Microorganism introduced with foreign lipoate metabolic gene and method for producing pantothenic acid or tryptophan using same

Abstract

The present disclosure provides: a microorganism introduced with a foreign lipoate metabolic gene; a composition for producing at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan, the composition comprising the microorganism; and a method for producing at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan, the method comprising a step for culturing the microorganism.

Description

Microorganisms into which foreign lipoate metabolism genes have been introduced and methods for producing pantothenic acid or tryptophan using the same

[0001] Cross-citation with related application(s)

[0002] This disclosure claims the benefit of priority to Korean Patent Application No. 10-2024-0103008, filed August 2, 2024, the entire contents of which are incorporated herein by reference.

[0003] The present disclosure relates to a microorganism into which an exogenous lipoate metabolism gene has been introduced, a production composition comprising the microorganism and at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, and a production method comprising a step of culturing the microorganism and at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan.

[0004]

[0005] Pantothenic acid, also known as vitamin B5, is a member of the vitamin B complex and is a commercially important substance with diverse applications in cosmetics, medicine, human nutrition, and animal nutrition. During the synthesis process through microbial fermentation, 5,10-methylenetetrahydrofolate (N5, N10-Methylenetetrahydrofolate) is required, and the glycine cleavage system is one of the methods for ensuring a smooth supply of this substance. Pantothenic acid is a structure in which beta-alanine is linked to pantoic acid via an amide bond.

[0006] Tryptophan is one of the amino acids that make up proteins. It is an essential amino acid that humans and animals cannot synthesize and must consume. Because it requires serine (L-serine) during the synthesis process through microbial fermentation, serine and glycine (L-glycine) are produced during fermentation. The glycine cleavage system converts the by-product glycine into CO2 and NH4. + It is broken down into carbon and nitrogen sources to be reused for tryptophan synthesis.

[0007] At least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan can be chemically synthesized or biotechnologically produced by fermenting a suitable microorganism in a suitable medium. The advantage of a biotechnological production method using a microorganism is that at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan in the desired stereoisomeric D-form is formed. Therefore, there is a need for the development of a microorganism having an advantageous effect in biotechnologically producing at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan, and a technology for highly efficiently producing at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan using the same.

[0008]

[0009] [Prior Art Literature]

[0010] [Patent Document]

[0011] (Patent Document 1) U.S. Patent No. 7718205

[0012]

[0013] One example of the present disclosure provides a microorganism producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, with enhanced activities of lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase.

[0014] Another example of the present disclosure provides a method for producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, comprising the step of culturing the microorganism in a medium.

[0015] Another example of the present disclosure provides a composition for production of at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, comprising the microorganism.

[0016] Another example of the present disclosure provides a use of the microorganism for producing one or more selected from the group consisting of pantothenic acid, pantoic acid and tryptophan.

[0017] Another example of the present disclosure provides the use of the microorganism for the preparation of a composition for producing one or more selected from the group consisting of pantothenic acid, pantoic acid and tryptophan.

[0018]

[0019] The present disclosure provides a microorganism having enhanced activities of lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase.

[0020] In one example, the microorganism may be a microorganism that produces at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan.

[0021]

[0022] In the present disclosure, the term "lipoate protein ligase (or lipoate-protein ligase A)" is an enzyme that catalyzes the process of transferring activated lipoyl to the lipoyl domain of a lipoate-dependent enzyme, which converts and activates ATP and lipoic acid into lipoyl-AMP, and can play a role in transferring a lipoyl moiety to a protein requiring a lipoyl domain. The protein requiring the lipoyl domain may be a glycine cleavage system (e.g., a gcvH subunit, etc.). The "lipoate protein ligase" of the present disclosure may be used interchangeably with "lipoyl(octanoyl) transferase" or "LipB".

[0023] The term “lipoyl synthase” in the present disclosure is an enzyme that catalyzes the conversion of an octanoyl domain of a lipoate-dependent enzyme into a lipoylated derivative by radical-mediated insertion of two sulfur atoms into the C-6 and C-8 positions of an octanoyl moiety bound to the lipoyl domain of the enzyme. The “lipoyl synthase” in the present disclosure may be used interchangeably with “lipoate synthase”, “lipoic acid synthase”, “sulfur insertion protein LipA”, or “LipA”.

[0024] As used herein, the term “lipoamide dehydrogenase” refers to an enzyme that is a component of the glycine degradation system and the alpha-ketone acid dehydrogenase complex, catalyzing the reaction of converting dihydrolipoic acid and NAD+ into lipoic acid and NADH. The term “lipoamide dehydrogenase” in the present disclosure may be used interchangeably with “dihydrolipoamide dehydrogenase,” “dihydrolipoyl dehydrogenase,” or “LpdA.”

[0025] In the present disclosure, the term “pantothenic acid (e.g., D-pantothenic acid)” is a compound having a structure of chemical formula 1, which is a vitamin (vitamin B5) in which β-alanine is linked to pantoic acid by an amide bond, and is a component of coenzyme A (CoA) and acyl carrier protein (ACP), and is involved in various metabolic functions of living organisms.

[0026] (Chemical Formula 1: Pantothenic Acid)

[0027] “Pantoic acid (e.g., D-pantoic acid)” is a compound with the structure of chemical formula 2 and is a component of various biologically active compounds:

[0028] (Chemical Formula 2: Pantosan)

[0029] In this disclosure, the term "tryptophan" is one of the α-amino acids, an essential amino acid that is not synthesized in the body and has a chemical formula of C 11 H 12 It refers to an aromatic L-amino acid called N2O2.

[0030] The microorganism producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan with enhanced activities of the above lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase may be a microorganism with enhanced endogenous lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase activities or with introduced exogenous protein ligase, lipoyl synthase and lipoamide dehydrogenase.

[0031] In the present disclosure, introduction of foreign proteins and / or genes may mean introduction of proteins and / or genes derived from cells belonging to a different genus or a different species than the microorganism (host cell) into which the proteins and / or genes are introduced.

[0032] The above-mentioned foreign lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase and / or polynucleotides encoding them may be derived from a microorganism of the genus Mycobacterium, but are not limited thereto.

[0033] The above Mycobacterium genus microorganisms include Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium africanum, Mycobacterium asiaticum, Mycobacterium bovis, Mycobacterium chelonae, Mycobacterium fortuitum, Mycobacterium gordonae, Mycobacterium haemophilum, Mycobacterium intracellulare, Mycobacterium kansasii, Mycobacterium lentiflavum, It may be selected from the group consisting of Mycobacterium malmoense, Mycobacterium marinum, Mycobacterium microti, Mycobacterium phlei, Mycobacterium scrofulaceum, Mycobacterium triplex, Mycobacterium uvium, and Mycobacterium xenopi, but is not limited thereto. In one example, the exogenous lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase and / or the polynucleotide encoding them may be derived from Mycobacterium smegmatis.

[0034] The sequence of the above-mentioned foreign lipoate protein ligase can be obtained from the known database NCBI's GenBank, and for example, the NCBI reference sequence can be WP_003895681.1. The sequence of the above-mentioned foreign lipoyl synthase can be obtained from the known database NCBI's GenBank, and for example, the NCBI reference sequence can be WP_011729704.1. The sequence of the above-mentioned foreign lipoamide dehydrogenase can be obtained from the known database NCBI's GenBank, and for example, the NCBI reference sequence can be WP_003892330.1.

[0035] In one example, the lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase derived from Mycobacterium smegmatis may have, comprise, consist of or consist essentially of the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0036] In one example, the lipoate protein ligase may comprise or consist of an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity to the amino acid sequence of SEQ ID NO: 1. In addition, a variant of the lipoate protein ligase having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added may also be included in the lipoate protein ligase, as long as the protein has such homology or identity and exhibits lipoate protein ligase activity. For example, if the amino acid sequence has sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions that do not alter the activity of lipoate protein ligase at the N-terminus, C-terminus and / or within the amino acid sequence.

[0037] In one example, the lipoyl synthase may comprise or consist of an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the amino acid sequence of SEQ ID NO: 2. In addition, as long as it is a protein having such homology or identity and exhibiting lipoyl synthase activity, a variant of the lipoyl synthase having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added may also be included in the lipoyl synthase. For example, this includes cases in which the amino acid sequence has an addition or deletion that does not alter the activity of the lipoyl synthase, a naturally occurring mutation, a silent mutation, or a conservative substitution at the N-terminus, C-terminus, and / or within the amino acid sequence.

[0038] In one example, the lipoamide dehydrogenase may comprise or consist of an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity to the amino acid sequence of SEQ ID NO: 3. In addition, a variant of the lipoamide dehydrogenase having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added may also be included in the lipoamide dehydrogenase, as long as it is a protein having such homology or identity and exhibiting lipoamide dehydrogenase activity. For example, if the amino acid sequence has sequence additions or deletions that do not alter the activity of lipoamide dehydrogenase, naturally occurring mutations, silent mutations or conservative substitutions at the N-terminus, C-terminus and / or within the amino acid sequence.

[0039] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0040]

[0041] The polynucleotide encoding the above lipoate protein ligase, lipoyl synthase, or lipoamide dehydrogenase can be prepared by referring to known codon information for the amino acid sequence, but may be derived from Mycobacterium smegmatis in one example. The polynucleotide encoding the above lipoate protein ligase, lipoyl synthase, or lipoamide dehydrogenase derived from Mycobacterium smegmatis can have its sequence obtained from NCBI, a known database.

[0042] In one example, the polynucleotide encoding the lipoate protein ligase derived from Mycobacterium smegmatis may have, include, consist of, or consist essentially of the nucleic acid sequence of SEQ ID NO: 4, and various modifications may be made in the coding region within a range that does not change the amino acid sequence of the polypeptide, taking into account codons preferred in a cell in which the lipoate protein ligase is to be expressed. In one example, the polynucleotide encoding the lipoate protein ligase may comprise or consist of a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the nucleic acid sequence of SEQ ID NO: 4.

[0043] In one example, the polynucleotide encoding the lipoyl synthase derived from Mycobacterium smegmatis may have, include, consist of, or consist essentially of the nucleic acid sequence of SEQ ID NO: 5, and various modifications may be made in the coding region within a range that does not change the amino acid sequence of the polypeptide, taking into account codons preferred in a cell to express the lipoyl synthase. In one example, the polynucleotide encoding the lipoyl synthase may comprise or consist of a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the nucleic acid sequence of SEQ ID NO: 5.

[0044] In one example, the polynucleotide encoding the lipoamide dehydrogenase derived from Mycobacterium smegmatis may have, include, consist of, or consist essentially of the nucleic acid sequence of SEQ ID NO: 6, and various modifications may be made in the coding region within a range that does not change the amino acid sequence of the polypeptide, taking into account codons preferred in a cell in which the lipoamide dehydrogenase is to be expressed. In one example, the polynucleotide encoding the lipoamide dehydrogenase may comprise or consist of a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the nucleic acid sequence of SEQ ID NO: 6.

[0045] A microorganism that produces at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, wherein the activity of lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase is enhanced, may be a microorganism into which a polynucleotide encoding the lipoate protein ligase, a polynucleotide encoding the lipoyl synthase and a polynucleotide encoding the lipoamide dehydrogenase have been introduced, and this may be introduced into the microorganism using a recombinant vector, in one example. The recombinant vector may be an expression vector. Expressing the lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase in the microorganism may be performed by culturing a recombinant cell (e.g., a microorganism) comprising the lipoate protein ligase gene, the lipoyl synthase gene and the lipoamide dehydrogenase gene, or a recombinant vector comprising the same.

[0046] The introduction of each polynucleotide encoding the lipoate protein ligase, lipoyl synthase, and lipoamide dehydrogenase, or a recombinant vector containing the same, into a microorganism can be performed by a person skilled in the art by appropriately selecting a known transformation method. As used herein, the term "transformation" refers to introducing a target polynucleotide, or a vector containing the same, into a host cell so that the polynucleotide can be expressed in the host cell. The transformed polynucleotide may include both an integrated location within the chromosome of the host cell or an extrachromosomal location, as long as it can be expressed within the host cell. In addition, there is no limitation on the form in which the polynucleotide is introduced, as long as it can be introduced into the host cell and expressed. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all the elements necessary for its own expression. The above expression cassette may typically include expression control elements such as a promoter, a transcription termination signal, a ribosome binding site, and / or a translation termination signal, which are operably linked to the polynucleotide. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell. The term "operably linked" as described above may mean that the polynucleotide is functionally linked to an expression control element (e.g., a promoter) so as to perform transcriptional regulation (e.g., transcription initiation) of the polynucleotide. Operable linkage can be performed using a genetic recombination technique known in the art.

[0047] The method of transforming the above polynucleotide into a host cell can be performed by any method of introducing a nucleic acid into a cell (microorganism), and can be performed by appropriately selecting a transformation technique known in the art depending on the host cell. Examples of the known transformation methods include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) precipitation, DEAE-dextran, cationic liposome, lipofection, and lithium acetate-DMSO.

[0048] As used herein, the term "vector" refers to a DNA construct containing a polynucleotide operably linked to suitable regulatory sequences so as to enable expression of the polynucleotide of interest in a suitable host. The regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence regulating the termination of transcription and / or translation. After being transformed into a host cell, the vector may be expressed independently of the host cell's genome (genetic material), or may be integrated into the host cell's genome.

[0049] The vector usable in the present disclosure is not particularly limited as long as it is replicable in a host cell, and may be selected from all commonly used vectors. Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc., in a natural or recombinant state. For example, as the vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc., can be used as a phage vector or a cosmid vector, and as a plasmid vector, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series, etc., can be used. Specifically, examples include, but are not limited to, pDZ, pDC, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, and pCC1BAC vectors.

[0050] The above vector may further comprise a selection marker to determine whether the vector has been transformed or further integrated into the host cell chromosome. The selection marker is used to select cells transformed with the vector or to determine whether the polynucleotide has integrated into the chromosome, and may be selected from genes that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface protein. In an environment treated with a selective agent, only cells expressing the selection marker will survive or exhibit other phenotypic characteristics, thereby enabling selection of transformed cells.

[0051] The microorganism having enhanced activities of the above lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase may be a microorganism having an additional enhanced glycine cleavage system.

[0052]

[0053] A microorganism with further enhanced activity of the above glycine cleavage system may be a microorganism into which an exogenous glycine cleavage system has been introduced.

[0054] The above glycine cleavage system may comprise a complex of glycine cleavage enzymes, or one or more glycine cleavage enzymes.

[0055] The above glycine decomposition enzyme may be any one enzyme selected from the group consisting of glycine dehydrogenase, aminomethyltransferase, glycine decarboxylase, dihydrolipoyl dehydrogenase, etc.

[0056] The above glycine cleavage system may comprise one or more subunits selected from the group consisting of a GcvP polypeptide, a GcvT polypeptide, and a GcvH polypeptide. In one example, the glycine cleavage system may comprise a GcvP polypeptide, a GcvT polypeptide, and a GcvH polypeptide. The glycine cleavage system may catalyze a process of converting glycine into carbon dioxide and ammonia, in which THF (tetrahydrofolate) is converted to mTHF (5,10-methylenetetrahydrofolate), and NAD+ (oxidized nicotine amide dinucleotide) is converted to NADH (reduced nicotine amide dinucleotide) and hydrogen ions (H + ) can be converted to.

[0057] The above foreign glycine cleavage system may comprise at least one subunit selected from the group consisting of GcvP, GcvT and GcvH polypeptides, each of which may be derived from a different foreign microorganism, or may be derived from the same foreign microorganism.

[0058] The above-mentioned foreign glycine cleavage system and / or polynucleotide encoding the same may be derived from a microorganism of the genus Mycobacterium, but is not limited thereto.

[0059] The above Mycobacterium genus microorganisms include Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium africanum, Mycobacterium asiaticum, Mycobacterium bovis, Mycobacterium chelonae, Mycobacterium fortuitum, Mycobacterium gordonae, Mycobacterium haemophilum, Mycobacterium intracellulare, Mycobacterium kansasii, Mycobacterium lentiflavum, It may be selected from the group consisting of Mycobacterium malmoense, Mycobacterium marinum, Mycobacterium microti, Mycobacterium phlei, Mycobacterium scrofulaceum, Mycobacterium triplex, Mycobacterium uvium, and Mycobacterium xenopi, but is not limited thereto. In one example, the exogenous glycine cleavage system and / or the polynucleotide encoding the same may be derived from Mycobacterium smegmatis.

[0060] The above GcvP polypeptide may refer to a protein having glycine dehydrogenase activity, a glycine-cleavage system P-protein, or a glycine dehydrogenase activity. The above GcvP polypeptide may be derived from Mycobacterium smegmatis. The sequence of the GcvP polypeptide derived from Mycobacterium smegmatis can be obtained from NCBI, a known database (NCBI Reference Sequence: WP_011729226.1).

[0061] In one example, the GcvP polypeptide derived from Mycobacterium smegmatis can have, comprise, consist of, or consist essentially of the amino acid sequence of SEQ ID NO: 77.

[0062] In one example, the GcvP polypeptide has an amino acid sequence of SEQ ID NO: 77 that is at least 60%, at least 65%, at least 70%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, It may comprise or consist of an amino acid sequence having a homology or identity of 98.5% or more, 99% or more, 99.5% or more, or 99.9% or more. In addition, if it is a protein having such homology or identity and exhibiting glycine dehydrogenase activity, a variant of the GcvP polypeptide having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added may also be included in the GcvP polypeptide. For example, it may have a sequence addition or deletion that does not alter glycine dehydrogenase activity, a naturally occurring mutation, a silent mutation, or a conservative substitution at the N-terminus, C-terminus, and / or within the amino acid sequence.

[0063] The above GcvT polypeptide may refer to “aminomethyltransferase” or “protein having aminomethyltransferase activity”. The above GcvT polypeptide may be derived from Mycobacterium smegmatis. The sequence of the GcvT polypeptide derived from Mycobacterium smegmatis can be obtained from NCBI, a known database (NCBI Reference Sequence: WP_011729697.1).

[0064] In one example, the GcvT polypeptide derived from Mycobacterium smegmatis can have, comprise, consist of, or consist essentially of the amino acid sequence of SEQ ID NO: 78. In one example, the GcvT polypeptide has at least 60%, 65%, 70%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, It may comprise or consist of an amino acid sequence having a homology or identity of 93.5% or more, 94% or more, 94.5% or more, 95% or more, 95.5% or more, 96% or more, 96.5% or more, 97% or more, 97.5% or more, 98% or more, 98.5% or more, 99% or more, 99.5% or more, or 99.9% or more. In addition, a variant of the GcvT polypeptide having an amino acid sequence in which a part of the sequence is deleted, modified, substituted, conservatively substituted, or added may also be included in the GcvT polypeptide, as long as it is a protein having such homology or identity and exhibiting aminomethyltransferase activity.

[0065] The above GcvH polypeptide may refer to Glycine cleavage system protein H. The GcvH polypeptide may have an activity of transferring a methylamine group of glycine, an activity of transferring a methylamine group of glycine from a GcvP polypeptide to a GcvT polypeptide. The GcvH polypeptide may be derived from Mycobacterium smegmatis. The sequence of the GcvH polypeptide derived from Mycobacterium smegmatis can be obtained from NCBI, a known database (NCBI Reference Sequence: WP_003895104.1).

[0066] In one example, the GcvH polypeptide derived from Mycobacterium smegmatis can have, comprise, consist of, or consist essentially of the amino acid sequence of SEQ ID NO: 79.

[0067] In one example, the GcvH polypeptide has an amino acid sequence of SEQ ID NO: 79 that is at least 60%, at least 65%, at least 70%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, It may comprise or consist of an amino acid sequence having a homology or identity of 98.5% or more, 99% or more, 99.5% or more, or 99.9% or more. In addition, as long as it is a protein having such homology or identity and exhibiting methylamination transfer activity, a variant of the GcvH polypeptide having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added may also be included in the GcvH polypeptide.

[0068]

[0069] In the present disclosure, the glycine cleavage system gene may refer to a polynucleotide encoding the glycine cleavage system, and may include one or more polynucleotides selected from the group consisting of a polynucleotide encoding a GcvP polypeptide (hereinafter, may be used interchangeably with the "gcpP gene"), a polynucleotide encoding a GcvT polypeptide (hereinafter, may be used interchangeably with the "gcpT gene"), and a polynucleotide encoding a GcvH polypeptide (hereinafter, may be used interchangeably with the "gcpH gene").

[0070] The above glycine cleavage system may be expressed by a gene including at least one selected from the group consisting of glycine cleavage genes, i.e., gcvP gene, gcvT gene, and gcvH gene.

[0071] In one example, the glycine cleavage system gene may include a polynucleotide encoding a GcvP polypeptide, a polynucleotide encoding a GcvT polypeptide, and a polynucleotide encoding a GcvH polypeptide.

[0072] The above glycine cleavage system gene may include one or more polynucleotides selected from the group consisting of a polynucleotide encoding a GcvP polypeptide, a polynucleotide encoding a GcvT polypeptide, and a polynucleotide encoding a GcvH polypeptide, regardless of the order. In one example, the glycine cleavage system gene may include a polynucleotide encoding a GcvP polypeptide, a polynucleotide encoding a GcvT polypeptide, and a polynucleotide encoding a GcvH polypeptide in that order from the 5' end to the 3' end.

[0073] The polynucleotide encoding the above GcvP polypeptide may be derived from, but is not limited to, Mycobacterium smegmatis, and may be prepared based on the amino acid sequence of the GcvP polypeptide with reference to a known codon table.

[0074] In one example, the polynucleotide encoding the GcvP polypeptide derived from Mycobacterium smegmatis may have, comprise, consist of, or consist essentially of the nucleic acid sequence of SEQ ID NO: 80 or SEQ ID NO: 28, and various modifications may be made to the coding region within a range that does not change the amino acid sequence of the polypeptide, taking into account codons preferred in a cell to which the GcvP polypeptide is to be expressed.

[0075] In one example, the polynucleotide encoding the GcvP polypeptide has at least 60%, at least 65%, at least 70%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, It may comprise or consist of a nucleic acid sequence having a homology or identity of 97.5% or more, 98% or more, 98.5% or more, 99% or more, 99.5% or more, or 99.9% or more.

[0076] The polynucleotide encoding the above GcvT polypeptide may be derived from, but is not limited to, Mycobacterium smegmatis, and may be prepared by referring to a known codon table based on the amino acid sequence of the GcvT polypeptide.

[0077] In one example, the polynucleotide encoding the GcvT polypeptide derived from Mycobacterium smegmatis may have, comprise, consist of, or consist essentially of the nucleic acid sequence of SEQ ID NO: 81 or SEQ ID NO: 29, and various modifications may be made to the coding region within a range that does not change the amino acid sequence of the polypeptide, taking into account codons preferred in a cell to which the GcvT polypeptide is to be expressed.

[0078] In one example, the polynucleotide encoding the GcvT polypeptide has at least 60%, at least 65%, at least 70%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, It may comprise or consist of a nucleic acid sequence having a homology or identity of 97.5% or more, 98% or more, 98.5% or more, 99% or more, 99.5% or more, or 99.9% or more.

[0079] The polynucleotide encoding the above GcvH polypeptide may be derived from, but is not limited to, Mycobacterium smegmatis, and may be prepared based on the amino acid sequence of the GcvH polypeptide with reference to a known codon table.

[0080] In one example, the polynucleotide encoding the GcvH polypeptide derived from Mycobacterium smegmatis may have, include, consist of, or consist essentially of the nucleic acid sequence of SEQ ID NO: 82 or SEQ ID NO: 30, and various modifications may be made to the coding region within a range that does not change the amino acid sequence of the polypeptide, taking into account codons preferred in a cell in which the GcvH polypeptide is to be expressed.

[0081] In one example, the polynucleotide encoding the GcvH polypeptide has at least 60%, at least 65%, at least 70%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, It may comprise or consist of a nucleic acid sequence having a homology or identity of 97.5% or more, 98% or more, 98.5% or more, 99% or more, 99.5% or more, or 99.9% or more.

[0082]

[0083] In this disclosure, 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0084] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0085] Whether any two polynucleotide or polypeptide sequences are homologous, or identical, can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information database.

[0086] Homology, or identity, of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program, such as that disclosed in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or, for example, Needleman et al. (1970), J Mol Biol. 48:443. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a coding sequence matrix, as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0087]

[0088] As used herein, the term “enhancement” of polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The term “enhancement” may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or activity before modification. The term “intrinsic activity” refers to the activity of a specific polypeptide that a parent strain or unmodified microorganism originally possessed before the trait change, when the trait change is caused by genetic mutation due to natural or artificial factors. This may be used interchangeably with “activity before modification.” “Enhanced,” “upregulated,” “overexpressed,” or “increased” the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of the specific polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.

[0089] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or increasing the concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the degree of activity of the polypeptide, the expression level, or the amount of a product resulting from the activity of the polypeptide.

[0090] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but are not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0091] Specifically, the enhancement of the polypeptide of the present disclosure is

[0092] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;

[0093] 2) Replacing the gene expression control region on the chromosome encoding the polypeptide with a highly active sequence;

[0094] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0095] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;

[0096] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);

[0097] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

[0098] 7) Codon optimization of polynucleotides encoding polypeptides;

[0099] 8) Analyze the tertiary structure of the polypeptide to select the exposed portion and modify or chemically modify it;

[0100] 9) Control of cellular localization of proteins (polypeptides); or

[0101] 10) It may be a combination of two or more of the above 1) to 9), but is not particularly limited thereto.

[0102] More specifically,

[0103] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0104] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.

[0105] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.

[0106] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0107] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not chromosomal insertion has occurred.

[0108] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0109] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.

[0110] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0111] The above 9) regulation of the intracellular location of the polypeptide may target the polypeptide to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the polypeptide, but is not limited thereto.

[0112] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.

[0113]

[0114] In the present disclosure, the term "microorganism (or strain)" may include both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification. The microorganism may be a microorganism whose specific mechanism has been strengthened or weakened due to causes such as the introduction of an external gene or the strengthening or weakening of the activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product (e.g., one or more selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan).

[0115] The microorganism (or strain, recombinant cell) of the present disclosure may be a microorganism having the ability to produce (or the production amount) of one or more selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan (hereinafter, simply referred to as “pantothenic acid, pantoic acid, and / or tryptophan”), or having an improved (or increased) ability to produce pantothenic acid, pantoic acid, and / or tryptophan.

[0116] The microorganism of the present disclosure may be, but is not limited to, a microorganism that naturally lacks the ability to produce pantothenic acid, pantoic acid, and / or tryptophan, or a microorganism that has the ability to produce pantothenic acid, pantoic acid, and / or tryptophan, into which lipoate protein ligase, lipoyl synthase, and lipoamide dehydrogenase are introduced or enhanced to impart or enhance the ability to produce pantothenic acid, pantoic acid, and / or tryptophan. The microorganism that has the ability to produce pantothenic acid, pantoic acid, and / or tryptophan imparted or enhanced may be a microorganism into which a polynucleotide encoding an exogenous lipoate protein ligase, lipoyl synthase, and lipoamide dehydrogenase is introduced. In one example, the exogenous lipoate protein ligase, lipoyl synthase, and lipoamide dehydrogenase, or the polynucleotide encoding them, may be derived from Mycobacterium smegmatis.

[0117] The fact that the above microorganism has improved pantothenic acid, pantoic acid and / or tryptophan production ability or has pantothenic acid, pantoic acid and / or tryptophan production ability may mean that the microorganism has improved pantothenic acid, pantoic acid and / or tryptophan production ability compared to a non-modified microorganism, a cell before recombination, a parent strain and / or a wild-type strain, or is endowed with pantothenic acid, pantoic acid and / or tryptophan production ability unlike a non-modified microorganism, a cell before recombination, a parent strain and / or a wild-type strain that does not have pantothenic acid, pantoic acid and / or tryptophan production ability.

[0118] For example, a microorganism into which an exogenous lipoate protein ligase, lipoyl synthase, and lipoamide dehydrogenase or a gene encoding them is introduced or into which the activity thereof is enhanced may have enhanced pantothenic acid, pantoic acid, and / or tryptophan production ability compared to a microorganism before introduction or before enhancement, i.e., an unmodified microorganism of the same species. In the present disclosure, "unmodified microorganism" does not exclude a strain containing a mutation that may naturally occur in a microorganism, and may mean a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation due to natural or artificial factors. For example, the non-modified microorganism may refer to a strain into which genes encoding lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase, or these three proteins, are not introduced, or before the activities of the three proteins, lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase, are enhanced. The "non-modified microorganism" may be used interchangeably with "pre-modified strain", "pre-modified microorganism", "non-mutated strain", "non-mutated microorganism" or "reference microorganism". As described above, the activities of the lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase, or the genes encoding them, are enhanced.

[0119] The above microorganism may be a microorganism of the genus Corynebacterium (Corynebacterium sp.). The above-mentioned Corynebacterium genus microorganisms are Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, and Corynebacterium pollutisoli. The microorganism may be selected from the group consisting of, but is not limited to, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, and Corynebacterium flavescens.

[0120] The above microorganism may additionally include a mutation that increases the production of pantothenic acid, pantoic acid, and / or tryptophan, and the location of the mutation and / or the type of gene and / or protein that is the target of the mutation may be included without limitation as long as it increases the production of pantothenic acid, pantoic acid, and / or tryptophan. For example, the above microorganism may be a microorganism in which the glycine cleavage system described above is further enhanced. The above recombinant cell may be used without limitation as long as it is a cell capable of transformation.

[0121] For example, the microorganism having improved pantothenic acid, pantoic acid, and / or tryptophan production ability may be newly granted, or increased by about 30% or more, about 40% or more, about 50% or more, about 55% or more, about 57% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 100% or more, about 150% or more, or about 200% or more, compared to the parent strain or non-modified microorganism before mutation, but is not limited thereto.

[0122] As another example, the microorganism having improved pantothenic acid, pantoic acid, and / or tryptophan production ability may have a pantothenic acid and / or pantoic acid production ability of about 1.1 times or more, about 1.2 times or more, about 1.3 times or more, about 1.4 times or more, about 1.5 times or more, about 1.6 times or more, about 1.7 times or more, about 1.8 times or more, about 1.9 times or more, or about 2 times or more (the upper limit is not particularly limited and may be, for example, about 100 times or less) compared to the parent strain before mutation or the non-mutated microorganism, but is not limited thereto.

[0123] For example, the microorganism having improved pantothenic acid, pantoic acid, and / or tryptophan production ability may be newly granted tryptophan production ability or increased by about 30% or more, about 40% or more, about 50% or more, about 55% or more, about 56% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 100% or more, about 150% or more, or about 200% or more, compared to the parent strain before mutation or the non-mutated microorganism, but is not limited thereto.

[0124] As another example, the microorganism having improved pantothenic acid, pantoic acid, and / or tryptophan production ability may have a tryptophan production ability of about 1.1 times or more, about 1.2 times or more, about 1.3 times or more, about 1.4 times or more, about 1.5 times or more, about 1.56 times or more, about 1.6 times or more, about 1.7 times or more, about 1.8 times or more, about 1.9 times or more, or about 2 times or more (the upper limit is not particularly limited and may be, for example, about 100 times or less) compared to the parent strain before mutation or the unmodified microorganism, but is not limited thereto.

[0125] The term “about” above includes all ranges including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all ranges of values ​​equal to or similar to the value following the term “about,” but is not limited thereto.

[0126]

[0127] Another aspect provides a method for producing (or manufacturing) at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, comprising the step of culturing a microorganism in a medium that produces at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, wherein the microorganism has enhanced activities of lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase.

[0128] The method for producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan of the present disclosure may include a step of culturing the microorganism of the present disclosure in a medium.

[0129] In this disclosure, "cultivation" refers to growing microorganisms under appropriately controlled environmental conditions. The culturing process of this disclosure can be performed using appropriate media and culture conditions known in the art. These culturing processes can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0130] In the present disclosure, "medium" refers to a material containing nutrients necessary for culturing the microorganism as a main component, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of the present disclosure may be any medium used for culturing general microorganisms without particular limitation, but the microorganism of the present disclosure may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins.

[0131] Specifically, culture media for microorganisms of the present disclosure, such as strains of the genus Corynebacterium, can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.Corynebacterium, USA, 1981)].

[0132] In the present disclosure, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses (e.g., blackstrap molasses), rice bran, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0133] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; amino acids such as glutamic acid, methionine, glutamine, etc.; organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0134] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0135] Additionally, during the cultivation of the microorganism of the present disclosure, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. Furthermore, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. Furthermore, to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or to maintain anaerobic and microaerobic states, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0136] In the culture of the present disclosure, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.

[0137] Pantothenic acid, pantoic acid and / or tryptophan produced by the culture of the present disclosure may be secreted into the medium or remain within the cells.

[0138] The method for producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan of the present disclosure may further include a step of preparing a microorganism of the present disclosure, a step of preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, prior to the culturing step.

[0139] The method for producing at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan of the present disclosure may further include a step of recovering at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan from a culture medium (a culture medium in which culture is performed) or a microorganism (e.g., a strain of the genus Corynebacterium) according to the culture. The recovering step may be additionally included after the culturing step.

[0140] The above recovery may be performed by collecting the desired pantothenic acid, pantoic acid and / or tryptophan using a suitable method known in the art according to the culture method of the microorganism of the present disclosure, for example, a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallizing protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the desired pantothenic acid, pantoic acid and / or tryptophan may be recovered from the medium or microorganism using a suitable method known in the art.

[0141] In addition, the production method of at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan of the present disclosure may additionally include a purification step. The purification may be performed using a suitable method known in the art. In one example, when the production method of at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously regardless of the order, or may be performed simultaneously or integrated into one step, but is not limited thereto.

[0142]

[0143] Another aspect is to provide a composition for producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, comprising a microorganism having enhanced activities of lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase, a medium in which the microorganism is cultured, or a combination thereof.

[0144] The composition of the present disclosure may further comprise any suitable excipient commonly used in a production composition, at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, and such excipient may be, for example, but is not limited to, a preservative, a wetting agent, a dispersing agent, a suspending agent, a buffer, a stabilizer or an isotonic agent.

[0145] Another aspect provides the use of the microorganism for the production of one or more selected from the group consisting of pantothenic acid, pantoic acid and tryptophan.

[0146] Another aspect provides the use of the microorganism for the preparation of a composition for producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan.

[0147]

[0148] When culturing a microorganism with enhanced lipoate protein ligase, lipoyl synthase, and lipoamide dehydratase activities of the present disclosure, high yields of one or more selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan are possible. Therefore, industrial benefits such as increased production convenience and reduced manufacturing costs are expected.

[0149]

[0150] Hereinafter, the present disclosure will be described in more detail with reference to the following examples. However, these examples are intended to exemplify the present disclosure, and the scope of the present disclosure is not limited by these examples, as will be apparent to those skilled in the art to which the present disclosure pertains.

[0151]

[0152] Example 1. Production of a pantothenic acid-producing strain of Corynebacterium spp. with a glycine cleavage system and evaluation of pantothenic acid production capacity.

[0153] Example 1-1. Production of pantothenic acid-producing microorganisms

[0154] A Corynebacterium glutamicum strain with increased pantothenic acid production was created by introducing a 3-methyl-2-oxobutanoate hydroxymethyltransferase G116A mutant (PanB(G116A), U.S. Publication No. US 2024-0167065 A1) derived from Escherichia coli.

[0155] First, a vector was constructed to delete panB present in the parent strain. PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and primers of SEQ ID NOs: 93 and 94 and 95 and 96. PCR was performed under the following conditions: denaturation at 95°C for 30 s; annealing at 55°C for 30 s; and polymerization at 72°C for 1 min, repeated 25 times. As a result, 1,000 bp of gene fragments upstream of the panB gene and 1,000 bp of gene fragments downstream of the panB gene were obtained, and each amplification product was purified using a QIAGEN PCR Purification kit and used as an insert DNA fragment for vector construction. The vector pDC24_ΔpanB for deleting the panB gene on the chromosome was constructed by cloning the pDC24 (SEQ ID NO: 106) vector and DNA fragments (1000 bp gene fragment upstream of the panB gene and 1000 bp gene fragment downstream of the panB gene) treated with restriction enzyme SmaI and heat-treated at 65°C for 20 minutes at a molar concentration (M) of 2:1:1 using TaKaRa's Infusion Cloning Kit according to the provided manual.

[0156] Next, PCR was performed using the genomic DNA of E. coli ATCC47076 strain as a template and primers of SEQ ID NOs: 97 and 98 and 99 and 100. PCR was performed under the following conditions: denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, repeated 25 times. As a result, 388 bp of gene fragments upstream of the panB gene and 490 bp of gene fragments downstream of the panB gene were obtained, and each amplification product was purified using a QIAGEN PCR Purification kit and used as an insert DNA fragment for vector construction. After treating with the restriction enzyme SmaI and heat-treating at 65℃ for 20 minutes, the pDC24_ΔpanB vector and the obtained DNA fragment were cloned at a molar concentration (M) of 1:1:1 using the Infusion Cloning Kit from TaKaRa according to the provided manual, thereby constructing the vector pDC24_ΔpanB::panB(EC, G116A) for introducing the panB (G116A) gene derived from Escherichia coli onto the chromosome. The constructed vector pDC24_ΔpanB::panB(EC, G116A) was transformed into Corynebacterium glutamicum ATCC 13032 via electroporation, and through a secondary crossing-over process, strain ATCC13032 ΔpanB::panB(EC, G116A) in which the endogenous panB on the chromosome was replaced with the panB(G116A) derived from E. coli was obtained. The appropriate substitution of panB (G116A) from E. coli was confirmed using the MASA (Mutant Allele Specific Amplification) PCR technique (Takeda et al., Hum. Mutation, 2, 112-117 (1993)) using the following primer combination.That is, the strains that were amplified were first determined by selecting the primer combinations (SEQ ID NOs: 101 and 102 and 103 and 104) that matched E. coli panB, and the panB sequences of the selected strains were secondarily confirmed by analyzing them using the primer combinations of SEQ ID NOs: 101 and 105.

[0157] The primer sequences used in the above examples are as shown in Table 1 below.

[0158] SEQ ID NO: 93TGAATTCGAGCTCGGTACCCGAAATAGCGCTTGATGAATC94GGTTGCTACCTGCACCCGGGGGGCATGAGTATAGATGTGA95CTATACTCATGCCCCCCGGGTGCAGGTAGCAACCACAAAG96GTCGACTCTAGAGGATCCCCTATGTGGCGTTGGGTGCAGC97CATCTATACTCATGCCCCCCATGAAACCGACCACCATCTC98ACGGTTTCTACCAGC CACTCggcGCCTTCAATTTTGACCATGT99ACATGGTCAAAATTGAAGGCgccGAGTGGCTGGTAGAAACCGT100TGTGGTTGCTACCTGCACCCTTAATGGAAACTGTGTTCTT 101ACTCAACTCGTCGGGATATT102TTCATCAGCAAAGAGTTTGG103TCCGCGCGGCTGTGCGGCAG104TGTGGTTCCAGAACCCGCTGAA105TTAATGGAAACTGTGTTCTT

[0159] Example 1-2. Production of microorganisms with a glycine cleavage system

[0160] To introduce a glycine cleavage system gene derived from an exogenous microorganism into the ATCC13032 ΔpanB::panB(EC, G116A) strain constructed in Example 1-1, a vector was first constructed to delete the sdaA gene (SEQ ID NO: 26) present in the parent strain. PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and the primer combinations of SEQ ID NOs: 7 and 8 and 9 and 10. The PCR conditions were 25 cycles of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. As a result, 866 bp of the upper region of the sdaA gene and 927 bp of the lower region of the sdaA gene were obtained, and each amplified product was purified using a PCR Purification kit from QIAGEN and used as an insert DNA fragment for vector construction. After treating with restriction enzymes SalI and BamHI and heat-treating at 65°C for 20 minutes, the pDZ (US Patent Publication No. US 9109242 B2) vector and each DNA fragment of the upper and lower regions of the sdaA gene were cloned at a molar concentration (M) of 2:1:1 using TaKaRa's Infusion Cloning Kit according to the provided manual, thereby constructing a vector pDZ_ΔsdaA (ATCC13032) for deleting the sdaA gene on the chromosome.

[0161] To introduce the glycine cleavage system genes derived from foreign microorganisms into pDZ_ΔsdaA (ATCC13032), the gcvP gene, gcvT gene, and gcvH genes derived from each microorganism were amplified using the genomic DNA of Mycobacterium smegmatis ATCC19420 (KCTC9108), Escherichia coli K 12 substr MG1655, and Corynebacterium stationis ATCC6872 as templates.

[0162] Specifically, using Mycobacterium smegmatis ATCC19420 (KCTC 9108) genomic DNA as a template and primer combinations of SEQ ID NOs: 39 and 40, 41 and 42, and 43 and 44, the gcvP gene (protein sequence: SEQ ID NO: 77, gene sequence: SEQ ID NO: 80 or SEQ ID NO: 28), gcvT gene (protein sequence: SEQ ID NO: 78, gene sequence: SEQ ID NO: 81 or SEQ ID NO: 29), and gcvH gene (protein sequence: SEQ ID NO: 79, gene sequence: SEQ ID NO: 82 or SEQ ID NO: 30) derived from Mycobacterium smegmatis were amplified.

[0163] Using Escherichia coli K 12 substr MG1655 genomic DNA as a template and primer combinations of SEQ ID NOs: 51 and 52, 53 and 54, and 55 and 56, the gcvP gene (protein sequence: SEQ ID NO: 45, gene sequence: SEQ ID NO: 48), gcvT gene (protein sequence: SEQ ID NO: 46, gene sequence: SEQ ID NO: 49), and gcvH gene (protein sequence: SEQ ID NO: 47, gene sequence: SEQ ID NO: 50) derived from E. coli were amplified.

[0164] Using Corynebacterium stationis ATCC6872 genomic DNA as a template and primer combinations of SEQ ID NOs: 63 and 64, 65 and 66, and 67 and 68, the gcvP gene (protein sequence: SEQ ID NO: 57, gene sequence: SEQ ID NO: 60), gcvT gene (protein sequence: SEQ ID NO: 58, gene sequence: SEQ ID NO: 61), and gcvH gene (protein sequence: SEQ ID NO: 59, gene sequence: SEQ ID NO: 62) from Corynebacterium stationis were amplified.

[0165] The promoter sequence (PlysC) of the lysC gene was amplified using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template. Specifically, the PlysC sequence was amplified using primer combinations of SEQ ID NOs: 69 and 70 for gcvPTH expression from Mycobacterium smegmatis, SEQ ID NOs: 69 and 71 for gcvPTH expression from Escherichia coli, and SEQ ID NOs: 69 and 72 for gcvPTH expression from Corynebacterium stationanis. PCR was performed with 25 cycles of denaturation at 95°C for 30 s; annealing at 55°C for 30 s; and polymerization at 72°C for 3 min. As a result, each PlysC (353 bp) fragment and DNA fragments of the gcvP gene, gcvT gene, and gcvH gene from each microorganism were obtained. The vector pDZ_ΔsdaA (ATCC13032) was treated with restriction enzyme NotI and heat-treated at 65°C for 20 minutes, and the PlysC fragment, gcvP gene fragment, gcvT gene fragment, and gcvH gene fragment amplified above were cloned using TaKaRa's Infusion Cloning Kit according to the provided manual to introduce the gcvP gene, gcvT gene, and gcvH gene derived from Mycobacterium smegmatis, Escherichia coli, and Corynebacterium stationis into the sdaA gene position on the chromosome, pDZ_ΔsdaA::PlysC-gcvPTH(M. sm) pDZ_ΔsdaA::PlysC-gcvPTH (E. coli) and pDZ_ΔsdaA::PlysC-gcvPTH (C. st) were constructed, respectively.

[0166] The constructed vectors were transformed into the ATCC13032_ΔpanB::panB(EC, G116A) strain constructed in Example 1-1, which is a pantothenic acid producing strain, through electroporation, and through a second crossing process, a strain with the sdaA gene deleted on the chromosome (ATCC13032_ΔpanB::panB(EC, G116A) ΔsdaA) and a strain with the sdaA gene deleted and the gcvPTH gene derived from each microorganism were respectively obtained. Appropriate substitution of the glycine cleavage system genes from Mycobacterium smegmatis, Escherichia coli, and Corynebacterium stationaris was initially confirmed by amplification of each glycine cleavage system gene using the MASA (Mutant Allele Specific Amplification) PCR technique (Takeda et al., Hum. Mutation, 2, 112-117 (1993)) using primer combinations of SEQ ID NOs: 11 and 12 and 13 and 14, and was finally confirmed by analyzing the gcvPTH sequence using primer combinations of SEQ ID NOs: 15 and 16. The final selected strains were named ATCC13032_ΔpanB::panB(EC, G116A)ΔsdaA::PlysC-gcvPTH(M. sm), ATCC13032_ΔpanB::panB(EC, G116A)ΔsdaA::PlysC-gcvPTH(E. coli), and ATCC13032_ΔpanB::panB(EC, G116A)ΔsdaA::PlysC-gcvPTH(C. st), respectively.

[0167]

[0168] Example 1-3. Production of a strain overexpressing the glycine cleavage system.

[0169] The PlysC fragment derived from Corynebacterium glutamicum and the gcvP, gcvT, and gcvH gene fragments derived from Mycobacterium smegmatis were obtained by the method described in Example 1-2 using primer combinations of SEQ ID NOs: 31, 32, 33, 34, 35, 36, and 37, 38. The vector was obtained by cloning the pECCG117 (Korean Patent No. 10-0057684) vector and the above DNA fragments (PlysC, gcvP, gcvT, gcvH) at a molar concentration (M) of 2:1:1:1:1 using TaKaRa's Infusion Cloning Kit according to the provided manual after treating with restriction enzyme BamHI and heat-treating at 65°C for 20 minutes, and naming it pECCG117_PlysC-gcvPTH(M. sm). The above vector was transformed into ATCC13032_ΔpanB::panB(EC, G116A) strain by electroporation to obtain a strain overexpressing GcvP, GcvT and GcvH derived from Mycobacterium smegmatis, and was named ATCC13032_ΔpanB::panB(EC, G116A) pECCG117_PlysC-gcvPTH(M. sm).

[0170]

[0171] The primer sequences used in the above examples are as shown in Table 2 below.

[0172]

[0173] Example 1-4. Evaluation of pantothenic acid production capacity

[0174] The pantothenic acid productivity of the mutant strains obtained in the above examples 1-3 was measured using the following method.

[0175] Specifically, the parent strain and the mutant strain were inoculated into a 250 ml corner-bubble flask containing 25 ml of production medium, and then cultured with shaking at 200 rpm at 32°C for 48 hours. The culture was centrifuged at 20,000 rcf for 10 minutes and the supernatant was collected. The collected supernatant was diluted 1 / 10 with TDW (triple distilled water), and HPLC analysis was performed to measure the pantothenic acid concentration.

[0176] <Production medium>

[0177] Glucose 10%, beta-alanine 0.5%, yeast extract 0.4%, ammonium sulfate 1.5%, monobasic potassium phosphate 0.1%, magnesium sulfate heptahydrate 0.05%, iron sulfate heptahydrate 10 mg / l, manganese sulfate monohydrate 6.7 mg / l, biotin 50 μg / l, thiamine HCl 100 μg / l, pH 7.2

[0178]

[0179] The pantothenic acid production ability of the mutant strains obtained in the above example is shown in Table 3 below.

[0180] StrainPantothenic acid concentration (g / L)L-gly concentration (g / L)Increase in pantothenic acid concentration compared to the control Parent strain (ATCC13032_ΔpanB::panB(EC, G116A))1.20.4-ATCC13032_ΔpanB::panB(EC, G116A)ΔsdaA1.40.416.67%ATCC13032_ΔpanB::panB(EC, G116A)ΔsdaA::PlysC-gcvPTH(M. sm)2.60.1116.67%ATCC13032_ΔpanB::panB(EC, G116A)ΔsdaA::PlysC-gcvPTH(E. coli)1.40.416.67%ATCC13032_ΔpanB::panB(EC, G116A)ΔsdaA::PlysC-gcvPTH(C. st)1.50.416.67%ATCC13032_ΔpanB::panB(EC, G116A) pECCG117_PlysC-gcvPTH(M. sm)3.20.0166.67%

[0181] As shown in Table 3 above, the Corynebacterium glutamicum strain (ATCC13032_ΔpanB::panB(EC, G116A)pECCG117_PlysC-gcvPTH(M. sm)) overexpressing the glycine cleavage system gene derived from Mycobacterium smegmatis showed a significantly superior effect, with the pantothenic acid production ability increasing by approximately 167% compared to the control group. The Corynebacterium glutamicum strain (ATCC13032_ΔpanB::panB(EC, G116A)ΔsdaA::PlysC-gcvPTH(M. sm)) in which the sdaA gene was deleted and the glycine cleavage system gene derived from Mycobacterium smegmatis was introduced also showed a significantly superior effect, with the pantothenic acid production ability increasing by approximately 117% compared to the control group.

[0182]

[0183] Example 2. Production of pantothenic acid-producing Corynebacterium microorganisms with lipoate metabolic pathway genes introduced and evaluation of pantothenic acid production capacity.

[0184] Example 2-1. Production of a pantothenic acid-producing Corynebacterium microorganism into which lipoate metabolic pathway genes have been introduced.

[0185] In order to confirm the effect of increasing pantothenic acid and pantoic acid production capacity of Corynebacterium microorganisms into which lipoate metabolic pathway genes were introduced, lipoate metabolic pathway genes, Mycobacterium smegmatis-derived lipoate protein ligase (LipB, NCBI reference: WP_003895681.1), lipoyl synthase (LipA, NCBI reference: WP_003884471.1), and lipoamide dehydrogenase (LpdA, NCBI reference: WP_005624645.1), were introduced into the Corynebacterium glutamicum ATCC13032_ΔpanB::panB(EC, G116A) pECCG117_PlysC-gcvPTH(M.sm) strain obtained in Example 1-3, and pantothenic acid production capacity was evaluated.

[0186] Specifically, DNA fragments encoding lipoate protein ligase (LipB), lipoyl synthase (LipA), and lipoamide dehydrogenase (LpdA) were amplified by PCR using the Mycobacterium smegmetis genome as a template in the same manner as in Example 1. The obtained DNA fragments lipB (687 bp, SEQ ID NOs: 83, 84), lipA (945 bp, SEQ ID NOs: 85, 86) and lpdA (1395 bp, SEQ ID NOs: 87, 88) were cloned into the PlipB promoter (528 bp, SEQ ID NOs: 89, 90) and PbetP promoter (159 bp, SEQ ID NOs: 91, 92) of Corynebacterium glutamicum ATCC13032 and the XbaI-treated pECCG117_PlysC-gcvPTH(M.sm) DNA fragment at a molar ratio of 1:1:1:1:1:1 using the Infusion Cloning Kit of TaKaRa, according to the provided manual, to obtain a plasmid. It was named pECCG117_PlysC-gcvPTH(M.sm)_PlipB-lipBA(M.sm)_PbetP-lpdA(M.sm).

[0187] The above-mentioned vector was transformed into the Corynebacterium glutamicum ATCC13032_ΔpanB::panB(EC, G116A) strain via electroporation to produce a strain into which three foreign lipoate metabolism genes were introduced.

[0188] The primer sequences used in the above examples are as shown in Table 4 below.

[0189] Primer SEQ ID NO: Nucleic acid sequence (5'→3')83AAGTACTACACTGGGAAAACaTGACATCGATCCGTTCGGC84CTGGCACGACAGTCAtAGATTCATCCTACGTTCAGGGTTT85CCTGAACGTAGGATGAATCTaTGACTGTCGTGCCAGAGGG86GCATCACAATGACATAACGATCAGGATACGGGGGGCTGAT87CCCAAGTAAAGGTGAGTTTTtaTGACCCACTTTGACG TTGT88CGCGGTGGCGGCCGCTCTAGTCAAAAGTTGATCATGTGGC89GGGGGATCCACTAGTTCTAGGCGATACTTCAACCCATGCA90GCCGAACGGATCGATGTCAtGTTTTCCCAGTGTAGTACTT91ATCAGCCCCCCGTATCCTGATCGTTATGTCATTGTGATGC92ACAACGTCAAAGTGGGTCAtAAAACTCACCTTTACTTGGG

[0190] Example 2-2: Confirmation of the effect of increasing pantothenic acid production in a pantothenic acid-producing Corynebacterium microorganism into which lipoate metabolic pathway genes were introduced.

[0191] In order to confirm the pantothenic acid production ability of the strain into which the lipoate metabolism gene produced in Example 2-1 was introduced, pantothenic acid was produced under the same medium conditions as Example 1, and the results are shown in Table 5 below.

[0192] Pantothenic acid concentration (g / L) L-gly concentration (g / L) ATCC13032_ΔpanB::panB(EC, G116A) pECCG117_PlysC-gcvPTH(M.sm)2.10.6 ATCC13032_ΔpanB::panB(EC, G116A) pECCG117_PlysC-gcvPTH(M.sm)-PlipB-lipBA(M.sm)-PbetP-lpdA(M.sm)3.30.2

[0193] As a result, as shown in Table 5, the parent strain, Corynebacterium glutamicum ATCC13032_ΔpanB::panB(EC, G116A) pECCG117_PlysC-gcvPTH(M.sm), was confirmed to produce approximately 2.1 g / L of pantothenic acid, but the ATCC13032_ΔpanB::panB(EC, G116A) pECCG117_PlysC-gcvPTH(M.sm)-PlipB-lipBA(M.sm)-PbetP-lpdA(M.sm) strain, into which lipoate metabolism genes lipB, lipA, and lpdA were introduced, was confirmed to produce 3.3 g / L of pantothenic acid, which was increased compared to the parent strain.

[0194] The above results imply that the three lipoate metabolism genes can further enhance the activity of the glycine cleavage system, thereby improving the production of pantothenic acid.

[0195]

[0196] Example 3. Production of a tryptophan-producing strain of Corynebacterium spp. with a glycine cleavage system.

[0197] Example 3-1. Production of microorganisms with a glycine cleavage system

[0198] To introduce the glycine cleavage system gene into CA04-8405 (KCCM12099P, U.S. Patent Publication No. US 10995378 B2), a tryptophan-producing strain derived from Corynebacterium glutamicum ATCC13869, a vector was first constructed to delete the sdaA (L-serine deaminase) gene (SEQ ID NO: 27) present in the parent strain. PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template and primer combinations of SEQ ID NOs: 17 and 18 and 19 and 20. The PCR conditions were 25 cycles of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. As a result, 966 bp of the upper region of the sdaA gene and 948 bp of the lower region of the sdaA gene were obtained, and each amplified product was purified using a PCR Purification kit from QIAGEN and used as an insert DNA fragment for vector construction. After treating with the restriction enzyme BamHI and heat-treating at 65°C for 20 minutes, the pDZ (US Patent Publication No. US 9109242 B2) vector and the vector and each DNA fragment of the upper and lower regions of the sdaA gene were cloned at a molar concentration (M) of 2:1:1 using the Infusion Cloning Kit from TaKaRa according to the provided manual, thereby constructing a vector pDZ_ΔsdaA (ATCC13869) for deleting the sdaA gene on the chromosome.

[0199] To introduce a glycine cleavage system derived from a foreign microorganism into pDZ_ΔsdaA (ATCC13869), the gcvP gene, gcvT gene, and gcvH gene derived from each microorganism were amplified using the genomic DNA of Mycobacterium smegmatis ATCC19420 (KCTC9108), Escherichia coli K 12 substr MG1655, and Corynebacterium stationis ATCC6872 as templates.

[0200] Specifically, using Mycobacterium smegmatis ATCC19420 (KCTC 9108) genomic DNA as a template and primer combinations of SEQ ID NOs: 39 and 40, 41 and 42, and 43 and 73, the gcvP gene (protein sequence: SEQ ID NO: 77, gene sequence: SEQ ID NO: 80 or SEQ ID NO: 28), gcvT gene (protein sequence: SEQ ID NO: 78, gene sequence: SEQ ID NO: 81 or SEQ ID NO: 29), and gcvH gene (protein sequence: SEQ ID NO: 79, gene sequence: SEQ ID NO: 82 or SEQ ID NO: 30) derived from Mycobacterium smegmatis were amplified.

[0201] Using Escherichia coli K 12 substr MG1655 genomic DNA as a template and primer combinations of SEQ ID NOs: 51 and 52, 53 and 54, and 55 and 74, gcvP gene (protein sequence: SEQ ID NO: 45, gene sequence: SEQ ID NO: 48), gcvT gene (protein sequence: SEQ ID NO: 46, gene sequence: SEQ ID NO: 49), and gcvH gene (protein sequence: SEQ ID NO: 47, gene sequence: SEQ ID NO: 50) derived from g E. coli were amplified.

[0202] Using Corynebacterium stationis ATCC6872 genomic DNA as a template and primer combinations of SEQ ID NOs: 63 and 64, 65 and 66, and 67 and 75, the gcvP gene (protein sequence: SEQ ID NO: 57, gene sequence: SEQ ID NO: 60), gcvT gene (protein sequence: SEQ ID NO: 58, gene sequence: SEQ ID NO: 61), and gcvH gene (protein sequence: SEQ ID NO: 59, gene sequence: SEQ ID NO: 62) from Corynebacterium stationis were amplified.

[0203] The promoter sequence (PlysC) of the lysC gene was amplified using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template. Specifically, the PlysC sequence was amplified using primer combinations of SEQ ID NOs: 76 and 70 for gcvPTH expression from Mycobacterium smegmatis, SEQ ID NOs: 76 and 71 for gcvPTH expression from Escherichia coli, and SEQ ID NOs: 76 and 72 for gcvPTH expression from Corynebacterium stationanis.

[0204] PCR was performed 25 times at 95°C for 30 seconds for denaturation; 55°C for 30 seconds for annealing; and 72°C for 3 minutes for polymerization. As a result, each PlysC (353 bp) fragment and DNA fragments of the gcvP gene, gcvT gene, and gcvH gene derived from each microorganism were obtained. After treating with restriction enzyme NotI and heat-treating at 65°C for 20 minutes, the vector amplified above and the PlysC fragment, gcvP gene fragment, gcvT gene fragment and gcvH gene DNA fragments were cloned using the Infusion Cloning Kit from TaKaRa in a molar concentration of 2:1:1:1:1 according to the provided manual to introduce the gcvP gene, gcvT gene and gcvH gene derived from Mycobacterium smegmatis, Escherichia coli and Corynebacterium stationaris into the sdaA gene position on the chromosome, thereby obtaining the vector pDZ_ΔsdaA(ATCC13869)::PlysC-gcvPTH(M. sm), pDZ_ΔsdaA(ATCC13869) ::PlysC-gcvPTH(E. coli), pDZ_ΔsdaA(ATCC13869) ::PlysC-gcvPTH(C. st) was constructed.

[0205]

[0206] The manufactured vectors were transformed into the CA04-8405 strain (US Patent Publication No. US 10995378 B2), a tryptophan-producing strain, through electroporation, and through a secondary crossing process, a strain with the sdaA gene deleted on the chromosome and a strain with the sdaA gene deleted and the gcvPTH gene derived from each microorganism were obtained, respectively. Appropriate substitution of the glycine cleavage system genes from Mycobacterium smegmatis, Escherichia coli, and Corynebacterium stationensis was initially confirmed by amplification of each glycine cleavage system gene using the MASA (Mutant Allele Specific Amplification) PCR technique (Takeda et al., Hum. Mutation, 2, 112-117 (1993)) using primer combinations of SEQ ID NOs: 21 and 12 and 13 and 22, and was finally confirmed by analyzing the gcvPTH sequence using primer combinations of SEQ ID NOs: 23 and 24. The final selected strains were named CA04-8405ΔsdaA::PlysC-gcvPTH (M. sm), CA04-8405ΔsdaA::PlysC-gcvPTH (C. st), and CA04-8405ΔsdaA::PlysC-gcvPTH (E. coli), respectively.

[0207]

[0208] Example 3-2. Production of a strain overexpressing the glycine cleavage system.

[0209] In addition, a strain overexpressing GcvP, GcvT, and GcvH derived from Mycobacterium smegmatis was obtained by transforming the CA04-8405 strain with the pECCG117_PlysC-gcvPTH (M. sm) vector prepared in Example 1-2 using electroporation, and was named CA04-8405 pECCG117_PlysC-gcvPTH (M. sm).

[0210]

[0211] The primer sequences used in the above examples are as shown in Table 6 below.

[0212]

[0213] Example 3-3. Evaluation of tryptophan production capacity

[0214] The tryptophan productivity of the mutant strains obtained in Example 3-2 was measured using the following method.

[0215] Specifically, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium and cultured at 30°C for 24 hours with shaking at 200 rpm. After completion of culture, the production amount of L-tryptophan was measured by HPLC.

[0216] <Jongbaeji>

[0217] Glucose 20g, peptone 10g, yeast extract 5g, urea 1.5g, KH2PO4 4g, K2HPO4 8g, MgSO4·7H2O 0.5g, biotin 100 μg, thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 2000 μg (based on 1 liter of distilled water)

[0218] <Production medium>

[0219] Glucose 30 g, (NH4)2SO4 15 g, MgSO4·7H2O 1.2 g, KH2PO4 1 g, yeast extract 5 g, biotin 900 μg, thiamine hydrochloride 4500 μg, calcium-pantothenic acid 4500 μg, CaCO3 30 g (based on 1 liter of distilled water)

[0220]

[0221] The tryptophan production ability of the mutant strains obtained in the above example is shown in Table 7 below.

[0222] StrainTryptophan concentration (g / L)L-gly concentration (g / L)Increase in tryptophan concentration compared to the controlControl (CA04-8405)1.520.2-CA04-8405ΔsdaA1.700.211.84%CA04-8405ΔsdaA::PlysC-gcvPTH(M. sm)2.180.043.42%CA04-8405ΔsdaA::PlysC-gcvPTH(E. coli)1.790.211.84%CA04-8405ΔsdaA::PlysC-gcvPTH(C. st)1.800.211.84%CA04-8405 pECCG117_PlysC-gcvPTH(M. sm)2.680.076.32%

[0223] As shown in Table 7 above, the CA04-8405ΔsdaA strain, in which the sdaA gene was deleted, showed an approximately 12% increase in tryptophan production compared to the control group. The Corynebacterium glutamicum strain (CA04-8405ΔsdaA::PlysC-gcvPTH(M. sm)) in which the sdaA gene was deleted and a glycine cleavage system gene from Mycobacterium smegmatis was introduced showed an approximately 43% increase in tryptophan production compared to the control group, showing a significantly superior effect. A Corynebacterium glutamicum strain (CA04-8405 pECCG117_PlysC-gcvPTH(M. sm)) overexpressing the glycine cleavage system gene derived from Mycobacterium smegmatis showed a significantly superior effect, with tryptophan production increasing by approximately 76% compared to the control group.

[0224]

[0225] Example 4. Production of tryptophan-producing Corynebacterium microorganisms with lipoate metabolic pathway genes introduced and evaluation of tryptophan production ability.

[0226] In order to confirm the effect of increasing tryptophan production capacity of Corynebacterium microorganisms into which lipoate metabolic pathway genes were introduced, lipoate metabolic pathway genes, Mycobacterium smegmatis-derived lipoate protein ligase (LipB, NCBI reference: WP_003895681.1), lipoyl synthase (LipA, NCBI reference: WP_003884471.1), and lipoamide dehydrogenase (LpdA, NCBI reference: WP_005624645.1), were introduced into the CA04-8405 pECCG117_PlysC-gcvPTH (M.sm) strain obtained in Example 3 in the same manner as in Example 2-1, and tryptophan production capacity was evaluated.

[0227] Specifically, the pECCG117_PlysC-gcvPTH(M.sm)_PlipB-lipBA(M.sm)_PbetP-lpdA(M.sm) vector produced in Example 2-1 was transformed into Corynebacterium glutamicum CA04-8405 using electroporation to produce a strain into which a foreign lipoate metabolism gene was introduced.

[0228] In order to confirm the tryptophan production ability of the strain into which the lipoate metabolism gene was introduced, tryptophan was produced under the same medium conditions as in Example 3, and the results are shown in Table 8 below.

[0229] Tryptophan concentration (g / L)L-gly concentration (g / L)CA04-8405 pECCG117_PlysC-gcvPTH(M.sm)2.680.0CA04-8405 pECCG117_PlysC-gcvPTH(M.sm)-PlipB-lipBA(M.sm)-PbetP-lpdA(M.sm)3.140.0

[0230] As a result, as shown in Table 8 above, the parent strain Corynebacterium glutamicum CA04-8405 pECCG117_PlysC-gcvPTH(M.sm) was confirmed to produce 2.68 g / L of tryptophan, but the CA04-8405 pECCG117_PlysC-gcvPTH(M.sm)-PlipB-lipBA(M.sm)-PbetP-lpdA(M.sm) strain, into which lipoate metabolism genes lipB, lipA, and lpdA derived from Mycobacterium smegmatis were simultaneously introduced, was confirmed to produce 3.14 g / L of tryptophan, which was approximately 1.17 times more than the parent strain.

[0231] From the above results, it was confirmed that the introduction of three types of exogenous lipoate metabolism genes can further enhance the activity of the glycine cleavage system, thereby improving tryptophan production capacity.

[0232]

[0233] From the above description, those skilled in the art will understand that the present disclosure can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present disclosure should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

1. A microorganism producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, with enhanced activities of lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase.

2. In the first paragraph, the microorganism is a microorganism into which an exogenous lipoate protein ligase, lipoyl synthase, and lipoamide dehydrogenase have been introduced.

3. In the second paragraph, the microorganism, wherein the exogenous lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase are derived from a microorganism of the genus Mycobacterium.

4. A microorganism in the third paragraph, wherein the exogenous lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase are derived from Mycobacterium smegmatis.

5. A microorganism according to claim 1, wherein the lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase each comprise amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO:

3.

6. A microorganism according to claim 5, wherein the lipoate protein ligase, lipoyl synthase and lipoamide dehydrogenase are encoded by polynucleotides comprising the nucleic acid sequences of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

7. In the first paragraph, the microorganism has enhanced activity of a glycine cleavage system.

8. A microorganism according to claim 7, wherein the glycine cleavage system comprises at least one subunit selected from the group consisting of GcvP, GcvT, and GcvH polypeptides.

9. A microorganism according to claim 7, wherein the glycine cleavage system comprises at least one selected from the group consisting of a GcvP polypeptide comprising the amino acid sequence of SEQ ID NO: 77 or an amino acid sequence having at least 90% sequence identity thereto, a GcvT polypeptide comprising the amino acid sequence of SEQ ID NO: 78 or an amino acid sequence having at least 90% sequence identity thereto, and a GcvH polypeptide comprising the amino acid sequence of SEQ ID NO: 79 or an amino acid sequence having at least 90% sequence identity thereto.

10. In the 9th paragraph, the microorganism is a microorganism into which a glycine cleavage system derived from Mycobacterium smegmatis or a polynucleotide encoding the same has been introduced.

11. In the first paragraph, the microorganism is a microorganism of the genus Corynebacterium.

12. A microorganism according to claim 11, wherein the microorganism is Corynebacterium glutamicum.

13. In the 7th paragraph, the microorganism is a microorganism whose activity of L-serine deaminase is further weakened.

14. A microorganism according to any one of claims 1 to 13, wherein the microorganism has increased production of at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan compared to a parent strain or wild type in which the activities of lipoate protein ligase, lipoyl synthase, and lipoamide dehydrogenase are not enhanced.

15. A production method for at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan, comprising a step of culturing a microorganism of any one of claims 1 to 13 in a medium.

16. A method for producing at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan, further comprising a step of recovering at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan from the culture medium or microorganism according to the 15th paragraph.

17. A production composition comprising at least one microorganism selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, comprising any one of claims 1 to 13.

18. Use of the microorganism of any one of claims 1 to 13 for the production of at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan.

Images