of said phage in a bacterium,comprising the steps of (a) contacting said bacterium either before, concomitant with or after infection with said phage, in particular before infection with said phage, with at least one compound CPP-ASOp, wherein CPP is a cell-penetrating peptide and ASOpis an antisense construct that is specifically binding to an mRNA coding for said protein, and (b) evaluating at least one parameter that is a measure for said replication.

[0031] In the context of the present invention, the term “CPP” refers to a cell-penetrating peptide that has the ability to translocate the plasma membrane of abacterium and is thus able to be taken up by said bacterium. Translocation may occurby a number of different mechanisms, including direct penetration of the membrane, endocytosis-mediated entry, and translocation through a transitory structure. CPPs may be naturally occurring peptides produced by living organisms, ii) chimericpeptides, which are modified natural proteins and iii) synthetic peptides entirelydesigned and synthesized in the laboratory. A systematic review of CPPs used for transporting nucleotide-based compositions into bacteria can be found in Gagat et al.,2027 and in El-Fateh et al., 2024. By combining a CPP with various molecular cargomolecules, such as an ASOpas defined herein, it facilitates the delivery of such cargo molecules to the cytoplasm or an organelle of said bacterium. Said cargo molecules can be attached to the CPP either through chemical linkage via covalent bonds or through non-covalent interactions.

[0032] In the context of the present invention, the term “ASO” refers to short antisenseoligonucleotides that bind specifically to the sequence of a target RNA and modulate protein expression through several different mechanisms. ASOs include unmodified short oligonucleotides having a phosphodiester backbone, which however are of low stability, and modified oligonucleotides, including phosphorothioates (PS), wherein thenon-bridging oxygen of the phosphate group is replaced by a sulphur group,phosphorodiamidate morpholino oligomers (PMO), wherein the five-membered sugar moiety is substituted with a six-membered morpholine subunit, and each morpholine ring is inter-connected with phosphorodiamidate linkage, peptide nucleic acids (PNA), which are synthetic nucleic acid mimics that contain neutral N-2-aminoethyl glycine units, with nucleobases connected by a flexible methyl carbonyl linker, and locked nucleic acids (LNAs), which contain a constrained methylene bridge between 2′ oxygen120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung and 4′ carbon of the ribose ring (see Dhuri et al. 2020). The superscriptspandcin ASOpand ASOb, as used herein, indicate that the respective ASO is directed at aphage and a bacterial protein, respectively. Ghosh et al. (2024) have published acomparative analysis of peptide-delivered ASOs.

[0033] In a particular embodiment, said bacterium is a Gram-negative bacterium,particularly a Gammaproteobacterium, particularly a Gammaproteobacterium selected from the Enterobacteriaceae, Vibrionaceae, or Pseudomonadaceae family, particularlyselected from Escherichia coli and Pseudomonas aeruginosa species.

[0034] In other particular embodiments, the Gram-negative bacterium is aGammaproteobacterium selected from Erwiniaceae, particularly is selected fromPantoea agglomerans, Erwinia horticola and Erwinia amylovora.

[0035] In a particular embodiment, said CPP is selected from the list of (KFF)3K,(RXR)4XB, (RFF)3R, (RXR)4, (RFR)4XB, (RFF)3R(3’), (RX)6B, pip1(D), drosocin, oncocin, TAT, BF2A, BF2A-RXR, drosocin-RXR, (KFF)3K(D), pip1, DAB, DAP, drosocin(D), (P59^W59)-Tat48-60, ANT, P12-(CH2)6, B12-SS, Bac1-15, IsCT-p, K6L2W3, KLW-L9,13-a, NLS-Gb3, Pep-1-K, SA-3, TDN, and TPk, in particular is selected from (KFF)3K and (RXR)4XB, more particularly is (RXR)4XB.

[0036] The reviews Gagat et al., 2027 and El-Fateh et al., 2024 that have already beenmentioned above include further references to publications discussion the individual CPPs.

[0037] In a particular embodiment, the CPP is an arginine-rich cell-penetrating peptide.In a particular such embodiment, the CPP is (RXR)4XB, (RFF)3R, (RXR)4, (RFR)4XB, (RFF)3R(3’), or (RX)6B, wherein each R is L-arginine, each F is phenylalanine, eachX is 6-aminohexanoic acid and B is ß-alanine.

[0038] In a particular other embodiment, the CPP is a lysine-rich cell-penetratingpeptide. In a particular such embodiment, the CPP is (KFF)3K or (KFF)3K wherein each K is L-lysine, and each F is phenylalanine.

[0039] In a particular embodiment, said phage is selected from: Chimalliviridae, inparticular a Chimallivirus selected from ΦKZ, KTN4, EL, 201^2-1, and ΦPA3, or a non- nucleus-forming jumbo phage, in particular PA5Oct, when the bacterium is Pseudomonas aeruginosa, or a Goslar Chimallivirus, when the bacterium is Escherichia coli; an enterobacteria phage λ, when the bacterium is Escherichia coli; and a single-stranded RNA phage, in particular a PP7 phage, when the bacterium is120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung Pseudomonas aeruginosa, or a levivirus, when the bacterium is Escherichia coli, in particular a Levivirus selected from MS2 and Qβ.

[0040] In a particular embodiment, said phage is a phage forming an EPI vesicle and / ora phage nucleus inside the bacterium. In particular such embodiments, said phage is a Chimallivirus.

[0041] A Chimallivirus of particular interest is phage ΦKZ, which infects the majorhuman pathogen, Pseudomonas aeruginosa.

[0042] ΦKZ-like jumbo phages are of great interest not only because of their potentialfor the treatment of recalcitrant P. aeruginosa infections via phage therapy (Chan et al.2016, Cobián Güemes et al. 2023, Naknaen et al. 2024), but also because of theircomplex infection cycle that includes the sequential formation of membrane- andprotein-bound compartments inside host cells. ΦKZ injects its genome together with a virion RNA-polymerase (vRNAP) inside an early phage infection (EPI) vesicle for immediate transcription of its genome (Armbruster et al.2023, Antonova et al.2024, Mozumdar et al.2024, Armbruster et al.2025). Subsequently, a subcellular structurereferred to as the phage nucleus is formed, in which the non-virion RNAP (nvRNAP)continues transcription, and the phage genome is replicated and loaded into attaching phage capsids (Chaikeeratisak et al. 2017a, reviewed in Prichard & Pogliano 2024, Antonova et al. 2024, Armbruster et al. 2025). These phage-induced cellular compartments shield the 280-kB dsDNA genome of ΦKZ from host defense mechanisms such as CRISPR-Cas and restriction enzymes (Malone et al. 2019, Mendoza et al. 2020) and make genetic gene silencing approaches challenging. Formation of the phage nucleus also necessitates mRNA export for cytosolictranslation and import of de novo synthesised phage proteins. Several conservedphage factors enable formation and organisation of the phage nucleus, e.g. the shell protein chimallin (ChmA) (Chaikeeratisak et al. 2017, Laughlin et al. 2022,Nieweglowska et al. 2023), the PicA protein (a.k.a Imp1), which mediates cargotrafficking into the phage nucleus (Morgan et al. 2024, Kokontis et al., 2025), and thetubulin-like protein PhuZ, which centers the phage nucleus in the middle of the cell and is involved in intracellular trafficking of newly assembled capsids (Kraemer et al.2012,Erb et al. 2014, Chaikeeratisak et al. 2017a, Chaikeeratisak et al. 2017b,Chaikeeratisak et al.2019). Nevertheless, major gaps remain in our understanding of the key decision points in the ΦKZ infection cycle. ΦKZ has ~400 annotated protein-120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung coding genes (Mesyanzhinov et al.2002), but how many of them play an essential or important role in successful host take-over and the consecutive steps in the phage infection cycle remains unknown. This is largely due to a lack of genetic tools thatpermit the rapid and targeted inactivation of ΦKZ genes. Similar open issues remainwith many other DNA or RNA phages.

[0043] In other particular embodiments, where the Gram-negative bacterium is aGammaproteobacterium selected from Erwiniaceae, the phage is selected fromChimalliviridae, and is in particular Erwinia phage vB_EamM_RAY (RAY), or isselected from a Keyvirus, in particular Key or AAS21. In particular such embodiments,where the Gram-negative bacterium is selected from Pantoea agglomerans, the phageis RAY.

[0044] In a particular other embodiment, said bacterium is a Gram-positive bacterium,particularly an actinobacterium or a firmicute, particularly selected from Streptococcus, Staphylococcus and Lactobacillus, particularly Lactobacillus casei, Lactococcusbulgaricus and Streptococcus thermophilus.

[0045] In a particular other embodiment, said Gram-positive bacterium is selected fromBacillaceae, in particular is a Bacillus, in particular Bacillus subtilis.

[0046] In a particular embodiment, said CPP is selected from the list of (KFF)3K, TAT(RXR)4XB, (RFR)4XB, ANT, K8, pip1 and pip1(D), in particular is selected from (KFF)3K and (RXR)4XB, more particularly is (KFF)3K.

[0047] In a particular embodiment, said phage is selected from phage PL-1 and phagephi FSW, more particularly is phage PL-1, when said bacterium is Lactobacillus casei, or wherein said phage is selected from cos, pac, 5093, and 987 groupSiphoviridae family phages, when said bacterium is Streptococcus thermophilus.

[0048] In a particular embodiment, said ASOp is selected from DNA, RNA, peptidenucleic acids (PNAs), peptide-conjugated phosphorodiamidate morpholino oligomers (PPMOs), phosphorothioate (PTO)-modified DNA, 2′-methylated RNA (RNA-OMe), 2′- methoxyethylated RNA (RNA-MOE), 2′-fluorinated RNA (RNA-F), 2′–4′-bridged RNA (BNA), and 2′–4′-locked RNA (LNA), in particular is selected PNAs, PPMOs, PTO- modified DNA, RNA-Ome, RNA-MOE, RNA-F, BNA, and LNA, more particularly fromPNAs and PPMOs, most particularly is a PNA. For a review of different ASOs, seeGhosh et al., 2024.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung

[0049] In a particular embodiment, said ASOp is a PNA consisting of n nucleotides,wherein n is selected from 9, 10, 11, 12, 13, 14, and 15, in particular wherein n is selected from 9, 10, 11, 12, and 13, more particularly wherein n is selected from 10, 11, and 12, in particular wherein n is 10 or 11.

[0050] In a particular embodiment, said ASOp is specific for a region of the genecomprising the start codon and / or the ribosomal binding site. An analysis of binding ofASOs to bacterial mRNA can be found in El-Fateh et al., 2024.

[0051] In a particular embodiment, said at least one parameter is selected from plaque-forming units, colony-forming units, formation of intracellular structures, early, intermediate and late phage transcripts, transcriptome and proteome signatures.

[0052] In a particular embodiment, said phage is a Chimallivirus and wherein said atleast one parameter is the formation of an intracellular structure selected from an EPIvesicle and a phage nucleus (see Chaikeeratisak et al. 2017, reviewed in Prichard &Pogliano 2024).

[0053] In a particular other embodiment, wherein said Gram-positive bacterium isselected from Bacillaceae, the phage is a Myovirus, and particularly is Bacillus phage SPO1.

[0054] In a particular embodiment, said step (a) is performed using one or more of thefollowing conditions: cell density OD600 of 0.3, a pre-incubation time of up to 30 min, a pre-incubation time ending not more than 5 minutes before infection with said phage, a concentration of said ASOpof at least 2 µM, in particular between 2 and 10 µM, more particularly between 4 and 6 µM, a multiplicity of infection (MOI) of 0.0001, a time of spotting after infection of 210 min; about 3 replication rounds and nearly full lysis of cells and a length of 10 to 11 nucleotides for the ASOp.

[0055] In a particular embodiment, said protein is a protein having a putative roleselected from a polymerase, a ribonuclease, capsid, endolysin, terminase, import proteins, and phylogenetically conserved proteins.

[0056] In a particular embodiment, in a first step, two or more ASOp sequences and / orCPPs are tested for efficient uptake by said bacterium and / or efficient interference with the transcript encoding said protein.

[0057] In a particular embodiment, in a first step, off-target and toxic effects areexcluded for the bacterium in a control experiment using said CPP-ASOp without prior,concomitant or subsequent infection by said phage.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung

[0058] In a particular embodiment, in a first step, the knockdown of said protein isvalidated by a quantitative readout of the targeted protein or its phenotypic impact.

[0059] In a particular embodiment, in a first step, two or more ASOps against the sametarget are identified that cause a similar phenotype.

[0060] In a particular embodiment, in a first step, phenotypic readouts are comparedamong different phages and hosts to exclude off-target or secondary effects.

[0061] In a particular embodiment, in a first step, the minimal inhibitory ASOpconcentration is determined, where no plaque formation can be seen, followed by astep of using the ASOp at optimal concentrations yielding the maximum log increase inplaque formation.

[0062] In the context of the present invention, the term “parameter that is a measurefor said replication” refers to any parameter that can be observed, visualized, measured, determined, calculated or the like resulting in a value or characterizationthat is a measure for the state and / or degree of phage replication resulting from theexperiment.

[0063] In a particular embodiment, said at least one parameter is selected plaque-forming units, colony-forming units, formation of intracellular structures, early, intermediate and late phage transcripts, transcriptome and proteome signatures.

[0064] In a particular embodiment, said phage is a Chimallivirus ΦKZ and wherein saidat least one parameter is the formation of an intracellular structure selected from an EPI vesicle and a phage nucleus

[0065] In a particular embodiment, said step (a) is performed using one or more of thefollowing conditions: culturing of said bacterium in MH medium; culturing saidbacterium to a cell density OD600 of 0.3; performing a pre-incubation step with saidCPP-ASOp of up to 30 min, in particular, wherein the pre-incubation time does not endmore than 5 minutes before infection with said phage; using a concentration of saidCPP-ASOpof at least 2 µM, in particular between 2 and 10 µM, more particularlybetween 4 and 6 µM; infecting said bacterium with said phage at a multiplicity ofinfection (MOI) of 0.0001; using a time of spotting after infection of 210 min; usingabout 3 replication rounds and nearly full lysis of cells; and using a length of 10 to 11nucleotides for the ASOp.

[0066] In a particular embodiment, said protein is a protein having a putative roleselected from a polymerase, a ribonuclease, and an import protein.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung

[0067] In a second aspect, the present invention relates to a method for assaying forthe relevance of a protein of a bacterium for the replication of a phage in saidbacterium, comprising the steps of (a) contacting said bacterium either before, concomitant with or after infection with said phage with at least one compound CPP- ASOb, wherein CPP is a cell-penetrating peptide and ASObis an antisense construct that is specifically binding to an mRNA coding for said protein, and (b) evaluation at least one parameter that is a measure for said replication..

[0068] The embodiments listed above for the first aspect apply to this second aspectas well (mutatis mutandis).

[0069] In a third aspect, the present invention relates to a method for inhibiting theformation of progeny particles of a phage from a bacterium infected with said phage, comprising the step of contacting said bacterium with at least one compound CPP- ASOp, wherein CPP is a cell-penetrating peptide and ASOpis an antisense construct that is specifically binding to an mRNA coding for a protein of said phage that is essential or important for phage replication, and / or at least one compound CPP-ASOb, wherein ASObis an antisense construct that is specifically binding to an mRNA coding for a protein of said bacterium that is essential or important for phage replication.

[0070] The embodiments listed above for the first aspect apply to this third aspect aswell (mutatis mutandis).

[0071] In a fourth aspect, the present invention relates to a method for preventing theformation of phage progeny particles from a bacterium at risk of being infected with said phage, comprising the step of contacting said bacterium with at least one compound CPP-ASOp, wherein CPP is a cell-penetrating peptide and ASOpis an antisense construct that is specifically binding to an mRNA coding for a protein of said phage that is essential or important for phage replication, and / or at least onecompound CPP- ASOb, wherein ASOb is an antisense construct that is specificallybinding to an mRNA coding for a protein of said bacterium that is essential or important for phage replication.

[0072] The embodiments listed above for the first aspect apply to this fourth aspect aswell (mutatis mutandis).

[0073] In a particular embodiment, said bacterium is Pseudomonas aeruginosa,wherein said phage is a Chimallivirus ΦKZ and wherein said protein of said phage is selected from ΦKZ049, picA (ΦKZ069), ΦKZ042, ΦKZ155, ΦKZ056, ΦKZ174,120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung ΦKZ177 and ΦKZ186, in particular wherein said bacterium is used in a biofilm-basedfermentation (see, for example, Ren et al. 2020).

[0074] In a fifth aspect, the present invention relates to a method for promoting theformation of phage progeny particles from a bacterium comprising the steps of (a) contacting said bacterium with at least one compound CPP-ASOb, wherein CPP is a cell-penetrating peptide and ASObis an antisense construct that is specifically binding to an mRNA coding for a protein essential or important for said bacterium’s defencesystem directed against replication of said phage in said bacterium; and (b) infectingsaid bacterium with said phage.

[0075] The embodiments listed above for the first aspect apply to this fifth aspect aswell (mutatis mutandis).

[0076] In a particular embodiment, said bacterium is Pseudomonas aeruginosa,wherein said phage is a Chimallivirus ΦKZ and wherein said protein is JukA and / or JukB.

[0077] In a sixth aspect, the present invention relates to a method for promoting theformation of phage progeny particles from a bacterium infected with, or otherwise comprising, a phage, in particular a prophage, comprising the steps of (a) contacting said bacterium with at least one compound CPP-ASOp / b, wherein CPP is a cell- penetrating peptide and ASOp / bis an antisense construct that is specifically binding toan mRNA coding for a phage or bacterial protein, respectively, repressing, preventingor delaying replication of said phage in said bacterium.

[0078] The embodiments listed above for the first aspect apply to this fifth aspect aswell (mutatis mutandis).

[0079] In a particular embodiment, said step (a) results in lysis of said bacterium.

[0080] In a seventh aspect, the present invention relates to a compound CPP-ASOp,wherein CPP is a cell-penetrating peptide and ASOpis an antisense construct that is specifically binding to an mRNA coding for a protein repressing, preventing or delayingreplication of a phage, in particular a lytic phage, in a bacterium for use in the treatmentof a patient suffering from an infection with said bacterium.

[0081] In particular embodiments, the patient is a human. In particular otherembodiments, the patient is a non-human animal.

[0082] In a related aspect, the present invention relates to a method of treating a plantinfected with a bacterium, comprising the step of administering or applying a compound120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung CPP-ASOpto said plant, wherein CPP is a cell-penetrating peptide and ASOpis an antisense construct that is specifically binding to an mRNA coding for a proteinrepressing, preventing or delaying replication of a phage, in particular a lytic phage, insaid bacterium

[0083] The embodiments listed above for the first aspect apply to this fifth aspect aswell (mutatis mutandis).

[0084] Birkholz et al. (2024) have shown that deletion of gene 210 (which is analogousto a knock-down with ASOs as taught in the present application) of phage ΦPA3 results in a fitness recovery of ΦKZ in a co-infection assay (see Fig.4a,b of Birkholz et al.),since gene 210 is responsible for the inter-phage warfare and is inhibiting ΦKZ Thus,it has been shown that a gene of a first phage can have the function to inhibit a second phage. Thus, in particular variants of the second to seventh aspect, the present invention relates to a situation, where two or more different phages are present in abacterial host cell, wherein a first phage is able to influence replication of a secondphage by either inhibiting or repressing, or by starting or increasing replication of said second phage, and wherein said ASOpis an antisense construct that is specifically binding to an mRNA coding for a protein of said first phage that is essential or important for replication of said second phage. EXAMPLES

[0085] Targeted mapping and characterization of essential or important phage genesis key to understanding the major molecular players in a phage’s infection cycle and its ability to counter host defence but is restricted to few model phage-host systems that are amenable to genetic manipulation. The present approach aimed at developing a straightforward and broadly applicable non-genetic route to assess gene essentiality,importance and function in phage-host interactions. Specifically, a programmable genesilencing at the RNA level was employed via exogenous delivery of synthetic antisense oligomers (ASOs) into the bacterial cytosol (Fig.1a). Such ASOs are typically 9-12 nucleobases in length and designed to sequester the ribosome binding site (RBS) or start codon (AUG) of a target mRNA to prevent synthesis of the encoded protein. They have been applied successfully in multiple bacterial species (Nielsen 2010, Vogel2020, Pifer & Greenberg 2020, El-Fateh et al. 2024, Vogel et al. 2025). One popular120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung ASO modality is peptide nucleic acid (PNA), which harbours a pseudo-peptide backbone that links the four natural nucleobases and protects the oligomer from nucleolytic and proteolytic degradation. For delivery across the bacterial envelope, the ASO is fused to a cell-penetrating peptide (CPP, reviewed in El-Fateh et al. 2024). Here, we pioneer the application of ASO technology to score phage gene essentialityor importance and to understand and break defense and counter-defense mechanismsin the phage-host interplay. Seeking to identify phage genes that are required duringP. aeruginosa infection or serve key functions in the intricate infection process of phageΦKZ in P. aeruginosa, we perform a systematic knockdown of ΦKZ genes coupledwith phenotypic, transcriptome and proteome analyses. We discover numerouspreviously unknown essential or important genes with varying phenotypes, includingΦKZ155, a conserved phage protein that acts at a key decision point duringprogression from the early to the intermediate phase of the phage replication cycle. Our results suggest that more ΦKZ proteins than previously appreciated contribute to the subcellular organisation of the phage replication cycle.

[0086] Surprisingly, the present inventors have found that the ASO technology cansuccessfully be applied to phage-infected cells and that annotated phage proteins can be silenced to investigate phage biology in bacterial host cells, in particular jumbophage biology in diverse Pseudomonas strains.

[0087] Thus, to overcome the barrier, mentioned above, a non-genetic approach usingexogenous delivery of synthetic programmable antisense oligomers (ASOs) to silence essential or important genes in both DNA and RNA phages of Pseudomonas aeruginosa, a lead pathogen in phage therapy, and Escherichia coli. Systematic knockdown of core and accessory genes, followed by global RNA-sequencing and microscopy analyses, led to the discovery of a set of important phage genes that can be used as targets for inhibition of phage replication. Our ASO approach promises to be widely applicable in phage biology, will help elucidate defence and anti-defence mechanisms in non-model phage-host pairs, works in clinical isolates of pathogenic bacteria, and offers a non-GMO solution for production strains for phage therapy and industrial applications. Example 1: Silencing of phage transcripts by ASOs120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung

[0088] Like other bacterial species, P. aeruginosa is amenable to ASO-induced genesilencing, as demonstrated by bactericidal ASOs that target and repress mRNAsencoding essential or important proteins of the transcription apparatus or in fatty acidsynthesis (Ghosal & Nielsen 2012, Howard et al. 2017, reviewed in El-Fateh et al.2024). Since phage mRNAs are translated outside the phage nucleus in the bacterialcytosol by cytosolic ribosomes, we hypothesized that they should be amenable toASO-mediated silencing, too (Fig.1a). Yet, it was unclear, if ASOs could compete withthe rapid overloading of transcription-translation machinery by phage transcripts in infected host cells, how the handover at the phage nucleus in ΦKZ will impact ASOtargeting and whether mRNA synthesis inside the phage nucleus would shield thesetranscripts from ASO recognition. To establish a proof-of-concept, we designed ASOs that target the transcript of the essential chimallin protein ChmA (ΦKZ054), which is the main constituent and abundant shell protein of the phage nucleus (Chaikeeratisaket al. 2017) in particular an 11mer ASO against the Shine-Dalgarno (SD) sequence ofchmA mRNA (gene ΦKZ054, Fig.1b). As a control, we treated the cells with an ASOthat does not target any specific gene (‘non-targeting control’). Initially, we monitoredChmA protein levels in P. aeruginosa cells incubated with those ASOs after phageinfection. Using a polyclonal antiserum raised against purified ChmA, we observed that20 min post infection (p.i.), i.e. within the first round of replication, the chmA-targetingASO prevented the synthesis of ChmA protein, even at a high multiplicity of infection(MOI) of 10 (Fig.1c).

[0089] ASOs were designed against RBS and AUG regions using the MASONalgorithm (Jung et al.2023, https: / / mason.helmholtz-hiri.de) and the NCBI sequence and annotation files (ΦKZ: NC_004629.1, PP7: NC_001628.1, PA14: CP000438.1, lambda: NC_001416.1, PA5Oct: NC_071039.1). ASO length was set to 10-mers for E.coli and 11-mers for P. a. and the allowed mismatches for off-targets were set to 4.ASOs were selected based on the following scoring values: melting temperature (45- 55°C), low purine percentage (25-35%) and few predicted off-targets in distinct translation initiation regions of the phage (<3). At least two ASOs were designed for each targeted gene. The control ASO-sequence was GACATAATTGT (ctrl.; SEQ ID NO:1). ASOs were commercially ordered at Peps 4LS (Heidelberg) with a peptide-backbone (PNA) and a 5´-RXR ((RXRRXRRXRRXRXB)-CPP = (RXR)4XB-CPP; SEQID NO:2) for P. aeruginosa and 5´-(KFF)3K (KFFKFFKFFK; SEQ ID NO:3) for E.coli.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung The initial concentration was adjusted to 1 mM in water based on the specific extinction coefficient using absorption. ASOs were stored at -20 °C. Prior usage, ASOs were thawed at room temperature, then heated for 5 min at 50 °C and then cooled down at room-temperature.

[0090] ChmA is essential for phage replication, hence its gene cannot be deleted inΦKZ. An ASO knockdown of its mRNA would be expected to phenocopy theessentiality of this gene. To test the functional effects of ChmA knockdown on phagereplication, we assessed cell survival (i.e. colony forming units (CFUs)) and phageplaque efficiency (i.e. the amount of plaque forming units (PFUs))after multiple rounds of replication. Strikingly, ASO-mediated knockdown of ChmA caused a strong reduction in phage progeny leading to a complete loss of plaques (Fig. 1d), demonstrating that sterilisation can be achieved with a chmA-targeting ASO. Thisexperimental set-up allowed us to amplify the effects on phage progeny, to sampledelayed replication times, and to score effects that only become apparent in the nextinfection round. Initially, we optimised the experimental conditions and adjusted the cell density (OD600 of 0.3), the ASO pre-treatment time (30 min), the concentration of ASOs (4-6 µM), the MOI (0.0001 to allow three rounds of replication until nearly complete host lysis), the time of spotting after infection (180 min; ~ 3 replicationrounds), and the length of the ASOs (10-11 nucleobases) (Figure 6). In detail, PAO1(DSMZ: DSM22644) was grown in LB media overnight at 37 °C and 220 rpm. Cellswere inoculated 1:100 and grown in MH media at 37 °C and 220 rpm to an OD of 0.3. ASOs were added at 6 µM final concentration to 50 µl cultures and incubated for 30 min. Cells were infected with ΦKZ at an MOI 0.0001 and the cells were incubated for 3 h.5 µl of cell culture were diluted in series and spotted on LB plates and on 0.5% LB soft agar plates with the susceptible strain PAO1 (one volume of 0.5% LB soft agar at 42 °C, was mixed with 0.01 volume cells at OD 0.5, and poured into a plate). Plates were imaged with the Typhoon 7000 phosphoimager (GE Healthcare) in fluorescence mode.

[0091] Thus, the experiments described above enabled the systematic optimization ofASO variables (carrier peptide, length) and experimental conditions (time pre / post- treatment, ASO toxicity and concentration, MOI) to increase the dynamic range of the phage plaque efficiency score (Fig.7120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung

[0092] Overall, these results demonstrate that ASO technology can be used to inhibitessential or important phage genes with subsequent effects on phage replication. Example 2: Imaging of structural phenotypes and sequencing of molecularphenotypes after ASO-based gene silencing

[0093] Next, we sought to image phenotypic consequences of ChmA loss upon ASOknockdown. We therefore monitored progression through the phage replication cycle by imaging the formation of phage-derived cellular compartments. At 5-min p.i., theEPI vesicle was visible in both control and anti-chmA ASO treated cells (Fig. 2a1e),indicating successful infection. At 30-min p.i., the phage nucleus had formed in the control sample, evident as a central DNA-containing structure. ASO-based knockdown of ChmA prevented the appearance of a recognizable phage nucleus. Instead, we observed smaller cellular structures that contained DNA, which we interpret as multipleEPI vesicles resulting from the high MOI of 10, necessary to achieve a synchronisedinfection. Hence, in the absence of ChmA, there is no formation of the phage nucleus, and this arrests the phage replication cycle (Fig.1e). This agrees with observationsmade in E. coli infected with the phage Goslar after silencing of ChmA via CRISPRinterference by antisense RNA targeting (CRISPRi-ART, Adler et al. 2025, , Morgan etal. 2024. Armbruster et al. 2025). The fact that ASO-based knockdown of ChmAcompletely prevented plaque formation (Fig.1d) implies that the EPI vesicle is not ableto support phage replication. These observations demonstrate that ASO-basedsilencing of phage genes is effective and can be coupled to imaging of cellular structures that form throughout the phage replication cycle to study phage biology.

[0094] Phage infection is a fine-tuned process that affects different cellular pathways,but not all will result in a macroscopic phenotype. We reasoned that more sensitive, global methods such as RNA-seq could reveal 'molecular phenotypes' after ASO- mediated phage gene knockdown, defined as specific transcriptional dysregulation in infected cells (Barquist et al.2016, Putzeys et al.2024).

[0095] To establish this approach for ΦKZ, we first performed high-resolution RNA-seqafter ChmA knockdown, which arrests the phage replication cycle at the level of the EPI vesicle (Fig.1e, Armbruster et al.2025). Samples were taken at 10, 15, 20, 25, 35 min after ΦKZ-infection. In the non-targeting ASO control samples a trajectory in120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung the principal component analysis revealed the transcriptional response throughout the phage replication cycle (Fig. 4a,b). Under these conditions, 10 min p.i. phage transcripts represented about 45% of all sequenced reads that map to coding sequences and this increased to about 70% at 35 min p.i. (in agreement with Gerovac et al. 2024, Danilova et al. 2020, Ceyssens et al. 2017). Interestingly, the chmA transcript itself was unaffected by the ASO treatment, suggesting that in this case translational inhibition does not lead to increased mRNA depletion, as previously observed for some bacterial mRNAs targeted with ASOs (Fig.4b, Popella et al.2022).Upon ChmA knockdown, intermediately expressed phage genes were stronglydepleted from 15 min p.i. onward, indicating that formation of the phage nucleus is required for expression of these genes by the nvRNAP (Figs.4b, 12). Consistent with their dependence on the nvRNAP, phage tRNAs were not detected after ChmA knockdown either. Several other transcripts showed prolonged expression after ChmA knockdown, indicating potential feedback inhibition from the phage nucleus.

[0096] On the host side, under control conditions, we did not observe a substantialtranscriptional response at later stages of infection compared to 10 min p.i., when host- takeover is considered to be completed. To test if this lack of a late host response is facilitated by the phage nucleus, we investigated host transcriptional changes upon ChmA knockdown. ChmA silencing caused the upregulation of 13 host transcripts outof ~3,637 detected transcripts in P. aeruginosa at 35 min p.i.. Among these genes werePA0201, which encodes a hypothetical hydrolase; the membrane protein FxsA, which is linked to phage exclusion and may prevent superinfection (Cheng et al.2004, Bondy- Denomy et al. 2016); and the type III secretion system regulator SuhB, which is important for Pseudomonas virulence (Li et al.2013). Hence, even in the absence of a phage nucleus, the host response to the EPI vesicle is limited, which proves the protective nature of this structure.Example 3: ASO-based gene silencing of phuZ

[0097] Seeking to confirm that ASO knockdown reproduces established phenotypes,we silenced the phuZ mRNA encoding the phage spindle apparatus protein thatpositions the phage nucleus in the middle of the cell (Kraemer et al.2012, Erb et al. 2014). ASO suppression of PhuZ synthesis resulted in decentralisation of the phage120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung nucleus towards the cell pole, effectively phenocopying deletion of the non-essentialphuZ gene in ΦKZ (Guan et al. 2022) (Fig.1f,g). These observations demonstrate thatASO-based silencing of phage genes is effective and can be coupled to imaging of cellular structures that form throughout the phage replication cycle to study phage biology. Example 4: ASO design and specificity

[0098] Studies using global data sets of ASO knockdown in different enteric bacteria(Popella et al.2021, 2022, Hör et al.2022, Ghosh et al.2024) led to an ASO design algorithm (MASON), which predicts effective and selective ASOs that inhibit bacterialprotein synthesis (Jung et al. 2023). This algorithm applies various criteria such as amelting temperature in the 45-55°C range, low self-complementarity and purine percentage, and a binding site in the narrow translation initiation region of bacterial mRNAs. These studies also showed that central mismatches are detrimental to ASO efficacy (Jung et al.2023). To test whether this applies to phage mRNAs as well, wemutated the chmA ASO and found that two central mismatches were sufficient torender the ASO ineffective (Fig.8).

[0099] To systematically address effective ASO sites within a phage 5’ mRNA region,we tiled the chmA mRNA in the -37 to +44-nt window relative to its AUG start codon,with single nucleotide resolution in the central part. Strikingly, all 19 ASOs that bind at or close to the SD or AUG with a melting temperature between 35 and 58°C strongly inhibited ChmA synthesis and phage plaque efficiency (Fig. 8). Our analysis also indicates that ASOs directed against the A / U-rich region between the SD and AUG fail to repress ChmA protein synthesis, likely due to their low melting temperature. This tiling experiment shows that it is possible to design multiple effective ASOs for a given target, which is recommended to mitigate the risk of off-targeting and false-positive readout of phenotypes.

[0100] To address ASO specificity and potential off-target effects at the proteinlevel, we performed proteomics of ΦKZ-infected P. aeruginosa pretreated with ASOsagainst three different mRNAs (chmA, the nvRNAP transcript (ΦKZ055), picA (ΦKZ069)). We sampled with a 2.5 minute temporal resolution within the first 10 minutes of ΦKZ infection. Among the 1,130 host proteins detected with high120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung confidence, we observed very limited alterations in protein levels, which argues againstthe many off targets in the host (Fig.9). Similarly, we analyzed the phage proteome at7.5 and 10 min p.i., i.e. when sufficient phage proteins could be detected with confidence. We observed a strikingly specific downregulation of the ASO targets ChmA, nvRNAP and PicA (Fig.9) without strong effects on other phage proteins.

[0101] All three targets—chmA, nvRNAP and picA—are co-transcribed with atleast one additional gene. Intriguingly, each of these ASOs only inhibited proteinsynthesis of the targeted cistron, e.g., the chmA ASO only suppressed ChmAsynthesis, while synthesis of the nvRNAP encoded by the subsequent cistron was unaffected (Fig. 9-e). These results demonstrate that ASO-based technology is suitable for the knockdown of proteins encoded by polycistronic transcripts. Example 5: ASO screen for factors that are important for phage replication

[0102] The programmable feature of ASOs allows for genome-wide screens forgene essentiality or importance to discover genes critical for phage replication. ΦKZpossesses a large genome with 377 annotated genes (NCBI), of which 85% have no predicted function (Mesyanzhinov et al. 2002, De Smet et al. 2017). This paucity of functional knowledge extends also to the much smaller core genome of Chimalliviridae, which consists of seven blocks of genes with likely interlinked functions, plus five independent genes (Prichard et al. 2023). To identify genes that are essential orimportant for ΦKZ replication in P. aeruginosa PAO1, we screened 75 core andannotated genes (omitting most of the structural genes) using ASO-based knockdown and CFU / PFU readout.

[0103] Overall, ASO-mediated knock down of one third of these genes (25) ledto a substantial effect on phage replication in CFU / PFU assays. As expected, several ASOs that target factors known to be essential or important for phage replication, such as chmA (ΦKZ054), the nvRNAP subunits (ΦKZ055 and -068) and the major head protein (ΦKZ120, Figs.3, 11b) triggered strong effects. Silencing of PicA (ΦKZ069), which is required for protein import into the phage nucleus (Morgan et al. 2024, Kokontis et al. 2025) abrogated plaque formation as well. We also observed strong effects upon knock-down of uncharacterised genes. For example, silencing of ΦKZ049, a gene that encodes a SH3 domain protein suggested to be associated with120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung the phage DNA polymerase (Iyer et al.2021) reduced plaque formation substantially. Similarly, knock-down of ΦKZ042, which encodes a conserved but uncharacterised protein, the hypothetical proteins ΦKZ174 / -177, and the early expressed transcript ΦKZ186 caused strongly reduced plaque-counts. Targeting of other genes caused milder effects (reduced plaque formation in the 1-2 order of magnitude range), although the recovery on the level of CFUs was more pronounced. An example is ΦKZ144, the gene encoding endolysin, which is vital for the final release of phage progeny from the cell (Briers et al.2007).

[0104] In addition to CFU / PFU quantitation, we used ChmA expression as anadditional readout, quantifying ChmA protein levels by immunoblotting after three rounds of replication. We observed reduced levels of ChmA for an additional 11 of the 61 genes that we screened using this read-out, even though we did not observe a strong effect on CFU / PFU. Examples include a putative RAD2 / SF2 helicase (ΦKZ075), a predicted DEAD / DEAH box helicase (ΦKZ203), the macro domain-containing protein ΦKZ104, as well as the uncharacterised core genes ΦKZ176, -161, -153, and -147, and the non-core genes ΦKZ283, -286, and 056.1. Therefore, these genes have an impact on ChmA production and thus are likely to affect the phage replication cycle, although they are not essential or important for phage replication.

[0105] .Unexpectedly, there are some core genes, where ASO knockdown hadno effect, e.g. see Fig.3, ΦKZ118, -181, -188, -032, -042, -062, -070, -140.

[0106] We also observed indirect and potential off-target effects upon ASOtreatment. For example, some ASOs were toxic to P. aeruginosa (22 / 176 tested ASOsoverall). Other ASOs increased PFUs by one order of magnitude, indicating that the targeted proteins, such as ΦKZ151 and -306, are negative regulators of phage replication or that possible off-target effects on the host may be beneficial for phage replication. We also observed 4 ASOs that caused phage plaques without phage infection. This is indicative of activation of a prophage, most likely the integrative filamentous phage Pf4 (Knezevic et al.2015, Gavric & Knezevic 2022).

[0107] In summary, our screening approach allowed us to identify 45 phageprotein knockdowns that caused varying effects on phage replication, which can now be studied further by coupling ASO-based knock-down with phenotypic readouts or multi-omics.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung

[0108] After we established RNA sequencing upon knockdown of ChmA withASOs (Fig.4a,b) and we observed for many targeted phage genes a reduction in PFUs(Fig.3), we reasoned that transcriptomics may be a sensitive readout that should allowthe discovery of potential functional links between phage factors based on correlated transcriptomic profiles after their knockdown. We therefore extended the RNA-seq analysis to 58 additional genes from our ASO screen. At 15 min p.i., we observed diverse effects on phage transcript levels of genomic islands that did not cluster clearly. At 30 min p.i., knockdown of ChmA, the nvRNAP subunit ΦKZ055, the nvRNAP sigma factor ΦKZ068, PicA (ΦKZ069) and ΦKZ056.1, -122, -124, and -151 caused a strong effect on phage transcription (Figs.4c, 13). Remarkably, ChmA, the nvRNAP and PicA clearly stood out and clustered together based on ΦKZ transcript level alterations. The fact that knockdown of PicA caused the same transcriptional phenotype as knockdownof ChmA and nvRNAP suggests that the nuclear import of nvRNAP subunits might bedependent on the recently discovered PicA protein importer (Morgan et al. 2024, Kokontis et al.2024).

[0109] On the host transcriptome, we observed diverse responses uponknockdown of phage proteins. For example, knockdown of ΦKZ174, which has a strong effect on phage replication, caused a strong downregulation of ~300 PAO1 transcripts. Curiously, knockdown of ΦKZ073 and -082 induced transcription of the Pf4 prophage locus, although it had no strong effects on PAO1 transcripts in general,suggesting a specific inhibitory mechanism of ΦKZ against the prophage. In summary,RNA sequencing revealed distinct transcriptional profiles upon knockdown of ΦKZ genes and allowed to cluster ΦKZ factors (Fig.4c) suggesting about a hand-full ofperturbation modes that allows now to illuminate their interplay in follow-up studies.

[0110] The CFU / PFU-based readout allowed us to sample effects arising fromlack of phage progeny, replication time delays, and effects on the next round of infection. Our screen revealed that nearly one third of the targeted genes have strong effects on phage replication. These data represent rich resources of interesting phage genes for further in-depth study and a source for effective ASO targets, e.g. for the targeting of phages in productions. Our non-genetic approach is versatile and applicable to diverse phages and hosts. Coupled to phenotypic readouts such as microscopy and global transcriptome analysis, it allows functional studies of phage biology.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung Example 6: ASO-based screening identified an essential or important phage replication factor

[0111] The major goal of our ASO-based knockdown screen was to identify ΦKZfactors with roles in the progression of the phage replication cycle. Curiously, we noticed that the knockdown of ΦKZ120, -155, -177 strongly reduced plaque formation,but had very little effects on phage transcription within the time course of our analysis(Figs.4c, 5a, 12, 14a). This can be rationalised for ΦKZ120, the major head protein, which is important during later stages of infection. The same is likely true for ΦKZ177, which is also expressed very late in the replication cycle. By contrast, ΦKZ155 is expressed at 20 min p.i. and its expression is dependent on ChmA. This suggests that ΦKZ155 plays an important role after the initial formation of the phage nucleus.

[0112] To further investigate the role of ΦKZ155 during phage infection, weperformed fluorescence microscopy imaging of phage infected cells. To our surprise, despite ongoing phage nucleus-dependent transcription (Figs.4c, 5a, 12), knockdown of ΦKZ155 inhibited the formation of a large phage nucleus centred within the cell at 35 min p.i. (Fig.5c).

[0113] ΦKZ155 is part of the core genome (Prichard et al. 2023). It is predictedby sequence homology to be contain an RNase HI domain (UniProt, Pfam domainPF00075) and appears to have an uncharacterised C-terminal part. RNase HI domains are typically found in enzymes that recognize RNA-DNA heteroduplexes and specifically cleave the RNA strand (Moelling et al. 2017). To validate its nucleolyticmode of action, we produced ΦKZ155 in an in vitro translation (IVT) reaction and addedRNA and RNA-DNA substrates. While single stranded RNA was not processed, RNA in an RNA-DNA duplex was degraded (Fig.14b). RNA degradation was based on the RNase HI catalytic mechanism, since exchange of the conserved RNase HI catalytic residue Asp102 to Asn abrogated the nucleolytic activity of the enzyme. These data establish that ΦKZ155 has RNase HI-like activity that does not appear to require a specific sequence motif.

[0114] RNases H-type nucleases are primarily known as enzymes that maintainDNA integrity (Moelling et al.2017). Yet, they also degrade RNA primers that initiate genome replication in both prokaryotes and eukaryotes. Therefore, we hypothesised120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung that ΦKZ155 might facilitate ΦKZ genome amplification. Indeed, after ASO-mediated silencing of ΦKZ155, we observed no phage genome amplification (Fig.5g, 14f,g). Of note, the lack of ΦKZ155 causes an arrest in phage nucleus maturation that allows to illuminate this transient step in follow-up studies (Fig. 5h). Here, we applied ASO- based knockdowns coupled to quantitative readouts of well described features in the phage replication cycle to pinpoint the moment of action of ΦKZ155 that apparently plays a role shortly after the initial phage nucleus is made and facilitates a handoverto the maturation of the phage nucleus and represents a novel phage replication factorthat can be targeted by ASOs to prevent phage replication.Example 7: ASO applications for the study of the phage-host interplay: Silencingof phage genes in genetically not tractable clinical isolates

[0115] To prove the versatility of ASOs in the study of phage-host interactions,we extended the approach to genetically intractable strains, targeting either phage orhost genes. Like many other strains isolated from patient samples, the P. aeruginosaclinical isolates PaLo8 / 9 / 39 / 44 (NCBI, PRJNA731114, a genomically diverse set ofisolates) are refractory to genome modification by classical approaches of bacterial genetics that require stable transformation with DNA, which includes electroporation(Fig.2a) and CRISPR-based technologies. However, using ASOs to target chmA, weachieved the same degree of inhibition of ΦKZ plaques and phage nucleus formationin these clinical isolates as we did in the P. aeruginosa standard laboratory strain PAO1used above (Fig.2a, Fig.10). Thus, ASOs offer a way to bypass the need for genetic tractability in functional studies of essential phage factors. Example 8: Silencing of phage genes that target anti-phage defence systems to allow for phage replication.

[0116] The clinical isolate PaLo44 unlike PAO1— is not susceptible to infectionwith a ΦKZ phage lacking the ΦKZ014 gene, which encodes a ribosome-associated protein that appears to circumvent a PaLo44-specific defense system (Gerovac et al. 2024). Using ASO-based knockdown of ΦKZ014 (Fig.2c), we were able to render PaLo44 resistant to ΦKZ as previously observed with an engineered ΔΦKZ014 phage120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung (Gerovac et al.2024). These data show that ASOs can be used to screen the impact of phage factors in diverse hosts without the need of genetic engineering. Example 9: Silencing of anti-phage defence systems in the host to render pathogens susceptible for phage infections.

[0117] Host-encoded defence systems are a major barrier to phage replication,but their genomic disruption is challenging. ASOs could be an alternative approach to inhibit their expression. To test this, we selected the JukAB defence system in the P.aeruginosa strain PA14, which rescues the cell by preventing early phage transcription,DNA replication, and nucleus assembly (Yuping et al.2025). Since the jukAB locus isconstitutively active, we added the ASO targeting the jukA transcript 2.5 h prior toinfection to ensure complete JukA depletion at the time of ΦKZ exposure. ASO-mediated silencing of the jukA mRNA rendered P. aeruginosa PA14 bacteria susceptible to ΦKZ and allowed phage replication (Fig. 2b), indicating successful knockdown of the defence system. These results demonstrate that ASOs can be used to inhibit phage defence systems to study their composition and sensitivity in their native host and to propagate phages in otherwise non-permissive (pathogenic) strains. Example 10: Silencing of phage in gram-positive and gram-negative host cells.

[0118] In the arms race between phages and bacteria, phages evolve counter-defences to overcome host defence systems. For example, ΦKZ encodes ΦKZ014, a ribosome-associated protein, which appears to circumvent a defence system specific to the clinical isolate PaLo44 (Gerovac et al.2024). A ΦKZ mutant lacking the ΦKZ014 gene can be generated in a PAO1 host, but will not produce progeny in the clinical isolate PaLo44. Similarly, we found that pretreatment with an ASO against the ΦKZ014 mRNA rendered PaLo44 resistant to wild-type ΦKZ (Fig.2c), phenocopying the effect previously observed with an engineered ΔΦKZ014 phage (Gerovac et al.2024).

[0119] Pseudomonas species are not only infected by DNA phages but also byRNA phages, generally an understudied class of bacterial viruses (Callanan et al. 2018, Hör 2025). Knowledge of diversity of RNA phages is now expanding owing to novel techniques that reduce the sampling bias that normally favours discovery of DNA120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung phages (Neri et al.2022). To test the applicability of ASO technology to RNA phages,we selected the model RNA phage PP7, which also infects P. aeruginosa PAO1. Wetargeted the replication (rep, RNA-dependent RNA polymerase, RdRP) and lysis (lys) genes of PP7 with ASOs. In this case, we reduced the ASO concentration to 0.2 µM due to unspecific effects of the control ASO at higher concentrations. In addition, ASOs were added repeatedly every 30 min until sampling and spotting. With this regime, we completely abrogated plaque formation for both targets (Fig. 2d). Thus, our ASO- based knockdown approach is applicable to both DNA and RNA phages with minor optimisations in terms of ASO concentration and administration.

[0120] Can ASO technology be applied across diverse phage-host pairs? Toexplore this, we tested ASO-mediated knockdown of phage genes in both Gram- negative and Gram-positive bacteria and their cognate phages. ASO-based knockdown of ChmA (Gp206) in the RAY phage (Prichard et al.2023), which infectsthe Gram-negative plant pathogen Pantoea agglomerans (Family Erwiniaceae)effectively abolished plaque formation (Fig.2e). To establish proof-of-principle for our approach in Gram-positive species, i.e. bacteria with a very different envelope structure, we targeted the DNA polymerase transcript (gene 31) in the phage SPO1 ofBacillus subtilis and observed a 100-fold reduction in plaque efficiency (Fig.2f).

[0121] Overall, these experiments highlight that ASO-based gene silencing is apowerful and broadly applicable technique to study many aspects of phage-host interactions, including in clinical isolates and strains that are not amenable to genetic manipulation. The technique can be applied to both host and phage genes and is agnostic to a phage’s type of genome. Moreover, we predict ASO-mediated silencing could be easily integrated into existing phage engineering methods and serve as aplatform technology to modify phages or sensitise pathogens for phage therapy.Example 11: Silencing phage genes in other DNA and in RNA phages

[0122] Other jumbo phages do not form a phage nucleus and are very differentin their replication cycle, for example, PA5Oct that also infects PAO1. We established ASO-based knockdowns also here against the portal and head protein transcripts that completely abrogated plaque formation (Fig.6d).

[0123] RNA phages are an understudied class of bacterial viruses (Callanan et120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung al.2018), although knowledge of their diversity is expanding owing to novel techniques that reduce the sampling bias that normally favours detection of DNA phages (Neri et al.2022). To test the applicability of ASO technology to RNA phages, we selected the model RNA phage PP7, which also infects P. aeruginosa PAO1. We targeted the replication (rep, RNA-dependent RNA polymerase, RdRP) and lysis (lys) genes of PP7 with ASOs and completely abrogated plaque formation (Fig. 2d). These data demonstrate that ASO-based knockdown of essential or important phage genes is applicable to DNA and RNA phages. Example 12: Silencing phage genes in phylogenetically distant species like E. coli

[0124] We focused on the lytic model phage λvir, which infects E. coli anddesigned ASOs that target the transcripts of five essential or important genes (O forreplication (rep), Q anti-termination factor (anti-term.)). Since we previouslyestablished that KFF is able to deliver ASOs in E. coli (Popella et al. 2021, Popella etal. 2022), we choose KFF as carrier peptide and 10-mer ASOs. After pre-incubation ofcells at OD6000.03 with the different ASOs (10 µM, single dose), we infected cells with the phage and assessed bacterial colonies (colony forming units, CFU) and phage plaques (plaque forming units, PFU) after three rounds of replication to amplify the effect and to cover effects that become apparent only upon re-infection (Fig. 2g). Knockdown of essential or important phage genes in λviryielded a reduction of plaques by 2-3 magnitudes and recovered bacterial growth at lower dilutions. This effect was in a similar range as previously described in a genome-wide CRISPRi approach targeting the same genes (Piya et al. 2023), indicating efficient ASO-mediated knockdown of the target genes. Example 13: Induction of prophages in bacteria with ASO treatment

[0125] We also observed indirect and potential off-target effects upon ASOtreatment. For example, some ASOs were toxic to P. aeruginosa (22 / 176 tested ASOsoverall). We also observed 4 ASOs that caused phage plaques without phage infection(Fig. 2h). This is indicative of activation of a prophage, most likely the integrative120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung filamentous phage Pf4 (Knezevic et al.2015, Gavric & Knezevic 2022). Example 14: Promotion of phage replication with ASO treatment

[0126] In other cases, we observed that ASO-based targeting of phage factorsyielded more plaques indicating that ASOs can be used to promote the replication of phages (Fig.2i). Example 15: Systematic ASO screen for factors important for phage plaque efficiency

[0127] After establishing proof-of-concept, we reasoned that the programmablefeature of ASOs would allow us to rapidly scale up this approach to screen for genes critical for phage plaque efficiency. ΦKZ features a large genome with 377 annotated genes (NCBI), of which 85% have no predicted function (Mesyanzhinov et al.2002, De Smet et al.2017). This paucity of functional knowledge extends to the smaller core genome of Chimalliviridae, which consists of seven blocks of genes with likely interlinked functions, plus five independent genes (Prichard et al. 2023). To identify ΦKZ genes that are essential for its propagation, we screened 75 core and annotated genes (omitting most of the structural genes) using ASO-based knockdown andCFU / PFU readout in the model host strain P. aeruginosa PAO1.

[0128] Overall, ASO-mediated knockdown of one third of these genes (24) ledto a strong effect (++, +++) on phage plaque efficiency in CFU / PFU assays with multiple log of PFU reduction and CFU recovery (Fig. 3, Fig. 11a). As expected, several ASOs that target factors known to be essential for phage plaque efficiency,such as chmA (ΦKZ054), the nvRNAP subunits (ΦKZ055 and -068) and the majorhead protein (ΦKZ120) triggered strong effects (+++) (Fig.3 and Fig.11b). Silencingof PicA (ΦKZ069), which is required for protein import into the phage nucleus (Morganet al.2024, Kokontis et al.2025) abrogated plaque formation as well. We also observedstrong effects upon knockdown of uncharacterised genes. For example, silencing of ΦKZ049, a gene that encodes a SH3 domain protein suggested to be associated with the phage DNA polymerase (Iyer et al.2021) reduced plaque formation substantially (Fig. 11b). Similarly, knockdown of ΦKZ042, which encodes a conserved but uncharacterised protein, the hypothetical proteins ΦKZ174 / -177, or the early120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschungexpressed transcript ΦKZ186 strongly reduced plaque counts (Fig. 12b). Of note,transcript abundance and protein levels of these hits varied widely, indicating that targeting of highly expressed genes with ASOs is possible (Fig.3). Knockdown of other genes produced milder effects, i.e., reducing plaque formation by only 2-3 orders of magnitude, but nevertheless protected the host from lysis as judged by CFU counts. This phenotype was observed for ΦKZ144, the gene encoding endolysin, which is vital for the final release of phage progeny from the cell (Briers et al.2007, Fig.11b). In addition to CFU / PFU quantitation, we used ChmA levels as an additional readout, quantifying ChmA protein by immunoblotting after three rounds of replication. We observed reduced levels of ChmA for 11 additional target genes, although we saw no substantial changes of the infection rate as measured via CFU / PFU (Fig.3). Examples include a putative RAD2 / SF2 helicase (ΦKZ075), a predicted DEAD / DEAH box helicase (ΦKZ203), the macro domain-containing protein ΦKZ104, the establishedvirion RNAP subunit ΦKZ176 (Thomas et al. 2016), as well as the uncharacterisedcore genes ΦKZ147, -153, -161and -161, and the non-core genes ΦKZ283 and -286.These genes can be expected to benefit phage fitness in more competitive situationssuch as non-laboratory environments or in P. aeruginosa strains with a differentrepertoire of defence systems. In the case of the vRNAP subunit ΦKZ176, the relatively modest effect on phage fitness is likely due to the fact that this protein is already present in the phage virion and injected into the host cell upon attack, hence ASO- mediated mRNA inhibition will not take effect in the initial round of infection. However, in the second and third round of infection, the ASO can inhibit the vRNAP transcript,reducing ΦKZ176 protein levels. This, in turn, leads to reduced ChmA levels, sinceearly transcription of chmA from the EPI vesicle is vRNAP-dependent (Ceyssens et al. 2014, Antonova et al.2023, Armbruster et al.2025).

[0129] We also observed indirect effects upon ASO treatment. For example,some ASOs were toxic to P. aeruginosa (22 / 176 of all tested ASOs, Fig.11a,c). Other ASOs increased PFUs by one order of magnitude, indicating that the targeted proteins, such as ΦKZ151 and -306, are negative regulators of phage plaque efficiency or that potential unspecific effects on the host may be beneficial for phage plaque efficiency (Fig. 11c). We also observed 4 ASOs that caused phage plaques without phage infection. This is indicative of activation of a prophage, most likely the integrative filamentous phage Pf4 (Knezevic et al.2015, Gavric & Knezevic 2022, Fig.11c).120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung

[0130] In summary, our screening approach yielded 45 phage proteins whoseknockdown caused varying effects on phage propagation, and which offer promising leads for in-depth studies using ASO treatment in combination with phenotypic or multi- omics readouts. Example 16: RNA-seq after ASO knockdown reveals molecular phenotypes of phage genes

[0131] Phage infection is a fine-tuned process that affects different cellularpathways, but not all will result in a macroscopic phenotype. We reasoned that more sensitive, global methods such as RNA-seq could reveal 'molecular phenotypes' after ASO-mediated phage gene knockdown, defined as specific transcriptional dysregulation in infected cells (Westermann et al.2016, Putzeys et al.2024).

[0132] To establish this approach for ΦKZ, we first performed RNA-seqafter ChmA knockdown, which arrests the phage replication cycle at the level of the EPI vesicle (Fig.1d, Armbruster et al.2025). In seeking to analyse both the phage andhost transcriptomes, total RNA was extracted from bacteria at 10, 15, 20, 25, 35 minafter ΦKZ-infection. In a principal component analysis (PCA) of the RNA-seq data, thetrajectory of the data from non-targeting ASO control samples revealed thetranscriptional response throughout the phage replication cycle (Fig.4a). Under these conditions, 10 min p.i. phage transcripts represented ~45% of all sequenced reads that map to coding sequences and this increased to ~70% at 35 min p.i. (Fig.12a,b, in agreement with Gerovac et al.2024, Danilova et al.2020, Ceyssens et al.2017). Whilethe overall amount of phage transcripts remained similar upon chmA knockdown,reads of middle / late phage genes were strongly depleted from 20 min p.i. onward, indicating that formation of the phage nucleus is required for expression of these genes by the nvRNAP (Fig.4b, Fig.12b-d, classes E, F). In contrast, early phage transcripts showed prolonged expression (Fig. 12d, classes A, B), possibly because vRNAP- driven transcription continues. Phage-encoded tRNAs were not detected after chmA knockdown (Fig. 12c), which is consistent with their dependence on the nvRNAP. These data support the model that once the phage genome is transferred from the EPIvesicle to the phage nucleus, it is transcribed by the nvRNAP, leading to cessation ofvRNAP-driven transcription (Ceyssens et al.2014, Antonova et al.2023, Antonova et120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung al.2024, Putzeys et al.2023, Armbruster et al.2025).

[0133] Interestingly, the chmA transcript itself was unaffected by the ASOtreatment, suggesting that, in this case, successful translational inhibition does not entail mRNA depletion (Fig.4b). This would also explain our observation that ASOs targeting polycistronic phage genes are cistron-specific (Fig. 11c-e). However, it is important to note that accelerated mRNA decay was observed for several ASO- targeted mRNAs in E. coli (Popella et al. 2022), highlighting the importance of monitoring mRNA levels when targeting individual cistrons within polycistronic transcripts.

[0134] On the host side, under control conditions, we did not observe asubstantial transcriptional response at later stages of infection compared to 10 min p.i., when host-takeover is considered to be complete (Fig.12b). To test if this lack of a late host response is facilitated by the phage nucleus, we investigated hosttranscriptional changes upon chmA mRNA silencing. The absence of ChmA resultedin upregulation of 13 host transcripts out of ~3,637 detected transcripts inP. aeruginosa at 35 min p.i. (Fig. 4b). Among these genes were PA0201, whichencodes a hypothetical hydrolase; the membrane protein FxsA, which is linked to phage exclusion and may prevent superinfection (Cheng et al.2004, Bondy-Denomy et al. 2016) and the type III secretion system regulator SuhB (PA3818), which isimportant for Pseudomonas virulence (Li et al. 2013). Hence, even in the absence ofthe phage nucleus, the host response to the EPI vesicle is limited, which proves the protective nature of this structure.

[0135] Based on these data, we reasoned that transcriptomics is a sensitivereadout that should allow the discovery of potential functional links between phage factors based on correlated transcriptomic profiles after their knockdown. We therefore extended the RNA-seq analysis to evaluating the consequences of ASO-mediatedsilencing of 58 genes from the screen above (Fig. 4c). At 15 min p.i., we observeddiverse effects on phage transcript levels of genomic islands that did not cluster very clearly (Fig.13a,b). At 30 min p.i., ASO-mediated depletion of ChmA, the nvRNAPsubunit ΦKZ055, the nvRNAP sigma factor ΦKZ068, PicA (ΦKZ069), ΦKZ-122, -124,and -151 showed a strong effect on phage transcription (Fig.4c). Of these, ChmA, the nvRNAP and PicA stood out because they strongly clustered based on ΦKZ transcript level alterations (Fig.5a, Fig.13c). Other clusters in the t-SNE plot exhibited more120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung subtle transcriptional effects in the complementary hierarchical clustering (Fig.13c). The fact that knockdown of PicA caused the same transcriptional phenotype as knockdown of ChmA and nvRNAP suggests that the nuclear import of nvRNAP subunits might be dependent on the recently discovered PicA protein importer (Morgan et al.2024, Kokontis et al.2025).

[0136] On the host transcriptome, we observed diverse responses uponknockdown of phage proteins (Fig. 4c, Fig. 13d-g). For example, knockdown of ΦKZ174, which abrogated plaque formation, was accompanied by a strong downregulation of ~300 PAO1 transcripts, i.e., almost 5% of all detected P. aeruginosa mRNAs (Fig.4c). While the function of the ΦKZ174 protein is unknown, we note that many of the genes repressed in its absence serve metabolic functions, suggesting that ΦKZ174 might act to prevent infected bacteria from metabolic shutdown. Equally interesting is the knockdown of ΦKZ082, which has no general effect on the PAO1 transcriptome but induces transcription of the Pf4 prophage locus (Fig.4c, Fig.13h). Since awakening of the Pf4 filamentous bacteriophage can result in partial lysis of the bacterial population (Petrova et al.2011), ΦKZ might use the ΦKZ073 and ΦKZ082 proteins as part of a specific inhibitory mechanism against the Pf4 prophage to ensureits own propagation. In summary, coupling ASO knockdown to RNA-seq revealeddistinct transcriptional profiles of perturbed ΦKZ genes and allowed us to cluster ΦKZ factors with different putative perturbation modes. Example 17: ΦKZ155 is an essential check-point protein for phage genome replication

[0137] The major goal of our ASO-based knockdown screen was to identify ΦKZfactors with key roles in the progression of the phage replication cycle, as defined by locking infection in a defined state. In this regard, we noticed a group of genes, i.e., ΦKZ120, ΦKZ155 and ΦKZ177, whose silencing strongly reduced plaque formation but hardly altered phage gene expression within the time course of our analysis (Figs. 4c, 5a). This can be rationalised for ΦKZ120 (major head protein) and ΦKZ177(function unknown), which are expressed during later stages of infection. By contrast,ΦKZ155 is strongly expressed at 20 min p.i. and its expression is dependent on ChmA (Fig.14a). This suggests that ΦKZ155 plays an important role after the initial formation120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung of the phage nucleus.

[0138] ΦKZ155 is part of the core set of proteins encoded by the nucleus-forming bacteriophage family (Prichard et al.2023). However, its role and time of action in the infection cycle of ΦKZ or any other of these phages is unknown. The predicted structure of ΦKZ155 harbours an N-terminal RNase HI domain (UniProt, Pfam domain PF00075) and a well-structured C-terminal domain (local distance difference test >0.9,AlphaFold3 server, Fig.5b, Abramson et al.2024, Kokontis et al.2025). To understandthe cellular consequences of ΦKZ155 depletion, we performed fluorescence microscopy imaging of phage-infected cells after ASO-mediated knockdown of the protein. To our surprise, knockdown of ΦKZ155 inhibited the formation of a prominent phage nucleus in the centre of the cell at 45 min p.i. (Fig.5c). To determine whether this is a conserved phenotype, we silenced the expression of Gp176, the homolog ofΦKZ155 in the P. aeruginosa phage ΦPA3. These two proteins show only 65%sequence identity, although their overall fold is predicted to be conserved (Fig.5b). Importantly, knockdown of Gp176 using an ASO with a different sequence also abrogated phage nucleus formation (Fig.5c).

[0139] To test if ASO-mediated knockdown of an essential gene such asΦKZ155 can be reversed through complementation with an insensitive allele, we expressed the ΦKZ155 gene from a plasmid with a heterologous promoter and 5’ untranslated region, which should be resistant to the anti-ΦKZ155 ASO. Notably, phage plaque efficiency and nucleus maturation were fully restored in this experimental set-up (Fig.5d,e). Interestingly, a catalytic centre mutant (ΦKZ155D102N) with no in vitroRNase H activity also restored plaque efficiency and nucleus formation in vivo (Fig.14b-d). This successful complementation experiment involving ASO knockdown of the endogenous transcript proves that ΦKZ155 (which is co-transcribed with ΦKZ154, ΦKZ156, and ΦKZ156.1; Putzeys et al. 2023) serves an essential function. Intriguingly, the absence of a visible phage nucleus was not due to shortage of the shell protein ChmA (Fig.5f). In addition, our RNA-seq data argue that upon ΦKZ155 knockdown, phage nucleus-dependent transcription takes place. Therefore, the phage nucleus must have formed and nvRNAP been imported (Fig.5a, Fig.13b). Thus, ASO- mediated ΦKZ155 knockdown causes an arrest at a checkpoint after initial phage nucleus formation. This is consistent with the localization of ΦKZ155 inside the phage nucleus (Fig.14e, Kokontis et al.2025), where it may play a role in phage nucleus120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung maturation.

[0140] To explain the proposed arrest of the infection cycle in the absence ofΦKZ155, we hypothesized that phage nucleus size might be linked to genome copy number. We therefore quantified phage DNA levels by dot blot analysis in cells treatedwith a control ASO or a ΦKZ155-targeting ASO following phage infection. In this assay,phage DNA is detected 40 min p.i. in P. aeruginosa PAO1 treated with the control ASOand increases thereafter. By contrast, we observed no phage genome amplification after ASO-mediated silencing of ΦKZ155 (Fig.5g). Reassuringly, this lack of genome amplification was also observed upon knockdown of the ΦPA3 homolog Gp176 (Fig. 14g). Of note, we observe no degradation of the host genome in this experimental set- up (Fig.14g). Thus, the lack of ΦKZ155 arrests the phage infection cycle at a crucial stage shortly after the initial phage nucleus is made and stalls amplification of the phage genome (Fig.5h). We predict that such defined arrested states achieved byASO-based knockdown of specific phage genes will be useful in dissecting themolecular steps that govern key decision points in the progressing phage infection cycle. Discussion

[0141] Here we demonstrate that ASO technology is effective in silencing phageand host transcripts to investigate biology at the host-phage interface. We applied this approach to screen core and functionally annotated genes of the jumbo phage ΦKZfor their essentiality or importance and their effect on the phage and hosttranscriptomes upon infection. The CFU / PFU-based readout allowed us to sample effects arising from lack of phage progeny, replication time delays, and effects on the next round of infection. Our screen revealed that nearly one third of the targeted genes have strong effects on phage replication. These data represent rich resources of interesting phage genes for further in-depth study and a source for effective ASO targets, e.g. for the targeting of phages in productions. Our non-genetic approach is versatile and applicable to diverse phages and hosts. Coupled to phenotypic readouts such as microscopy and global transcriptome analysis, it allows functional studies of phage biology. Through this approach, we identified the RNase HI-domain containing120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschungprotein ΦKZ155 as an essential factor linked to genome amplification and a noveltarget for ASO-based knockdown of phage replication.

[0142] ASOs can be used in versatile ways to study the phage-host conflict. Forexample, knockdown of anti-phage defence systems, shown here for JukAB (Fig.2b). Of note, the effectors of anti-phage defence systems can be activated also by a cellular response that can be also a general stress response and is dependent on the strain’s physiological state and stress tolerance. ASO-based knockdowns allow the study of defense responses in the native host that can be extended to screens of strain libraries that are often genetically intractable. This is particularly important in clinical isolatesthat are genetically not tractable (Figs. 2a, 10). Directing ASO-based knockdownsagainst the host is also relevant in the context of phage therapy. For example, knockdown of anti-phage defence systems can be used to render pathogens susceptible to phages (Fig. 2b) or to promote phage replication (Fig. 2i) by co- application of ASOs and phage cocktails, e.g. in wound infections. Alternatively, reducing the expression levels of anti-phage defence systems in clinical isolates through ASO treatment might allow initial infection by model phages, which could then evolve through escaper mutations into novel therapeutic phages. Similarly, ASOs could be used to optimise production strains for therapeutic phages. Of note, weobserved that some ASOs cause prophage induction (Fig. 2h), which could be usedas a route to target self-lysis of pathogens in therapy. On the other hand, ASO-based knockdown of phage genes can also be used to render phages compatible with otherphages in phage cocktails. For example, ASOs could be used in phage co-infectionassays to identify phage factors that are involved in inter-phage warfare (Birkholz et al. 2024b), potentially leading to novel phage combinations in phage therapy with ASOs that could be also used to adjusted phage cocktail therapy throughout the treatment.

[0143] ASOs could be used as a virucide for sterilisation through inhibition ofwell-characterised essential phage transcripts, e.g. the phage polymerase and capsid. This was shown here for the jumbo phages ΦKZ that forms a phage nucleus and PA5Oct that does not form a phage nucleus (Fig.6d), for the RNA phage PP7 (Fig.2d), and for the E. coli phage LambdaVir (Fig. 2g) that shows applicability of ASOs inphylogenetically distant species. In addition, our screen revealed six otheruncharacterised targets (Fig. 3, 4c) that lend itself for targeting of nucleus-formingphages by ASOs. Importantly, ASO-based knockdown does not require genetic120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung engineering of cells. Therefore, this approach does not require permissions to work with genetically modified organisms (GMO). It represents a non-genetic approach that is applicable to diverse phages and hosts and may accelerate phage research and therapy.

[0144] The ASO-mediated gene silencing reported in this study is expected tobe of broad use in phage biology because it greatly enhances our ability to assess gene functions in phage-host interactions. While applied here mainly to identify keygenes of the P. aeruginosa phage ΦKZ, we also show that the general strategy isreadily adaptable to other phages and hosts, including ones that are genetically intractable. As demonstrated here, ASOs can be used to study many aspects of phage- host interactions, beyond scoring the essentiality of single genes. We show successful silencing of genes in RNA and DNA phages (including a nucleus-forming jumbo phage), suppression of a host-encoded phage defence system, applicability to clinical isolates, and scalability to enable systematic screens for essential genes of a phage of interest. We have also shown that the coupling of ASO-mediated gene silencing to sensitive readouts such as RNA-seq greatly extends the information output from suchscreens. Our sampling of a fifth of the genes of the model jumbo phage ΦKZ clearlydemonstrates that many genes that lack predictable physiological or molecular functions produce macroscopic or molecular phenotypes when silenced. Given thatour screen was performed in one growth condition and a single host, we are likelyunderestimating the proportion of functional genes.

[0145] It is also important to bear in mind that the ASOs used here weredesigned to translationally silence mRNAs, with the goal to suppress protein synthesis. However, there is a growing appreciation of noncoding RNA functions in phage-host interactions (Altuvia et al.2018, Sprenger et al.2024), and the ASO approach used here should be easily applicable to inhibiting phage-related regulatory small RNAs. Likewise, ASOs could be important for exploring the expanding class of minimal RNA replicators such as viroids and viroid-like covalently closed circular (ccc) RNAs, some of which are predicted to replicate in environmental bacteria (Lee et al.2023, Zheludev et al.2024). Further, we foresee applications in phage therapy, e.g., in the optimisationof production strains or phage cocktails, or in industrial settings, e.g., preventing startercultures from detrimental phage infections. Such applications should greatly benefit120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung from a main distinguishing feature of ASO-based knockdowns, which is that they obviate the need for generating a genetically modified organism (GMO) in the process.

[0146] Our screening data represent rich resources of interesting phage genesfor further in-depth study and a source for effective ASO targets in the family of nucleus-forming jumbo phages. Our follow-up analysis of ΦKZ155 revealed a conserved and essential phage-encoded RNase H-like protein and suggests that it functions in the temporal coordination of phage nucleus maturation and genome amplification. This would suggest that ΦKZ155 localized within the phage nucleus,where the phage genome is amplified. Indeed, ΦKZ155 (now also referred to as Nlp2)was recently used to study PicA (Imp1)-mediated import into the phage nucleus (Kokontis et al. 2025). Using an ectopically expressed GFP-tagged variant, we confirmed the predicted nuclear localization of ΦKZ155. We also observed that it forms a single punctum at the nucleus’ periphery (Fig.14e), similar to the recently reported localization of PicA (Imp1) and supporting the proposed stable interaction between both proteins (Morgan et al.2024, Kokontis et al.2025).

[0147] Future studies should focus on how ΦKZ155 serves an essential functionin licensing phage genome amplification at this stage of the infection cycle. RNase HI domains as the one borne by ΦKZ155 typically recognize RNA-DNA heteroduplexes, cleaving the RNA strand (Moelling et al.2017). Although the molecular mechanisms underlying phage genome replication are largely unknown, it has been suggested thatphage-related DNA-RNA duplexes are resolved by either phage- or host-encodedRNase H (Hobbs & Nossal 1996). Indeed, phage T4 carries an RNase HI gene that becomes essential upon targeted inactivation of the host RNase HI (Hollingsworth & Nossal 1991, Hobbs & Nossal 1996, Mueser et al.2010). On the one hand, we have been able to confirm the predicted intrinsic RNase HI-like activity of ΦKZ155 using invitro translated (IVT) protein (Fig. 14b). On the other hand, a catalytic centre mutantprotein (ΦKZ155D102N) with no in vitro RNase H activity still restored plaque efficiencyand nucleus formation in vivo (Fig. 14c,d), arguing that the cleavage of DNA-RNAduplexes is dispensable for ΦKZ155’s essential function. Intriguingly, the RNase HI fold is conserved in known ΦKZ155 homologs, which strongly suggests a nucleic acid- related function. However, it is possible that instead of acting as a ribonuclease, the N- terminal RNase HI domain serves a sensory function in phage genome replication. It will also be important to assess how this part of the protein interacts with or even120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung supports the C-terminal import domain of ΦKZ155 and identify molecular interaction partners of this protein to understand the temporal and spatial control of this crucial step in the phage replication cycle. The transient state shortly after the phage genome is translocated from the EPI vesicle into the phage nucleus is poorly understood molecularly and structurally in ΦKZ but now addressable by arresting this state with ASOs against ΦKZ155. Our ASO technology in combination with plasmid complementation (Fig.5d, Fig.14c,d) can be used to dissect functions and residues of phage proteins, circumventing the need to engineer phage mutants, a process that is not trivial and impossible for essential genes.

[0148] It is intriguing to note that ΦKZ encodes at least ten nucleases (2.5% ofall annotated genes). Their targets and catalytic mechanisms remain largely unknown, except for ΦKZ179, whose homolog in phage ΦPA3 has just been shown to help ΦPA3attack the ΦKZ genome when both phages infect the same Pseudomonas cell(Birkholz et al. 2024). In agreement with a specialised role in inter-phage warfare, knockdown of the ΦKZ179 nuclease did not show a phenotype in our assay where ΦKZ was the only phage present (Fig.3). However, our screen did identify at least one additional candidate, ΦKZ072, which encodes a predicted HNH nuclease, with a strong knockdown phenotype in the range of ChmA or ΦKZ155 (Fig. 3). Interestingly, ΦKZ072 is expressed early and it does not require phage nucleus formation for its expression, as evidenced by the fact that its expression is not inhibited by chmA knockdown. This suggests a role for ΦKZ072 in early host take-over. Other candidates with milder phenotypes under our assay conditions were ΦKZ056, ΦKZ165 and ΦKZ199. With the ability to inhibit their expression now in hand, it will be interesting to unravel how these essential and non-essential nucleases act at different stages in the finely orchestrated phage replication cycle.

[0149] While our study demonstrates that ASO-based gene silencing is abroadly applicable tool for studying phage biology, the technology also has limitations. The approach relies on efficient delivery of the ASO into the bacterial cytosol. CPPs such as (KFF)3K and (RXR)4XB are commonly used carriers and generally effective in many different bacterial species. However, their efficacy is influenced by bacterial outer membrane composition (Ebbensgaard et al.2018) and may be limited by toxicity at higher doses. Alternative carriers including siderophores and nanoparticles are currently being developed (Vogel et al.2025). ASOs are designed to block translation120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung but they can also trigger mRNA degradation (Popella et al., 2021, 2022). Although we did not observe reduced ΦKZ transcript levels, such potential effects should be kept in mind when targeting polycistronic mRNAs in other species. In designing effective ASOs, attention should be paid to challenges from incomplete genome annotation, such as ORF misannotations and the presence of introns in phage coding sequences. Since ASOs typically cause knockdowns rather than complete knockouts and cannot target virion-packaged proteins, such as vRNAP, during the initial infection, the phenotypes may be mild. Nonetheless, with careful consideration of these factors when selecting the phage-host system, ASOs will be a powerful tool. Methods

[0150] ASOs. ASOs were designed against RBS and AUG regions using theMASON algorithm (Jung et al. 2023, https: / / mason.helmholtz-hiri.de) and the NCBI sequence and annotation files (ΦKZ: NC_004629.1, PP7: NC_001628.1, PA14: CP000438.1, λvir: NC_001416.1, PA5Oct: NC_071039.1, RAY: NC_041973.1, SPO1:NC_011421.1). ASO length was set to 10-mers for E. coli. and 11-mers for P.aeruginosa. and the allowed mismatches for off-targets were set to 4. ASOs wereselected based on the following scoring values: melting temperature (45-55°C), low purine percentage (25-35%) and few predicted off-targets in distinct translation initiation regions of the phage (<3). At least two ASOs were designed for each targeted gene. The control ASO-sequence was GACATAATTGT (ctrl.). ASOs were commercially ordered at Peps 4LS (Heidelberg) with a peptide-backbone (PNA) and a5´-RXR (RXRRXRRXRRXRXB) CPP for P. aeruginosa and 5´-(KFF)3K(KFFKFFKFFK) for E.coli. The initial concentration was adjusted to 1 mM in water based on the specific extinction coefficient using absorption. ASOs were stored at -20 °C. Prior usage, ASOs were thawed at room temperature, then heated for 5 min at 50 °C and then cooled down at room-temperature.

[0151] CFU / PFU assay. PAO1 (JVS-11761, DSMZ: DSM22644), PaLo44 (R.Lavigne lab, KU Leuven, Belgium), PA14 (R. Lavigne lab, KU Leuven, Belgium) were grown in LB media overnight at 37 °C and 220 rpm. Cells were inoculated 1:100 and grown in MH media at 37 °C and 220 rpm to an OD of 0.3. ASOs were added at 6 µM final concentration to 50 µl cultures and incubated for 30 min. Cells were infected with ΦKZ at an MOI 0.0001 and the cells were incubated for 3 h.5 µl of cell culture were120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung diluted in series and spotted on LB plates and on 0.5% LB soft agar plates with the susceptible strain PAO1 (one volume of 0.5% LB soft agar at 42 °C, was mixed with 0.01 volume cells at OD 0.5, and poured into a plate). Plates were imaged with theTyphoon 7000 phosphor imager (GE Healthcare) in fluorescence mode.

[0152] For jukA silencing in PA14, the cells were inoculated 1:100 in MH mediaafter 30 min cells were pre-treated with 6 µM ASOs. The cells were infected after 150min pre-incubation time with ΦKZ at an MOI=0.0001 and incubated further for 180 minfollowed by CFU / PFU determination.

[0153] For PP7 infection, PAO1 cells were inoculated 1:100 in MH media andtreated at OD 0.3 with 0.05 µM final concentration ASOs, additionally every 30 min 0.05 µM final concentration ASOs were added. Cells were infected 30 min after startingtreatment with PP7 at an MOI of 0.00001, and cells were harvested for CFU / PFUanalysis after 120 min.

[0154] For RAY phage, Pantoea agglomerans cells were grown o / n in LB andwere then inoculated 1:100 in MH media and grown at 37 °C, at OD 0.3, cells were pretreated with 6 µM RXR-ASOs for 30 min. Cells were infected with phage at an MOI=0.0001, followed by incubation for 300 min and spotting.

[0155] For SPO1 phage, B. subtilis 168 was grown o / n in LB media and werethen inoculated 1:100 in MH media, and grown at 37 °C, at OD 0.3, cells were pretreated with 6 µM KFF-ASOs for 30 min. Cells were infected with phage at an MOI=0.0001, followed by incubation for 180 min and spotting.

[0156] Immunoblotting. Infected cell cultures were mixed with final 1× SDS-PAGE loading dye (60 mM Tris / HCl pH 6.8, 0.2 g / ml sodium dodecyl sulphate (SDS), 0.1 mg / ml bromophenol blue, 77 mg / ml DTT, 10% (v / v) glycerol) and were boiled for 10 min at 95 °C for denaturation. Protein samples were analysed by SDS-PAGE and blotted onto methanol-preactivated polyvinylidene (PVDF) membranes. As a loading control, we used Coomassie staining of a second gel where we loaded the same sample volume. ChmA was produced as previously described (Laughlin et al.2022) inE. coli BL21-CodonPlus (DE3)-RIL cells (Agilent Technologies, JVS-12280,chloramphenicol resistance) that were transformed with pET-M14(+) plasmid carryingthe chmA gene with a N-terminal His-V5-TEV-tag (pMiG118). As previously describedChmA was purified (Laughlin et al. 2022). The tag could not be removed in the purification procedure. Commercial antibody sera were generated at Eurogentec.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung Rabbits were immunised with the purified ChmA protein. The rabbit serum (no.2481) was used together with anti-rabbit-HRP antibody (Thermo Scientific, 31460) in a1:10,000 dilution in 5% BSA / TBST for ChmA detection in immunoblotting. Antibodyspecificity was validated in immunoblotting by comparison between ΦKZ-infected and non-infected cells that yielded a defined band at 70 kDa corresponding for ChmA only in infected cells (Fig.1b). Of note, crossreactivity was observed for the host proteome that could be depleted upon repeated use of the antibody.

[0157] Microscopy.0.85% (w / v) agarose was dissolved in 5-fold water dilutedLB media and boiled to melt. The liquid agarose was poured on microscope slides with one slide pair at each side as a spacer and one slide on top to form a closed gel sliceas described in (Skinner et al. 2013). After solidification ~1×1 cm pads were cut. Cellswere grown in MH media at 220 rpm and 37 °C to an OD600 ~0.3, then preincubated with 8 µM ASOs for 30 min, and infected with ΦKZ or ΦPA3 at an MOI of 10. At indicated time points the phage replication cycle was quenched by cooling the cells onice for 10 min and the cells were pelleted at 8k×g for 5 min. The supernatant wasremoved and the cells were resuspended in 500 µl 4% paraformaldehyde and incubated for 15 min on ice. Afterwards cells were washed with PBS and were resuspended in 50 µl PBS for storage at 4 °C. For the imaging of the ΦKZ155 knockdown, we crosslinked bacteria in the media with 2% glutaraldehyde for 30 min on ice, followed by the addition of 5% formaldehyde for 30 min on ice, as previously described (Alpers et al. 2023). Cells were stained with 16 µM FM4-64, and 360 nM DAPI and 5 µl were layered onto 1.2% agarose pads. The pad was placed with the side of application downwards into a µ-Slide 8 Well high Grid-500. Transmission and fluorescence were detected with a confocal laser scanning microscope Leica SP5. Images were processed with ImageJ (1.53)

[0158] For the imaging of ΦKZ155-GFP, PAO1 cells were transformed with aplasmid (pLBu005) coding for ΦKZ155-GFP under the control of an arabinose- inducible pBAD promoter and selected on gentamycin plates. The cells (JVS-13713) were grown to an OD 0.25 and induced with arabinose at indicated concentrationsfollowed by phage infection with an MOI of 10 at OD 0.3. The harvesting, crosslinkingand imaging of cells was conducted as described previously for wt cells.

[0159] Proteomics. PAO1 cells were grown o / n in LB media and were theninoculated 1:100 in MH media and grown at 37 °C and 220 rpm for 150 min to OD 0.3.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung Cells were pretreated for 30 min with 6 µM ASOs against chmA, nvRNAP transcript (ΦKZ055), and picA. Subsequently, cells were infected with ΦKZ at an MOI=5. At 2.5, 5.0, 7.5, and 10.0 min p.i. cells were harvested with addition of 1 / 3 volume 4× Boltsodium dodecyl sulphate (SDS) sample buffer (Invitrogen) and were immediatelyboiled at 95 °C for 5 min. MS sample preparation and measurement was conducted at the Proteomics Core Facility EMBL Heidelberg as previously described (Gerovac et al. 2024). Proteins were quantified using the label free quantification (LFQ).

[0160] RNA preparation and sequencing. PAO1 was grown o / n in LB at 37 °C220 rpm. Cells were inoculated 1:100 in MH media at 37 °C and grown until OD6000.3.6 µM ASO (JVpna-79 for control or -72 for chmA inhibition) were added to 1.6 ml ofcell culture and incubated for 30 min at 37 °C, 220 rpm. Cells were infected with ΦKZat an MOI of 5. At indicated time points, 250 µl were removed and put on ice. Infection efficiency was independently validated by confocal microscopy and CFU spotting with50 µl of cells. RNA was isolated from 200 µl of cells using the RNAsnap procedure(Stead et al.2012). Two volumes of RNAprotect (Qiagen) were added and cells were incubated for 5 min. Cells were pelleted at full-speed for 20 min at 4 °C and the supernatant was removed. The pellet was resuspended in 100 µl SNAP buffer (0.025% SDS, 18 mM EDTA, 1% β-mercaptoethanol, 95% formamide (RNA-grade)). Samples were incubated for 7 min at 95 °C, cell debris was pelleted at full-speed for 5 min atroom-temperature, and the supernatant was transferred to a new tube. 1.5 volumes ofethanol were added to the supernatant and the sample was mixed by pipetting. Thesample was loaded onto a miRNeasy mini column (Qiagen) two times and spun at full- speed for 20 s at room-temperature. Columns were washed two times with 500 µl RPEbuffer (Qiagen) and spun at 8k×g for one minute at room-temperature. One final spinwas used to dry the column in an empty tube.30 µl RNase-free water was added tothe column and the RNA eluted at 8k×g for one minute at room-temperature. Theelution was repeated with the flow-through to recover more RNA. The RNA concentration was determined by absorption at 260 nm. RNA was stored at -80 °C.

[0161] RNA-sequencing was performed at the CoreUnit SysMed at theUniversity of Würzburg. DNA was digested with DNaseI and the rRNA was depleted with the Lexogen RiboCOP META depletion kit. RNA library was prepared with the CORALL Total RNA-Seq Library Prep Kit V1 (Lexogen). The library was sequenced on the NextSeq2000 (Illumina) with a P1-seq kit (single-end 1x100 bp, Illumina). RNA-120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung seq analysis for the ChmA knockdown and the screen was conducted withREADemption 0.4.3 and 2.0.4 (Förstner et al.2014), respectively. Reads were alignedfor PAO1 and ΦKZ to NC_002516 and NC_004629, respectively. Enrichment of transcripts was calculated with the DeSeq module in READemption. Read-coverage was illustrated with the Integrated Genomics Viewer (IGV, Robinson et al.2011).

[0162] We defined early and intermediate phage transcripts based on theirsignificant enrichment (log2fold >2 or log2fold <-2, -log10padj >10) between the control35- and 10-min samples (similar as in Ceyssens et al. 2014).

[0163] Structure prediction. Structures were predicted from protein sequencesusing Google AlphaFold3 server (Abramson et al. 2024, alphafoldserver.com). This information is subject to AlphaFold Server Output Terms of Use found atalphafoldserver.com / output-terms (Google LLC). Ongoing use is subject to AlphaFoldServer Output Terms of Use and of any modifications made.

[0164] Complementation assay. PAO1 cells were transformed withpLBu019_ΦKZ155-TEV-3xFLAG and pLBu021_ΦKZ155CDN-TEV-3xFLAG and selected with gentamycin. Cells were grown o / n in LB media with gentamycin. For the assay, no gentamycin was used in the media. Cells were inoculated 1:100 in MH media. Cells were treated with 6 µM ASOs against control or ΦKZ155 for 30 min. For spotting, cells were infected with ΦKZ at an MOI=0.0001, the complementation gene was induced with 0.2% arabinose, and cells were spotted after 180 min p.i.. For imaging, cells were infected with ΦKZ at an MOI=10, the complementation gene was induced with 0.2% arabinose, and cells were chemically crosslinked 35 min p.i. and stained with FM4-64 and DAPI as previously described and imaged.

[0165] In vitro translation. Template DNA was produced via PCR and Taq-polymerase followed by gel purification. JVO-23244 and -5 were used to amplify wtΦKZ155 with a T7 promoter from ΦKZ lysate, and for ΦKZ155D102N. Plasmid pLBu021(JVS-) was used as template. The template DNA was amplified with JVO-23244 / -5 primers adding T7 promoter to the amplified fragment. 250 ng template DNA wassupplemented in 10 µl PURExpress in vitro protein synthesis kit mix (NEB). Thereaction mix was incubated for 2 h at 30 °C and was subsequently used for assays.

[0166] Cleavage assays. RNA, DNA templates (JVRNA-001,AUAUAAGGGAACAUAGAUAAACCCCUCCCUAAUAAAAUG; SEQ ID NO:4, JVO- 23272, ATATAAGGGAACATAGATAAACCCCTCCCTAATAAAATG; SEQ ID NO:5)120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung were 5´-32P-labeled, mixed in 1:2 ratio together with the reverse complement DNA (JVO-23273, CATTTTATTAGGGAGGGGTTTATCTATGTTCCCTTATAT; SEQ ID NO:6), boiled and slowly cooled down to room temperature in a water bath to anneal the duplexes.1 pmol were added to 2 µl PURExpress IVT mix that translated for 2 h a control, ΦKZ155, ΦKZ155D102N, or other nucleases as indicated. The mix was incubated for 1 h, mixed with one volume GLII buffer, boiled for 5 min, rapidly cooled down on ice, and loaded onto 6% 6 M Urea-PAGE (19:1) gels that were run at 300 V for 2 h. The gel was transferred onto Whatman filter paper, vacuum dried, and a phosphor image screen was used to read out the autoradiogram on a Typhoon FLA7000 imager (GE). As a positive control, we used a commercially available RNase H (NEB, M0297S).

[0167] Southern-dot-blotting. PAO1 cells were grown to OD 0.3 in MH mediaand were pretreated with 6 µM ASOs against ΦKZ nucleases for 30 min. Cells were infected at an MOI of 10 with ΦKZ. At indicated time points a fraction of the culture was removed and 1% SDS was added followed by boiling at 95 °C for 5 min. Subsequently the DNA was extracted from the sample with PCI, and subsequently with one volume chloroform. The aqueous phase was supplemented with 1.5 volume 1 M NaOH and 15 mM EDTA (pH 9). The sample was heated for 3 min at 95 °C and put on ice for 5 min. The solution was filtered with a dot blot apparatus through an equilibrated (0.3 M NaOH) and positively charged nylon membrane. Subsequently, the membrane wasdried and the DNA crosslinked via exposition to UV light for 5 min. The membrane wasequilibrated with hybridization solution for two times, and a radiolabeled oligo was added for hybridization o / n starting at 60 °C for 1 h and then 48 °C overnight. The membrane was washed once for 15 min with 2×SSC, and 0.5×SSC, and a screen wasused for phosphor imaging on a Typhoon FLA7000 imager (GE).

[0168] Data availability. Raw sequencing data and coverage files areaccessible at Gene Expression Omnibus (Barrett et al., 2012) for ChmA knockdownand the screen experiments with the accession numbers GSE269401 andGSE269911, respectively. Proteomics data were deposited at PRIDE with the identifierPXD062538. Source data are provided with this paper; gel source data are availablein Figures 6 and 7. References120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung Abramson, J., Adler, J., Dunger, J., Evans, R., Green, T., Pritzel, A., Ronneberger, O., Willmore, L., Ballard, A. J., Bambrick, J., Bodenstein, S. W., Evans, D. A., Hung, C.-C., O’Neill, M., Reiman, D., Tunyasuvunakool, K., Wu, Z., Žemgulytė, A., Arvaniti, E., … Jumper, J. M. (2024). Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature, doi: 10.1038 / s41586-024-07487-w. Adler, B.A., Al-Shimary, M.J., Patel, J.R., Armbruster, E.G., Colognori, D., Charles, E.J., Miller, K.V., Lahiri, A., Cui, M.L., Oromí-Bosch, A., … Doudna, J.A., Cress, B.F. (2025). CRISPRi-ART enables functional genomics of diverse bacteriophages using RNA-binding dCas13d. Nature Microbiology, in press, doi: 10.1038 / s41564-025- 01935-7. Altuvia, S., Storz, G., & Papenfort, K. (2018). Cross-regulation between bacteria and phages at a posttranscriptional level. Microbiology Spectrum, 6(4), doi: 10.1128 / microbiolspec.RWR-0027-2018. Alpers, K., Vatareck, E., Gröbe, L., Müsken, M., Scharfe, M., Häussler, S., Tomasch,J. (2023) Transcriptome dynamics of Pseudomonas aeruginosa during transition fromoverlapping to non-overlapping cell cycles. mSystems, 8(2), doi: 10.1128 / msystems.01130-22. Antonova, D., Belousova, V.V., Zhivkoplias, E., Sobinina, M., Artamonova, T., Vishnyakov, I.E., Kurdyumova, I., Arseniev, A., Morozova, N., Severinov, K., Khodorkovskii, M., Yakunina, M.V. (2023). The Dynamics of Synthesis and Localization of Jumbo Phage RNA Polymerases inside Infected Cells. Viruses 15, doi: 10.3390 / v15102096. Antonova, D., Nichiporenko, A., Sobinina, M., Wang, Y., Vishnyakov, I.E., Moiseenko, A., Kurdyumova, I., Chesnokov, Y.M., Stepanchikova, E., Bourkaltseva, M., et al. (2024). Genomic transfer via membrane vesicle: a strategy of giant phage phiKZ for early infection. J. Virol.98, e0020524. https: / / doi.org / 10.1128 / jvi.00205-24. Armbruster, E.G., Rani, P., Lee, J., Klusch, N., Hutchings, J., Hoffman, L.Y., Buschkaemper, H., Enustun, E., Adler, B.A., Inlow, K., VanderWal, A. R., Hoffman, M.Y., Daksh, D., Aindow, A., Deep, A., Rodriguez, Z.K., Morgan, C.J., Ghassemian,M., Laughlin, T.G., Charles, E., Cress, B.F., Savage, D.F., Doudna, J.A., Pogliano,K., Corbett, K.D., Villa, E., Pogliano, J. (2025). Sequential membrane- and protein-bound organelles compartmentalize genomes during phage infection. Cell Host &Microbe, in press, doi: 10.1016 / j.chom.2025.03.005.Barrett, T., Wilhite, S. E., Ledoux, P., Evangelista, C., Kim, I. F., Tomashevsky, M., Marshall, K. A., Phillippy, K. H., Sherman, P. M., Holko, M., Yefanov, A., Lee, H., Zhang, N., Robertson, C. L., Serova, N., Davis, S., & Soboleva, A. (2013). NCBI GEO: archive for functional genomics data sets-update. Nucleic Acids Research, 41(Database issue), D991–D995, doi: 10.1093 / nar / gks1193.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung Bernheim, A., & Sorek, R. (2020). The pan-immune system of bacteria: antiviral defence as a community resource. Nature Reviews. Microbiology, 18(2), 113–119. doi: 10.1038 / s41579-019-0278-2. Birkholz, E. A., Morgan, C. J., Laughlin, T. G., Lau, R. K., Prichard, A., Rangarajan, S., Meza, G. N., Lee, J., Armbruster, E., Suslov, S., Pogliano, K., Meyer, J. R., Villa, E., Corbett, K. D., & Pogliano, J. (2024). An intron endonuclease facilitates interference competition between coinfecting viruses. Science, 385(6704), 105–112, doi: 10.1126 / science.adl1356. Bondy-Denomy, J., Qian, J., Westra, E. R., Buckling, A., Guttman, D. S., Davidson, A. R., & Maxwell, K. L. (2016). Prophages mediate defense against phage infection through diverse mechanisms. The ISME Journal, 10(12), 2854–2866, doi: 10.1038 / ismej.2016.79. Bondy-Denomy, J., Pawluk, A., Maxwell, K. L., & Davidson, A. R. (2013). Bacteriophage genes that inactivate the CRISPR / Cas bacterial immune system. Nature, 493(7432), 429–432, doi: 10.1038 / nature11723. Bondy-Denomy, J., Qian, J., Westra, E.R., Buckling, A., Guttman, D.S., Davidson, A.R., and Maxwell, K.L. (2016). Prophages mediate defense against phage infection through diverse mechanisms. ISME J.10, 2854–2866. Briers, Y., Volckaert, G., Cornelissen, A., Lagaert, S., Michiels, C. W., Hertveldt, K., & Lavigne, R. (2007). Muralytic activity and modular structure of the endolysins ofPseudomonas aeruginosa bacteriophages phiKZ and EL. Molecular Microbiology,65(5), 1334–1344, doi: 10.1111 / j.1365-2958.2007.05870.x. Callanan, J., Stockdale, S. R., Shkoporov, A., Draper, L. A., Ross, R. P., & Hill, C. (2018). RNA phage biology in a metagenomic era. Viruses, 10(7), doi: 10.3390 / v10070386. Camara-Wilpert, S., Mayo-Muñoz, D., Russel, J., Fagerlund, R. D., Madsen, J. S., Fineran, P. C., Sørensen, S. J., & Pinilla-Redondo, R. (2023). Bacteriophages suppress CRISPR–Cas immunity using RNA-based anti-CRISPRs. Nature, 623(7987), 601–607, doi: 10.1038 / s41586-023-06612-5. Ceyssens, P.-J., Minakhin, L., Van den Bossche, A., Yakunina, M., Klimuk, E., Blasdel, B., De Smet, J., Noben, J.-P., Blasi, U., Severinov, K., & Lavigne, R. (2014). Development of giant bacteriophage ΦKZ is independent of the host transcriptionapparatus. Journal of Virology, 88(18), 10501–10510, doi: 10.1128 / jvi.01347-14.Chaikeeratisak, V., Nguyen, K., Khanna, K., Brilot, A.F., Erb, M.L., Coker, J.K.C., Vavilina, A., Newton, G.L., Buschauer, R., Pogliano, K., et al. (2017). Assembly of a nucleus-like structure during viral replication in bacteria. Science 355, 194–197. Chaikeeratisak, V., Nguyen, K., Egan, M. E., Erb, M. L., Vavilina, A., & Pogliano, J. (2017b). The phage nucleus and tubulin spindle are conserved among largePseudomonas phages. Cell Reports, 20(7), 1563–1571,doi: 10.1016 / j.celrep.2017.07.064.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung Chaikeeratisak, V., Khanna, K., Nguyen, K. T., Sugie, J., Egan, M. E., Erb, M. L., Vavilina, A., Nonejuie, P., Nieweglowska, E., Pogliano, K., Agard, D. A., Villa, E., & Pogliano, J. (2019). Viral capsid trafficking along treadmilling tubulin filaments in bacteria. Cell, 177(7), 1771–1780.e12, doi: 10.1016 / j.cell.2019.05.032. Chaikeeratisak, V., Birkholz, E. A., & Pogliano, J. (2021). The phage nucleus and PhuZ spindle: defining features of the subcellular organization and speciation of nucleus-forming jumbo phages. Frontiers in Microbiology, 12, 641317, doi: 10.3389 / fmicb.2021.641317. Chan, B. K., Sistrom, M., Wertz, J. E., Kortright, K. E., Narayan, D., & Turner, P. E. (2016). Phage selection restores antibiotic sensitivity in MDR Pseudomonas aeruginosa. Scientific Reports, 6(1), 26717, doi: 10.1038 / srep26717. Cheng, X., Wang, W., & Molineux, I. J. (2004). F exclusion of bacteriophage T7 occurs at the cell membrane. Virology, 326(2), 340–352, doi: 10.1016 / j.virol.2004.06.001. Cobián Güemes, A. G., Ghatbale, P., Blanc, A. N., Morgan, C. J., Garcia, A., Leonard, J., Huang, L., Kovalick, G., Proost, M., Chiu, M., Kuo, P., Oh, J., Karthikeyan, S., Knight, R., Pogliano, J., Schooley, R. T., & Pride, D. T. (2023). Jumbo phages are active against extensively drug-resistant eyedrop-associatedPseudomonas aeruginosa infections. Antimicrobial Agents and Chemotherapy,67(12), e0065423, doi: 10.1128 / aac.00654-23. Danilova, Y. A., Belousova, V. V., Moiseenko, A. V., Vishnyakov, I. E., Yakunina, M. V., & Sokolova, O. S. (2020). Maturation of pseudo-nucleus compartment in P. aeruginosa, infected with giant phiKZ phage. Viruses, 12(10), doi: 10.3390 / v12101197. De Smet, J., Hendrix, H., Blasdel, B. G., Danis-Wlodarczyk, K., & Lavigne, R. (2017).Pseudomonas predators: understanding and exploiting phage-host interactions.Nature Reviews Microbiology, 15(9), 517–530, doi: 10.1038 / nrmicro.2017.61. Dhuri, K., Bechtold, C., Quijano, E., Pham, H., Gupta, A., Vikram, A., & Bahal, R. (2020). Antisense oligonucleotides: An emerging area in drug discovery and development. Journal of Clinical Medicine Research, 9(6), doi: 10.3390 / jcm9062004 Ebbensgaard, A., Mordhorst, H., Aarestrup, F.M., Hansen, E.B. (2018) The role of outer membrane proteins and lipopolysaccharides for the sensitivity of Escherichiacoli to antimicrobial peptides. Frontiers in Microbiology, doi:10.3389 / fmicb.2018.02153. El-Fateh, M., Chatterjee, A., & Zhao, X. (2024). A systematic review of peptide nucleic acids (PNAs) with antibacterial activities: Efficacy, potential and challenges. International Journal of Antimicrobial Agents, 63(3), 107083, doi: 10.1016 / j.ijantimicag.2024.107083.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung Erb, M. L., Kraemer, J. A., Coker, J. K. C., Chaikeeratisak, V., Nonejuie, P., Agard, D. A., & Pogliano, J. (2014). A bacteriophage tubulin harnesses dynamic instability to center DNA in infected cells. eLife, 3(3), e03197, doi: 10.7554 / eLife.03197. Förstner, K. U., Vogel, J., & Sharma, C. M. (2014). READemption—a tool for the computational analysis of deep-sequencing–based transcriptome data. Bioinformatics , 30(23), 3421–3423, doi: 10.1093 / bioinformatics / btu533.Gagat, M., Zielińska, W., & Alina Grzanka (2017). A. Cell-penetrating peptides andtheir utility in genome function modifications (Review). Int J Mol Med. 40(6), 1615–1623, doi: 10.3892 / ijmm.2017.3172Gavric, D., & Knezevic, P. (2022). Filamentous Pseudomonas phage Pf4 in thecontext of therapy-inducibility, infectivity, lysogenic conversion, and potential application. Viruses, 14(6), doi: 10.3390 / v14061261. Gerovac, M., Chihara, K., Wicke, L., Böttcher, B., Lavigne, R., & Vogel, J. (2024). Phage proteins target and co-opt host ribosomes immediately upon infection. Nature Microbiology, 9(3), 787–800, doi: 10.1038 / s41564-024-01616-x. Ghosal, A, Nielsen, P.E. (2012) Potent antibacterial antisense peptide-peptide nucleic acid conjugates against Pseudomonas aeruginosa. Nucleic Acid Therapeutics, 22(5), doi: 10.1089 / nat.2012.0370.Ghosh, G., Popella, L., Dhamodharan, V., Jung, J., Dietzsch, J., Barquist, L.,Höbartner, C., & Vogel, J. (2024) A comparative analysis of peptide-deliveredantisense antibiotics using diverse nucleotide mimics. RNA. 30(6): 624–643 doi:10.1261 / rna.079969.124. Guan, J., Oromí-Bosch, A., Mendoza, S. D., Karambelkar, S., Berry, J. D., & Bondy- Denomy, J. (2022). Bacteriophage genome engineering with CRISPR-Cas13a. Nature Microbiology, 7(12), 1956–1966, doi: 10.1038 / s41564-022-01243-4. Hobbs, L. J., & Nossal, N. G. (1996). Either bacteriophage T4 RNase H orEscherichia coli DNA polymerase I is essential for phage replication. Journal ofBacteriology, 178(23), 6772–6777, doi: 10.1128 / jb.178.23.6772-6777.1996. Hollingsworth, H. C., & Nossal, N. G. (1991). Bacteriophage T4 encodes an RNase H which removes RNA primers made by the T4 DNA replication system in vitro. The Journal of Biological Chemistry, 266(3), 1888–1897. https: / / www.ncbi.nlm.nih.gov / pubmed / 1703156. Hör, J., Jung, J., Ðurica-Mitić, S., Barquist, L., and Vogel, J. (2022). INRI-seq enables global cell-free analysis of translation initiation and off-target effects of antisense inhibitors. Nucleic Acids Research, 50(22), e128, doi: 10.1093 / nar / gkac838. Hör, J. (2025) Advancing RNA phage biology through meta-omics, Nucleic Acids Research, 53(8), gkaf314, doi: 10.1093 / nar / gkaf314. Howard, J. J., Sturge, C. R., Moustafa, D. A., Daly, S. M., Marshall-Batty, K. R., Felder, C. F., Zamora, D., Yabe-Gill, M., Labandeira-Rey, M., Bailey, S. M., Wong,120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung M., Goldberg, J. B., Geller, B. L., & Greenberg, D. E. (2017). Inhibition ofPseudomonas aeruginosa by peptide-conjugated phosphorodiamidate morpholinooligomers. Antimicrobial Agents and Chemotherapy, 61(4), doi: 10.1128 / AAC.01938- 16. Itoh, T., & Tomizawa, J. (1980). Formation of an RNA primer for initiation of replication of ColE1 DNA by ribonuclease H. Proceedings of the National Academy of Sciences of the United States of America, 77(5), 2450–2454, doi: 10.1073 / pnas.77.5.2450. Iyer, L. M., Anantharaman, V., Krishnan, A., Burroughs, A. M., & Aravind, L. (2021). Jumbo phages: a comparative genomic overview of core functions and adaptions for biological conflicts. Viruses, 13(1), doi: 10.3390 / v13010063. Jung, J., Popella, L., Do, P. T., Pfau, P., Vogel, J., & Barquist, L. (2023). Design and off-target prediction for antisense oligomers targeting bacterial mRNAs with the MASON web server. RNA , 29(5), 570–583, doi: 10.1261 / rna.079263.122. Katz MA, Sawyer EM, Oriolt L, Kozlova A, Williams MC, Margolis SR, Johnson M, Bondy-Denomy J, Meeske AJ. Diverse viral cas genes antagonize CRISPR immunity. Nature.2024 Oct;634(8034):677-683. doi: 10.1038 / s41586-024-07923-x. Epub 2024 Sep 4. PMID: 39232173; PMCID: PMC11991930. Knezevic, P., Voet, M., & Lavigne, R. (2015). Prevalence of Pf1-like (pro)phagegenetic elements among Pseudomonas aeruginosa isolates. Virology, 483, 64–71,doi: 10.1016 / j.virol.2015.04.008. Kokontis, C., Klein, T.A., Silas, S., and Bondy-Denomy, J. (2025). Multi-interface licensing of protein import into a phage nucleus. Nature, in press, doi: 10.1038 / s41586-024-08547-x. Kole, R., Krainer, A.R., and Altman, S. (2012). RNA therapeutics: beyond RNA interference and antisense oligonucleotides. Nat. Rev. Drug Discov.11, 125–140. Kraemer, J. A., M. L. Erb, C. A. Waddling, E. A. Montabana, E. A. Zehr, H. Wang, K. Nguyen, D. S. L. Pham, D. A. Agard, & J. Pogliano (2012). A phage tubulin assembles dynamic filaments by an atypical mechanism to center viral DNA withinthe host cell. Cell, 149(7), 1488–1499, doi: 10.1016 / j.cell.2012.04.034.Laughlin, T. G., Deep, A., Prichard, A. M., Seitz, C., Gu, Y., Enustun, E., Suslov, S., Khanna, K., Birkholz, E. A., Armbruster, E., McCammon, J. A., Amaro, R. E., Pogliano, J., Corbett, K. D., & Villa, E. (2022). Architecture and self-assembly of the jumbo bacteriophage nuclear shell. Nature, 608(7922), 429–435, doi: 10.1038 / s41586-022-05013-4. Lee, B. D., Neri, U., Roux, S., Wolf, Y. I., Camargo, A. P., Krupovic, M., RNA Virus Discovery Consortium, Simmonds, P., Kyrpides, N., Gophna, U., Dolja, V. V., & Koonin, E. V. (2023). Mining metatranscriptomes reveals a vast world of viroid-like circular RNAs. Cell, 186(3), 646–661.e4, doi: 10.1016 / j.cell.2022.12.039.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung Li Kewei, Xu Chang, Jin Yongxin, Sun Ziyu, Liu Chang, Shi Jing, Chen Gukui, Chen Ronghao, Jin Shouguang, & Wu Weihui. (2013). SuhB is a regulator of multiple virulence genes and essential for pathogenesis of Pseudomonas aeruginosa. mBio, 4(6), 10.1128 / mbio.00419–13, doi: 10.1128 / mbio.00419-13. Mahler, M., Costa, A. R., van Beljouw, S. P. B., Fineran, P. C., & Brouns, S. J. J. (2022). Approaches for bacteriophage genome engineering. Trends in Biotechnology, doi: 10.1016 / j.tibtech.2022.08.008. Malone, L. M., Warring, S. L., Jackson, S. A., Warnecke, C., Gardner, P. P., Gumy, L. F., & Fineran, P. C. (2020). A jumbo phage that forms a nucleus-like structure evades CRISPR-Cas DNA targeting but is vulnerable to type III RNA-based immunity. Nature Microbiology, 5(1), 48–55, doi: 10.1038 / s41564-019-0612-5. Marsh, J. W., Kirk, C., & Ley, R. E. (2023). Toward microbiome engineering: Expanding the repertoire of genetically tractable members of the human gut microbiome. Annual Review of Microbiology, 77, 427–449, doi: 10.1146 / annurev- micro-032421-112304. Mayo-Muñoz, D., Pinilla-Redondo, R., Birkholz, N., & Fineran, P. C. (2023). A host of armor: Prokaryotic immune strategies against mobile genetic elements. Cell Reports, 42(7), 112672, doi: 10.1016 / j.celrep.2023.112672. Mayo-Muñoz, D., Pinilla-Redondo, R., Camara-Wilpert, S., Birkholz, N., & Fineran, P. C. (2024). Inhibitors of bacterial immune systems: discovery, mechanisms and applications. Nature Reviews Genetics, doi: 10.1038 / s41576-023-00676-9. McDonnell, B., Mahony, J., Hanemaaijer, L., Kouwen, T. R. H. M., & van Sinderen, D. (2018). Generation of bacteriophage-insensitive mutants of Streptococcusthermophilus via an antisense RNA CRISPR-Cas silencing approach. Applied andEnvironmental Microbiology, 84(4), doi: 10.1128 / AEM.01733-17. Mendoza, S. D., Nieweglowska, E. S., Govindarajan, S., Leon, L. M., Berry, J. D., Tiwari, A., Chaikeeratisak, V., Pogliano, J., Agard, D. A., & Bondy-Denomy, J. (2020). A bacteriophage nucleus-like compartment shields DNA from CRISPR nucleases. Nature, 577(7789), 244–248, doi: 10.1038 / s41586-019-1786-y. Mesyanzhinov, V. V., Robben, J., Grymonprez, B., Kostyuchenko, V. A., Bourkaltseva, M. V., Sykilinda, N. N., Krylov, V. N., & Volckaert, G. (2002). The genome of bacteriophage φKZ of Pseudomonas aeruginosa. Journal of Molecular Biology, 317(1), 1–19, doi: 10.1006 / jmbi.2001.5396. Moelling, K., Broecker, F., Russo, G., & Sunagawa, S. (2017). RNase H as gene modifier, driver of evolution and antiviral defense. Frontiers in Microbiology, 8, 1745, doi: 10.3389 / fmicb.2017.01745. Morgan, C. J., Enustun, E., Armbruster, E. G., Birkholz, E. A., Prichard, A., Forman, T., Aindow, A., Wannasrichan, W., Peters, S., Inlow, K., Shepherd, I. L., Razavilar, A., Chaikeeratisak, V., Adler, B. A., Cress, B. F., Doudna, J. A., Pogliano, K., Villa, E., Corbett, K. D., & Pogliano, J. (2024). An essential and highly selective protein120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung import pathway encoded by nucleus-forming phage. Proceedings of the National Academy of Sciences of the United States of America, 121(19), e2321190121, doi: 10.1073 / pnas.2321190121. Mozumdar, D., Fossati, A., Stevenson, E., Guan, J., Nieweglowska, E., Rao, S., Agard, D., Swaney, D. L., & Bondy-Denomy, J. (2024). Characterization of a lipid- based jumbo phage compartment as a hub for early phage infection. Cell Host & Microbe, 32(7), 1050–1058.e7. doi: 10.1016 / j.chom.2024.05.016. Mueser, T. C., Hinerman, J. M., Devos, J. M., Boyer, R. A., & Williams, K. J. (2010). Structural analysis of bacteriophage T4 DNA replication: a review in the Virology Journal series on bacteriophage T4 and its relatives. Virology Journal, 7, 359, doi: 10.1186 / 1743-422X-7-359. Naknaen, A., Samernate, T., Saeju, P., Nonejuie, P., & Chaikeeratisak, V. (2024). Nucleus-forming jumbophage PhiKZ therapeutically outcompetes non-nucleus- forming jumbophage Callisto. iScience, 27(5), 109790, doi: 10.1016 / j.isci.2024.109790. Neri, U., Wolf, Y. I., Roux, S., Camargo, A. P., Lee, B., Kazlauskas, D., Chen, I. M., Ivanova, N., Zeigler Allen, L., Paez-Espino, D., Bryant, D. A., Bhaya, D., RNA Virus Discovery Consortium, Krupovic, M., Dolja, V. V., Kyrpides, N. C., Koonin, E. V., & Gophna, U. (2022). Expansion of the global RNA virome reveals diverse clades of bacteriophages. Cell, 185(21), 4023–4037.e18, doi: 10.1016 / j.cell.2022.08.023 Nielsen, P. E. (2010). Gene targeting and expression modulation by peptide nucleic acids (PNA). Current Pharmaceutical Design, 16(28), 3118–3123, doi: 10.2174 / 138161210793292546. Nieweglowska, E. S., Brilot, A. F., Méndez-Moran, M., Kokontis, C., Baek, M., Li, J., Cheng, Y., Baker, D., Bondy-Denomy, J., & Agard, D. A. (2023). The ϕPA3 phage nucleus is enclosed by a self-assembling 2D crystalline lattice. Nature Communications, 14(1), 927, doi: 10.1038 / s41467-023-36526-9. Ofir, G., & Sorek, R. (2018). Contemporary Phage Biology: From Classic Models to New Insights. Cell, 172(6), 1260–1270, doi: 10.1016 / j.cell.2017.10.045. Petrova, O. E., Schurr, J. R., Schurr, M. J., & Sauer, K. (2011). The novelPseudomonas aeruginosa two-component regulator BfmR controls bacteriophage-mediated lysis and DNA release during biofilm development through PhdA. Molecular Microbiology, 81(3), 767–783, doi: 10.1111 / j.1365-2958.2011.07733.x. Pifer, R., & Greenberg, D. E. (2020). Antisense antibacterial compounds. Translational Research: The Journal of Laboratory and Clinical Medicine, 223, 89– 106, doi: 10.1016 / j.trsl.2020.06.001. Pires, D. P., Cleto, S., Sillankorva, S., Azeredo, J., & Lu, T. K. (2016). Genetically engineered phages: A review of advances over the last decade. Microbiology and Molecular Biology Reviews: MMBR, 80(3), 523–543, doi: 10.1128 / MMBR.00069-15.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung Piya, D., Nolan, N., Moore, M.L., Ramirez Hernandez, L.A., Cress, B.F., Young, R., Arkin, A.P., and Mutalik, V.K. (2023). Genome-wide CRISPRi knockdown to map gene essentiality landscape in Coliphages λ and P1. bioRxiv, 2023.05.14.540688. 10.1101 / 2023.05.14.540688. Popella, L., Jung, J., Popova, K., Ðurica-Mitić, S., Barquist, L., Vogel, J. (2021) Global RNA profiles show target selectivity and physiological effects of peptide-delivered antisense antibiotics. Nucleic Acids Research, 49(8), 4705-4724, doi: 10.1093 / nar / gkab242. Popella, L., Jung, J., Do, P. T., Hayward, R. J., Barquist, L., & Vogel, J. (2022). Comprehensive analysis of PNA-based antisense antibiotics targeting various essential genes in uropathogenic Escherichia coli. Nucleic Acids Research, 50(11), 6435–6452, doi: 10.1093 / nar / gkac362. Prichard, A., Lee, J., Laughlin, T.G., Lee, A., Thomas, K.P., Sy, A.E., Spencer, T., Asavavimol, A., Cafferata, A., Cameron, M., et al. (2023). Identifying the core genome of the nucleus-forming bacteriophage family and characterization of Erwiniaphage RAY. Cell Reports 42, 112432.Prichard, A., & Pogliano, J. (2024). The intricate organizational strategy of nucleus- forming phages. Current Opinion in Microbiology, 79, 102457, doi: 10.1016 / j.mib.2024.102457. Putzeys, L., Wicke, L., Brandão, A., Boon, M., Pires, D. P., Azeredo, J., Vogel, J., Lavigne, R., & Gerovac, M. (2024). Exploring the transcriptional landscape of phage- host interactions using novel high-throughput approaches. Current Opinion in Microbiology, 77, 102419, doi: 10.1016 / j.mib.2023.102419. Robins, W. P., Faruque, S. M., & Mekalanos, J. J. (2013). Coupling mutagenesis and parallel deep sequencing to probe essential residues in a genome or gene. Proceedings of the National Academy of Sciences of the United States of America, 110(9), E848–E857, doi: 10.1073 / pnas.1222538110. Ren, P., Chen, T., Liu, N., Sun, W., Hu, G., Yu, Y., Yu,B., Ouyang, P., Liu, D., & Chen, Y. (2020) Efficient Biofilm-Based Fermentation Strategies by eDNA Formation for l-Proline Production with Corynebacterium glutamicum. ACS Omega 5 (51), 33314-33322; DOI: 10.1021 / acsomega.0c05095 Robinson, J. T., Thorvaldsdóttir, H., Winckler, W., Guttman, M., Lander, E. S., Getz, G., & Mesirov, J. P. (2011). Integrative genomics viewer. Nature Biotechnology, 29(1), 24–26, doi: 10.1038 / nbt.1754. Skinner, S. O., Sepúlveda, L. A., Xu, H., & Golding, I. (2013). Measuring mRNA copynumber in individual Escherichia coli cells using single-molecule fluorescent in situhybridization. Nature Protocols, 8(6), 1100–1113, doi: 10.1038 / nprot.2013.066. Sprenger, M., Siemers, M., Krautwurst, S., & Papenfort, K. (2024). Small RNAs direct attack and defense mechanisms in a quorum sensing phage and its host. Cell Host & Microbe, 32(5), 727–738.e6, doi: 10.1016 / j.chom.2024.03.010.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung Stead, M. B., Agrawal, A., Bowden, K. E., Nasir, R., Mohanty, B. K., Meagher, R. B., & Kushner, S. R. (2012). RNAsnapTM: a rapid, quantitative and inexpensive, method for isolating total RNA from bacteria. Nucleic Acids Research, 40(20), e156–e156, doi: 10.1093 / nar / gks680. Sturino, J. M., & Klaenhammer, T. R. (2002). Expression of antisense RNA targetedagainst Streptococcus thermophilus bacteriophages. Applied and EnvironmentalMicrobiology, 68(2), 588–596, doi: 10.1128 / AEM.68.2.588-596.2002. Thomas, J.A., Benítez Quintana, A.D., Bosch, M.A., Coll De Peña, A., Aguilera, E., Coulibaly, A., Wu, W., Osier, M.V., Hudson, A.O., Weintraub, S.T., Susan, T., Black, L.W. (2016). Identification of essential genes in the Salmonella phage SPN3US reveals novel insights into giant phage head structure and assembly. Journal ofVirology, 90, 10284–10298, doi: 10.1128 / JVI.01492-16.Vogel, J. (2020). An RNA biology perspective on species-specific programmable RNA antibiotics. Molecular Microbiology, 113(3), 550–559, doi: 10.1111 / mmi.14476. Vogel, J., Faber, F., Barquist, L., Sparmann, A., Popella, L., and Ghosh, C. (2025). ASOBIOTICS 2024: an interdisciplinary symposium on antisense-based programmable RNA antibiotics. RNA 31, 465–474, doi: 10.1261 / rna.080347.124. Vogele, K., Falgenhauer, E., von Schönberg, S., Simmel, F.C., and Pirzer, T. (2021). Small antisense DNA-based gene silencing enables cell-free bacteriophage manipulation and genome replication. ACS Synthetic Biology 10(3), 459–465, doi: 10.1021 / acssynbio.0c00402. Westermann, A. J., Förstner, K. U., Amman, F., Barquist, L., Chao, Y., Schulte, L. N., Müller, L., Reinhardt, R., Stadler, P. F., & Vogel, J. (2016). Dual RNA-seq unveils noncoding RNA functions in host–pathogen interactions. Nature, 529(7587), 496– 501, doi: 10.1038 / nature16547. Yuping, L., Guan, L., Becher, I., Makarova, K.S., Cao, X., Hareendranath, S., Guan, J., Stein, F., Yang, S., Boergel, A., Lapouge, K., Remans, K., Agard, D., Savitski, M., Typas, A., Koonin, E.V., Feng, Y., Bondy-Denomy, J. (2025). Jumbo phage killer immune system targets early infection of nucleus-forming phages. Cell, in press, doi: 10.1016 / j.cell.2025.02.016. Zheludev, I. N., Edgar, R. C., Lopez-Galiano, M. J., de la Peña, M., Babaian, A., Bhatt, A. S., & Fire, A. Z. (2024). Viroid-like colonists of human microbiomes. bioRxiv, doi: 10.1101 / 2024.01.20.576352.

Claims

120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung CLAIMS1. A method for assaying for the relevance of a protein of a phage for thereplication of said phage in a bacterium, comprising the steps of (a) contactingsaid bacterium either before, concomitant with or after infection with said phage, in particular before infection with said phage, with at least one compound CPP-ASOp, wherein CPP is a cell-penetrating peptide and ASOp is an antisenseconstruct that is specifically binding to an mRNA coding for said protein, and (b) evaluating at least one parameter that is a measure for said phage replication.

2. The method according to claim 1, wherein said bacterium is a Gram-negativebacterium, particularly a Gammaproteobacterium, particularly aGammaproteobacterium selected from the Enterobacteriaceae, Vibrionaceae,Erwiniaceae or Pseudomonadaceae family, particularly selected fromEscherichia coli, Pantoea agglomerans and Pseudomonas aeruginosa species.

3. The method according to claim 2, wherein said CPP is selected from the list of(KFF)3K, (RXR)4XB, (RFF)3R, (RXR)4, (RFR)4XB, (RFF)3R(3’), (RX)6B, pip1(D), drosocin, oncocin, TAT, BF2A, BF2A-RXR, drosocin-RXR, (KFF)3K(D),pip1, DAB, DAP, drosocin(D), (P59^W59)-Tat48-60, ANT, P12-(CH2)6, B12-SS, Bac1-15, IsCT-p, K6L2W3, KLW-L9,13-a, NLS-Gb3, Pep-1-K, SA-3, TDN, and TPk, in particular is selected from (KFF)3K and (RXR)4XB, moreparticularly is (RXR)4XB.

4. The method according to claim 2 or 3, wherein said phage is selected from:Chimalliviridae, in particular a Chimallivirus selected from ΦKZ, KTN4, EL,201^2-1, and ΦPA3, or a non-nucleus-forming jumbo phage, in particularPA5Oct, when the bacterium is Pseudomonas aeruginosa, phage RAY, whenthe bacterium is Pantoea agglomerans, or a Goslar Chimallivirus, when thebacterium is Escherichia coli; an enterobacteria phage λ, when the bacterium is Escherichia coli; and a single-stranded RNA phage, in particular a PP7 phage,when the bacterium is Pseudomonas aeruginosa, or a levivirus, when thebacterium is Escherichia coli, in particular a Levivirus selected from MS2 and Qβ.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung5. The method according to claim 1, wherein said bacterium is a Gram-positivebacterium, particularly an actinobacterium or a firmicute, particularly selected from Streptococcus, Staphylococcus and Lactobacillus, particularlyLactobacillus casei, Lactococcus bulgaricus and Streptococcus thermophilus oris selected from Bacillaceae.

6. The method according to claim 5, wherein said CPP is selected from the list of(KFF)3K, TAT (RXR)4XB, (RFR)4XB, ANT, K8, pip1 and pip1(D), in particular is selected from (KFF)3K and (RXR)4XB, more particularly is (KFF)3K.

7. The method according to claim 5 or 6, wherein said phage is selected fromphage PL-1 and phage phi FSW, more particularly is phage PL-1, when saidbacterium is Lactobacillus casei; wherein said phage is selected from cos, pac, 5093, and 987 group Siphoviridae family phages, when said bacterium isStreptococcus thermophilus, or wherein said phage is Bacillus phage SPO1, when said bacterium is Bacillus subtilis.

8. The method according to any one of claims 1 to 7, wherein said ASOp isselected from DNA, RNA, peptide nucleic acids (PNAs), peptide-conjugatedphosphorodiamidate morpholino oligomers (PPMOs), phosphorothioate (PTO)-modified DNA, 2′-methylated RNA (RNA-OMe), 2′-methoxyethylated RNA (RNA-MOE), 2′-fluorinated RNA (RNA-F), 2′–4′-bridged RNA (BNA), and 2′–4′-locked RNA (LNA), in particular is selected PNAs, PPMOs, PTO-modified DNA,RNA-OMe, RNA-MOE, RNA-F, BNA, and LNA, more particularly from PNAsand PPMOs, most particularly is a PNA.

9. The method according to claim 8, wherein said ASOp is a PNA consisting of nnucleotides, wherein n is selected from 9, 10, 11, 12, 13, 14, and 15, inparticular wherein n is selected from 9, 10, 11, 12, and 13, more particularlywherein n is selected from 10, 11, and 12, in particular wherein n is 10 or 11.

10. The method of claim 8 or 9, wherein said ASOp is specific for a region of thegene comprising the start codon and / or the ribosomal binding site.

11. The method according to any one of claims 1 to 10, wherein said at least oneparameter is selected from plaque-forming units, colony-forming units, formation of intracellular structures, early, intermediate and late phage transcripts, transcriptome and proteome signatures.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung12. The method according to claim 11, wherein said phage is a Chimallivirus andwherein said at least one parameter is the formation of an intracellular structure selected from an EPI vesicle and a phage nucleus.

13. The method according to any one of claims 1 to 12, wherein said step (a) isperformed using one or more of the following conditions: culturing of said bacterium in MH medium; culturing said bacterium to a cell density OD600 of0.3; performing a pre-incubation step with said CPP-ASOp of up to 30 min, inparticular, wherein the pre-incubation time does not end more than 5 minutesbefore infection with said phage; using a concentration of said CPP-ASOp of atleast 2 µM, in particular between 2 and 10 µM, more particularly between 4 and 6µM; infecting said bacterium with said phage at a multiplicity of infection (MOI)of 0.0001; using a time of spotting after infection of 210 min; using about 3 replication rounds and nearly full lysis of cells; and using a length of 10 to 11nucleotides for the ASOp.

14. The method according to any one of claim 1 to 13, wherein said protein is aprotein having a putative role selected from a polymerase, a ribonuclease, capsid, endolysin, terminase, import proteins, and phylogenetically conserved proteins.

15. A method for assaying for the relevance of a protein of a bacterium for thereplication of a phage in said bacterium, comprising the steps of (a) contactingsaid bacterium either before, concomitant with or after infection with said phage with at least one compound CPP-ASOb, wherein CPP is a cell-penetratingpeptide and ASObis an antisense construct that is specifically binding to an mRNA coding for said protein, and (b) evaluation at least one parameter that is a measure for said replication.

16. A method for inhibiting the formation of progeny particles of a phage from abacterium infected with said phage, comprising the step of contacting said bacterium with at least one compound CPP-ASOp, wherein CPP is a cell-penetrating peptide and ASOpis an antisense construct that is specifically binding to an mRNA coding for a protein of said phage that is essential or important for phage replication, and / or at least one compound CPP-ASOb, wherein ASObis an antisense construct that is specifically binding to an mRNA120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung coding for a protein of said bacterium that is essential or important for phage replication.

17. A method for preventing the formation of phage progeny particles from abacterium at risk of being infected with said phage, comprising the step of contacting said bacterium with at least one compound CPP-ASOp, wherein CPP is a cell-penetrating peptide and ASOpis an antisense construct that is specifically binding to an mRNA coding for a protein of said phage that is essential or important for phage replication, and / or at least one compound CPP- ASOb, wherein ASOb is an antisense construct that is specifically bindingto an mRNA coding for a protein of said bacterium that is essential or important for phage replication.

18. The method according to claim 17, wherein said bacterium is Pseudomonasaeruginosa, wherein said phage is a Chimallivirus ΦKZ and wherein said protein of said phage is selected from ΦKZ049, picA (ΦKZ069), ΦKZ042,ΦKZ155, ΦKZ056, ΦKZ174, ΦKZ177 and ΦKZ186, in particular wherein saidbacterium is used in a biofilm-based fermentation.

19. A method for promoting the formation of phage progeny particles from abacterium comprising the steps of (a) contacting said bacterium with at least one compound CPP- ASOb, wherein CPP is a cell-penetrating peptide andASObis an antisense construct that is specifically binding to an mRNA coding for a protein essential or important for said bacterium’s defence system directed against replication of said phage in said bacterium; and (b) infectingsaid bacterium with said phage.

20. The method according to claim 19, wherein said bacterium is Pseudomonasaeruginosa, wherein said phage is a Chimallivirus ΦKZ and wherein said protein is jukA and / or jukB.

21. A method for promoting the formation of phage progeny particles from abacterium infected with, or otherwise comprising, a phage, in particular a prophage, comprising the steps of (a) contacting said bacterium with at least one compound CPP-ASOp / b, wherein CPP is a cell-penetrating peptide and ASOp / bis an antisense construct that is specifically binding to an mRNA coding for a phage or bacterial protein, respectively, repressing, preventing or delayingreplication of said phage in said bacterium.120638P1116PC July 30, 2025Julius-Maximilians-Universität Würzburg Helmholtz-Zentrum für Infektionsforschung22. The method of claim 21, wherein said step (a) results in lysis of said bacterium.

23. A compound CPP-ASOp, wherein CPP is a cell-penetrating peptide and ASOp isan antisense construct that is specifically binding to an mRNA coding for a protein repressing, preventing or delaying replication of a phage, in particular alytic phage, in a bacterium for use in the treatment of a patient suffering from aninfection with said bacterium.

24. A method of treating a plant infected with a bacterium, comprising the step ofadministering or applying a compound CPP-ASOpto said plant, wherein CPP is a cell-penetrating peptide and ASOpis an antisense construct that is specifically binding to an mRNA coding for a protein repressing, preventing or delaying replication of a phage, in particular a lytic phage, in said bacterium.

Citation Information

Patent Citations

  • Antisense antibiotics and bacterial secretion based delivery system to eliminate drug-resistant bacteria

    US20210087565A1

  • Modified peptide-oligonucleotide conjugate

    WO2023093960A1