Peptide-based inhibitors of PTP1b / NCK1 interaction and methods of making and using same

Abstract

The disclosure relates generally to synthetic peptides which bind NCK1. The invention further relates to methods of using the peptides for inhibiting an interaction between NCK1 and PTP1B, and for treating a disease or disorder associated with insulin resistance, including type 2 diabetes and obesity.

Description

PEPTIDE-BASED INHIBITORS OF PTP1B / NCK1 INTERACTION AND METHODS OF MAKING AND USING SAME CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 688,211, filed August 28, 2024, and U.S. Provisional Application No.63 / 828,666, filed June 23, 2025, the entire disclosure of each of which is hereby incorporated by reference in its entirely for all purposes. SEQUENCE LISTING

[0002] This application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML copy, created on August 21, 2025, is named CGP-003WO_SL.xml and is 631,757 bytes in size. FIELD OF THE DISCLOSURE

[0003] The disclosure relates generally to synthetic peptides which bind NCK1 and their use in treating diseases and disorders, including obesity and Type 2 Diabetes (T2D). BACKGROUND

[0004] Diabetes is a chronic metabolic disease involving the production and / or activity of insulin. It is estimated that more than 500 million people around the world are living with diabetes, and this number is expected to continue to increase. In the United States alone, 140 million adults have diabetes or prediabetes, mostly linked to excessive body weight and sedentary lifestyle. Type 2 diabetes (T2D; i.e., Type 2 diabetes mellitus) is the most common form of diabetes, accounting for approximately 90% of diabetes cases (Ong et al. (2023) LANCET 402(10397): 203-34). T2D is characterized by hyperglycemia resulting from insulin resistance. There is no approved cure for T2D, and treatment for the disease can require a lifetime of continuous medication. T2D is a progressive condition and thus, treatment typically must increase over time to keep blood glucose levels within the recommended range. Complications from T2D can have a considerable impact on health, resulting in damage to organs throughout the body. T2D is also a significant cause of blindness, kidney failure, heart attacks, stroke, and lower limb amputation. Only a limited number of approved medications for treatment of T2D exist, and most approaches focus on similar targeting systems, such as insulins, metformin, and glucagon like 1 peptide (GLP) analogues (e.g. semaglutide and liraglutide). However, current interventions are not always successful, can have significant side effects, and do not target theroot cause of T2D, insulin resistance. Accordingly, there is a substantial need for novel, more effective treatments for T2D.

[0005] Obesity is a complex disease and a major risk factor not only for T2D (with 80% of T2D patients being overweight or obese), but also for other chronic illnesses and associated mortality, such as cardiovascular diseases (e.g., heart disease, stroke), hypertension, metabolic syndrome, atherosclerosis, non-alcoholic fatty liver disease (NAFLD), various forms of dementia, including Alzheimer's disease, cancer and other diseases (Lin et al. (2021) FRONT. ENDOCRINOL.12: 706978). It is believed that the “Western diet” is fuelling an obesity epidemic, with rates of excess body fat accumulation and obesity growing fast in adults and children across all ages. In 2020, it was estimated that 38% of the world population is classified as overweight or obese. This is projected to rise to 51% by 2035, continuing a trajectory that saw worldwide obesity nearly triple between 1975-2016 (Lobstein et al., World Obesity Atlas 2023, World Obesity Federation). First-line treatment plans for obesity start with lifestyle intervention, including diet and physical activity, which are then supplemented with medications such as GLP-1 analogues, lipase inhibitors, and appetite suppressors. However, many of these medications are of limited efficacy and / or may cause significant adverse side effects, and so there is a significant unmet need for additional obesity treatments.

[0006] The insulin receptor (IR) is a transmembrane receptor tyrosine kinase (RTK) which binds extracellular ligands (e.g., insulin) and thereby initiates the phosphoinositide 3-kinase (PI3K) / Protein Kinase B (Akt) signaling cascade in the IR signaling pathway, ultimately resulting in glucose uptake. Defects in IR signaling (e.g., decreased IR kinase activity, decreased cellular levels of IR, and / or decreased downstream pathway signaling from the IR) can contribute to a decrease in responsiveness to normal insulin levels, for example, insulin resistance, which is known to be a key factor in the development of T2D.

[0007] Protein-tyrosine phosphatase 1B (PTP1B) is an endoplasmic reticulum (ER)-associated phosphatase. PTP1B is known to interact with, and dephosphorylate, the activated insulin receptor, thereby resulting in the downregulation of the insulin receptor signaling pathway (Bock et al. (2006) DIABETES 55(12): 3536-3549). In mice, genetic ablation of the gene encoding PTP1B is known to result in enhanced insulin sensitivity and increased insulin receptor phosphorylation (Tsou et al. (2013) FRONT. NEUROSCI.6: 192). Additionally, PTP1B - / - mice are resistant to weight gain, and remain insulin-sensitive when placed on a high-fat diet (Elchebly et al. (1999) SCIENCE 283(5407): 1544-48). PTP1B is also a negative regulator of leptin receptor. Accordingly, PTP1B has been contemplated as a therapeutic target, particularlyfor the treatment of obesity and type 2 diabetes (Zabolotny et al. (2002) DEV. CELL 2(4): 489- 95). However, to date, no inhibitors of PTP1B have been approved in the United States or Europe for the treatment of T2D.

[0008] Accordingly, there is a need in the art for compositions and methods for treating diseases or disorders associated with insulin resistance (e.g., T2D, obesity, etc.), for example, by inhibiting certain activities of PTP1B in a subject in need thereof. SUMMARY OF THE INVENTION

[0009] In the insulin receptor (IR) signaling pathway, the Cellular Protein-tyrosine phosphatase 1B (PTP1B) interacts with the SH3-2 domain of the non-catalytic region of tyrosine kinase 1 protein (NCK1) to produce a cellular signaling complex. NCK1 is a cytoplasmic adaptor protein known to be involved in transducing signals from receptor tyrosine kinases to downstream signaling recipients. NCK1 modulates the expression of PTP1B, and it has been observed that NCK1 depletion enhances insulin sensitivity similar to that seen with PTP1B inhibition (Li et al. (2014) CELL COMMUN. SIGNAL.12(1): 71).

[0010] As discussed herein, the interaction between the SH3-2 domain of NCK1 and PTP1B can modulate the downstream signaling activity of the insulin receptor and the IR mediated pathway. By contacting NCK1 with a peptide-based agent that interferes with the interaction between the NCK1 SH3-2 domain and PTP1B, PTP1B-mediated downregulation of the IR signaling pathway can be suppressed, thereby restoring IR signaling (see, FIGURES 1A-C). Additionally, it is contemplated that interfering with the specific complex formation between NCK1 and PTP1B (as opposed to inhibiting PTP1B activity broadly) will not suppress other activities of PTP1B, which are important for normal cellular function. Likewise, by only targeting one domain of NCK1, it is anticipated that other important functions of the NCK1 adaptor protein will not be materially impacted. Disruption of the NCK1-PTP1B complex presents a novel approach to functionally achieving selective inhibition of PTP1B.

[0011] The disclosure provides, among other things, modified synthetic peptides that bind NCK1, and particularly the SH3-2 domain of NCK1. Furthermore, the NCK1-binding synthetic peptides of the disclosure can be administered to a subject in need thereof to treat or prevent a disease or disorder, e.g., diabetes or obesity. The synthetic peptides of the disclosure may comprise an amino acid analog (e.g., a proline analog, an arginine analog, and / or a lysine analog) an N-terminal fatty acid modification, and / or a D-amino acid, which can improve stability, oral bioavailability, and / or pharmacokinetic half-life of the synthetic peptide, as well alter tissue distribution (e.g., by permitting greater access or distribution to the central nervoussystem) relative to a peptide without such modification(s). In certain embodiments, a synthetic peptide of the disclosure consists essentially of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, a synthetic peptide of the disclosure is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 amino acids (or amino acid analogs) in length.

[0012] Accordingly, in a first aspect, the disclosure provides a synthetic peptide comprising an amino acid sequence of at least seven consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises an amino acid sequence according to Formula I: X1P'2X3X4P'5X6R (Formula I) wherein X1is selected from any amino acid and a proline analog; P'2is proline or a proline analog; X3is selected from any amino acid and a proline analog; X4is selected from alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, and a proline analog; P'5is proline or a proline analog; X6is selected from any amino acid and a proline analog; and wherein the synthetic peptide comprises at least one proline analog. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of seven to ten consecutive amino acids or amino acid analogs.

[0013] Each proline analog can, for example, be independently selected from the group consisting of L-pipecolic acid, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, (S)-1,2,3,4- tetrahydroisoquinoline-3-carboxylic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, trans-4-hydroxyproline, (S)-2-amino-3-(thiophen-2- yl)propanoic acid, L-azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid , (2S,4S)-4-aminopyrrolidine-2-carboxylic acid, (2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, (S)-indoline-2-carboxylic acid, (S)-oxazolidine-4-carboxylic acid, cis-4- hydroxyproline, (2S,3R)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,3S)-3-hydroxypyrrolidine- 2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4S)-4- (difluoromethyl)pyrrolidine-2-carboxylic acid, 2,4-methanoproline, (2S,4R)-4-(difluoromethoxy)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2- carboxylic acid, (S)-isoxazolidine-3-carboxylic acid, 4-trans-guanidinoproline, 4-cis- guanidinoproline, alpha-methyl-L-proline, and α-aminoisobutyric acid. For example, each proline analog can be independently selected from (i) the group consisting of L-pipecolic acid, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, (S)-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4- difluoroproline, trans-4-hydroxyproline, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, L- azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid , (2S,4S)-4- aminopyrrolidine-2-carboxylic acid, (2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro- L-proline, (S)-indoline-2-carboxylic acid, (S)-oxazolidine-4-carboxylic acid, cis-4- hydroxyproline, (2S,3R)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,3S)-3-hydroxypyrrolidine- 2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4S)-4- (difluoromethyl)pyrrolidine-2-carboxylic acid, 2,4-methanoproline, (2S,4R)-4- (difluoromethoxy)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2- carboxylic acid, (S)-isoxazolidine-3-carboxylic acid, 4-trans-guanidinoproline, 4-cis- guanidinoproline, and alpha-methyl-L-proline; (ii) the group consisting of L-pipecolic acid, (S)- 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4- difluoroproline, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, trans-4-hydroxyproline, (2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, alpha-methyl-L-proline, L-azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid, (S)-oxazolidine-4- carboxylic acid, (S)-indoline-2-carboxylic acid, (2S,4S)-4-aminopyrrolidine-2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, α-aminoisobutyric acid, (2S,4S)-4- (difluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(difluoromethoxy)pyrrolidine-2- carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2-carboxylic acid, cis-4- hydroxyproline, and 2,4-methanoproline; or (iii) the group consisting of L-pipecolic acid, (S)- 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4- difluoroproline, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, and trans-4-hydroxyproline. In certain embodiments, each proline analog is an internal residue of the synthetic peptide, e.g., wherein each proline analog is independently selected from the list of proline analogs set forth in Table A1. Additionally or alternatively, the at least one proline analog may be the N-terminal residue of the synthetic peptide, e.g., wherein the at least one proline analog is selected from the list of proline analogs set forth in Table A2.

[0014] For the first aspect, in certain embodiments of the synthetic peptide, X1is (i) a proline analog, or (ii) an amino acid selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine (e.g., proline). In certain embodiments, P'2is (i) a proline analog, or (ii) proline. In certain embodiments, X3is (i) a proline analog, or (ii) an amino acid selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine, for example, alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, or valine (e.g., arginine). In certain embodiments, X4is (i) a proline analog, or (ii) an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, proline, threonine, tyrosine, and valine, for example, alanine, isoleucine, proline, or valine (e.g., proline). In certain embodiments, P'5is (i) a proline analog, or (ii) proline. In certain embodiments, X6is (i) a proline analog, or (ii) an amino acid selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine, for example, alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, or valine (e.g., lysine).

[0015] For the first aspect, in certain embodiments, the synthetic peptide further comprises an amino acid or amino acid analog (X0) at a position that is immediately N-terminal to position X1. In certain embodiments, X0is (i) a proline analog, or (ii) selected from any amino acid, for example, proline or alanine (e.g., proline). In certain embodiments, the synthetic peptide further comprises an amino acid or amino acid analog (X8) at a position that is immediately C-terminal to the arginine at position 7 of Formula I. In certain embodiments, X8is (i) a proline analog, or (ii) selected from any amino acid, for example, an amino acid selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, serine, tryptophan, or tyrosine (e.g., isoleucine, arginine, cysteine, or alanine).

[0016] In a second aspect, the disclosure provides a synthetic peptide comprising an amino acid sequence of at least seven consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises an amino acid sequence according to Formula II: X1P X3X4P X6R'7(Formula II) wherein X1is selected from any amino acid and an arginine analog; X3is selected from any amino acid and an arginine analog; X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, and an arginine analog; X6is selected from any amino acid and an arginine analog; R'7is arginine or an arginine analog; and the synthetic peptide comprises at least one arginine analog. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of seven to ten consecutive amino acids or amino acid analogs.

[0017] Each arginine analog can, for example, be independently selected from the group consisting of L-homoarginine, L-citrulline, L-ornithine, 4-guanidinophenylalanine, 4-trans- guanidinoproline, 4-cis-guanidinoproline, methylarginine, asymmetric dimethylarginine, symmetric dimethylarginine, beta,beta-dimethylarginine, 2-amino-4-guanidino- L-butyric acid, and 2-amino-3-guanidino- L-propionic acid. For example, each arginine analog may be independently selected from (i) the group consisting of L-homoarginine, L-citrulline, L-ornithine, 4-guanidinophenylalanine, 4-trans-guanidinoproline, 4-cis-guanidinoproline, methylarginine, asymmetric dimethylarginine, symmetric dimethylarginine, and beta, beta-dimethylarginine; (ii) the group consisting of L-homoarginine, L-citrulline, L-ornithine, methylarginine, symmetric dimethylarginine, 2-amino-4-guanidino- L-butyric acid, 2-amino-3-guanidino- L-propionic acid, 4-cis-guanidinoproline, beta,beta-dimethylarginine, asymmetric dimethylarginine, 4-trans- guanidinoproline, and 4-guanidinophenylalanine; and / or (iii) the group consisting of L- homoarginine and L-citrulline. In certain embodiments, each arginine analog is an internal residue of the synthetic peptide, for example, wherein each arginine analog is independently selected from the list of arginine analogs set forth in Table B1. Additionally or alternatively, the at least one arginine analog is the N-terminal residue of the synthetic peptide for example, wherein the at least one arginine analog is selected from the list of arginine analogs set forth in Table B3. In further embodiments, the at least one arginine analog is the C-terminal residue of the synthetic peptide, for example, wherein the at least one arginine analog is selected from the list of arginine analogs set forth in Table B2.

[0018] For the second aspect, in certain embodiments, X1is (i) an arginine analog, or (ii) an amino acid selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine,phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine, for example, proline. In certain embodiments, X3is (i) an arginine analog, or (ii) an amino acid selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine, for example, alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, or valine (e.g., arginine). In certain embodiments, X4is (i) an arginine analog, or (ii) an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, proline, threonine, tyrosine, and valine, for example, alanine, isoleucine, proline, or valine (e.g., proline). In certain embodiments, X6is (i) an arginine analog, or (ii) an amino acid selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine, for example, alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, or valine (e.g., lysine). In certain embodiments, R'7is (i) an arginine analog, or (ii) arginine.

[0019] For the second aspect, in certain embodiments, the synthetic peptide further comprises an amino acid or amino acid analog (X0) at a position that is immediately N-terminal to position X1. In certain embodiments, X0is (i) an arginine analog, or (ii) selected from any amino acid, for example, proline or arginine (e.g., proline). In certain embodiments, the synthetic peptide further comprises an amino acid or amino acid analog (X8) at a position that is immediately C- terminal to position R'7of Formula II. In certain embodiments, X8is (i) an arginine analog, or (ii) selected from any amino acid, for example, selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine, e.g. alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, serine, tryptophan, or tyrosine (e.g., isoleucine, arginine, cysteine, or alanine).

[0020] In a third aspect, the disclosure provides a synthetic peptide comprising an amino acid sequence of at least seven consecutive amino acids or amino acid analogs, including an N- terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises an amino acid sequence according to Formula III: X1P X3X4P X6R (Formula III)wherein X1is selected from any amino acid and a lysine analog; X3is selected from any amino acid and a lysine analog; X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, and a lysine analog; X6is selected from any amino acid and a lysine analog; and the synthetic peptide comprises at least one lysine analog. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of seven to ten consecutive amino acids or amino acid analogs.

[0021] Each lysine analog can, for example, be independently selected from the group consisting of L-ornithine, L-citrulline, L-homolysine, (S)-2-amino-3-(3-aminophenyl)propanoic acid, S-(2-aminoethyl)-L-cysteine, and 2,4-diamino-L-butryic acid. For example, each lysine analog can be independently selected from (i) the group consisting of L-ornithine, L-citrulline, L- homolysine, (S)-2-amino-3-(3-aminophenyl)propanoic acid, and S-(2-aminoethyl)-L-cysteine; or (ii) the group consisting of L-ornithine, L-citrulline, 2,4-diamino-L-butryic acid, L-homolysine, and S-(2-aminoethyl)-L-cysteine. In certain embodiments, each lysine analog is L-ornithine. In certain embodiments, each lysine analog is an internal residue of the synthetic peptide, e.g., wherein each lysine analog is independently selected from the list of lysine analogs set forth in Table C1. Additionally or alternatively, the at least one lysine analog is the N-terminal residue of the synthetic peptide, for example, wherein the at least one lysine analog is selected from the list of lysine analogs set forth in Table C2. In further embodiments, the at least one lysine analog is the C-terminal residue of the synthetic peptide.

[0022] For the third aspect, in certain embodiments, X1is (i) a lysine analog, or (ii) an amino acid selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine, for example, proline. In certain embodiments, X3is (i) a lysine analog, or (ii) selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine, for example, alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, or valine (e.g., arginine). In certain embodiments, X4is (i) a lysine analog, or (ii) an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, proline, threonine, tyrosine, and valine, for example, alanine, isoleucine, proline, or valine (e.g., proline). In certain embodiments, X6is (i) a lysine analog, or (ii) an amino acid selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine,glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine, for example, alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, or valine (e.g., lysine).

[0023] For the third aspect, in certain embodiments, the synthetic peptide further comprises an amino acid or amino acid analog (X0) at a position that is immediately N-terminal to position X1. In certain embodiments, X0is (i) a lysine analog, or (ii) selected from any amino acid, for example, proline or alanine (e.g., alanine). In certain embodiments, the synthetic peptide further comprises an amino acid or amino acid analog (X8) at a position that is immediately C-terminal to the arginine at position 7 of Formula III. In certain embodiments, X8is (i) a lysine analog, or (ii) selected from any amino acid, for example, selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, serine, tryptophan, or tyrosine (e.g., isoleucine, arginine, cysteine, or alanine).

[0024] For the first, second, and third aspects, the synthetic peptide can, in certain embodiments, comprise at least one D-amino acid.

[0025] In a fourth aspect, the disclosure provides a synthetic peptide comprising an amino acid sequence of at least seven consecutive amino acids or amino acid analogs, including an N- terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises an amino acid sequence according to Formula IV: X1P'2X3X4P'5X6R'7(Formula IV) wherein X1is selected from any amino acid, a proline analog, an arginine analog, and a lysine analog; P'2is proline or a proline analog; X3is selected from any amino acid, a proline analog, an arginine analog, and a lysine analog; X4is selected from alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, a proline analog, an arginine analog, and a lysine analog; P'5is proline or a proline analog; X6is selected from any amino acid, a proline analog, an arginine analog, and a lysine analog;R'7is selected from arginine and an arginine analog; and wherein (i) the synthetic peptide comprises at least one amino acid analog, and / or (ii) the synthetic peptide comprises at least one D-amino acid. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of seven to ten consecutive amino acids or amino acid analogs.

[0026] For the fourth aspect, the synthetic peptide may comprise at least one proline analog. For example, in certain embodiments, each proline analog is independently selected from (i) the group consisting of L-pipecolic acid, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, (S)- 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (R)-thiazolidine-4-carboxylic acid, cis-4- fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, trans-4-hydroxyproline, (S)-2-amino-3- (thiophen-2-yl)propanoic acid, L-azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid, (2S,4S)-4-aminopyrrolidine-2-carboxylic acid, (2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, (S)-indoline-2-carboxylic acid, (S)-oxazolidine-4-carboxylic acid, cis-4-hydroxyproline, (2S,3R)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,3S)-3- hydroxypyrrolidine-2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4S)-4-(difluoromethyl)pyrrolidine-2-carboxylic acid, 2,4-methanoproline, (2S,4R)-4- (difluoromethoxy)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2- carboxylic acid, (S)-isoxazolidine-3-carboxylic acid, 4-trans-guanidinoproline, 4-cis- guanidinoproline, alpha-methyl-L-proline, and α-aminoisobutyric acid; (ii) the group consisting of L-pipecolic acid, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, (S)-1,2,3,4- tetrahydroisoquinoline-3-carboxylic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, trans-4-hydroxyproline, (S)-2-amino-3-(thiophen-2- yl)propanoic acid, L-azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid , (2S,4S)-4-aminopyrrolidine-2-carboxylic acid, (2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, (S)-indoline-2-carboxylic acid, (S)-oxazolidine-4-carboxylic acid, cis-4- hydroxyproline, (2S,3R)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,3S)-3-hydroxypyrrolidine- 2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4S)-4- (difluoromethyl)pyrrolidine-2-carboxylic acid, 2,4-methanoproline, (2S,4R)-4- (difluoromethoxy)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2- carboxylic acid, (S)-isoxazolidine-3-carboxylic acid, 4-trans-guanidinoproline, 4-cis- guanidinoproline, and alpha-methyl-L-proline; (iii) the group consisting of L-pipecolic acid, (S)- 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4- difluoroproline, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, trans-4-hydroxyproline,(2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, alpha-methyl-L-proline, L-azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid, (S)-oxazolidine-4- carboxylic acid, (S)-indoline-2-carboxylic acid, (2S,4S)-4-aminopyrrolidine-2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, α-aminoisobutyric acid, (2S,4S)-4- (difluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(difluoromethoxy)pyrrolidine-2- carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2-carboxylic acid, cis-4- hydroxyproline, and 2,4-methanoproline; or (iv) the group consisting of L-pipecolic acid, (S)- 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4- difluoroproline, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, and trans-4-hydroxyproline.

[0027] For the fourth aspect, the synthetic peptide may additionally or alternatively comprise at least one arginine analog. For example, in certain embodiments, each arginine analog is independently selected from (i) the group consisting of L-homoarginine, L-citrulline, L-ornithine, 4-guanidinophenylalanine, 4-trans-guanidinoproline, 4-cis-guanidinoproline, methylarginine, asymmetric dimethylarginine, symmetric dimethylarginine, beta,beta-dimethylarginine, 2- amino-4-guanidino- L-butyric acid, and 2-amino-3-guanidino- L-propionic acid; (ii) the group consisting of L-homoarginine, L-citrulline, L-ornithine, 4-guanidinophenylalanine, 4-trans- guanidinoproline, 4-cis-guanidinoproline, methylarginine, asymmetric dimethylarginine, symmetric dimethylarginine, and beta,beta-dimethylarginine; (iii) the group consisting of L- homoarginine, L-citrulline, L-ornithine, methylarginine, symmetric dimethylarginine, 2-amino-4- guanidino- L-butyric acid, and 2-amino-3-guanidino- L-propionic acid, 4-cis-guanidinoproline, beta,beta-dimethylarginine, asymmetric dimethylarginine, 4-trans-guanidinoproline, and 4- guanidinophenylalanine; or (iv) the group consisting of L-homoarginine and L-citrulline.

[0028] For the fourth aspect, the synthetic peptide may additionally or alternatively comprise at least one lysine analog. For example, in certain embodiments, each lysine analog is independently selected from (i) the group consisting of L-ornithine, L-citrulline, L-homolysine, (S)-2-amino-3-(3-aminophenyl)propanoic acid, S-(2-aminoethyl)-L-cysteine, and 2,4-diamino-L- butryic acid; (ii) the group consisting of L-ornithine, L-citrulline, L-homolysine, (S)-2-amino-3- (3-aminophenyl)propanoic acid, and S-(2-aminoethyl)-L-cysteine; or (iii) the group consisting of L-ornithine, L-citrulline, 2,4-diamino-L-butryic acid, L-homolysine, and S-(2-aminoethyl)-L- cysteine. For example, in certain embodiments, each lysine analog is L-ornithine.

[0029] For the fourth aspect, in certain embodiments, each proline analog can be an internal residue of the synthetic peptide (e.g., wherein each proline analog is independently selected fromthe list of proline analogs set forth in Table A1), each arginine analog can be an internal residue of the synthetic peptide (e.g., wherein each arginine analog is independently selected from the list of arginine analogs set forth in Table B1), and / or each lysine analog can be an internal residue of the synthetic peptide (e.g., wherein each lysine analog is independently selected from the list of lysine analogs set forth in Table C1).

[0030] For the fourth aspect, in certain embodiments, the N-terminal residue of the synthetic peptide is a proline analog, an arginine analog, or a lysine analog, optionally wherein the N- terminal residue is selected from the list of proline analogs set forth in Table A2, the list of arginine analogs set forth in Table B3, or the list of lysine analogs set forth in Table C2, respectively. Additionally or alternatively, the C-terminal residue of the synthetic peptide may be an arginine analog, e.g., wherein the C-terminal residue is selected from the list of arginine analogs set forth in Table B2.

[0031] For the fourth aspect, in certain embodiments, X1is (i) an amino acid selected from alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine, for example, proline; or (ii) a proline analog, an arginine analog, or a lysine analog, for example, a proline analog. In certain embodiments, P'2is (i) proline or (ii) a proline analog. In certain embodiments, X3is (i) an amino acid selected from alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine, for example, alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, or valine (e.g., arginine); or (ii) a proline analog, an arginine analog, or a lysine analog, for example, an arginine analog. In certain embodiments, X4is (i) selected from alanine, arginine, isoleucine, leucine, lysine, proline, threonine, tyrosine, and valine, for example, alanine, isoleucine, proline, or valine (e.g., proline); or (ii) a proline analog, an arginine analog, or a lysine analog, for example, a proline analog. In certain embodiments, P'5is (i) proline or (ii) a proline analog. In certain embodiments, X6is (i) selected from alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine, for example, alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, or valine (e.g., lysine); or (ii) a proline analog, an arginine analog, or a lysine analog, for example, a lysine analog. In certain embodiments, R'7is (i) arginine or (ii) an arginine analog.

[0032] For the fourth aspect, in certain embodiments, the synthetic peptide further comprises an amino acid or amino acid analog (X0) at a position that is immediately N-terminal to position X1. X0can, for example, be selected from any amino acid, e.g., proline or alanine. X0may also be a proline analog, an arginine analog, or a lysine analog, for example, a proline analog. In certain embodiments, the synthetic peptide further comprises an amino acid or amino acid analog (X8) at a position that is immediately C-terminal to the arginine or arginine analog at position R'7. X8can, for example, be selected from any amino acid. In certain embodiments, X8is (i) selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine, for example, alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, serine, tryptophan, or tyrosine (e.g., arginine, cysteine, alanine, or isoleucine); or (ii) a proline analog, an arginine analog, or a lysine analog. In certain embodiments, X8is a proline analog.

[0033] For any of the first, second, third, or fourth aspects in embodiments where X0is present, X0can be, for example, a D-amino acid, e.g., D-proline or D-alanine.

[0034] For any of the first, second, third, or fourth aspects in embodiments where X8is present, X8can be, for example, a D-amino acid, e.g., D-alanine, D-arginine, or D-isoleucine.

[0035] For any of the first, second, third, or fourth aspects, in certain embodiments, X1is a D- amino acid, e.g., D-proline.

[0036] For any of the first, second, third or fourth aspects, the N-terminal residue of the synthetic peptide may comprise a modification. For example, the N-terminal residue can be acetylated and / or can comprise a fatty acid modification. The fatty acid modification can, for example, be selected from the group consisting of N-epsilon-palmitoyl-L-lysine, N-epsilon-((S)- 4-carboxy-4-palmitamidobutanoyl)-L-lysine, (1S,28S)-1-amino-7,16,25,30-tetraoxo-9,12,18,21- tetraoxa-6,15,24,29-tetraazahexatetracontane-1,28,46-tricarboxylic acid, (1S,28S)-1-amino- 7,16,25,30-tetraoxo-9,12,18,21-tetraoxa-6,15,24,29-tetraazaoctatetracontane-1,28,48- tricarboxylic acid, N-epsilon-heptanoyl-L-lysine, N-epsilon-octanoyl-L-lysine, N-epsilon-lauroyl- L-lysine, N-epsilon-(12-aminolauroyl)- L-lysine, N-gamma-lauroyl-L-glutamine, N-epsilon- myristoyl-L-lysine, (S)-16-((5-amino-5-carboxypentyl)amino)-16-oxohexadecanoic acid, 16- (((S)-4-(((S)-5-amino-5-carboxypentyl)amino)-1-carboxy-4-oxobutyl)amino)-16- oxohexadecanoic acid, N-epsilon-stearoyl-L-lysine, propionic acid, butyric acid, valeric acid, caproic acid, adipic acid, heptanoic acid, caprylic acid, octanedioic acid, capric acid, decanedioic acid, lauric acid, dodecanedioic acid, 12-aminododecanoic acid, tridecylic acid, myristic acid,tetradecanedioic acid, pentadecylic acid, pentadecanedioic acid, palmitic acid, thapsic acid, margaric acid, heptadecanedioic acid, stearic acid, octadecanedioic acid, nonadecylic acid, nonadecanedioic acid, arachidic acid, icosanedioic acid, behenic acid, and docosanedioic acid (e.g., a fatty acid modification selected from the group consisting of N-epsilon-palmitoyl-L- lysine, N-epsilon-((S)-4-carboxy-4-palmitamidobutanoyl)-L-lysine, and (1S,28S)-1-amino- 7,16,25,30-tetraoxo-9,12,18,21-tetraoxa-6,15,24,29-tetraazahexatetracontane-1,28,46- tricarboxylic acid.) In certain embodiments, the fatty acid modification is selected from the list of fatty acid modifications set forth in Table D.

[0037] For any of the first, second, third, or fourth aspects, the synthetic peptide can comprise the amino acid sequence of any one of SEQ ID NOs: 171-202, 209-328, 330-357, or 366.

[0038] In a fifth aspect, the disclosure provides a synthetic peptide comprising an amino acid sequence of at least seven consecutive amino acids or amino acid analogs, including an N- terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises an amino acid sequence according to Formula III: X1P X3X4P X6R (Formula III) wherein X1is selected from any amino acid; X3is selected from any amino acid; X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine; X6is selected from any amino acid; and the synthetic peptide comprises an N-terminal fatty acid modification. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of seven to ten consecutive amino acids or amino acid analogs. The N-terminal fatty acid modification can be, e.g., selected from the list of fatty acid modifications set forth in Table D.

[0039] For the fifth aspect, in certain embodiments, the N-terminal fatty acid modification is selected from the group consisting of N-epsilon-palmitoyl-L-lysine, N-epsilon-((S)-4-carboxy-4- palmitamidobutanoyl)-L-lysine, (1S,28S)-1-amino-7,16,25,30-tetraoxo-9,12,18,21-tetraoxa- 6,15,24,29-tetraazahexatetracontane-1,28,46-tricarboxylic acid, (1S,28S)-1-amino-7,16,25,30- tetraoxo-9,12,18,21-tetraoxa-6,15,24,29-tetraazaoctatetracontane-1,28,48-tricarboxylic acid, N- epsilon-heptanoyl-L-lysine, N-epsilon-octanoyl-L-lysine, N-epsilon-lauroyl-L-lysine, N-epsilon- (12-aminolauroyl)- L-lysine, N-gamma-lauroyl-L-glutamine, N-epsilon-myristoyl-L-lysine, (S)- 16-((5-amino-5-carboxypentyl)amino)-16-oxohexadecanoic acid, 16-(((S)-4-(((S)-5-amino-5- carboxypentyl)amino)-1-carboxy-4-oxobutyl)amino)-16-oxohexadecanoic acid, N-epsilon- stearoyl-L-lysine, propionic acid, butyric acid, valeric acid, caproic acid, adipic acid, heptanoic acid, caprylic acid, octanedioic acid, capric acid, decanedioic acid, lauric acid, dodecanedioicacid, 12-aminododecanoic acid, tridecylic acid, myristic acid, tetradecanedioic acid, pentadecylic acid, pentadecanedioic acid, palmitic acid, thapsic acid, margaric acid, heptadecanedioic acid, stearic acid, octadecanedioic acid, nonadecylic acid, nonadecanedioic acid, arachidic acid, icosanedioic acid, behenic acid, and docosanedioic acid. In certain embodiments, the N-terminal fatty acid modification is selected from the group consisting of N-epsilon-palmitoyl-L-lysine, N- epsilon-((S)-4-carboxy-4-palmitamidobutanoyl)- L-lysine, and (1S,28S)-1-amino-7,16,25,30- tetraoxo-9,12,18,21-tetraoxa-6,15,24,29-tetraazahexatetracontane-1,28,46-tricarboxylic acid. In certain embodiments, the N-terminal residue of the synthetic peptide is also acetylated.

[0040] For the fifth aspect, in certain embodiments, X1is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine (e.g., proline). In certain embodiments, X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine, for example, alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, or valine (e.g., arginine). In certain embodiments, X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, proline, threonine, tyrosine, and valine, for example, alanine, isoleucine, proline, or valine (e.g., proline). In certain embodiments, X6is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine, for example, alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, or valine (e.g., lysine).

[0041] For the fifth aspect, in certain embodiments, the synthetic peptide further comprises an amino acid (X0) at a position that is immediately N-terminal to position X1. In certain embodiments, X0is selected from any amino acid, for example, proline or alanine (e.g., proline). In certain embodiments, the synthetic peptide further comprises an amino acid (X8) at a position that is immediately C-terminal to the arginine at position 7 of Formula III. In certain embodiments, X8is selected from any amino acid, for example, from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine,methionine, phenylalanine, serine, tryptophan, or tyrosine (e.g., isoleucine, arginine, cysteine, or alanine).

[0042] For the fifth aspect, in certain embodiments, the synthetic peptide comprises the amino acid sequence of any one of SEQ ID NOs: 203-208, 358-360, or 367.

[0043] In certain embodiments of each of the foregoing aspects, X1is the N-terminal amino acid or amino acid analog of the synthetic peptide. In other embodiments, the synthetic peptide comprises 1, 2, or 3 amino acids N-terminal to position X1. In certain embodiments of each of the foregoing aspects, the amino acid or amino acid analog at position 7 is the C-terminal amino acid or amino acid analog of the synthetic peptide. In other embodiments, the synthetic peptide comprises 1, 2, or 3 amino acids C-terminal to position X7. In certain embodiments of each of the foregoing aspects, the amino acid sequence of the synthetic peptide consists essentially of seven, eight, nine, or ten consecutive amino acids or amino acid analogs.

[0044] In certain embodiments of each of the foregoing aspects: (i) if X3is alanine and X4is valine, then X6is not proline; (ii) if X4is proline and X6is arginine, then X3is not arginine or glutamine; and / or (iii) if X4is proline and X6is methionine, then X3is not histidine.

[0045] In certain embodiments of each of the foregoing aspects, the C-terminal amino acid or amino acid analog comprises a modification. For example, the C-terminal amino acid or amino acid analog can be amidated, or may comprise an ethylamide (NHEt) group.

[0046] In certain embodiments of each of the foregoing aspects, the foregoing synthetic peptides exhibit binding to the SH3-2 domain of NCK1 with a KDof < 1,000 µM, e.g., with a KDof ≤ 600 µM or with a KDof ≤ 300 µM.

[0047] In another aspect, the disclosure provides a composition comprising (i) any one of the foregoing synthetic peptides, and (ii) a salt. The salt can be an acetate, e.g., a bis-acetate or a tri- acetate. In certain embodiments, the purity of the synthetic peptide in the composition is at least 95% (e.g., 95%, 96%, 97%, 98%, 99%).

[0048] In a related aspect, the disclosure provides a pharmaceutical composition comprising a synthetic peptide of any one of the foregoing embodiments, and a pharmaceutically acceptable carrier. In certain embodiments, the pharmaceutical composition is sterile. In certain embodiments, the pharmaceutical composition is dried (e.g., freeze dried or lyophilized), or the pharmaceutical composition is an aqueous composition (e.g., an injectable aqueous composition).

[0049] In another aspect, the disclosure provides a delivery system comprising (i) a delivery device and (ii) one of the foregoing compositions or pharmaceutical compositions. The delivery device can be, e.g., a syringe.

[0050] In another aspect, the disclosure provides a method of modulating the activity of NCK1, the method comprising contacting NCK1 with any of the foregoing synthetic peptides or compositions, thereby to modulate the activity of NCK1. In certain embodiments, the step of contacting disrupts the interaction between PTP1B and NCK1, and / or the step of contacting results in modulating the activity of PTP1B.

[0051] In another aspect, the disclosure provides a method of decreasing body fat mass in a subject in need thereof, the method comprising administering to the subject an effective amount of any one of the foregoing synthetic peptides, compositions comprising one or more of such peptides, or pharmaceutical compositions comprising one or more of such peptides, thereby to decrease body fat mass of the subject.

[0052] In another aspect, the disclosure provides a method of treating or preventing obesity in a subject in need thereof, the method comprising administering to the subject an effective amount of any one of the foregoing synthetic peptides, compositions comprising one or more of such peptides, or pharmaceutical compositions comprising one or more of such peptides, thereby to treat or prevent obesity in the subject.

[0053] In another aspect, the disclosure provides a method of treating or preventing diabetes in a subject in need thereof, the method comprising administering to the subject an effective amount of any one of the foregoing synthetic peptides, compositions comprising one or more of such peptides, or pharmaceutical compositions comprising one or more of such peptides, thereby to treat or prevent diabetes in the subject. In certain embodiments, the diabetes is type 2 diabetes.

[0054] In certain embodiments of the foregoing therapeutic methods, the subject is a mammal, e.g., a human. In certain embodiments of the foregoing therapeutic methods, the administration comprises systemic administration and / or subcutaneous administration.

[0055] These and other aspects and features of the invention are described in the following detailed description and claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] The invention can be more completely understood with reference to the following drawings, in which:

[0057] FIGURE 1A is a schematic that depicts interaction between PTP1B (labeled “2”) and NCK1 (labeled “1”) (upper panel) and disruption between the two proteins using a NCK1- binding modulating agent (labeled “3”), such as a synthetic peptide disclosed herein (lower panel). FIGURES 1B-1C are schematics depicting the impact of NCK1 and PTP1B on insulin receptor signaling (FIGURE 1B), and the how the use of a NCK1-binding modulating agent can disrupt the interaction between NCK1 and PTP1B and consequently enhance insulin pathway signaling, thereby restoring insulin sensitivity (FIGURE 1C). The term “IR” represents insulin receptor, the term “IRS1” represents insulin receptor substrate 1, and the term “PI3K / AKT” represents “phosphoinositide 3-kinase / protein kinase B.”

[0058] FIGURES 2A-2D depict immunoblots showing co-immunoprecipitation of FLAG- PTP1B and HA-NCK1 in HEK-293 cells co-transfected with both proteins. Either FLAG- PTP1B (FIGURE 2A) or HA-NCK1 (FIGURE 2B) was immunoprecipitated from the co- transfected cells, and Western blotting was used to detect the presence of the other fusion protein in the cell lysate (lane 2) and the IP eluate (lane 4). Non-transfected HEK-293 cells were used as negative controls (lanes 1 and 3). Ponceau staining was used to measure total protein in the FLAG-PTP1B IP assay (FIGURE 2C) and in the HA-NCK1 IP assay (FIGURE 2D).

[0059] FIGURE 3 depicts an immunoblot showing co-immunoprecipitation of His-PTP1B and GST-tagged full-length NCK1 (“N” or “GST NCK1”) or GST-tagged SH3-2 domain of NCK1 (“SH3-2” or “GST SH3-2”). Bead-bound GST fusion protein was co-incubated with the indicated concentration of His-PTP1B, and His-PTP1B was detected in the IP eluate by Western blotting (top image). GST alone (“X” or “Control GST”) and GST-tagged PTP1B (“P” or “GST PTP1B”) were used as negative controls. “E protein” refers to the purified SH3-2 domain of NCK1. Ponceau staining was used to measure total protein (bottom image).

[0060] FIGURE 4A depicts an immunoblot showing that certain peptides prevent co- immunoprecipitation of FLAG-PTP1B and GST-tagged SH3-2 domain of NCK1 (“SH3”). GST was fused to full-length NCK1 (“Nck1”), all SH3 domains of NCK1 (“SH3”), the NCK1 SH2 domain (“SH2”), the NCK1 SH3-1 domain (“SH31”), the NCK1 SH3-2 domain (“SH32”), and the NCK1 SH3-3 domain (“SH33”). GST alone was used as a negative control (“GST”). FLAG-PTP1B was incubated with the indicated bead-bound GST-fusion protein, and FLAG- PTP1B was detected in the IP eluate by western blotting. The outlined region in column “SH3- 2” identifies the PTP1B band. For GST-SH3-2 and FLAG-PTP1B, the mixture was further incubated with one of peptides A through K, (1 mM). FIGURE 4B depicts an input control for the immunoblot. FIGURE 4C depicts a Ponceau stain for the immunoblot, which was used tomeasure total protein. FIGURE 4D depicts a legend summarizing the peptides tested in columns A through K, and summarizes which peptides did and did not break the interaction between FLAG-PTP1B and SH3-2, based on the results in FIGURE 4A.

[0061] FIGURE 5 is a bar graph showing the efflux ratios of different compounds in a Caco-2 assay. The efflux ratio of MD20 (0.252) is indicated as a bolded line.

[0062] FIGURE 6 is a graph showing MD20 concentrations in the indicated tissues in a mouse following intraperitoneal (IP) administration of the peptide at a dose of 30 mg / kg. Tissue samples were collected at 0, 0.25, 0.5, 1, 2, 4, 8, and 24 hours post-injection. MD20 was not detected in liver tissue at any time point.

[0063] FIGURES 7A-7B are graphs showing body weight changes in mice following daily IP injection of MD17 or MD20 at a dose of 15 mg / kg or 30 mg / kg for 28 consecutive days. Mice injected with a PBS solution were used as a control. Results are reported as mean body weight of the treatment group at weekly timepoints (FIGURE 7A) and as the percentage change in body weight at the conclusion of the 4-week protocol (FIGURE 7B).

[0064] FIGURES 8A-8D are bar graphs showing changes in lean mass and fat mass (as measured by Echo MRI scan) in mice following daily IP injection of MD17 or MD20 at a dose of 15 mg / kg or 30 mg / kg for 28 consecutive days. Mice injected with a PBS solution were used as a control. Results are reported as mean lean mass (FIGURE 8A) and mean fat mass (FIGURE 8B) pre- and post-treatment, and as the percentage change in lean mass (FIGURE 8C) and fat mass (FIGURE 8D) at the conclusion of the 4-week protocol. Data represent mean ± SEM; statistical differences were determined using one-way ANOVA with Bonferroni post hoc tests.

[0065] FIGURES 9A-9F are bar graphs showing metabolic markers and liver toxicity markers in mice following daily IP injection of MD17 or MD20 at a dose of 15 mg / kg or 30 mg / kg for 28 consecutive days. Mice injected with a PBS solution were used as a control. Mice were fasted for 5 hours at the conclusion of the experiment, and blood and serum samples were analyzed for blood glucose (FIGURE 9A), insulin (FIGURE 9B), leptin (FIGURE 9C), free fatty acid (FAA, FIGURE 9D), and for liver toxicity markers alanine aminotransferase (ALT) (FIGURE 9E) and aspartate aminotransferase (AST) (FIGURE 9F). Data represent mean ± SEM; statistical differences were determined using one-way ANOVA with Bonferroni post hoc tests.

[0066] FIGURE 10 depicts a diagram summarizing the mouse high-fat diet (HFD) study described in Example 7, which was used to investigate the effect of daily IP MD20 administration (30 mg / kg) on a mouse model of obesity and type 2 diabetes.

[0067] FIGURES 11A-11B are graphs showing body weight changes in HFD-fed mice following daily administration of MD20. After eight weeks of HFD feeding, mice were administered a daily IP injection of MD20 (30 mg / kg) or a vehicle control for 7 weeks. Results are reported as mean body weight of the treatment group at weekly timepoints (FIGURE 11A) and as the percentage change in body weight at weekly timepoints post-treatment with MD20 (FIGURE 11B).

[0068] FIGURES 12A-12F are graphs showing changes in lean mass and fat mass (as measured by Echo MRI scan) in HFD-fed mice following daily administration of MD20. After eight weeks of HFD feeding, mice were administered a daily IP injection of MD20 (30 mg / kg) or a vehicle control for 7 weeks. Results for the indicated weeks post-treatment are reported as mean fat mass (FIGURE 12A, FIGURE 12B), mean lean mass (FIGURE 12A, FIGURE 12D), and percentage change in fat mass (FIGURE 12C). Results at the conclusion of the protocol are reported as percentage change in fat mass (FIGURE 12E) and the percentage change in lean mass (FIGURE 12F). Data represent mean ± SEM; statistical differences were determined using repeated measures two-way ANOVA followed by a Bonferroni post hoc test or two-tailed student’s t-test.

[0069] FIGURES 13A-13B are graphs showing the results of an insulin tolerance test (ITT) in HFD-fed mice following 7 weeks of daily IP administration of MD20 (30 mg / kg) or a vehicle control. At the conclusion of the study, mice were 5-hour fasted and subsequently injected IP with 0.6 mU / g insulin. Blood glucose levels were measured at 0, 15, 30, 60, and 90 minutes post-insulin injection. Results were reported as blood glucose concentration (FIGURE 13A) and as percentage change in blood glucose levels (FIGURE 13B). Data represent mean ± SEM; statistical differences were determined using repeated measures two-way ANOVA followed by Bonferroni post hoc test.

[0070] FIGURE 14 is a bar graph showing changes in blood glucose levels in HFD-fed mice before and during the course of 7 weeks of daily IP administration of MD20 (30 mg / kg) or a vehicle control. Blood glucose levels were measured prior to starting an HFD diet (“pre-HFD”), following administration of an HFD diet but prior to treatment (“pre-treat”), and at the indicated timepoints following daily treatment with MD20 or vehicle control (“week #”). Data represent mean ± SEM; statistical differences were determined using one-way ANOVA followed by Bonferroni post hoc test.

[0071] FIGURE 15 is a graph showing the results of a glucose tolerance test (GTT) in HFD- fed mice following 7 weeks of daily IP administration of MD20 (30 mg / kg) or a vehicle control.At the conclusion of the study, mice were 5-hour fasted and subsequently injected IP with 2 mg / g glucose. Blood glucose levels were measured at 0, 15, 30, 60, and 90 minutes post-glucose injection. Results were reported as blood glucose concentration. Data represent mean ± SEM; statistical differences were determined using repeated measures two-way ANOVA followed by Bonferroni post hoc test.

[0072] FIGURES 16A-16F are graphs showing serum levels of various markers in HFD-fed mice following 7 weeks of daily IP administration of MD20 (30 mg / kg) or a vehicle control. Mice were fasted for 5 hours at the conclusion of the experiment, and serum samples were analyzed for levels of insulin (FIGURE 16A), leptin (FIGURE 16B), cholesterol (FIGURE 16C), free fatty acids (FIGURE 16D), triglycerides (FIGURE 16E), and liver triglycerides (FIGURE 16F). Data represent mean ± SEM; statistical differences were determined using two tailed student’s t-test.

[0073] FIGURES 17A-17B are graphs showing serum ALT and AST activity in HFD-fed mice following 7 weeks of daily IP administration of MD20 (30 mg / kg) or a vehicle control. Mice were fasted for 5 hours at the conclusion of the experiment, and serum samples were analyzed for alanine aminotransferase (ALT) activity (FIGURE 17A) and aspartate aminotransferase (AST) activity (FIGURE 17B). Data represent mean ± SEM; statistical differences were determined using two tailed student’s t-test.

[0074] FIGURES 18A-18B are graphs showing changes in body weight in db / db mice following daily subcutaneous (SC) administration of either 15, 30, or 45 mg / kg MD18 (FIGURE 18A) or 15, 30, or 45 mg / kg MD20 (FIGURE 18B) for the indicated number of days, as compared to a vehicle control (“PBS”). Data represent means ± SEM.

[0075] FIGURES 19A-19D are graphs showing changes in changes in fat mass (FIGURE 19A and FIGURE 19C) and lean mass (FIGURE 19B and FIGURE 19D) in db / db mice following daily SC administration of MD18 (15, 30, or 45 mg / kg), MD20 (15, 30, or 45 mg / kg), or a vehicle control for 41 days. Data are presented as absolute mass (FIGURE 19A and FIGURE 19B) and as percent change in mass pre- versus post-treatment (FIGURE 19C and FIGURE 19D). Data represent means ± SEM.

[0076] FIGURES 20A-20E are graphs showing the results of a glucose tolerance test (GTT) in db / db mice. A GTT was carried after 4 weeks of daily SC administration of either MD18 (15, 30, or 45 mg / kg;), MD20 (15, 30, or 45 mg / kg;), or a vehicle control, as indicated. The GTT was carried out by IP injecting 5h-fasted mice with glucose. Blood glucose levels were measured pre-glucose-injection and at 15, 30, 60, and 90 minutes post-glucose injection, andresults were reported as blood glucose concentration (FIGURE 20A and FIGURE 20B), as percent change in blood glucose concentration pre- versus post-treatment (FIGURE 20C and FIGURE 20D), and as the glucose area under the curve (AUC; FIGURE 20E). Data represent means ± SEM.

[0077] FIGURES 21A-21C are graphs showing the results of an insulin tolerance test (ITT) in db / db mice following 6 weeks of daily SC administration of either MD18 (15, 30, or 45 mg / kg; FIGURE 21A), MD20 (15, 30, or 45 mg / kg; FIGURE 21B), or a vehicle control. The ITT was carried out by injecting 5h-fasted mice IP with 1 IU / kg insulin. Blood glucose levels were measured pre-insulin-injection and at 15, 30, 60, and 90 minutes post-insulin injection. Results were reported as percentage change in glucose levels (FIGURES 21A-21B) and as the glucose AUC (FIGURE 21C). Data represent means ± SEM.

[0078] FIGURES 22A-22E are bar graphs showing basal blood glucose levels in db / db mice over after 1 week (FIGURE 22A), 2 weeks (FIGURE 22B), 3 weeks (FIGURE 22C), 4 weeks (FIGURE 22D), or five weeks (FIGURE 22E) of daily SC administration of either MD18 (15, 30, or 45 mg / kg), MD20 (15, 30, or 45 mg / kg), or a vehicle control (“PBS”). Blood glucose was measured using AlphaTRAK 2 glucose strips and glucometer (Abbott, UK) or by glucose assay (AB65333, Abcam), as indicated. Data represent means ± SEM.

[0079] FIGURES 23A-23B are graphs showing serum levels of insulin (FIGURE 23A) and leptin (FIGURE 23B) in 5-hour-fasted db / db mice following about 6 weeks of daily SC administration of MD18 (15, 30, or 45 mg / kg), MD20 (15, 30, or 45 mg / kg), or a vehicle control (“PBS”). Data represent mean ± SEM.

[0080] FIGURES 24A-24C are graphs showing body weight changes in LDLR- / - mice following daily administration of MD20. After eight weeks of HFD feeding, mice were administered a daily IP injection of MD20 (30 mg / kg) or a vehicle control for 6 weeks. Results are reported as mean body weight at weekly timepoints post-HFD-feeding (FIGURE 24A) or post-MD20 treatment (FIGURE 24C), or as percentage change in body weight post-treatment (FIGURE 24B). Data represent mean ± SEM; statistical differences were determined using two way ANOVA followed by Bonferroni post hoc tests.

[0081] FIGURES 25A-25F are graphs showing changes in lean mass and fat mass (as measured by Echo MRI scan) in HFD-fed LDLR- / - mice following daily administration of MD20 (30 mg / kg) or a vehicle control for 6 weeks. Data were recorded at the indicated timepoints post-treatment, and results are reported as absolute fat mass (FIGURE 25A), percentage change in fat mass (FIGURES 25B and FIGURE 25C), absolute lean mass(FIGURE 25D), and percentage change in lean mass (FIGURES 25E and FIGURE 25F). Data represent mean ± SEM; statistical differences were determined using repeated measures two-way ANOVA followed by a Bonferroni post hoc test or two-tailed student’s t-test.

[0082] FIGURES 26A-26D are graphs showing the results of an insulin tolerance test (ITT) in HFD-fed LDLR- / - mice following 6 weeks of daily IP administration of either MD20 (30 mg / kg) or a vehicle control. At the conclusion of the study, mice were 5h-fasted and subsequently injected IP with 0.6 mU / g insulin. Blood glucose levels were measured pre-insulin injection (basal glucose concentration; FIGURE 26C) and at 15, 30, 60, and 90 minutes post- insulin injection. Results were reported as blood glucose concentration (FIGURE 26A), as percentage change in glucose levels (FIGURE 26B), and as the glucose AUC FIGURE 26D). Data represent mean ± SEM; statistical differences were determined using (repeated measures two-way ANOVA followed by Bonferroni post hoc test.

[0083] FIGURES 27A-27C are graphs showing the results of a glucose tolerance test (GTT) in HFD-fed LDLR- / - mice. A GTT was carried after 0 weeks (FIGURE 27A), 3 weeks (FIGURE 27B), and 5 weeks (FIGURE 27C) of daily IP administration of either MD20 (30 mg / kg) or a vehicle control. The GTT was carried out by IP injecting 5h-fasted mice with 2 mg / g glucose. Blood glucose levels were measured at 0, 15, 30, 60, and 90 minutes post-glucose injection, and results were reported as blood glucose concentration. Data represent mean ± SEM; statistical differences were determined using repeated measures two-way (FIGURES 27A-27B) or one-way (FIGURE 27C) ANOVA followed by Bonferroni post hoc test.

[0084] FIGURES 28A-28H are graphs showing levels of various hormones, lipids, and hepatic toxicity markers in HFD-fed LDLR- / - mice following 6 weeks of daily IP administration of MD20 (30 mg / kg) or a vehicle control. Mice were fasted for 5 hours at the conclusion of the experiment, and serum samples were analyzed for levels of insulin (FIGURE 28A), leptin (FIGURE 28B), cholesterol (FIGURE 28C), free fatty acids (FIGURE 28D), triglycerides (FIGURE 28E), alanine aminotransferase (ALT) activity (FIGURE 28G), and aspartate aminotransferase (AST) activity (FIGURE 28H). Liver triglyceride levels were also analyzed (FIGURE 28F). Data represent mean ± SEM; statistical differences were determined using two tailed student’s t-test.

[0085] FIGURES 29A-29B summarize the extent of aortic plaque coverage in HFD-fed LDLR- / - mice following 6 weeks of daily IP administration of MD20 (30 mg / kg) or a vehicle control. FIGURE 29A is a graph showing percentage of aortic plaque coverage in MD20- treated mice (“Treatment”) as compared to control mice (“Vehicle”). Data represent mean ±SEM; statistical differences were determined using one- or two-tailed student’s t-test. FIGURE 29B is a photograph depicting a mouse aorta stained with Sudan IV to measure plaque coverage.

[0086] FIGURES 30A-30E are graphs showing expression of various genes in tissues of HFD-fed LDLR- / - mice following 6 weeks of daily IP administration of MD20 (30 mg / kg) or a vehicle control. Mice were fasted for 5 hours at the conclusion of the experiment, liver and white adipose tissue (“WAT”) samples were collected, and gene expression was measured by qRT-PCR. Expression of glucose transporter 4 (GLUT4; FIGURE 30A) and stearoyl-CoA- desaturase 1 (SCD1; FIGURE 30B) was measured in adipose tissue, and expression of Glucose- 6-phosphatase (G6P; FIGURE 30C), Activating Transcription Factor 4 (ATF4; FIGURE 30D), and 3-hydroxy-3-methylglutaryl (HMGCS; FIGURE 30E) was measured in liver tissue. Data represent mean ± SEM; statistical differences were determined using two tailed student’s t-test. DETAILED DESCRIPTION

[0087] In the insulin receptor (“IR”) signaling pathway, PTP1B interacts with the SH3-2 domain of the protein NCK1 to produce an intracellular signaling complex that mediates signaling in the IR pathway. NCK1 is a cytoplasmic adaptor protein known to be involved in transducing signals from receptor tyrosine kinases to downstream signaling recipients. NCK1 modulates the expression of PTP1B, and NCK1 depletion enhances insulin sensitivity similar to that seen with PTP1B inhibition (Li et al. (2014) supra). Deletion of NCK1 has previously been found to decrease ER stress, improve glucose tolerance and insulin signaling in mice (Latreille et al. (2011) AM. J. PHYSIOL. ENDOCRINOL. METAB.300(3): E423-E434; Bywaters et al. (2021)) and to increase pancreatic β cells survival and insulin synthesis under diabetic conditions (Yamani et al. (2014) MOL. BIOL. CELL 25(5): 702-711; Yamani et al. (2015) CELL. SIGNAL. 27(12): 2555-2567). NCK1 has been found to play a role in regulating insulin signaling via activation of the PI3K / AKT pathway via a PTP1B-dependent mechanism, i.e. forming an interaction complex with PTP1B (Li et al. (2014) supra).

[0088] As discussed herein, the interaction between the SH3-2 domain of NCK1 and PTP1B can modulate the activity of the insulin receptor (IR) and the IR-mediated pathway. By contacting NCK1 with a peptide-based agent that interferes with the interaction between the NCK1 SH3-2 domain and PTP1B, PTP1B-mediated downregulation of the IR signaling pathway can be suppressed, thereby restoring IR signaling (see, FIGURES 1A-1C). Additionally, it is anticipated that interfering with the specific complex formation between NCK1 and PTP1B (as opposed to inhibiting PTP1B activity broadly) will not suppress other activities of PTP1B, which are important for normal cellular function. Likewise, by only targeting one domain of NCK1, itis anticipated that other important functions of the NCK1 adaptor protein will not be materially impacted. Disruption of the NCK1-PTP1B complex presents a novel approach to functionally achieving selective inhibition of PTP1B.

[0089] The disclosure provides, among other things, modified synthetic peptides that bind NCK1, and particularly the SH3-2 domain of NCK1. Furthermore, the NCK1-binding synthetic peptides of the disclosure can be administered to a subject in need thereof to treat or prevent a disease or disorder, e.g., diabetes or obesity. The synthetic peptides of the disclosure may comprise an amino acid analog (e.g., a proline analog, an arginine analog, and / or a lysine analog), an N-terminal fatty acid modification, and / or a D-amino acid, which can improve stability, oral bioavailability, and / or pharmacokinetic half-life of the synthetic peptide, as well alter tissue distribution (e.g., by permitting greater access or distribution to the central nervous system). I. Definitions

[0090] Where the use of the term “about” is before a quantitative value, the present invention also includes the specific quantitative value itself, unless specifically stated otherwise. As used herein, the term “about” refers to a ±10% variation from the nominal value unless otherwise indicated or inferred.

[0091] The term “effective amount” as used herein refers to the amount of an active agent (e.g., a synthetic peptide) sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations, applications, or dosages and is not intended to be limited to a particular formulation or administration route. For example, an effective amount may be an amount sufficient to achieve one or more of the following: (i) modulate an activity of NCK1, (ii) modulate an activity of PTP1B, (iii) inhibit, disrupt, reduce, or prevent NCK1-binding to PTP1B, (iv) increase, enhance, or restore insulin receptor signaling; (v) treat or prevent a disease or disorder, e.g., Type 2 diabetes or obesity, or a symptom or manifestation thereof; (vi) decrease body weight or lessen an increase in body weight; or (vii) decrease body fat mass or lessen an increase in body fat mass.

[0092] As used herein, the term “isolated” when used in conjunction with a particular article (e.g., protein, peptide, nucleic acid, or cell) is understood to mean: (1) that the article has been separated or purified from other components (e.g., other proteins, peptides, nucleic acids, cells, or cellular materials) and / or chemicals (e.g., reagents used in manufacture); (2) that the article may be separated or purified from the environment in which it may exist in nature, for example, a tissue or fluid sample; or (3) that the article does not occur in nature. For example, a moleculethat is removed from a cell that produces it, is “isolated.” A chemically synthesized molecule is “isolated.” As used herein, the term “isolated” can also refer to a molecule that is substantially free of other molecules of the same species. For example, a protein or peptide may be “isolated” from other proteins or peptides having different amino acid sequences. The purity or homogeneity of a desired article can be assayed using techniques well known in the art, including gel electrophoresis, high performance liquid chromatography, or mass spectrometry. Any of the polynucleotides or polypeptides described herein may be isolated.

[0093] As used herein, the term “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0094] The term “pharmaceutically acceptable carrier” as used herein refers to buffers, carriers, and excipients suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable carriers include any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions (e.g., such as an oil / water or water / oil emulsions), and various types of wetting agents. The compositions also can include stabilizers and preservatives. For examples of carriers, stabilizers, and adjuvants, see e.g., Adeboye Adejare, Remington: The Science and Practice of Pharmacy (23d ed.2020).

[0095] As used herein, “percent identity” between a polypeptide sequence and a reference sequence is defined as the percentage of amino acid residues in the polypeptide sequence that are identical to the amino acid residues in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Similarly, percent “identity” between a nucleic acid sequence and a reference sequence is defined as the percentage of nucleotides in the nucleic acid sequence that are identical to the nucleotides in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent sequence identity (e.g., nucleic acid sequence identity or amino acid sequence identity) can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST (Basic Local Alignment Search Tool), BLAST-2, ALIGN, MEGALIGN (DNASTAR), CLUSTALW, CLUSTAL OMEGA, or MUSCLE software. For adiscussion of basic issues in searching sequence databases see Altschul et al., (1994) NATURE GENETICS 6:119-129, which is fully incorporated by reference herein. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0096] As used herein, “treat”, “treating”, and “treatment” refer to the treatment of a disease, disorder, or symptom or manifestation of such in a subject, e.g., in a human. This includes: (a) preventing a disease or disorder, (b) inhibiting the disease, disorder, etc., i.e., slowing or arresting its progress or development; and (b) relieving the disease, disorder, etc., i.e., causing regression of the disease state. As used herein, “prevent”, “preventing” and “prevention” refer to causing a disease, disorder, or symptom or manifestation of such not to occur for at least a period of time in at least some subjects. As used herein, the terms “subject” and “patient” refer to an organism to be treated by the methods and compositions described herein. Such organisms preferably include, but are not limited to, mammals (e.g., murines, simians, equines, bovines, porcines, canines, felines, and the like), and more preferably includes humans.

[0097] As used herein, the term “polypeptide”, refers to a polymer of amino acids, optionally including one or more amino acid analogs. A protein is a molecule composed of one or more polypeptides. A peptide is a relatively short polypeptide, typically between about 2 and 60 amino acids or amino acid analogs in length. However, depending upon the circumstances, the terms “protein”, “polypeptide”, and “peptide” may be used interchangeably. It is contemplated that polypeptides used herein may contain amino acids such as those that are naturally found in proteins, or can be replaced with amino acids that are not naturally found in proteins and / or amino acid analogs that are not amino acids, but where the resulting polypeptides have comparable binding activity or other biological activities as the polypeptides disclosed herein. One or more of the amino acids in a polypeptide may be modified, for example, by the addition of a chemical entity such as an amide group, an acetyl group, or a fatty acid moiety. For example, the polypeptide may be acetylated, e.g., at the N-terminus; amidated, e.g., at the C- terminus; and / or modified by a fatty acid moiety, e.g., at the N-terminus.

[0098] As used herein, an “amino acid analog” refers to a compound containing an amine and a carboxylic acid group capable of being incorporated into the backbone of a polypeptide chain but is chemically and / or structurally different from a proteogenic amino acid. For example, an amino acid analog may have the same basic chemical structure as a proteogenic amino acid (e.g., an organic molecule containing an amine group, a carboxyl group, and a side chain or R group), but with a modified side chain or R group. The modified side chain or R group of the aminoacid analog can mimic that of a proteogenic amino acid and retain at least some of the same basic chemical behavior as the proteogenic amino acid. A large number of art-recognized analogs of the 20 amino acids commonly found in proteins (the “standard” amino acids) are known. For example, a large number of proline analogs are known in the art, as described in, e.g., Kubyshkin and Rubini (2012) CHEM. REV.124(13):8130-8232.

[0099] As used herein, “ P’ ” in the context of a peptide refers to either a naturally-occurring proline residue or a proline analog.

[0100] As used herein, “ R’ ” in the context of a peptide refers to either a naturally-occurring arginine residue or an arginine analog.

[0101] Polypeptides may, for example, be purified from natural sources, produced in vitro or in vivo using recombinant DNA technology in suitable expression systems (e.g., by recombinant host cells or in transgenic animals or plants), synthesized through chemical means such as solid phase peptide synthesis, liquid-phase peptide synthesis, and / or methods involving chemical ligation of synthesized peptides (see, e.g., Kent (2003) J. PEPT. SCI.9(9):574-93), or any combination of the foregoing. These methods are well known, and one of skill in the art will be able to select and implement an appropriate method for synthesizing the peptides and polypeptides described herein.

[0102] As used herein, the terms “polypeptide sequence” or “amino acid sequence” can refer to a sequence of covalently coupled amino acids and / or amino acid analogs, but is not necessarily restricted to the sequence information (i.e. the succession of letters or three letter codes chosen among the letters and codes used as abbreviations for amino acid names) that biochemically characterizes a polypeptide. A polypeptide sequence presented herein is presented in an N-terminal to C-terminal direction unless otherwise indicated.

[0103] The term “purified”, as used herein, means that an entity or substance is separated from one or more other entities or substances with which it was previously found before being purified. An entity or substance may be partially purified, substantially purified, or pure. A substance or entity such as a nucleic acid or polypeptide is considered pure when it is removed from substantially all other compounds or entities other than a solvent and any ions contained in the solvent, i.e., it constitutes at least about 90%, more preferably at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater than 99% of the dry weight of the composition. A partially or substantially purified compound or entity such as a nucleic acid or polypeptide may be removed from at least 50%, at least 60%, at least 70%, or at least 80% by weight of the material with which it is naturally found, e.g., cellular material such as cellular proteins and / ornucleic acids. In certain embodiments, the purified nucleic acid or polypeptide constitutes at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or even more, by dry weight, of the total nucleic acid or polypeptide, respectively, in a composition. Methods for assessing purity are known in the art and include chromatographic methods, immunological methods, electrophoretic methods, etc. Any of the polynucleotides or polypeptides described herein may be purified.

[0104] As used herein, “recombinant host cells,” “host cells,” and other such terms, denote prokaryotic or eukaryotic cells or cell lines that have been used as recipients for an exogenous nucleic acid (typically DNA) such as an expression vector into which a nucleic acid portion that encodes a polypeptide of interest has been inserted. These terms include the progeny of the original cell into which the vector or other nucleic acid has been introduced. Appropriate unicellular host cells include any of those routinely used in expressing polynucleotides (e.g., eukaryotic, mammalian, and / or viral polynucleotides) including, for example, prokaryotes, such as E. coli; and eukaryotes, including for example, fungi, such as yeast (e.g., Pichia pastoris and Saccharomyces cerevisiae); insect cells (e.g., Sf9), plant cells, and animal cells, e.g., mammalian cells such as CHO, R1.1, B-W, L-M, African Green Monkey Kidney cells (e.g. COS-1, COS-7, BSC-1, BSC-40 and BMT-10) and cultured human cells. Terms such as “host cells”, etc., are also used to refer to cells or cell lines that can be used as recipients for an exogenous nucleic acid, prior to its introduction. As used herein, the term “recombinant nucleic acid” refers to a nucleic acid that contains nucleic acid portions that are not found joined together in nature. As used herein, the term “recombinant polypeptide” refers to a polypeptide that is produced by transcription and translation of an exogenous nucleic acid by a recombinant host cell, typically after introduction of an expression vector that contains a portion that encodes the recombinant polypeptide into the host cell.

[0105] As used herein, the term “charged amino acid” refers to an amino acid selected from arginine, histidine, lysine, aspartic acid (i.e., aspartate), and glutamic acid (i.e., glutamate). As used herein, the term “positively charged amino acid” refers to an amino acid selected from arginine, histidine, and lysine. As used herein, the term “negatively charged amino acid” refers to an amino acid selected from aspartic acid (i.e., aspartate) and glutamic acid (i.e., glutamate).

[0106] As used herein, the term “uncharged amino acid” refers to an amino acid selected from alanine, asparagine, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

[0107] As used herein, the term “hydrophobic amino acid” refers to an amino acid selected from alanine, cysteine, isoleucine, leucine, methionine, phenylalanine, tryptophan, and valine.

[0108] As used herein, the term “hydrophilic amino acid” refers to an amino acid selected from arginine, asparagine, aspartic acid, glutamine, glutamic acid, and lysine.

[0109] As used herein, the term “neutral amino acid” refers to an amino acid selected from glycine, histidine, proline, serine, threonine, and tyrosine.

[0110] As used herein, the term “aliphatic amino acid” refers to an amino acid selected from alanine, glycine, isoleucine, leucine, proline, and valine.

[0111] As used herein, the term “aromatic amino acid” refers to an amino acid selected from phenylalanine, tryptophan, and tyrosine. As used herein, the term “non-aromatic amino acid” refers to an amino acid selected from alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, and valine.

[0112] As used herein, the term “conservative substitution” refers to a substitution with a structurally similar amino acid. For example, conservative substitutions may include those within the following groups: Ser and Cys; Leu, Ile, and Val; Glu and Asp; Lys and Arg; Phe, Tyr, and Trp; and Gln, Asn, Glu, Asp, and His. Conservative substitutions may also be defined by the BLAST (Basic Local Alignment Search Tool) algorithm, the BLOSUM substitution matrix (e.g., BLOSUM 62 matrix), or the PAM substitution:p matrix (e.g., the PAM 250 matrix). In certain embodiments, a synthetic peptide of the disclosure comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 conservative substitutions relative to a “wild type” or reference peptide or amino acid sequence. In certain embodiments, a synthetic peptide of the disclosure comprises less than 2, less than 3, less than 4, less than 5, less than 6, less than 7, less than 8, less than 9, less than 10, less than 11, less than 12, less than 13, less than 14, or less than 15 conservative substitutions relative to a “wild type” or reference peptide or amino acid sequence.

[0113] As used herein, the term "carbonyl-containing moiety” refers to any chemical moiety that contains a carbonyl group. In certain embodiments, the carbonyl-containing moiety is not and does not contain an amino acid. A non-limiting example of a carbonyl-containing moiety is an acetyl group. In certain embodiments, the carbonyl group of the carbonyl- containing moiety is covalently attached to the most N-terminal nitrogen of the N-terminal amino acid in a peptide. In certain embodiments, if the N-terminal amino acid is proline, then the carbonyl group of the carbonyl-containing moiety is covalently attached to the nitrogen adjacent to the alpha carbon in proline’s five-membered ring.II. Synthetic Peptides

[0114] The present disclosure encompasses the finding that synthetic peptides comprising a motif of PTP1B can bind NCK1. NCK1 is a cytoplasmic adaptor protein known to be involved in transducing signals from receptor tyrosine kinases to downstream signaling proteins. NCK1 comprises, in the N- to C-terminal direction, a first, second, and third SRC Homology 3 domain (SH3 domain; referred to herein as SH3-1, SH3-2, and SH3-3, respectively) and an SRC Homology 2 domain (SH2 domain). SH3 domains are small, intracellular protein domains which mediate protein-protein interactions. An exemplary amino acid sequence for wild-type human NCK1 is set forth as SEQ ID NO: 140. The SH3-1, SH3-2, and SH3-3 domains of NCK1 correspond to positions 2-61, 106-165, and 190-252, respectively, of SEQ ID NO: 140.

[0115] Without wishing to be bound by theory, it is believed that by binding to the SH3-2 domain of NCK1, the synthetic peptides comprising at least a portion of the PTP1B motif reduce, inhibit, or prevent interaction between PTP1B and NCK1, thereby specifically modulating the activity of PTP1B, e.g., by reducing or inhibiting PTP1B-mediated downregulation of insulin receptor signaling and / or by modulating regulation of the PI3K / AKT pathway. Additionally, without wishing to be bound by theory, the synthetic peptides of the disclosure may comprise an amino acid analog (e.g., a proline analog, an arginine analog, and / or a lysine analog), an N-terminal fatty acid modification, and / or a D-amino acid, which are believed to be capable of improving the stability, oral bioavailability, and / or pharmacokinetic half-life of the synthetic peptide.

[0116] Accordingly, in one aspect, the disclosure provides a synthetic NCK1-binding peptide comprising an amino acid sequence of at least seven consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the synthetic peptide comprises (1) an amino acid analog selected from a proline analog, an arginine analog, and / or a lysine analog; (2) an N-terminal fatty acid modification; and / or (3) a D-amino acid. In certain embodiments, a synthetic NCK1-binding peptide of the disclosure comprises an amino acid sequence according to Formula I, II, III, or IV: X1P'2X3X4P'5X6R (Formula I) X1P X3X4P X6R'7(Formula II) X1P X3X4P X6R (Formula III) X1P'2X3X4P'5X6R'7(Formula IV).

[0117] In certain embodiments, a synthetic peptide of the disclosure consists essentially of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15,7 to 14, 7 to 13, 7 to 12, 7 to 11, 7 to 10, 7 to 9, 7 to 8, 8 to 50, 8 to 40, 8 to 30, 8 to 25, 8 to 20, 8 to 15, 8 to 14, 8 to 13, 8 to 12, 8 to 11, 8 to 10, 8 to 9, 9 to 50, 9 to 40, 9 to 30, 9 to 25, 9 to 20, 9 to 15, 9 to 14, 9 to 13, 9 to 12, 9 to 11, 9 to 10, 10 to 50, 10 to 40, 10 to 30, 10 to 25, 10 to 20, 10 to 15, 10 to 14, 10 to 13, 10 to 12, 10 to 11, 11 to 50, 11 to 40, 11 to 30, 11 to 25, 11 to 20, 11 to 15, 11 to 14, 11 to 13, 11 to 12, 12 to 50, 12 to 40, 12 to 30, 12 to 25, 12 to 20, 12 to 15, 12 to 14, 12 to 13, 13 to 50, 13 to 40, 13 to 30, 13 to 25, 13 to 20, 13 to 15, 13 to 14, 14 to 50, 14 to 40, 14 to 30, 14 to 25, 14 to 20, 14 to 15, 15 to 50, 15 to 40, 15 to 30, 15 to 25, 15 to 20, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 50, 25 to 40, 25 to 30, 30 to 50, 30 to 40, or 40 to 50 consecutive amino acids or amino acid analogs (e.g., 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs). For example, in certain embodiments, a synthetic peptide of the disclosure consists essentially of 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive amino acids or amino acid analogs. In certain embodiments, a synthetic peptide of the disclosure consists essentially of 7 to 10 consecutive amino acids or amino acid analogs, e.g. 7 to 10, 8 to 10, 9 to 10, 7 to 9, 8 to 9, or 7 to 8 consecutive amino acids or amino acid analogs. For example, in certain embodiments, a synthetic peptide of the disclosure consists essentially of 7, 8, 9, or 10 consecutive amino acids or amino acid analogs.

[0118] In certain embodiments, a synthetic peptide of the disclosure is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, 7 to 14, 7 to 13, 7 to 12, 7 to 11, 7 to 10, 7 to 9, 7 to 8, 8 to 50, 8 to 40, 8 to 30, 8 to 25, 8 to 20, 8 to 15, 8 to 14, 8 to 13, 8 to 12, 8 to 11, 8 to 10, 8 to 9, 9 to 50, 9 to 40, 9 to 30, 9 to 25, 9 to 20, 9 to 15, 9 to 14, 9 to 13, 9 to 12, 9 to 11, 9 to 10, 10 to 50, 10 to 40, 10 to 30, 10 to 25, 10 to 20, 10 to 15, 10 to 14, 10 to 13, 10 to 12, 10 to 11, 11 to 50, 11 to 40, 11 to 30, 11 to 25, 11 to 20, 11 to 15, 11 to 14, 11 to 13, 11 to 12, 12 to 50, 12 to 40, 12 to 30, 12 to 25, 12 to 20, 12 to 15, 12 to 14, 12 to 13, 13 to 50, 13 to 40, 13 to 30, 13 to 25, 13 to 20, 13 to 15, 13 to 14, 14 to 50, 14 to 40, 14 to 30, 14 to 25, 14 to 20, 14 to 15, 15 to 50, 15 to 40, 15 to 30, 15 to 25, 15 to 20, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 25 to 50, 25 to 40, 25 to 30, 30 to 50, 30 to 40, or 40 to 50 amino acids (or amino acid analogs) in length (e.g., 7 to 20, 7 to 15, or 7 to 10 amino acids or amino acid analogs in length). For example, in certain embodiments, a synthetic peptide of the disclosure is 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids (or amino acid analogs) in length. In certain embodiments, a synthetic peptide of the disclosure is 7 to 10 (e.g.7 to 10, 8 to 10, 9 to 10, 7 to 9, 8 to 9, or 7 to 8) amino acids (or amino acid analogs) in length. For example, in certain embodiments, a synthetic peptide of the disclosure is 7, 8, 9, or 10 amino acids (or amino acid analogs) in length.

[0119] In certain embodiments, a synthetic peptide of the disclosure comprises at least one or at least two amino acid or amino acid analog residues that are covalently linked to a chemical moiety, e.g., a moiety not naturally found in a naturally occurring peptide. In certain embodiments, the N-terminal and / or the C-terminal amino acid or amino acid analog of the synthetic peptide is modified by the addition of a chemical moiety, e.g., a moiety not naturally found in a naturally occurring peptide. In certain embodiments, the N-terminal amino acid or amino acid analog is modified by the addition of an acetyl group, a pyroglutamic acid, or a fatty acid moiety. In certain embodiments, the N-terminal amino acid or amino acid analog is acetylated. In certain embodiments, the N-terminal amino acid or amino acid analog comprises a fatty acid modification. In certain embodiments, the C-terminal amino acid or amino acid analog is modified by the addition of an amide group or an ethylamide group. In certain embodiments, the C-terminal amino acid or amino acid analog is amidated.

[0120] In certain embodiments, the KDvalue with which a synthetic peptide of the disclosure binds NCK1 is less than or equal to 1 mM, 900 µM, 800 µM, 700 µM, 600 µM, 500 µM, 450 µM, 400 µM, 350 µM, 300 µM, 250 µM, 200 µM, 175 µM, 150 µM, 125 µM, 100 µM, 90 µM, 80 µM, 70 µM, 60 µM, or 50 µM, for example, as determined by isothermal titration calorimetry (ITC). In certain embodiments, the KDvalue with which a synthetic peptide of the disclosure binds NCK1 is less than or equal to 1 mM, less than or equal to 600 μM, or less than or equal to 300 μM, e.g., as determined by ITC. In certain embodiments, a synthetic peptide of the disclosure binds NCK1 with a lower KDthan the KDwith which the peptide set forth as SEQ ID NO: 9 binds to NCK1, e.g., as determined by ITC. In certain embodiments, the KDvalue with which a synthetic peptide of the disclosure binds the SH3-2 domain of NCK1 is less than or equal to 1 mM, 900 µM, 800 µM, 700 µM, 600 µM, 500 µM, 450 µM, 400 µM, 350 µM, 300 µM, 250 µM, 200 µM, 175 µM, 150 µM, 125 µM, 100 µM, 90 µM, 80 µM, 70 µM, 60 µM, or 50 µM, for example, as determined by ITC. In certain embodiments, the KDvalue with which a synthetic peptide of the disclosure binds the SH3-2 domain of NCK1 is less than or equal to 1 mM, less than or equal to 600 μM, or less than or equal to 300 μM, e.g., as determined by ITC. In certain embodiments, a synthetic peptide of the disclosure binds the SH3-2 domain of NCK1 with a lower KDthan the KDwith which the peptide set forth as SEQ ID NO: 9 binds to the SH3- 2 domain of NCK1, e.g., as determined by ITC.

[0121] ITC binding assays are known in the art and may be carried out, for example, as described herein in Example 3, Example 4, and / or Example 10. For example, an ITC binding assay may be conducted at 25 °C using an appropriate calorimeter, e.g., a MicroCal PEAQ-ITC calorimeter, optionally using an ITC buffer with 10 mM sodium phosphate and 100 mM sodiumchloride (pH = 8.0). In certain embodiments, the peptide or series of peptides are used at a concentration of 1 – 3 mM, and titrated in to NCK1 SH3-2 domain (optionally used at a concentration of 50 – 125 μM). In certain embodiments, the following conditions may be used: one injection of 0.2 μL followed by 19 injections of 2 μL, 120 seconds spacing between injections, at 25 °C.

[0122] In certain embodiments, a synthetic peptide of the disclosure comprises at least 3 proline residues. For example, in certain embodiments, the synthetic peptide comprises at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 proline residues. In certain embodiments, the synthetic peptide has 1, 2, 3, 4, 5, 6, 7, or 8 proline residues.

[0123] In certain embodiments, a synthetic peptide of the disclosure comprises at least 2 positively charged amino acids or amino acid analogs. For example, in certain embodiments, a synthetic peptide of the disclosure comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 positively charged amino acids or amino acid analogs. In certain embodiments, the synthetic peptide has 1, 2, 3, 4, 5, 6, 7, or 8 positively charged amino acid or amino acid analog residues.

[0124] In certain embodiments, the synthetic peptide comprises at least one D-amino acid, for example, at least two, at least three, at least four or at least five D-amino acids. In certain embodiments, the synthetic peptide comprises no more than five D-amino acids, e.g., no more than one, no more than two, no more than three, or no more than four D-amino acids. In certain embodiments, the synthetic peptide comprises exactly one, exactly two, exactly three, exactly four, or exactly five D-amino acids.

[0125] In certain embodiments, the synthetic peptide comprises or consists essentially of the amino acid sequence of any one of SEQ ID NOs: 171-328, 330-360, or 366-367. As used herein, references to “the amino acid sequence” of any of the SEQ ID NOs disclosed herein are understood to refer to the sequence of amino acids and / or amino acid analogs in the peptide, and do not specifically refer to N- or C-terminal modifications, unless otherwise understood from context. In certain embodiments, the synthetic peptide comprises the amino acid sequence of any one of SEQ ID NOs: 171-328, 330-360, or 366-367, and also further comprises an N- terminal or C-terminal modification, e.g., an N-terminal acetyl group, an N-terminal fatty acid moiety, or a C-terminal amide group. In certain embodiments, the synthetic peptide comprises the amino acid sequence of any one of SEQ ID NOs: 171-328, 330-360, or 366-367 and also the N-terminal and / or C-terminal modifications as set forth in any one of SEQ ID NOs: 171-328, 330-360, or 366-367.a. Synthetic Peptides Comprising a Proline Analog

[0126] In certain embodiments described herein, the disclosure relates to a synthetic peptide comprising an amino acid sequence of at least 7 consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the synthetic peptide comprises at least one proline analog and comprises the amino acid sequence of Formula I: X1P'2X3X4P'5X6R (Formula I), wherein X1is selected from any amino acid and a proline analog; P'2is proline or a proline analog; X3is selected from any amino acid and a proline analog; X4is selected from alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, and a proline analog; P'5is proline or a proline analog; and X6is selected from any amino acid and a proline analog. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 amino acids (or amino acid analogs) in length. In certain embodiments, the synthetic peptide is 7 to 10 amino acids (or amino acid analogs) in length.

[0127] In certain embodiments, X1is a proline analog. In other embodiments, X1is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X1is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X1is proline. In certain embodiments, X1is a D-amino acid, e.g., D-proline.

[0128] In certain embodiments, P'2is a proline analog. In other embodiments, P'2is proline.

[0129] In certain embodiments, X3is a proline analog. In other embodiments, X3is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid,glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, and valine. In certain embodiments, X3is arginine.

[0130] In certain embodiments, X3is a charged amino acid, for example, a positively charged amino acid or a negatively charged amino acid. In certain embodiments, X3is arginine, histidine, or lysine. In certain embodiments, X3is arginine. In certain embodiments, X3is glutamic acid. In certain embodiments, X3is an uncharged amino acid. In certain embodiments, X3is a hydrophobic amino acid. In certain embodiments, X3is alanine, asparagine, or serine.

[0131] In certain embodiments, X4is a proline analog. In other embodiments, X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine. In certain embodiments, X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, proline, threonine, and valine. In certain embodiments, X4is selected from the group consisting of alanine, isoleucine, proline, and valine. In certain embodiments, X4is selected from the group consisting of isoleucine, proline, and valine. In certain embodiments, X4is proline.

[0132] In certain embodiments, X4is an uncharged, non-aromatic amino acid. In certain embodiments, X4is alanine or proline. In certain embodiments, X4is proline. In certain embodiments, X4is a hydrophobic, non-aromatic amino acid. In certain embodiments, X4is alanine. In certain embodiments, X4is a charged amino acid, for example, a positively charged amino acid. In certain embodiments, X4is arginine.

[0133] In certain embodiments, P'5is a proline analog. In other embodiments, P'5is proline.

[0134] In certain embodiments, X6is a proline analog. In other embodiments, X6is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is selected from the group consisting of alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is lysine.

[0135] In certain embodiments, X6is a charged amino acid, for example a positively charged amino acid or a negatively charged amino acid. In certain embodiments, X6is arginine, histidine, or lysine. In certain embodiments, X6is lysine. In certain embodiments, X6is glutamic acid. In certain embodiments, X6is an uncharged amino acid. In certain embodiments, X6is alanine, asparagine, cysteine, serine, or tryptophan. In certain embodiments, X6is a hydrophobic amino acid. In certain embodiments, X6is alanine, cysteine, or tryptophan.

[0136] In certain embodiments, the synthetic peptide further comprises an amino acid residue or a proline analog that is N-terminal to position X1in Formula I ( X0). In certain embodiments, X0is a proline analog. In other embodiments, X0is selected from any amino acid, e.g., selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X0is alanine or proline. In certain embodiments, X0is proline. In certain embodiments, X0is a D-amino acid, e.g., D-proline or D-alanine.

[0137] In certain embodiments, the synthetic peptide further comprises an amino acid residue or a proline analog that is C-terminal to the arginine residue at position 7 in Formula I (X8). In certain embodiments, X8is a proline analog. In other embodiments, X8is selected from any amino acid, e.g., selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine. In certain embodiments, X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, serine, tryptophan, and tyrosine. In certain embodiments, X8is selected from the group consisting of arginine, cysteine, and alanine. In certain embodiments, X8is isoleucine. In certain embodiments, X8is a D-amino acid, for example, D-alanine, D-arginine, or D-isoleucine.

[0138] In certain embodiments, if X3and X6are each independently any amino acid, then X4is a non-aromatic amino acid. In certain embodiments, if X3is alanine and X4is valine, then X6is not proline. In certain embodiments, if X4is proline and X6is arginine, then X3is not arginine or glutamine. In certain embodiments, if X4is proline and X6is methionine, then X3is not histidine.

[0139] In certain embodiments, the synthetic peptide comprises one proline analog, e.g., exactly one proline analog. For example, in certain embodiments, X0(if present) is a proline analog; X1is selected from any amino acid (e.g., proline); P'2is proline; X3is selected from any amino acid (e.g., arginine); X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); P'5is proline; X6is selected from any amino acid (e.g., lysine); and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is a proline analog; P'2is proline; X3is selected from any amino acid (e.g., arginine); X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); P'5is proline; X6is selected from any amino acid (e.g., lysine); and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is selected from any amino acid (e.g., proline); P'2is a proline analog; X3is selected from any amino acid (e.g., arginine); X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); P'5is proline; X6is selected from any amino acid (e.g., lysine); and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is selected from any amino acid (e.g., proline); P'2is proline; X3is a proline analog; X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); P'5is proline; X6is selected from any amino acid (e.g., lysine); and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is selected from any amino acid (e.g., proline); P'2is proline; X3is selected from any amino acid (e.g., arginine); X4is a proline analog; P'5is proline; X6is selected from any amino acid (e.g., lysine); and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is selected from any amino acid (e.g., proline); P'2is proline; X3is selected from any amino acid (e.g., arginine); X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); P'5is a proline analog; X6is selected from any amino acid (e.g., lysine); and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is selected from any amino acid (e.g., proline); P'2is proline; X3is selected from any amino acid (e.g., arginine); X4is an amino acid selectedfrom the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); P'5is proline; X6is a proline analog; and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is selected from any amino acid (e.g., proline); P'2is proline; X3is selected from any amino acid (e.g., arginine); X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); P'5is proline; X6is selected from any amino acid (e.g., lysine); and X8is a proline analog.

[0140] In certain embodiments, X4is a proline analog (e.g., Pip) and P'5is a proline analog (e.g., Oic). For example, in certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is selected from any amino acid (e.g., proline); P'2is proline; X3is selected from any amino acid (e.g., arginine); X4is a proline analog (e.g., Pip); P'5is a proline analog (e.g., Oic); and X6is selected from any amino acid (e.g., lysine).

[0141] In certain embodiments, X1is the N-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one, two, or three additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) N-terminally to X1. In certain embodiments, each of the additional one, two, or three additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately N-terminal to X1(if present) is proline. In certain embodiments, the two amino acids immediately N-terminal to X1(if present) are each proline. In certain embodiments, the three amino acids immediately N-terminal to X1(if present) are, in the N-to-C-terminal direction, isoleucine, proline, and proline, respectively.

[0142] In certain embodiments, X0is the N-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one or two additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) N-terminally to X0. In certain embodiments, each of the additional one or two consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately N-terminal to X0(if present) is proline. In certain embodiments, the two amino acids immediately N-terminal to X0(if present) are isoleucine and proline, respectively.

[0143] In certain embodiments, the R in position 7 of Formula I is the C-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one, two, or three additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) C-terminally to the R in position 7 of Formula I.In certain embodiments, each of the additional one, two, or three additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately C- terminal to the R in position 7 of Formula I (if present) is isoleucine. In certain embodiments, the two amino acids immediately C-terminal to the R in position 7 of Formula I (if present) are isoleucine and leucine, respectively. In certain embodiments, the three amino acids immediately C-terminal to the R in position 7 of Formula I (if present) are, in the N-to-C-terminal direction, isoleucine, leucine, and glutamic acid, respectively.

[0144] In certain embodiments, X8is the C-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one or two additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) C-terminally to X8. In certain embodiments, each of the additional one or two additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately C-terminal to X8(if present) is leucine. In certain embodiments, the two amino acids immediately C-terminal to X8(if present) are leucine and glutamic acid, respectively.

[0145] In certain embodiments, each proline analog is independently selected from the group consisting of L-pipecolic acid, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, (S)-1,2,3,4- tetrahydroisoquinoline-3-carboxylic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, trans-4-hydroxyproline, (S)-2-amino-3-(thiophen-2- yl)propanoic acid, L-azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid, (2S,4S)-4-aminopyrrolidine-2-carboxylic acid, (2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, (S)-indoline-2-carboxylic acid, (S)-oxazolidine-4-carboxylic acid, cis-4- hydroxyproline, (2S,3R)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,3S)-3-hydroxypyrrolidine- 2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4S)-4- (difluoromethyl)pyrrolidine-2-carboxylic acid, 2,4-methanoproline, (2S,4R)-4- (difluoromethoxy)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2- carboxylic acid, (S)-isoxazolidine-3-carboxylic acid, 4-trans-guanidinoproline, 4-cis- guanidinoproline, alpha-methyl-L-proline, and α-aminoisobutyric acid. In certain embodiments, each proline analog is independently selected from the group consisting of L-pipecolic acid, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, (S)-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4- difluoroproline, trans-4-hydroxyproline, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, L- azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid, (2S,4S)-4-aminopyrrolidine- 2-carboxylic acid, (2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, (S)-indoline-2-carboxylic acid, (S)-oxazolidine-4-carboxylic acid, cis-4-hydroxyproline, (2S,3R)-3- hydroxypyrrolidine-2-carboxylic acid, (2S,3S)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,4S)- 4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4S)-4-(difluoromethyl)pyrrolidine-2- carboxylic acid, 2,4-methanoproline, (2S,4R)-4-(difluoromethoxy)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2-carboxylic acid, (S)-isoxazolidine-3-carboxylic acid, 4-trans-guanidinoproline, 4-cis-guanidinoproline, and alpha-methyl-L-proline. In certain embodiments, each proline analog is independently selected from the group consisting of L- pipecolic acid, (S)-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (S)-2-amino-3-(thiophen-2- yl)propanoic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, trans-4-hydroxyproline, (2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, alpha-methyl-L-proline, L-azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid, (S)-oxazolidine-4- carboxylic acid, (S)-indoline-2-carboxylic acid, (2S,4S)-4-aminopyrrolidine-2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, α-aminoisobutyric acid, (2S,4S)-4- (difluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(difluoromethoxy)pyrrolidine-2- carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2-carboxylic acid, cis-4- hydroxyproline, and 2,4-methanoproline. In certain embodiments, each proline analog is independently selected from the group consisting of L-pipecolic acid, (S)-1,2,3,4- tetrahydroisoquinoline-3-carboxylic acid, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, (R)- thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, and trans-4-hydroxyproline. In certain embodiments, each proline analog is independently selected from the list of proline analogs set forth in Table A1, Table A2, or Table A3. Table A1 – Exemplary Proline Analogs Incorporated into Peptides (Internal)Table A2 – Exemplary Proline Analogs Incorporated into Peptides (N-terminal)Table A3 – Exemplary Proline Analogs Incorporated into Peptides (C-terminal)

[0146] In Table A2, the chemical group denoted by “X” can be selected from any one of the chemical groups appearing in Table D below.

[0147] In certain embodiments, the proline analog is an internal residue of the synthetic peptide. For example, in certain embodiments, the proline analog is a selected from the list of proline analogs set forth in Table A1. In certain embodiments, the proline analog is the N- terminal residue of the synthetic peptide. For example, in certain embodiments, the proline analog is a selected from the list of proline analogs set forth in Table A2. In certain embodiments, the X in the structures set forth in Table A2 represents a hydrogen (H) or an acetyl group (Ac) or a fatty acid modification, for example, as set forth in Table D. In certain embodiments, the proline analog is the C-terminal residue of the synthetic peptide. For example, in certain embodiments, the proline analog is selected from the list of proline analogs set forth in Table A3. In certain embodiments, the C-terminal proline analog is amidated.

[0148] In certain embodiments, the N-terminal residue of the synthetic peptide comprises a modification. For example, in certain embodiments, the N-terminal residue of the synthetic peptide is acetylated (e.g., as shown in Table D). In certain embodiments, the N-terminal residue comprises a fatty acid modification, such as an N-terminal fatty acid modification set forth in Table D.

[0149] In certain embodiments, P'5is a proline analog (e.g., (2S,3aS,7aS)-octahydroindole-2- carboxylic acid) and X8is present. For example, in certain embodiments, P'5is a proline analog (e.g., (2S,3aS,7aS)-octahydroindole-2-carboxylic acid) and X8is selected from any amino acid, e.g., selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, P'5is a proline analog (e.g., (2S,3aS,7aS)-octahydroindole-2-carboxylic acid) and X8is selected from arginine, cysteine, and alanine. In certain embodiments, P'5is a proline analog (e.g., (2S,3aS,7aS)-octahydroindole-2-carboxylic acid) and X8is a D-amino acid, e.g., D- isoleucine or D-arginine.

[0150] In certain embodiments, X4is selected from alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, and a proline analog, wherein the proline analog is not (S)-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (Tic), (S)-2-amino-3- (thiophen-2-yl)propanoic acid (Thi), Alpha-methyl-L-proline (Pro(2-methyl)), or 2,4- methanoproline. In certain embodiments X4is not (S)-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (Tic), (S)-2-amino-3-(thiophen-2-yl)propanoic acid (Thi), Alpha-methyl-L- proline (Pro(2-methyl)), or 2,4-methanoproline. In certain embodiments, X4is not a proline analog.

[0151] In certain embodiments, X1is selected from any amino acid and a proline analog, wherein the proline analog is not (S)-4-oxopyrrolidine-2-carboxylic acid (Pro(4-keto)). In certain embodiments, X1is not (S)-4-oxopyrrolidine-2-carboxylic acid (Pro(4-keto)). In certain embodiments, X1is not a proline analog.

[0152] In certain embodiments, X3is selected from any amino acid and a proline analog, wherein the proline analog is not α-aminoisobutyric acid. In certain embodiments, X3is not α- aminoisobutyric acid. In certain embodiments, X3is not a proline analog.

[0153] In certain embodiments, P'2is a proline analog, wherein the proline analog is not 2,4- methanoproline. In certain embodiments, P'2is not 2,4-methanoproline.

[0154] In certain embodiments, the synthetic peptide comprises or consists essentially of the amino acid sequence of any one of SEQ ID NOs: 171-191, 209-256, 272-273, 286-314, 321-324, 327, 330-347, 349-357, or 366. In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 15, Table 19, and Table 20.

[0155] In certain embodiments, the synthetic peptide comprises or consists essentially of the amino acid sequence of any one of SEQ ID NOs: 171-175, 177-191, 209-215, 217-236, 238-256, 272-273, 286-290, 292-302, 304-314, 321-324, 327, 330-332, 334-347, 349-357, or 366. In certain embodiments, the synthetic peptide does not comprise the amino acid sequence of any one of SEQ ID NOs: 176, 216, 237, 291, 303, or 333. In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 15, Table 19, and Table 20, wherein the KDvalue with which the synthetic peptide binds NCK1 is less than or equal to 1 mM (e.g., as measured by ITC). In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 15, Table 19, and Table 20, wherein the KDvalue with which the synthetic peptide binds NCK1 is less than or equal to 600 μM (e.g., as measured by ITC). In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 15, Table 19, and Table 20, wherein the KDvalue with which the synthetic peptide binds NCK1 is less than or equal to 300 μM (e.g., as measured by ITC). b. Synthetic Peptides Comprising an Arginine Analog

[0156] In certain embodiments described herein, the disclosure relates to a synthetic peptide comprising an amino acid sequence of at least 7 consecutive amino acids or amino acid analogs,including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the synthetic peptide comprises at least one arginine analog and comprises the amino acid sequence of Formula II: X1P X3X4P X6R'7(Formula II), wherein X1is selected from any amino acid and an arginine analog; X3is selected from any amino acid and an arginine analog; X4is selected from alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, and an arginine analog; X6is selected from any amino acid and an arginine analog; and R'7is selected from arginine and an arginine analog. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 amino acids (or amino acid analogs) in length. In certain embodiments, the synthetic peptide is 7 to 10 amino acids (or amino acid analogs) in length.

[0157] In certain embodiments, X1is an arginine analog. In other embodiments, X1is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X1is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X1is proline. In certain embodiments, X1is a D-amino acid, e.g., D-proline.

[0158] In certain embodiments, X3is an arginine analog. In other embodiments, X3is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid,glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, and valine. In certain embodiments, X3is arginine.

[0159] In certain embodiments, X3is a charged amino acid, for example, a positively charged amino acid or a negatively charged amino acid. In certain embodiments, X3is arginine, histidine, or lysine. In certain embodiments, X3is arginine. In certain embodiments, X3is glutamic acid. In certain embodiments, X3is an uncharged amino acid. In certain embodiments, X3is a hydrophobic amino acid. In certain embodiments, X3is alanine, asparagine, or serine.

[0160] In certain embodiments, X4is an arginine analog. In other embodiments, X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine. In certain embodiments, X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, proline, threonine, and valine. In certain embodiments, X4is selected from the group consisting of alanine, isoleucine, proline, and valine. In certain embodiments, X4is selected from the group consisting of isoleucine, proline, and valine. In certain embodiments, X4is proline.

[0161] In certain embodiments, X4is an uncharged, non-aromatic amino acid. In certain embodiments, X4is alanine or proline. In certain embodiments, X4is proline. In certain embodiments, X4is a hydrophobic, non-aromatic amino acid. In certain embodiments, X4is alanine. In certain embodiments, X4is a charged amino acid, for example, a positively charged amino acid. In certain embodiments, X4is arginine.

[0162] In certain embodiments, X6is an arginine analog. In other embodiments, X6is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is selected from the group consisting of alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is lysine.

[0163] In certain embodiments, X6is a charged amino acid, for example a positively charged amino acid or a negatively charged amino acid. In certain embodiments, X6is arginine, histidine, or lysine. In certain embodiments, X6is lysine. In certain embodiments, X6is glutamic acid. In certain embodiments, X6is an uncharged amino acid. In certain embodiments,X6is alanine, asparagine, cysteine, serine, or tryptophan. In certain embodiments, X6is a hydrophobic amino acid. In certain embodiments, X6is alanine, cysteine, or tryptophan.

[0164] In certain embodiments, R'7is an arginine analog. In other embodiments, R'7is arginine.

[0165] In certain embodiments, the synthetic peptide further comprises an amino acid residue or an arginine analog that is N-terminal to position X1in Formula II (X0). In certain embodiments, X0is an arginine analog. In other embodiments, X0is selected from any amino acid, e.g., selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X0is selected from the group consisting of alanine and proline. In certain embodiments, X0is proline. In certain embodiments, X0is a D-amino acid, e.g., D-proline or D- alanine.

[0166] In certain embodiments, the synthetic peptide further comprises an amino acid residue or an arginine analog that is C-terminal to position R'7in Formula II (X8). In certain embodiments, X8is an arginine analog. In other embodiments, X8is selected from any amino acid, e.g., selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine. In certain embodiments, X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, serine, tryptophan, and tyrosine. In certain embodiments, X8is selected from the group consisting of arginine, cysteine, and alanine. In certain embodiments, X8is isoleucine. In certain embodiments, X8is a D-amino acid, for example, D-alanine, D-arginine, or D-isoleucine.

[0167] In certain embodiments, if X3and X6are each independently any amino acid, then X4is a non-aromatic amino acid. In certain embodiments, if X3is alanine and X4is valine, then X6is not proline. In certain embodiments, if X4is proline and X6is arginine, then X3is not arginine or glutamine. In certain embodiments, if X4is proline and X6is methionine, then X3is not histidine.

[0168] In certain embodiments, the synthetic peptide comprises one arginine analog, e.g., exactly one arginine analog. For example, in certain embodiments, X0(if present) is an arginine analog; X1is selected from any amino acid (e.g., proline); X3is selected from any amino acid (e.g., arginine); X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); X6is selected from any amino acid (e.g., lysine); R'7is arginine; and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is an arginine analog; X3is selected from any amino acid (e.g., arginine); X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); X6is selected from any amino acid (e.g., lysine); R'7is arginine; and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is selected from any amino acid (e.g., proline); X3is an arginine analog; X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); X6is selected from any amino acid (e.g., lysine); R'7is arginine; and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is selected from any amino acid (e.g., proline); X3is selected from any amino acid (e.g., arginine); X4is an arginine analog; X6is selected from any amino acid (e.g., lysine); R'7is arginine; and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is selected from any amino acid (e.g., proline); X3is selected from any amino acid (e.g., arginine); X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); X6is an arginine analog; R'7is arginine; and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is selected from any amino acid (e.g., proline); X3is selected from any amino acid (e.g., arginine); X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); X6is selected from any amino acid (e.g., lysine); R'7is an arginine analog; and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is selected from any amino acid (e.g., proline); X3is selected from any amino acid (e.g., arginine); X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine,tyrosine, and valine (e.g., proline); X6is selected from any amino acid (e.g., lysine); R'7is arginine; and X8is an arginine analog.

[0169] In certain embodiments, X1is the N-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one, two, or three additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) N-terminally to X1. In certain embodiments, each of the additional one, two, or three additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately N-terminal to X1(if present) is proline. In certain embodiments, the two amino acids immediately N-terminal to X1(if present) are each proline. In certain embodiments, the three amino acids immediately N-terminal to X1(if present) are, in the N-to-C-terminal direction, isoleucine, proline, and proline, respectively.

[0170] In certain embodiments, X0is the N-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one or two additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) N-terminally to X0. In certain embodiments, each of the additional one or two consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately N-terminal to X0(if present) is proline. In certain embodiments, the two amino acids immediately N-terminal to X0(if present) are isoleucine and proline, respectively.

[0171] In certain embodiments, R'7is the C-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one, two, or three additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) C-terminally to R'7. In certain embodiments, each of the additional one, two, or three additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately C-terminal to R'7(if present) is isoleucine. In certain embodiments, the two amino acids immediately C-terminal to R'7(if present) are isoleucine and leucine, respectively. In certain embodiments, the three amino acids immediately C-terminal to R'7(if present) are, in the N-to-C-terminal direction, isoleucine, leucine, and glutamic acid, respectively.

[0172] In certain embodiments, X8is the C-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one or two additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) C-terminally to X8. In certain embodiments, each of the additional one or two additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the aminoacid immediately C-terminal to X8(if present) is leucine. In certain embodiments, the two amino acids immediately C-terminal to X8(if present) are leucine and glutamic acid, respectively.

[0173] In certain embodiments, each arginine analog is independently selected from the group consisting of L-homoarginine, L-citrulline, L-ornithine, 4-guanidinophenylalanine, 4-trans- guanidinoproline, 4-cis-guanidinoproline, methylarginine, asymmetric dimethylarginine, symmetric dimethylarginine, beta,beta-dimethylarginine, 2-amino-4-guanidino- L-butyric acid, and 2-amino-3-guanidino- L-propionic acid. In certain embodiments, each arginine analog is independently selected from the group consisting of L-homoarginine, L-citrulline, L-ornithine, 4- guanidinophenylalanine, 4-trans-guanidinoproline, 4-cis-guanidinoproline, methylarginine, asymmetric dimethylarginine, symmetric dimethylarginine, and beta,beta-dimethylarginine. In certain embodiments, each arginine analog is independently selected from the group consisting of L-homoarginine, L-citrulline, L-ornithine, methylarginine, symmetric dimethylarginine, 2- amino-4-guanidino- L-butyric acid, and 2-amino-3-guanidino- L-propionic acid, 4-cis- guanidinoproline, beta,beta-dimethylarginine, asymmetric dimethylarginine, 4-trans- guanidinoproline, and 4-guanidinophenylalanine. In certain embodiments, the arginine analog is independently selected from the group consisting of L-homoarginine and L-citrulline.

[0174] In certain embodiments, the arginine analog is selected from the list of arginine analogs set forth in Table B1, Table B2 or Table B3. Table B1 – Exemplary Arginine Analogs Incorporated into Peptides (Internal Residues)Table B2 – Exemplary Arginine Analogs Incorporated into Peptides (C-terminal Residues)Table B3 – Exemplary Arginine Analogs Incorporated into Peptides (N-terminal Residues)

[0175] In Table B3, the chemical group denoted by “X” can be selected from any one of the chemical groups appearing in Table D below.

[0176] In certain embodiments, the arginine analog is an internal residue of the synthetic peptide. For example, in certain embodiments, the arginine analog is a selected from the list of arginine analogs set forth in Table B1. In certain embodiments, the arginine analog is the C- terminal residue of the synthetic peptide. For example, in certain embodiments, the arginine analog is a selected from the list of arginine analogs set forth in Table B2. In certain embodiments, the arginine analog is the N-terminal residue of the synthetic peptide. For example, in certain embodiments, the arginine analog is a selected from the list of arginine analogs set forth in Table B3. In certain embodiments, the X in the structures set forth in Table B3 represents a hydrogen (H) or an acetyl group (Ac) or a fatty acid modification, for example, as set forth in Table D.

[0177] In certain embodiments, the C-terminal arginine analog is amidated.

[0178] In certain embodiments, the N-terminal residue of the synthetic peptide comprises a modification. For example, in certain embodiments, the N-terminal residue of the synthetic peptide is acetylated (e.g., as shown in Table D). In certain embodiments, the N-terminal residue comprises a fatty acid modification, such as an N-terminal fatty acid modification set forth in Table D.

[0179] In certain embodiments, R'7is selected from arginine and an arginine analog, wherein the arginine analog is not L-Citrulline or L-Ornithine. In certain embodiments, R'7is not L- Citrulline or L-Ornithine. In certain embodiments, R'7is not an arginine analog.

[0180] In certain embodiments, the synthetic peptide comprises or consists essentially of the amino acid sequence of any one of SEQ ID NOs: 192-200, 257-269, or 315-319. In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 16.

[0181] In certain embodiments, the synthetic peptide comprises or consists essentially of the amino acid sequence of any one of SEQ ID NOs: 192-195, 200, 257-269, or 315-319. In certain embodiments, the synthetic peptide does not comprise the amino acid sequence of any of SEQ ID NOs: 196-199. In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 16, wherein the KDvalue with which the synthetic peptide binds NCK1 is less than or equal to 1 mM (e.g., as measured by ITC). In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 16, wherein the KDvalue with which the synthetic peptide binds NCK1 is less than or equal to 600 μM (e.g., as measured by ITC). In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 16, wherein the KDvalue with which the synthetic peptide binds NCK1 is less than or equal to 300 μM (e.g., as measured by ITC). c. Synthetic Peptides Comprising a Lysine Analog

[0182] In certain embodiments described herein, the disclosure relates to a synthetic peptide comprising an amino acid sequence of at least 7 consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the synthetic peptide comprises at least one lysine analog and comprises the amino acid sequence of Formula III: X1P X3X4P X6R (Formula III), wherein X1is selected from any amino acid and a lysine analog; X3is selected from any amino acid and a lysine analog; X4is selected from alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, and a lysine analog; and X6is selected fromany amino acid and a lysine analog. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 amino acids (or amino acid analogs) in length. In certain embodiments, the synthetic peptide is 7 to 10 amino acids (or amino acid analogs) in length.

[0183] In certain embodiments, X1is a lysine analog. In other embodiments, X1is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X1is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X1is proline. In certain embodiments, X1is a D-amino acid, e.g., D-proline.

[0184] In certain embodiments, X3is a lysine analog. In other embodiments, X3is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, and valine. In certain embodiments, X3is arginine.

[0185] In certain embodiments, X3is a charged amino acid, for example, a positively charged amino acid or a negatively charged amino acid. In certain embodiments, X3is arginine, histidine, or lysine. In certain embodiments, X3is arginine. In certain embodiments, X3is glutamic acid. In certain embodiments, X3is an uncharged amino acid. In certain embodiments, X3is a hydrophobic amino acid. In certain embodiments, X3is alanine, asparagine, or serine.

[0186] In certain embodiments, X4is a lysine analog. In other embodiments, X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline,threonine, tyrosine, and valine. In certain embodiments, X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, proline, threonine, and valine. In certain embodiments, X4is selected from the group consisting of alanine, isoleucine, proline, and valine. In certain embodiments, X4is selected from the group consisting of isoleucine, proline, and valine. In certain embodiments, X4is proline.

[0187] In certain embodiments, X4is an uncharged, non-aromatic amino acid. In certain embodiments, X4is alanine or proline. In certain embodiments, X4is proline. In certain embodiments, X4is a hydrophobic, non-aromatic amino acid. In certain embodiments, X4is alanine. In certain embodiments, X4is a charged amino acid, for example, a positively charged amino acid. In certain embodiments, X4is arginine.

[0188] In certain embodiments, X6is a lysine analog. In other embodiments, X6is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is selected from the group consisting of alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is lysine.

[0189] In certain embodiments, X6is a charged amino acid, for example a positively charged amino acid or a negatively charged amino acid. In certain embodiments, X6is arginine, histidine, or lysine. In certain embodiments, X6is lysine. In certain embodiments, X6is glutamic acid. In certain embodiments, X6is an uncharged amino acid. In certain embodiments, X6is alanine, asparagine, cysteine, serine, or tryptophan. In certain embodiments, X6is a hydrophobic amino acid. In certain embodiments, X6is alanine, cysteine, or tryptophan.

[0190] In certain embodiments, the synthetic peptide further comprises an amino acid residue or a lysine analog that is N-terminal to position X1in Formula III (X0). In certain embodiments, X0is a lysine analog. In other embodiments, X0is selected from any amino acid, e.g., selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X0is alanine orproline. In certain embodiments, X0is proline. In certain embodiments, X0is a D-amino acid, e.g., D-proline or D-alanine.

[0191] In certain embodiments, the synthetic peptide further comprises an amino acid residue or an arginine analog that is C-terminal to the arginine residue at position 7 in Formula III (X8). In certain embodiments, X8is a lysine analog. In other embodiments, X8is selected from any amino acid, e.g., selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine. In certain embodiments, X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, serine, tryptophan, and tyrosine. In certain embodiments, X8is selected from the group consisting of arginine, cysteine, and alanine. In certain embodiments, X8is isoleucine. In certain embodiments, X8is a D-amino acid, for example, D-alanine, D-arginine, or D-isoleucine.

[0192] In certain embodiments, if X3and X6are each independently any amino acid, then X4is a non-aromatic amino acid. In certain embodiments, if X3is alanine and X4is valine, then X6is not proline. In certain embodiments, if X4is proline and X6is arginine, then X3is not arginine or glutamine. In certain embodiments, if X4is proline and X6is methionine, then X3is not histidine.

[0193] In certain embodiments, the synthetic peptide comprises one lysine analog, e.g., exactly one lysine analog. For example, in certain embodiments, X0(if present) is a lysine analog; X1is selected from any amino acid (e.g., proline); X3is selected from any amino acid (e.g., arginine); X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); X6is selected from any amino acid (e.g., lysine); and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is a lysine analog; X3is selected from any amino acid (e.g., arginine); X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); X6is selected from any amino acid (e.g., lysine); and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1isselected from any amino acid (e.g., proline); X3is a lysine analog; X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); X6is selected from any amino acid (e.g., lysine); and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is selected from any amino acid (e.g., proline); X3is selected from any amino acid (e.g., arginine); X4is a lysine analog; X6is selected from any amino acid (e.g., lysine); and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is selected from any amino acid (e.g., proline); X3is selected from any amino acid (e.g., arginine); X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); X6is a lysine analog; and X8, if present, is selected from any amino acid (e.g., isoleucine). In certain embodiments, X0(if present) is selected from any amino acid (e.g., proline); X1is selected from any amino acid (e.g., proline); X3is selected from any amino acid (e.g., arginine); X4is an amino acid selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine (e.g., proline); X6is selected from any amino acid (e.g., lysine); and X8is a lysine analog.

[0194] In certain embodiments, X1is the N-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one, two, or three additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) N-terminally to X1. In certain embodiments, each of the additional one, two, or three additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately N-terminal to X1(if present) is proline. In certain embodiments, the two amino acids immediately N-terminal to X1(if present) are each proline. In certain embodiments, the three amino acids immediately N-terminal to X1(if present) are, in the N-to-C-terminal direction, isoleucine, proline, and proline, respectively.

[0195] In certain embodiments, X0is the N-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one or two additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) N-terminally to X0. In certain embodiments, each of the additional one or two consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately N-terminal to X0(if present) is proline. In certain embodiments, the two amino acids immediately N-terminal to X0(if present) are isoleucine and proline, respectively.

[0196] In certain embodiments, the R in position 7 of Formula III is the C-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one, two, or three additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) C-terminally to the R in position 7 of Formula III. In certain embodiments, each of the additional one, two, or three additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately C-terminal to the R in position 7 of Formula III (if present) is isoleucine. In certain embodiments, the two amino acids immediately C-terminal to the R in position 7 of Formula III (if present) are isoleucine and leucine, respectively. In certain embodiments, the three amino acids immediately C-terminal to the R in position 7 of Formula III (if present) are, in the N-to-C- terminal direction, isoleucine, leucine, and glutamic acid, respectively.

[0197] In certain embodiments, X8is the C-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one or two additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) C-terminally to X8. In certain embodiments, each of the additional one or two additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately C-terminal to X8(if present) is leucine. In certain embodiments, the two amino acids immediately C-terminal to X8(if present) are leucine and glutamic acid, respectively.

[0198] In certain embodiments, each lysine analog is independently selected from the group consisting of L-ornithine, L-citrulline, L-homolysine, (S)-2-amino-3-(3-aminophenyl)propanoic acid, S-(2-aminoethyl)- L-cysteine, and 2,4-diamino-L-butryic acid. In certain embodiments, each lysine analog is independently selected from the group consisting of L-ornithine, L- citrulline, L-homolysine, (S)-2-amino-3-(3-aminophenyl)propanoic acid, and S-(2-aminoethyl)- L-cysteine. In certain embodiments, each lysine analog is independently selected from the group consisting of L-ornithine, L-citrulline, 2,4-diamino-L-butryic acid, L-homolysine, and S-(2- aminoethyl)-L-cysteine. In certain embodiments, each lysine analog is ornithine.

[0199] In certain embodiments, each lysine analog is independently selected from the list of lysine analogs set forth in Table C1, Table C2, or Table C3.Table C1 – Exemplary Lysine Analogs Incorporated into PeptidesTable C2 – Exemplary Lysine Analogs Incorporated into Peptides (N-terminal Residues)Table C3 – Exemplary Lysine Analogs Incorporated into Peptides (C-terminal Residues)

[0200] In Table C2, the chemical group denoted by “X” can be selected from any one of the chemical groups appearing in Table D below.

[0201] In certain embodiments, the lysine analog is an internal residue of the synthetic peptide. For example, in certain embodiments, the lysine analog is selected from the list of lysine analogs set forth in Table C1. In certain embodiments, the lysine analog is the N-terminal residue of the synthetic peptide. For example, in certain embodiments, the lysine analog is selected from the list of lysine analogs set forth in Table C2. In certain embodiments, the X in the structures set forth in Table C2 represents a hydrogen (H) or an acetyl group (Ac) or a fatty acid modification, for example, as set forth in Table D. In certain embodiments, the lysine analog is the C-terminal residue of the synthetic peptide. For example, in certain embodiments, the lysine analog is selected from the list of proline analogs set forth in Table C3. In certain embodiments, the C- terminal lysine analog is amidated.

[0202] In certain embodiments, the N-terminal residue of the synthetic peptide comprises a modification. For example, in certain embodiments, the N-terminal residue of the synthetic peptide is acetylated (e.g., as shown in Table D). In certain embodiments, the N-terminal residue comprises a fatty acid modification, such as an N-terminal fatty acid modification set forth in Table D.

[0203] In certain embodiments, the synthetic peptide comprises or consists essentially of the amino acid sequence of any one of SEQ ID NOs: 201-202, 270-271, or 320. In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 17.d. Synthetic Peptides Comprising a Proline Analog, an Arginine Analog, and / or a Lysine Analog

[0204] In certain embodiments described herein, the disclosure relates to a synthetic peptide comprising an amino acid sequence of at least 7 consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the synthetic peptide comprises at least one amino acid analog and comprises the amino acid sequence of Formula IV: X1P'2X3X4P'5X6R'7(Formula IV), wherein X1is selected from any amino acid, a proline analog, an arginine analog, and a lysine analog; P'2is proline or a proline analog; X3is selected from any amino acid, a proline analog, an arginine analog, and a lysine analog; X4is selected from alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, a proline analog, an arginine analog, and a lysine analog; P'5is proline or a proline analog; X6is selected from any amino acid, a proline analog, an arginine analog, and a lysine analog; and R'7is selected from arginine and an arginine analog. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 amino acids (or amino acid analogs) in length. In certain embodiments, the synthetic peptide is 7 to 10 amino acids (or amino acid analogs) in length.

[0205] In certain embodiments, X1is a proline analog, an arginine analog, or a lysine analog (e.g., a proline analog). In other embodiments, X1is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X1is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X1is proline. In certain embodiments, X1is a D-amino acid, e.g., D-proline.

[0206] In certain embodiments, P'2is a proline analog. In other embodiments, P'2is proline.

[0207] In certain embodiments, X3is a proline analog, an arginine analog, or a lysine analog, e.g., an arginine analog. In other embodiments, X3is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, and valine. In certain embodiments, X3is arginine.

[0208] In certain embodiments, X3is a charged amino acid, for example, a positively charged amino acid or a negatively charged amino acid. In certain embodiments, X3is arginine, histidine, or lysine. In certain embodiments, X3is arginine. In certain embodiments, X3is glutamic acid. In certain embodiments, X3is an uncharged amino acid. In certain embodiments, X3is a hydrophobic amino acid. In certain embodiments, X3is alanine, asparagine, or serine.

[0209] In certain embodiments, X4is a proline analog, an arginine analog, or a lysine analog, e.g., a proline analog. In other embodiments, X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine. In certain embodiments, X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, proline, threonine, and valine. In certain embodiments, X4is selected from the group consisting of alanine, isoleucine, proline, and valine. In certain embodiments, X4is selected from the group consisting of isoleucine, proline, and valine. In certain embodiments, X4is proline.

[0210] In certain embodiments, X4is an uncharged, non-aromatic amino acid. In certain embodiments, X4is alanine or proline. In certain embodiments, X4is proline. In certain embodiments, X4is a hydrophobic, non-aromatic amino acid. In certain embodiments, X4is alanine. In certain embodiments, X4is a charged amino acid, for example, a positively charged amino acid. In certain embodiments, X4is arginine.

[0211] In certain embodiments, P'5is a proline analog. In other embodiments, P'5is proline.

[0212] In certain embodiments, X6is a proline analog, an arginine analog, or a lysine analog, e.g., a lysine analog. In other embodiments, X6is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine,isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is selected from the group consisting of alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is lysine.

[0213] In certain embodiments, X6is a charged amino acid, for example a positively charged amino acid or a negatively charged amino acid. In certain embodiments, X6is arginine, histidine, or lysine. In certain embodiments, X6is lysine. In certain embodiments, X6is glutamic acid. In certain embodiments, X6is an uncharged amino acid. In certain embodiments, X6is alanine, asparagine, cysteine, serine, or tryptophan. In certain embodiments, X6is a hydrophobic amino acid. In certain embodiments, X6is alanine, cysteine, or tryptophan.

[0214] In certain embodiments, R'7is an arginine analog. In other embodiments, R'7is arginine.

[0215] In certain embodiments, the synthetic peptide further comprises an amino acid residue or an amino acid analog that is N-terminal to position X1in Formula I (X0). In certain embodiments, X0is a proline analog, an arginine analog, or a lysine analog, e.g., a proline analog. In other embodiments, X0is selected from any amino acid, e.g., selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X0is alanine or proline. In certain embodiments, X0is proline. In certain embodiments, X0is a D-amino acid, e.g., D- proline or D-alanine.

[0216] In certain embodiments, the synthetic peptide further comprises an amino acid residue or an amino acid analog that is C-terminal to the arginine residue or arginine analog at position R'7in Formula IV (X8). In certain embodiments, X8is a proline analog, an arginine analog, or a lysine analog. For example, in certain embodiments, X8is a proline analog. In other embodiments, X8is selected from any amino acid, e.g., selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X8is selected from the group consisting ofalanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine. In certain embodiments, X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, serine, tryptophan, and tyrosine. In certain embodiments, X8is selected from the group consisting of arginine, cysteine, and alanine. In certain embodiments, X8is isoleucine. In certain embodiments, X8is a D-amino acid, for example, D-alanine, D-arginine, or D-isoleucine.

[0217] In certain embodiments, if X3and X6are each independently any amino acid, then X4is a non-aromatic amino acid. In certain embodiments, if X3is alanine and X4is valine, then X6is not proline. In certain embodiments, if X4is proline and X6is arginine, then X3is not arginine or glutamine. In certain embodiments, if X4is proline and X6is methionine, then X3is not histidine.

[0218] In certain embodiments, the synthetic peptide comprises a proline analog. In certain embodiments, the synthetic peptide comprises an arginine analog. In certain embodiments, the synthetic peptide comprises a lysine analog. In certain embodiments, the synthetic peptide comprises a proline analog and an arginine analog. In certain embodiments, the synthetic peptide comprises a proline analog and an lysine analog. In certain embodiments, the synthetic peptide comprises an arginine analog and an lysine analog. In certain embodiments, the synthetic peptide comprises a proline analog, an arginine analog, and a lysine analog.

[0219] In certain embodiments, the synthetic peptide comprises at least one amino acid analog, for example, at least two, at least three, at least four, or at least five amino acid analogs. In certain embodiments, the synthetic peptide comprises no more than five amino acid analogs, e.g., no more than one, no more than two, no more than three, or no more than four amino acid analogs. In certain embodiments, the synthetic peptide comprises exactly one, exactly two, exactly three, exactly four, or exactly five D-amino acids analogs.

[0220] In certain embodiments, X1is the N-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one, two, or three additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) N-terminally to X1. In certain embodiments, each of the additional one, two, or three additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately N-terminal to X1(if present) is proline. In certain embodiments, the two amino acids immediately N-terminal to X1(if present) are each proline.In certain embodiments, the three amino acids immediately N-terminal to X1(if present) are, in the N-to-C-terminal direction, isoleucine, proline, and proline, respectively.

[0221] In certain embodiments, X0is the N-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one or two additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) N-terminally to X0. In certain embodiments, each of the additional one or two consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately N-terminal to X0(if present) is proline. In certain embodiments, the two amino acids immediately N-terminal to X0(if present) are isoleucine and proline, respectively.

[0222] In certain embodiments, the R'7position of Formula IV is the C-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one, two, or three additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) C-terminally to the R'7position of Formula IV. In certain embodiments, each of the additional one, two, or three additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately C- terminal to the R'7position of Formula IV (if present) is isoleucine. In certain embodiments, the two amino acids immediately C-terminal to the R'7position of Formula IV (if present) are isoleucine and leucine, respectively. In certain embodiments, the three amino acids immediately C-terminal to the R'7position of Formula IV (if present) are, in the N-to-C-terminal direction, isoleucine, leucine, and glutamic acid, respectively.

[0223] In certain embodiments, X8is the C-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one or two additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) C-terminally to X8. In certain embodiments, each of the additional one or two additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately C-terminal to X8(if present) is leucine. In certain embodiments, the two amino acids immediately C-terminal to X8(if present) are leucine and glutamic acid, respectively.

[0224] In certain embodiments wherein the synthetic peptide comprises a proline analog, each proline analog is independently selected from the group consisting of L-pipecolic acid, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, (S)-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4- difluoroproline, trans-4-hydroxyproline, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, L-azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid , (2S,4S)-4- aminopyrrolidine-2-carboxylic acid, (2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro- L-proline, (S)-indoline-2-carboxylic acid, (S)-oxazolidine-4-carboxylic acid, cis-4- hydroxyproline, (2S,3R)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,3S)-3-hydroxypyrrolidine- 2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4S)-4- (difluoromethyl)pyrrolidine-2-carboxylic acid, 2,4-methanoproline, (2S,4R)-4- (difluoromethoxy)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2- carboxylic acid, (S)-isoxazolidine-3-carboxylic acid, 4-trans-guanidinoproline, 4-cis- guanidinoproline, alpha-methyl-L-proline, and α-aminoisobutyric acid. In certain embodiments, each proline analog is independently selected from the group consisting of L-pipecolic acid, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, (S)-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4- difluoroproline, trans-4-hydroxyproline, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, L- azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid, (2S,4S)-4-aminopyrrolidine- 2-carboxylic acid, (2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, (S)- indoline-2-carboxylic acid, (S)-oxazolidine-4-carboxylic acid, cis-4-hydroxyproline, (2S,3R)-3- hydroxypyrrolidine-2-carboxylic acid, (2S,3S)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,4S)- 4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4S)-4-(difluoromethyl)pyrrolidine-2- carboxylic acid, 2,4-methanoproline, (2S,4R)-4-(difluoromethoxy)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2-carboxylic acid, (S)-isoxazolidine-3-carboxylic acid, 4-trans-guanidinoproline, 4-cis-guanidinoproline, and alpha-methyl-L-proline. In certain embodiments, each proline analog is independently selected from the group consisting of L- pipecolic acid, (S)-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (S)-2-amino-3-(thiophen-2- yl)propanoic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, trans-4-hydroxyproline, (2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, alpha-methyl-L-proline, L-azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid, (S)-oxazolidine-4- carboxylic acid, (S)-indoline-2-carboxylic acid, (2S,4S)-4-aminopyrrolidine-2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, α-aminoisobutyric acid, (2S,4S)-4- (difluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(difluoromethoxy)pyrrolidine-2- carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2-carboxylic acid, cis-4- hydroxyproline, and 2,4-methanoproline. In certain embodiments, each proline analog is independently selected from the group consisting of L-pipecolic acid, (S)-1,2,3,4- tetrahydroisoquinoline-3-carboxylic acid, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, and trans-4-hydroxyproline. In certain embodiments, each proline analog is independently selected from the list of proline analogs set forth in Table A1, Table A2, or Table A3. In certain embodiments, the proline analog is an internal residue of the synthetic peptide. For example, in certain embodiments, the proline analog is a selected from the list of proline analogs set forth in Table A1. In certain embodiments, the proline analog is the N-terminal residue of the synthetic peptide. For example, in certain embodiments, the proline analog is a selected from the list of proline analogs set forth in Table A2. In certain embodiments, the proline analog is the C-terminal residue of the synthetic peptide. For example, in certain embodiments, the proline analog is a selected from the list of proline analogs set forth in Table A3. In certain embodiments, the C-terminal proline analog is amidated.

[0225] In certain embodiments wherein the synthetic peptide comprises an arginine analog, each arginine analog is independently selected from the group consisting of L-homoarginine, L- citrulline, L-ornithine, 4-guanidinophenylalanine, 4-trans-guanidinoproline, 4-cis- guanidinoproline, methylarginine, asymmetric dimethylarginine, symmetric dimethylarginine, beta,beta-dimethylarginine, 2-amino-4-guanidino- L-butyric acid, and 2-amino-3-guanidino- L- propionic acid. In certain embodiments, each arginine analog is independently selected from the group consisting of L-homoarginine, L-citrulline, L-ornithine, 4-guanidinophenylalanine, 4-trans- guanidinoproline, 4-cis-guanidinoproline, methylarginine, asymmetric dimethylarginine, symmetric dimethylarginine, and beta,beta-dimethylarginine. In certain embodiments, each arginine analog is independently selected from the group consisting of L-homoarginine, L- citrulline, L-ornithine, methylarginine, symmetric dimethylarginine, 2-amino-4-guanidino- L- butyric acid, and 2-amino-3-guanidino- L-propionic acid, 4-cis-guanidinoproline, beta,beta- dimethylarginine, asymmetric dimethylarginine, 4-trans-guanidinoproline, and 4- guanidinophenylalanine. In certain embodiments, the arginine analog is independently selected from the group consisting of L-homoarginine and L-citrulline. In certain embodiments, the arginine analog is selected from the list of arginine analogs set forth in Table B1, Table B2, or Table B3. In certain embodiments, the arginine analog is an internal residue of the synthetic peptide. For example, in certain embodiments, the arginine analog is a selected from the list of arginine analogs set forth in Table B1. In certain embodiments, the arginine analog is the C- terminal residue of the synthetic peptide. For example, in certain embodiments, the arginine analog is a selected from the list of arginine analogs set forth in Table B2. In certain embodiments, the arginine analog is the N-terminal residue of the synthetic peptide. Forexample, in certain embodiments, the arginine analog is a selected from the list of arginine analogs set forth in Table B3. In certain embodiments, the C-terminal arginine analog is amidated.

[0226] In certain embodiments wherein the synthetic peptide comprises a lysine analog, each lysine analog is independently selected from the group consisting of L-ornithine, L-citrulline, L- homolysine, (S)-2-amino-3-(3-aminophenyl)propanoic acid, S-(2-aminoethyl)- L-cysteine, and 2,4-diamino-L-butryic acid. In certain embodiments, each lysine analog is independently selected from the group consisting of L-ornithine, L-citrulline, L-homolysine, (S)-2-amino-3-(3- aminophenyl)propanoic acid, and S-(2-aminoethyl)- L-cysteine. In certain embodiments, each lysine analog is independently selected from the group consisting of L-ornithine, L-citrulline, 2,4- diamino-L-butryic acid, L-homolysine, and S-(2-aminoethyl)-L-cysteine. In certain embodiments, each lysine analog is ornithine. In certain embodiments, each lysine analog is independently selected from the list of lysine analogs set forth in Table C1, Table C2, or Table C3. In certain embodiments, the lysine analog is an internal residue of the synthetic peptide. For example, in certain embodiments, the lysine analog is selected from the list of lysine analogs set forth in Table C1. In certain embodiments, the lysine analog is the N-terminal residue of the synthetic peptide. For example, in certain embodiments, the lysine analog is selected from the list of lysine analogs set forth in Table C2. In certain embodiments, the lysine analog is the C- terminal residue of the synthetic peptide. For example, in certain embodiments, the lysine analog is a selected from the list of lysine analogs set forth in Table C3. In certain embodiments, the C-terminal lysine analog is amidated.

[0227] In certain embodiments, the N-terminal residue of the synthetic peptide comprises a modification. For example, in certain embodiments, the N-terminal residue of the synthetic peptide is acetylated (e.g., as shown in Table D). In certain embodiments, the N-terminal residue comprises a fatty acid modification, such as an N-terminal fatty acid modification set forth in Table D.

[0228] In certain embodiments, X4is selected from alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, an arginine analog, a lysine analog, and a proline analog, wherein the proline analog is not (S)-1,2,3,4-tetrahydroisoquinoline-3- carboxylic acid (Tic), (S)-2-amino-3-(thiophen-2-yl)propanoic acid (Thi), Alpha-methyl-L- proline (Pro(2-methyl)), or 2,4-methanoproline. In certain embodiments X4is not (S)-1,2,3,4- tetrahydroisoquinoline-3-carboxylic acid (Tic), (S)-2-amino-3-(thiophen-2-yl)propanoic acid(Thi), Alpha-methyl-L-proline (Pro(2-methyl)), or 2,4-methanoproline. In certain embodiments, X4is not a proline analog.

[0229] In certain embodiments, X1is selected from any amino acid, an arginine analog, a lysine analog, and a proline analog, wherein the proline analog is not (S)-4-oxopyrrolidine-2- carboxylic acid (Pro(4-keto)). In certain embodiments, X1is not (S)-4-oxopyrrolidine-2- carboxylic acid (Pro(4-keto)). In certain embodiments, X1is not a proline analog.

[0230] In certain embodiments, X3is selected from any amino acid, a proline analog, an arginine analog, and a lysine analog, wherein the proline analog is not α-aminoisobutyric acid. In certain embodiments, X3is not α-aminoisobutyric acid. In certain embodiments, X3is not a proline analog.

[0231] In certain embodiments, P'2is a proline analog, wherein the proline analog is not 2,4- methanoproline. In certain embodiments, P'2is not 2,4-methanoproline.

[0232] In certain embodiments, the synthetic peptide comprises or consists essentially of the amino acid sequence of any one of SEQ ID NOs: 171-202, 209-273, 286-327, 330-357, or 366. In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 15, Table 16, Table 17, Table 19, or Table 21.

[0233] In certain embodiments, the synthetic peptide comprises or consists essentially of the amino acid sequence of any one of SEQ ID NOs: 171-175, 177-195, 200-202, 209-215, 217-236, 238-273, 286-290, 292-302, 304-327, 330-332, 334-357, or 366. In certain embodiments, the synthetic peptide does not comprise the amino acid sequence of any of SEQ ID NOs: 176, 196- 199, 216, 237, 291, 303, or 333. In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 15, Table 16, Table 17, Table 19, or Table 21, wherein the KDvalue with which the synthetic peptide binds NCK1 is less than or equal to 1 mM (e.g., as measured by ITC). In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 15, Table 16, Table 17, Table 19, or Table 21, wherein the KDvalue with which the synthetic peptide binds NCK1 is less than or equal to 600 μM (e.g., as measured by ITC). In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 15, Table 16, Table 17, Table 19, or Table 21, wherein the KDvalue with which the synthetic peptide binds NCK1 is less than or equal to 300 μM (e.g., as measured by ITC).e. Synthetic Peptides Comprising a D-Amino Acid

[0234] In certain embodiments described herein, the disclosure relates to a synthetic peptide comprising an amino acid sequence of at least 7 consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the synthetic peptide comprises at least one D-amino acid and comprises the amino acid sequence of Formula IV: X1P'2X3X4P'5X6R'7(Formula IV), wherein X1is selected from any amino acid, a proline analog, an arginine analog, and a lysine analog; P'2is proline or a proline analog; X3is selected from any amino acid, a proline analog, an arginine analog, and a lysine analog; X4is selected from alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, a proline analog, an arginine analog, and a lysine analog; P'5is proline or a proline analog; X6is selected from any amino acid, a proline analog, an arginine analog, and a lysine analog; and R'7is selected from arginine and an arginine analog. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 amino acids (or amino acid analogs) in length. In certain embodiments, the synthetic peptide is 7 to 10 amino acids (or amino acid analogs) in length.

[0235] In certain embodiments, X1is a proline analog, an arginine analog, or a lysine analog (e.g., a proline analog). In other embodiments, X1is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X1is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X1is proline. In certain embodiments, X1is a D-amino acid, e.g., D-proline.

[0236] In certain embodiments, P'2is a proline analog. In other embodiments, P'2is proline.

[0237] In certain embodiments, X3is a proline analog, an arginine analog, or a lysine analog, e.g., an arginine analog. In other embodiments, X3is selected from any amino acid, e.g.,alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, and valine. In certain embodiments, X3is arginine.

[0238] In certain embodiments, X3is a charged amino acid, for example, a positively charged amino acid or a negatively charged amino acid. In certain embodiments, X3is arginine, histidine, or lysine. In certain embodiments, X3is arginine. In certain embodiments, X3is glutamic acid. In certain embodiments, X3is an uncharged amino acid. In certain embodiments, X3is a hydrophobic amino acid. In certain embodiments, X3is alanine, asparagine, or serine.

[0239] In certain embodiments, X4is a proline analog, an arginine analog, or a lysine analog, e.g., a proline analog. In other embodiments, X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine. In certain embodiments, X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, proline, threonine, and valine. In certain embodiments, X4is selected from the group consisting of alanine, isoleucine, proline, and valine. In certain embodiments, X4is selected from the group consisting of isoleucine, proline, and valine. In certain embodiments, X4is proline.

[0240] In certain embodiments, X4is an uncharged, non-aromatic amino acid. In certain embodiments, X4is alanine or proline. In certain embodiments, X4is proline. In certain embodiments, X4is a hydrophobic, non-aromatic amino acid. In certain embodiments, X4is alanine. In certain embodiments, X4is a charged amino acid, for example, a positively charged amino acid. In certain embodiments, X4is arginine.

[0241] In certain embodiments, P'5is a proline analog. In other embodiments, P'5is proline.

[0242] In certain embodiments, X6is a proline analog, an arginine analog, or a lysine analog, e.g., a lysine analog. In other embodiments, X6is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is selected from the group consisting ofalanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is selected from the group consisting of alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is lysine.

[0243] In certain embodiments, X6is a charged amino acid, for example a positively charged amino acid or a negatively charged amino acid. In certain embodiments, X6is arginine, histidine, or lysine. In certain embodiments, X6is lysine. In certain embodiments, X6is glutamic acid. In certain embodiments, X6is an uncharged amino acid. In certain embodiments, X6is alanine, asparagine, cysteine, serine, or tryptophan. In certain embodiments, X6is a hydrophobic amino acid. In certain embodiments, X6is alanine, cysteine, or tryptophan.

[0244] In certain embodiments, R'7is an arginine analog. In other embodiments, R'7is arginine.

[0245] In certain embodiments, the synthetic peptide further comprises an amino acid residue or an amino acid analog that is N-terminal to position X1in Formula I (X0). In certain embodiments, X0is a proline analog, an arginine analog, or a lysine analog, e.g., a proline analog. In other embodiments, X0is selected from any amino acid, e.g., selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X0is alanine or proline. In certain embodiments, X0is proline. In certain embodiments, X0is a D-amino acid, e.g., D- proline or D-alanine.

[0246] In certain embodiments, the synthetic peptide further comprises an amino acid residue or an amino acid analog that is C-terminal to the arginine residue at position 7 in Formula I (X8). In certain embodiments, X8is a proline analog, an arginine analog, or a lysine analog. For example, in certain embodiments, X8is a proline analog. In other embodiments, X8is selected from any amino acid, e.g., selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine. In certain embodiments, X8is selected from the groupconsisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, serine, tryptophan, and tyrosine. In certain embodiments, X8is selected from the group consisting of arginine, cysteine, and alanine. In certain embodiments, X8is isoleucine. In certain embodiments, X8is a D-amino acid, for example, D-alanine, D-arginine, or D-isoleucine.

[0247] In certain embodiments, if X3and X6are each independently any amino acid, then X4is a non-aromatic amino acid. In certain embodiments, if X3is alanine and X4is valine, then X6is not proline. In certain embodiments, if X4is proline and X6is arginine, then X3is not arginine or glutamine. In certain embodiments, if X4is proline and X6is methionine, then X3is not histidine.

[0248] In certain embodiments, the synthetic peptide comprises a proline analog. In certain embodiments, the synthetic peptide comprises an arginine analog. In certain embodiments, the synthetic peptide comprises a lysine analog. In certain embodiments, the synthetic peptide comprises a proline analog and an arginine analog. In certain embodiments, the synthetic peptide comprises a proline analog and an lysine analog. In certain embodiments, the synthetic peptide comprises an arginine analog and an lysine analog. In certain embodiments, the synthetic peptide comprises a proline analog, an arginine analog, and a lysine analog.

[0249] In certain embodiments, the synthetic peptide comprises at least two D-amino acids, for example, at least three, at least four, or at least five D-amino acids. In certain embodiments, the synthetic peptide comprises no more than five D-amino acids, e.g., no more than one, no more than two, no more than three, or no more than four D-amino acids. In certain embodiments, the synthetic peptide comprises exactly one, exactly two, exactly three, exactly four, or exactly five D-amino acids.

[0250] In certain embodiments, the synthetic peptide comprises an amino acid analog. In certain embodiments, the synthetic peptide comprises at least one amino acid analog, for example, at least two, at least three, at least four, or at least five amino acid analogs. In certain embodiments, the synthetic peptide comprises no more than five amino acid analogs, e.g., no more than one, no more than two, no more than three, no more than four, or no more than five amino acid analogs. In certain embodiments, the synthetic peptide comprises exactly one, exactly two, exactly three, exactly four, or exactly five amino acids analogs.

[0251] In certain embodiments, X1is the N-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one, two, or three additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked bypeptide bond) N-terminally to X1. In certain embodiments, each of the additional one, two, or three additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately N-terminal to X1(if present) is proline. In certain embodiments, the two amino acids immediately N-terminal to X1(if present) are each proline. In certain embodiments, the three amino acids immediately N-terminal to X1(if present) are, in the N-to-C-terminal direction, isoleucine, proline, and proline, respectively.

[0252] In certain embodiments, X0is the N-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one or two additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) N-terminally to X0. In certain embodiments, each of the additional one or two consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately N-terminal to X0(if present) is proline. In certain embodiments, the two amino acids immediately N-terminal to X0(if present) are isoleucine and proline, respectively.

[0253] In certain embodiments, the R'7position of Formula IV is the C-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one, two, or three additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) C-terminally to the R'7position of Formula IV. In certain embodiments, each of the additional one, two, or three additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately C- terminal to the R'7position of Formula IV (if present) is isoleucine. In certain embodiments, the two amino acids immediately C-terminal to the R'7position of Formula IV (if present) are isoleucine and leucine, respectively. In certain embodiments, the three amino acids immediately C-terminal to the R'7position of Formula IV (if present) are, in the N-to-C-terminal direction, isoleucine, leucine, and glutamic acid, respectively.

[0254] In certain embodiments, X8is the C-terminal amino acid or amino acid analog of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one or two additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) C-terminally to X8. In certain embodiments, each of the additional one or two additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately C-terminal to X8(if present) is leucine. In certain embodiments, the two amino acids immediately C-terminal to X8(if present) are leucine and glutamic acid, respectively.

[0255] In certain embodiments, X3is not a D-amino acid. In certain embodiments, X3is not D- arginine. In certain embodiments, X4is not a D-amino acid. In certain embodiments, X4is not D-proline. In certain embodiments, P'5is not a D-amino acid. In certain embodiments, P'5is not D-proline. In certain embodiments, X6is not a D-amino acid. In certain embodiments, X6is not D-lysine. In certain embodiments, none of X3, X4, P'5, or X6are D-amino acids.

[0256] In certain embodiments wherein the synthetic peptide comprises a proline analog, each proline analog is independently selected from the group consisting of L-pipecolic acid, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, (S)-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4- difluoroproline, trans-4-hydroxyproline, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, L- azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid , (2S,4S)-4- aminopyrrolidine-2-carboxylic acid, (2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro- L-proline, (S)-indoline-2-carboxylic acid, (S)-oxazolidine-4-carboxylic acid, cis-4- hydroxyproline, (2S,3R)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,3S)-3-hydroxypyrrolidine- 2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4S)-4- (difluoromethyl)pyrrolidine-2-carboxylic acid, 2,4-methanoproline, (2S,4R)-4- (difluoromethoxy)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2- carboxylic acid, (S)-isoxazolidine-3-carboxylic acid, 4-trans-guanidinoproline, 4-cis- guanidinoproline, alpha-methyl-L-proline, and α-aminoisobutyric acid. In certain embodiments, each proline analog is independently selected from the group consisting of L-pipecolic acid, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, (S)-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4- difluoroproline, trans-4-hydroxyproline, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, L- azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid, (2S,4S)-4-aminopyrrolidine- 2-carboxylic acid, (2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, (S)- indoline-2-carboxylic acid, (S)-oxazolidine-4-carboxylic acid, cis-4-hydroxyproline, (2S,3R)-3- hydroxypyrrolidine-2-carboxylic acid, (2S,3S)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,4S)- 4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4S)-4-(difluoromethyl)pyrrolidine-2- carboxylic acid, 2,4-methanoproline, (2S,4R)-4-(difluoromethoxy)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2-carboxylic acid, (S)-isoxazolidine-3-carboxylic acid, 4-trans-guanidinoproline, 4-cis-guanidinoproline, and alpha-methyl-L-proline. In certain embodiments, each proline analog is independently selected from the group consisting of L- pipecolic acid, (S)-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (S)-2-amino-3-(thiophen-2- yl)propanoic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline,4,4-difluoroproline, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, trans-4-hydroxyproline, (2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, alpha-methyl-L-proline, L-azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid, (S)-oxazolidine-4- carboxylic acid, (S)-indoline-2-carboxylic acid, (2S,4S)-4-aminopyrrolidine-2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, α-aminoisobutyric acid, (2S,4S)-4- (difluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(difluoromethoxy)pyrrolidine-2- carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2-carboxylic acid, cis-4- hydroxyproline, and 2,4-methanoproline. In certain embodiments, each proline analog is independently selected from the group consisting of L-pipecolic acid, (S)-1,2,3,4- tetrahydroisoquinoline-3-carboxylic acid, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, (R)- thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, and trans-4-hydroxyproline. In certain embodiments, each proline analog is independently selected from the list of proline analogs set forth in Table A1, Table A2, or Table A3. In certain embodiments, the proline analog is an internal residue of the synthetic peptide. For example, in certain embodiments, the proline analog is selected from the list of proline analogs set forth in Table A1. In certain embodiments, the proline analog is the N-terminal residue of the synthetic peptides. For example, in certain embodiments, the proline analog is a selected from the list of proline analogs set forth in Table A2. In certain embodiments, the proline analog is the C-terminal residue of the synthetic peptide. For example, in certain embodiments, the proline analog is selected from the list of proline analogs set forth in Table A3. In certain embodiments, the C-terminal proline analog is amidated.

[0257] In certain embodiments wherein the synthetic peptide comprises an arginine analog, each arginine analog is independently selected from the group consisting of L-homoarginine, L- citrulline, L-ornithine, 4-guanidinophenylalanine, 4-trans-guanidinoproline, 4-cis- guanidinoproline, methylarginine, asymmetric dimethylarginine, symmetric dimethylarginine, beta,beta-dimethylarginine, 2-amino-4-guanidino- L-butyric acid, and 2-amino-3-guanidino- L- propionic acid. In certain embodiments, each arginine analog is independently selected from the group consisting of L-homoarginine, L-citrulline, L-ornithine, 4-guanidinophenylalanine, 4-trans- guanidinoproline, 4-cis-guanidinoproline, methylarginine, asymmetric dimethylarginine, symmetric dimethylarginine, and beta,beta-dimethylarginine. In certain embodiments, each arginine analog is independently selected from the group consisting of L-homoarginine, L- citrulline, L-ornithine, methylarginine, symmetric dimethylarginine, 2-amino-4-guanidino- L- butyric acid, and 2-amino-3-guanidino- L-propionic acid, 4-cis-guanidinoproline, beta,beta-dimethylarginine, asymmetric dimethylarginine, 4-trans-guanidinoproline, and 4- guanidinophenylalanine. In certain embodiments, the arginine analog is independently selected from the group consisting of L-homoarginine and L-citrulline. In certain embodiments, the arginine analog is independently selected from the list of arginine analogs set forth in Table B1, Table B2 or Table B3. In certain embodiments, the arginine analog is an internal residue of the synthetic peptide. For example, in certain embodiments, the arginine analog is selected from the list of arginine analogs set forth in Table B1. In certain embodiments, the arginine analog is the C-terminal residue of the synthetic peptide. For example, in certain embodiments, the arginine analog is selected from the list of arginine analogs set forth in Table B2. In certain embodiments, the arginine analog is the N-terminal residue of the synthetic peptide. For example, in certain embodiments, the arginine analog is a selected from the list of arginine analogs set forth in Table B3. In certain embodiments, the C-terminal arginine analog is amidated.

[0258] In certain embodiments wherein the synthetic peptide comprises a lysine analog, each lysine analog is independently selected from the group consisting of L-ornithine, L-citrulline, L- homolysine, (S)-2-amino-3-(3-aminophenyl)propanoic acid, S-(2-aminoethyl)- L-cysteine, and 2,4-diamino-L-butryic acid. In certain embodiments, each lysine analog is independently selected from the group consisting of L-ornithine, L-citrulline, L-homolysine, (S)-2-amino-3-(3- aminophenyl)propanoic acid, and S-(2-aminoethyl)- L-cysteine. In certain embodiments, each lysine analog is independently selected from the group consisting of L-ornithine, L-citrulline, 2,4- diamino-L-butryic acid, L-homolysine, and S-(2-aminoethyl)-L-cysteine. In certain embodiments, each lysine analog is ornithine. In certain embodiments, each lysine analog is independently selected from the list of lysine analogs set forth in Table C1 or Table C2. In certain embodiments, the lysine analog is an internal residue of the synthetic peptide. For example, in certain embodiments, the lysine analog is selected from the list of lysine analogs set forth in Table C1. In certain embodiments, the lysine analog is the N-terminal residue of the synthetic peptide. For example, in certain embodiments, the lysine analog is selected from the list of lysine analogs set forth in Table C2. In certain embodiments, the lysine analog is the C- terminal residue of the synthetic peptide. For example, in certain embodiments, the lysine analog is a selected from the list of lysine analogs set forth in Table C3. In certain embodiments, the C-terminal lysine analog is amidated.

[0259] In certain embodiments, the N-terminal residue of the synthetic peptide comprises a modification. For example, in certain embodiments, the N-terminal residue of the synthetic peptide is acetylated (e.g., as shown in Table D). In certain embodiments, the N-terminalresidue comprises a fatty acid modification, such as an N-terminal fatty acid modification set forth in Table D.

[0260] In certain embodiments, X4is selected from alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, an arginine analog, a lysine analog, and a proline analog, wherein the proline analog is not (S)-1,2,3,4-tetrahydroisoquinoline-3- carboxylic acid (Tic), (S)-2-amino-3-(thiophen-2-yl)propanoic acid (Thi), Alpha-methyl-L- proline (Pro(2-methyl)), or 2,4-methanoproline. In certain embodiments X4is not (S)-1,2,3,4- tetrahydroisoquinoline-3-carboxylic acid (Tic), (S)-2-amino-3-(thiophen-2-yl)propanoic acid (Thi), Alpha-methyl-L-proline (Pro(2-methyl)), or 2,4-methanoproline. In certain embodiments, X4is not a proline analog.

[0261] In certain embodiments, X1is selected from any amino acid, an arginine analog, a lysine analog, and a proline analog, wherein the proline analog is not (S)-4-oxopyrrolidine-2- carboxylic acid (Pro(4-keto)). In certain embodiments, X1is not (S)-4-oxopyrrolidine-2- carboxylic acid (Pro(4-keto)). In certain embodiments, X1is not a proline analog.

[0262] In certain embodiments, X3is selected from any amino acid, a proline analog, an arginine analog, and a lysine analog, wherein the proline analog is not α-aminoisobutyric acid. In certain embodiments, X3is not α-aminoisobutyric acid. In certain embodiments, X3is not a proline analog.

[0263] In certain embodiments, P'2is a proline analog, wherein the proline analog is not 2,4- methanoproline. In certain embodiments, P'2is not 2,4-methanoproline.

[0264] In certain embodiments, the synthetic peptide comprises or consists essentially of the amino acid sequence of any one of SEQ ID NOs: 274-287 or 328. In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 20.

[0265] In certain embodiments, the synthetic peptide comprises or consists essentially of the amino acid sequence of any one of SEQ ID NOs: 274-275 or 279-287. In certain embodiments, the synthetic peptide does not comprise the amino acid sequence of any of SEQ ID NOs: 276- 278 or 328. In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 20, wherein the KDvalue with which the synthetic peptide binds NCK1 is less than or equal to 1 mM (e.g., as measured by ITC). In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 20, wherein the KDvalue with which the synthetic peptide binds NCK1 is less than or equal to 600 μM (e.g., as measured by ITC). In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth inTable 20, wherein the KDvalue with which the synthetic peptide binds NCK1 is less than or equal to 300 μM (e.g., as measured by ITC). f. Synthetic Peptides Comprising an N-terminal Fatty Acid Modification

[0266] In certain embodiments described herein, the disclosure relates to a synthetic peptide comprising an amino acid sequence of at least 7 consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the synthetic peptide comprises an N-terminal fatty acid modification and comprises the amino acid sequence of Formula III: X1P X3X4P X6R (Formula III), wherein X1is selected from any amino acid; X3is selected from any amino acid; X4is selected from alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine; and X6is selected from any amino acid. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 amino acids (or amino acid analogs) in length. In certain embodiments, the synthetic peptide is 7 to 10 amino acids (or amino acid analogs) in length.

[0267] In certain embodiments, X1is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X1is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X1is proline.

[0268] In certain embodiments, X3is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X3is selected from the group consisting of alanine, arginine,asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine. In certain embodiments, X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, and valine. In certain embodiments, X3is arginine.

[0269] In certain embodiments, X3is a charged amino acid, for example, a positively charged amino acid or a negatively charged amino acid. In certain embodiments, X3is arginine, histidine, or lysine. In certain embodiments, X3is arginine. In certain embodiments, X3is glutamic acid. In certain embodiments, X3is an uncharged amino acid. In certain embodiments, X3is a hydrophobic amino acid. In certain embodiments, X3is alanine, asparagine, or serine.

[0270] In certain embodiments, X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine. In certain embodiments, X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, proline, threonine, and valine. In certain embodiments, X4is selected from the group consisting of alanine, isoleucine, proline, and valine. In certain embodiments, X4is selected from the group consisting of isoleucine, proline, and valine. In certain embodiments, X4is proline.

[0271] In certain embodiments, X4is an uncharged, non-aromatic amino acid. In certain embodiments, X4is alanine or proline. In certain embodiments, X4is proline. In certain embodiments, X4is a hydrophobic, non-aromatic amino acid. In certain embodiments, X4is alanine. In certain embodiments, X4is a charged amino acid, for example, a positively charged amino acid. In certain embodiments, X4is arginine.

[0272] In certain embodiments, X6is selected from any amino acid, e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is selected from the group consisting of alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X6is lysine.

[0273] In certain embodiments, X6is a charged amino acid, for example a positively charged amino acid or a negatively charged amino acid. In certain embodiments, X6is arginine, histidine, or lysine. In certain embodiments, X6is lysine. In certain embodiments, X6is glutamic acid. In certain embodiments, X6is an uncharged amino acid. In certain embodiments, X6is alanine, asparagine, cysteine, serine, or tryptophan. In certain embodiments, X6is a hydrophobic amino acid. In certain embodiments, X6is alanine, cysteine, or tryptophan.

[0274] In certain embodiments, the synthetic peptide further comprises an amino acid residue that is C-terminal to position R in Formula III (X8). In certain embodiments, X8is selected from any amino acid, e.g., selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In certain embodiments, X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine. In certain embodiments, X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, serine, tryptophan, and tyrosine. In certain embodiments, X8is selected from the group consisting of arginine, cysteine, and alanine. In certain embodiments, X8is isoleucine.

[0275] In certain embodiments, if X3and X6are each independently any amino acid, then X4is a non-aromatic amino acid. In certain embodiments, if X3is alanine and X4is valine, then X6is not proline. In certain embodiments, if X4is proline and X6is arginine, then X3is not arginine or glutamine. In certain embodiments, if X4is proline and X6is methionine, then X3is not histidine.

[0276] In certain embodiments, X1is the N-terminal amino acid of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one, two, or three additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) N-terminally to X1. In certain embodiments, each of the additional one, two, or three additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately N-terminal to X1(if present) is proline. In certain embodiments, the two amino acids immediately N-terminal to X1(if present) are each proline. In certain embodiments, the three amino acids immediately N-terminal to X1(if present) are, in the N-to-C-terminal direction, isoleucine, proline, and proline, respectively.

[0277] In certain embodiments, the R in position 7 of Formula III is the C-terminal amino acid of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one, two, or three additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) C-terminally to the R in position 7 of Formula III. In certain embodiments, each of the additional one, two, or three additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately C-terminal to the R in position 7 of Formula III (if present) is isoleucine. In certain embodiments, the two amino acids immediately C-terminal to the R in position 7 of Formula III (if present) are isoleucine and leucine, respectively. In certain embodiments, the three amino acids immediately C-terminal to the R in position 7 of Formula III (if present) are, in the N-to-C-terminal direction, isoleucine, leucine, and glutamic acid, respectively.

[0278] In certain embodiments, X8is the C-terminal amino acid of the synthetic peptide. In certain embodiments, the synthetic peptide comprises one or two additional consecutive amino acids or amino acid analogs covalently linked (e.g., linked by peptide bond) C-terminally to X8. In certain embodiments, each of the additional one or two additional consecutive amino acids is, independently, any amino acid. In certain embodiments, the amino acid immediately C-terminal to X8(if present) is leucine. In certain embodiments, the two amino acids immediately C- terminal to X8(if present) are leucine and glutamic acid, respectively.

[0279] In certain embodiments, the N-terminal fatty acid modification is selected from a fatty acid modification set forth in Table D. Table D – Exemplary N-terminal Modifications

[0280] In certain embodiments, the N-terminal fatty acid modification is selected from the group consisting of N-epsilon-palmitoyl-L-lysine, N-epsilon-((S)-4-carboxy-4- palmitamidobutanoyl)-L-lysine, (1S,28S)-1-amino-7,16,25,30-tetraoxo-9,12,18,21-tetraoxa- 6,15,24,29-tetraazahexatetracontane-1,28,46-tricarboxylic acid, (1S,28S)-1-amino-7,16,25,30- tetraoxo-9,12,18,21-tetraoxa-6,15,24,29-tetraazaoctatetracontane-1,28,48-tricarboxylic acid, N- epsilon-heptanoyl-L-lysine, N-epsilon-octanoyl-L-lysine, N-epsilon-lauroyl-L-lysine, N-epsilon-(12-aminolauroyl)-L-lysine, N-gamma-lauroyl-L-glutamine, N-epsilon-myristoyl-L-lysine, (S)- 16-((5-amino-5-carboxypentyl)amino)-16-oxohexadecanoic acid, 16-(((S)-4-(((S)-5-amino-5- carboxypentyl)amino)-1-carboxy-4-oxobutyl)amino)-16-oxohexadecanoic acid, N-epsilon- stearoyl-L-lysine, propionic acid, butyric acid, valeric acid, caproic acid, adipic acid, heptanoic acid, caprylic acid, octanedioic acid, capric acid, decanedioic acid, lauric acid, dodecanedioic acid, 12-aminododecanoic acid, tridecylic acid, myristic acid, tetradecanedioic acid, pentadecylic acid, pentadecanedioic acid, palmitic acid, thapsic acid, margaric acid, heptadecanedioic acid, stearic acid, octadecanedioic acid, nonadecylic acid, nonadecanedioic acid, arachidic acid, icosanedioic acid, behenic acid, and docosanedioic acid. In certain embodiments, the N-terminal fatty acid modification is selected from the group consisting of N-epsilon-palmitoyl-L-lysine, N- epsilon-((S)-4-carboxy-4-palmitamidobutanoyl)-L-lysine, and (1S,28S)-1-amino-7,16,25,30- tetraoxo-9,12,18,21-tetraoxa-6,15,24,29-tetraazahexatetracontane-1,28,46-tricarboxylic acid.

[0281] In certain embodiments, the N-terminal residue of the synthetic peptide is also acetylated.

[0282] In certain embodiments, the synthetic peptide does not comprise any amino acid analogs. In other embodiments, the synthetic peptide comprises an amino acid analog, e.g., a proline analog, an arginine analog, or a lysine analog. In certain embodiments, the synthetic peptide does not comprise any D-amino acids. In certain embodiments, the synthetic peptide comprises or consists essentially of the amino acid sequence of any one of SEQ ID NOs: 203- 208, 358-360, or 367. In certain embodiments, the synthetic peptide is selected from the synthetic peptides set forth in Table 18. III. Pharmaceutical Compositions

[0283] For therapeutic use, a synthetic NCK1-binding peptide of the disclosure preferably is combined with a pharmaceutically acceptable carrier.

[0284] Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is known in the art. Suitable formulations for use in the present disclosure are found in Adeboye Adejare, Remington: The Science and Practice of Pharmacy (23d ed.2020). For a brief review of methods for drug delivery, see, e.g., Langer, Science (1990) 249:1527-1533, 1990.

[0285] In certain embodiments, a pharmaceutical composition may contain formulation materials for modifying, maintaining or preserving, for example, the pH, osmolarity, viscosity,clarity, color, isotonicity, odor, sterility, stability, rate of dissolution or release, adsorption or penetration of the composition. In such embodiments, suitable formulation materials include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine or lysine); antimicrobials; antioxidants (such as ascorbic acid, sodium sulfite or sodium hydrogen-sulfite); buffers (such as borate, bicarbonate, Tris-HCl, citrates, phosphates or other organic acids); bulking agents (such as mannitol or glycine); chelating agents (such as ethylenediamine tetraacetic acid (EDTA)); complexing agents (such as caffeine, polyvinylpyrrolidone, beta- cyclodextrin or hydroxypropyl-beta-cyclodextrin); fillers; monosaccharides; disaccharides; and other carbohydrates (such as glucose, mannose or dextrins); proteins (such as serum albumin, gelatin or immunoglobulins); coloring, flavoring and diluting agents; emulsifying agents; hydrophilic polymers (such as polyvinylpyrrolidone); low molecular weight polypeptides; salt- forming counterions (such as sodium); preservatives (such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid or hydrogen peroxide); solvents (such as glycerin, propylene glycol or polyethylene glycol); sugar alcohols (such as mannitol or sorbitol); suspending agents; surfactants or wetting agents (such as pluronics, PEG, sorbitan esters, polysorbates such as polysorbate 20, polysorbate, triton, tromethamine, lecithin, cholesterol, tyloxapal); stability enhancing agents (such as sucrose or sorbitol); tonicity enhancing agents (such as alkali metal halides, preferably sodium or potassium chloride, mannitol sorbitol); delivery vehicles; diluents; excipients and / or pharmaceutical adjuvants (see Adeboye Adejare, Remington: The Science and Practice of Pharmacy (23d ed.2020)).

[0286] In one embodiment, the disclosure provides a pharmaceutical composition comprising a synthetic peptide described herein, wherein the synthetic peptide comprises an amino acid sequence of at least 7 consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises the amino acid sequence of Formula I, Formula II, Formula III, or Formula IV as described herein above. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs. In the certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 amino acids (or amino acid analogs) in length. In certain embodiments, the synthetic peptide is 7 to 10 amino acids (or amino acid analogs) in length.In another embodiment, the disclosure provides a pharmaceutical composition comprising a synthetic peptide described herein, wherein the synthetic peptide comprises an amino acid sequence of at least 7 consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises the amino acid sequence of Formula I, Formula II, Formula III or Formula IV as described herein above, and wherein the synthetic peptide comprises at least one amino acid analog, an N-terminal fatty acid modification, and / or at least one D-amino acid. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs. In the certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 amino acids (or amino acid analogs) in length. In certain embodiments, the synthetic peptide is 7 to 10 amino acids (or amino acid analogs) in length.

[0287] In certain embodiments, a synthetic NCK1-binding peptide of the disclosure is formulated as a salt, e.g., as an acetate salt. In certain embodiments, the acetate salt a bis-acetate salt or as a tri-acetate salt. In certain embodiments, the acetate salt is a trifluoroacetate salt. In certain embodiments, the peptide is formulated as an acetate salt and combined with a pharmaceutically acceptable carrier. In certain embodiments, at least one amino acid or at least two amino acid residues are covalently linked to a chemical moiety not present in a natural amino acid. In certain embodiments, the disclosure provides a composition (e.g., a pharmaceutical composition) comprising a synthetic NCK1-binding peptide formulated as a free base or as a salt, as described herein.

[0288] In certain embodiments, a composition (e.g., a pharmaceutical composition) may comprise a synthetic NCK1-binding peptide of the disclosure, wherein the purity of the synthetic peptide is at least 95%. For example, the purify of the synthetic peptide in the composition may be at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5%.

[0289] Pharmaceutical compositions containing a synthetic NCK1-binding peptide as disclosed herein can optionally be dried, using any appropriate method known to those skilled in the art. The pharmaceutical composition can, for example, be freeze dried or lyophilized.

[0290] In certain embodiments, a pharmaceutical composition may contain nanoparticles, or lipid droplets, e.g., polymeric nanoparticles, liposomes, or micelles (See Anselmo et al. (2016) BIOENG. TRANSL. MED.1: 10-29).

[0291] In certain embodiments, a pharmaceutical composition may contain a sustained- or controlled-delivery formulation. Techniques for formulating sustained- or controlled-delivery means, such as liposome carriers, bio-erodible microparticles or porous beads and depot injections, are also known to those skilled in the art. Sustained-release preparations may include, e.g., porous polymeric microparticles or semipermeable polymer matrices in the form of shaped articles, e.g., films, or microcapsules. Sustained release matrices may include polyesters, hydrogels, polylactides, copolymers of L-glutamic acid and gamma ethyl-L-glutamate, poly (2- hydroxyethyl-inethacrylate), ethylene vinyl acetate, or poly-D(−)-3-hydroxybutyric acid. Sustained release compositions may also include liposomes that can be prepared by any of several methods known in the art.

[0292] Pharmaceutical compositions containing a synthetic NCK1-binding peptide as disclosed herein can be presented in a dosage unit form and can be prepared by any suitable method. A pharmaceutical composition should be formulated to be compatible with its intended route of administration. Examples of routes of administration are subcutaneous (SC), intravenous (IV), intraperitoneal, intradermal, inhalation, transdermal, topical, transmucosal, intrathecal, and rectal administration. In certain embodiments, the synthetic peptide is administered by subcutaneous administration.

[0293] Useful formulations can be prepared by methods known in the pharmaceutical art. For example, see Adeboye Adejare, Remington: The Science and Practice of Pharmacy (23d ed. 2020). Formulation components suitable for parenteral administration include a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as EDTA; buffers such as acetates, citrates or phosphates; and agents for the adjustment of tonicity such as sodium chloride or dextrose.

[0294] For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). The carrier should be stable under the conditions of manufacture and storage, and should be preserved against microorganisms. The carrier can be a solvent or dispersion mediumcontaining, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof.

[0295] Pharmaceutical formulations preferably are sterile. Sterilization can be accomplished by any suitable method, e.g., filtration through sterile filtration membranes, gamma radiation, etc. Where the composition is lyophilized, filter sterilization can be conducted prior to or following lyophilization and reconstitution.

[0296] The compositions described herein may be administered locally or systemically. It is contemplated that the compositions described herein are generally administered by parenteral administration. Preparations for parenteral administration include sterile aqueous or non- aqueous solutions, suspensions, and emulsions. In certain embodiments, the pharmaceutical composition is administered subcutaneously or may be administered intravenously, e.g., via intravenous infusion. In certain embodiments, it is contemplated that the synthetic constructs disclosed herein can be administered by systemic administration.

[0297] In embodiments wherein the compositions (e.g., pharmaceutical compositions) of the disclosure are aqueous, the composition can comprise a synthetic peptide of the disclosure at a concentration of, e.g., 150 mg / mL to 400 mg / mL. For example, the concentration of the synthetic peptide in the aqueous composition can be 150 mg / mL to 400 mg / mL, 150 mg / mL to 300 mg / mL, 150 mg / mL to 200 mg / mL, 200 mg / mL to 400 mg / mL, 200 mg / mL to 300 mg / mL, or 300 mg / mL to 400 mg / mL. In certain embodiments, the concentration of the synthetic peptide in the aqueous composition is 150 mg / mL, 200 mg / mL, 300 mg / mL, or 400 mg / mL. In certain embodiments, the aqueous composition is injectable (e.g., suitable for subcutaneous injection).

[0298] Generally, a therapeutically effective amount of active component, for example, a synthetic NCK1-binding peptide of the disclosure, is in the range of 0.1 mg / kg to 100 mg / kg, e.g., 1 mg / kg to 100 mg / kg. In certain embodiments, the effective amount is in the range of 15 to 30 mg / kg. In certain embodiments, the effective amount is 15 mg / kg. In certain embodiments, the effective amount is 30 mg / kg. In certain embodiments, the effective amount is in the range of 30 mg / kg to 150 mg / kg, e.g., 30 mg / kg to 75 mg / kg or 75 mg / kg to 150 mg / kg. In certain embodiments, the effective amount is 30 mg / kg. In certain embodiments, the effective amount is 75 mg / kg. In certain embodiments, the effective amount is 150 mg / kg. In certain embodiments, the effective amount is in the range of 50 mg / kg to 350 mg / kg, e.g., 50 mg / kg to 175 mg / kg or 175 mg / kg to 350 mg / kg. In certain embodiments, the effective amount is 50 mg / kg. In certain embodiments, the effective amount is 175 mg / kg. In certain embodiments, theeffective amount is 350 mg / kg. In certain embodiments, the effective amount of a synthetic NCK1-binding peptide of the disclosure (e.g., formulated as an acetate salt) is in the range of 40 mg to 320 mg. For example, in certain embodiments, the effective amount is in the range of 40 mg to 320 mg, 40 mg to 240 mg, 40 mg to 160 mg, 40 mg to 80 mg, 80 mg to 320 mg, 80 mg to 240 mg, 80 mg to 160 mg, 160 mg to 320 mg, 160 mg to 240 mg, or 240 mg to 320 mg. In certain embodiments, the effective amount is 40 mg, 80 mg, 160 mg, 240 mg, or 320 mg. In certain embodiments, the effective amount of a synthetic NCK1-binding peptide of the disclosure (e.g., formulated or measured as a free base) is in the range of 30 mg to 270 mg. For example, in certain embodiments, the effective amount is in the range of 30 mg to 270 mg, 30 mg to 200 mg, 30 mg to 140 mg, 30 mg to 70 mg, 60 mg to 270 mg, 60 mg to 200 mg, 60 mg to 140 mg, 130 mg to 270 mg, 130 mg to 200 mg, or 190 mg to 270 mg. In certain embodiments, the effective amount is 30 mg, 60 mg, 70 mg, 130 mg, 140 mg, 190 mg, 200 mg, or 270 mg.

[0299] The amount administered will depend on variables such as the type and extent of disease or indication to be treated, the overall health of the patient, the in vivo potency of the active component, the pharmaceutical formulation, and the route of administration. The initial dosage can be increased beyond the upper level in order to rapidly achieve the desired blood- level or tissue-level. Alternatively, the initial dosage can be smaller than the optimum, and the daily dosage may be progressively increased during the course of treatment. Human dosage can be optimized, e.g., in a conventional Phase I dose escalation study. Dosing frequency can vary, depending on factors such as route of administration, dosage amount, serum half-life of the synthetic peptide, and the disease, disorder, or condition being treated. Exemplary dosing frequencies are once per day, once per week and once every two weeks.

[0300] The disclosure also provides a delivery system comprising (1) a composition (e.g., a pharmaceutical composition) disclosed herein, and (2) a delivery device. The composition can be, for example, a composition (e.g., a pharmaceutical composition) comprising a synthetic NCK1-binding peptide of the disclosure, optionally wherein the peptide is formulated as a salt, e.g., an acetate salt, e.g., a bis-acetate salt or a tri-acetate salt. In certain embodiments, the peptide is formulated as a trifluoroacetate salt. In certain embodiments, the delivery device is suitable for administering the composition comprising a synthetic peptide of the disclosure to a subject in need thereof, e.g., via subcutaneous or intravenous injection. In certain embodiments, the delivery device is a syringe, a pen delivery device, an injector delivery system, and / or an autoinjector. In certain embodiments, the delivery device is a syringe, e.g., a pre-filled syringe.IV. Methods and Therapeutic Uses

[0301] The disclosure also provides a method of modulating an activity of NCK1, wherein the method comprises contacting NCK1 with a synthetic peptide that disrupts an interaction between PTP1B and NCK1, thereby modulating or inhibiting binding between NCK1 and PTP1B. In certain embodiments, the agent is a synthetic peptide or composition of the disclosure that can reduce or prevent the interaction between PTP1B and NCK1. In certain embodiments, contacting NCK1 with the synthetic peptide disrupts binding between PTP1B and NCK1. Binding of PTP1B and NCK1 can be measured using any number of techniques known in the art including, for example, via co-immunoprecipitation assays, via isothermal Titration Calorimetry (ITC), or via Surface Plasmon Resonance (SPR). In certain embodiments, contacting NCK1 results in modulating an activity of PTP1B. In certain embodiments, the activity of PTP1B is downregulation of the insulin receptor signaling pathway. In certain embodiments, the activity of PTP1B is dephosphorylation of the insulin receptor.

[0302] The disclosure also provides a method of increasing insulin receptor signaling, e.g., in a subject, cell, or tissue, wherein the method comprises contacting NCK1 with a synthetic peptide or composition of the disclosure that can reduce or prevent the interaction between PTP1B and NCK1, thereby increasing insulin receptor signaling.

[0303] The present disclosure provides methods for decreasing or inhibiting binding between PTP1B and NCK1, by contacting NCK1 with an effective amount of a synthetic peptide that disrupts an interaction between PTP1B and NCK1, thereby modulating or inhibiting binding between NCK1 and PTP1B. In certain embodiments, the method is used to modulate an activity of PTP1B, e.g., PTP1B-mediated downregulation of insulin receptor signaling, thereby enhancing or restoring sensitivity to insulin and / or insulin receptor signaling in a cell or tissue. Without wishing to be bound by theory, it is believed that by using synthetic peptides that target and bind NCK1 (rather than PTP1B), that administration of the peptide will preferentially or specifically inhibit PTP1B activity that is dependent on interaction with the NCK1 adapter protein (e.g., downregulation of insulin receptor signaling), while having less or a minimal impact on, e.g., PTP1B-mediated regulation of other targets or pathways.

[0304] Each of the compositions and methods disclosed herein can be used to treat or prevent a disease or disorder associated with PTP1B and / or NCK1. In certain embodiments, the disclosure provides administering a synthetic peptide of the disclosure that disrupts an interaction between PTP1B and NCK1 to a subject in need thereof. In certain embodiments, theagent is a NCK1-binding peptide as described in, e.g., section II of this disclosure (e.g., any one of sections II(a) through II(f) of this disclosure).

[0305] The disclosure provides a method of treating or preventing a disease or disorder associated with PTP1B and / or NCK1. In certain embodiments, the method comprises administering a NCK1-binding peptide of the disclosure to a subject in need thereof. The method can comprise administering to the subject an effective amount of a synthetic NCK1- binding peptide described herein, either alone or in a combination with another therapeutic agent to treat or prevent the disease or disorder in the subject. An effective amount of the peptide can be administered in one or more administrations, applications, or dosages and is not intended to be limited to a particular formulation or administration route.

[0306] In certain embodiments, the disease or disorder is a disease or disorder associated with NCK1 activity and / or PTP1B activity. In certain embodiments, the disease or disorder is a metabolic disease or disorder. In certain embodiments, the diseases or disorder is diabetes, obesity, insulin resistance, hyperlipidemia, or atherosclerosis. In certain embodiments, the disease or disorder is diabetes, e.g., Type 2 diabetes. In certain embodiments, the disease or disorder is obesity.

[0307] In one embodiment, the disclosure provides a method of treating or preventing diabetes (e.g., Type 2 diabetes) in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic peptide described herein or a pharmaceutical composition comprising the synthetic peptide and a pharmaceutically acceptable carrier, thereby to treat or prevent diabetes in the subject, wherein the synthetic peptide comprises an amino acid sequence of at least 7 consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises the amino acid sequence of Formula I, Formula II, Formula III, or Formula IV as described herein above, and wherein the synthetic peptide comprises at least one amino acid analog, an N-terminal fatty acid modification, and / or at least one D-amino acid. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10amino acids (or amino acid analogs) in length. In certain embodiments, the synthetic peptide is 7 to 10 amino acids (or amino acid analogs) in length.

[0308] In another embodiment, the disclosure provides a method of treating or preventing diabetes (e.g., Type 2 diabetes) in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic peptide or a pharmaceutical composition comprising the synthetic peptide and a pharmaceutically acceptable carrier, thereby to treat or prevent diabetes in the subject, wherein the synthetic peptide comprises an amino acid sequence of at least 7 consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises the amino acid sequence of Formula I, Formula II, Formula III, or Formula IV as described herein above, and wherein the synthetic peptide comprises at least one amino acid analog, an N-terminal fatty acid modification, and / or at least one D-amino acid. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 amino acids (or amino acid analogs) in length. In certain embodiments, the synthetic peptide is 7 to 10 amino acids (or amino acid analogs) in length.

[0309] In addition, the disclosure provides a method of treating obesity in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic peptide or a pharmaceutical composition comprising the synthetic peptide and a pharmaceutically acceptable carrier, thereby to treat obesity in the subject, wherein the synthetic peptide comprises an amino acid sequence of at least 7 consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises the amino acid sequence of Formula I, Formula II, Formula III, or Formula IV as described herein above. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 aminoacids (or amino acid analogs) in length. In certain embodiments, the synthetic peptide is 7 to 10 amino acids (or amino acid analogs) in length.

[0310] In another embodiment, the disclosure provides a method of treating obesity in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic peptide or a pharmaceutical composition comprising the synthetic peptide and a pharmaceutically acceptable carrier, thereby to treat obesity in the subject, wherein the synthetic peptide comprises an amino acid sequence of at least 7 consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises the amino acid sequence of Formula I, Formula II, Formula III, or Formula IV as described herein above, and wherein the synthetic peptide comprises at least one amino acid analog, an N-terminal fatty acid modification, and / or at least one D-amino acid. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 amino acids (or amino acid analogs) in length. In certain embodiments, the synthetic peptide is 7 to 10 amino acids (or amino acid analogs) in length.

[0311] The methods and compositions described herein can be used alone or in combination with other therapeutic agents and / or modalities. The term administered “in combination,” as used herein, is understood to mean that two (or more) different treatments are delivered to the subject during the course of the subject’s affliction with the disorder, such that the effects of the treatments on the patient overlap at a point in time. In certain embodiments, the delivery of one treatment is still occurring when the delivery of the second begins, so that there is overlap in terms of administration. This is sometimes referred to herein as “simultaneous” or “concurrent delivery.” In other embodiments, the delivery of one treatment ends before the delivery of the other treatment begins. In certain embodiments of either case, the treatment is more effective because of combined administration. For example, the second treatment is more effective, e.g., an equivalent effect is seen with less of the second treatment, or the second treatment reduces symptoms to a greater extent, than would be seen if the second treatment were administered in the absence of the first treatment, or the analogous situation is seen with the first treatment. In certain embodiments, delivery is such that the reduction in a symptom, or other parameterrelated to the disorder is greater than what would be observed with one treatment delivered in the absence of the other. The effect of the two treatments can be partially additive, wholly additive, or greater than additive. The delivery can be such that an effect of the first treatment delivered is still detectable when the second is delivered.

[0312] In certain embodiments, a method or composition described herein, is administered in combination with one or more additional therapies, e.g., insulin therapy, surgery, or administration of another therapeutic preparation.

[0313] The disclosure also provides a method of decreasing fat body fat mass in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of a synthetic peptide of the disclosure or pharmaceutical composition comprising the same. In certain embodiments, body fat mass in the subject is decreased by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%. The disclosure also provides a method of reducing or lessening an increase in body fat mass in a subject, e.g., as compared to an appropriate standard or control, wherein the method comprises administering to the subject an effective amount of a synthetic peptide of the disclosure or pharmaceutical composition comprising the same. In certain embodiments, the appropriate standard or control is determined according to the rate of body fat mass gain in the same subject prior to administration of the synthetic peptide or the pharmaceutical composition. In certain embodiments, the appropriate standard or control is a subject or population who is not administered the peptide or composition of the disclosure. In certain embodiments, administration of the synthetic peptide or composition does not result in a substantial change in lean body mass in the subject. In certain embodiments, administration of the synthetic peptide or composition does not result in a decrease in lean body mass in the subject.

[0314] The disclosure also provides a method of decreasing body weight in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of a synthetic peptide of the disclosure or pharmaceutical composition comprising the same. In certain embodiments, body weight of the subject is decreased by at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 8%, at least about 10%, at least about 12%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, or at least about 50%. The disclosure also provides a method of reducing or lessening an increase in body weight of a subject, e.g., as compared to an appropriate standard or control, wherein the method comprises administering to the subject aneffective amount of a synthetic peptide of the disclosure or pharmaceutical composition comprising the same. In certain embodiments, the appropriate standard or control is determined according to the rate of body weight gain in the same subject prior to administration of the synthetic peptide or the pharmaceutical composition. In certain embodiments, the appropriate standard or control is a subject or population who is not administered the peptide or composition of the disclosure. In certain embodiments, administration of the synthetic peptide or composition does not result in a substantial change in lean body mass in the subject. In certain embodiments, administration of the synthetic peptide or composition does not result in a decrease in lean body mass in the subject.

[0315] In one embodiment, the disclosure provides a method of decreasing body fat mass in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic peptide described herein or a pharmaceutical composition comprising a synthetic peptide disclosed herein and a pharmaceutically acceptable carrier, thereby to decrease body fat mass of the subject, wherein the synthetic peptide comprises an amino acid sequence of at least 7 consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises the amino acid sequence of Formula I, Formula II, Formula III, or Formula IV as described herein above. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 amino acids (or amino acid analogs) in length. In certain embodiments, the synthetic peptide is 7 to 10 amino acids (or amino acid analogs) in length.

[0316] In another embodiment, the disclosure provides a method of decreasing body fat mass in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic peptide described herein or a pharmaceutical composition comprising a synthetic peptide disclosed herein and a pharmaceutically acceptable carrier, thereby to decrease body fat mass of the subject, wherein the synthetic peptide comprises an amino acid sequence of at least 7 consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises the amino acid sequence of Formula I, Formula II, Formula III, or Formula IV as described herein above, and wherein the synthetic peptide comprises at least one aminoacid analog, an N-terminal fatty acid modification, and / or at least one amino acid analog. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 50 consecutive amino acids or amino acid analogs, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide consists essentially of an amino acid sequence of 7 to 10 consecutive amino acids or amino acid analogs. In certain embodiments, the synthetic peptide is 7 to 50 amino acids (or amino acid analogs) in length, e.g., 7 to 40, 7 to 30, 7 to 25, 7 to 20, 7 to 15, or 7 to 10 amino acids (or amino acid analogs) in length. In certain embodiments, the synthetic peptide is 7 to 10 amino acids (or amino acid analogs) in length. V. Methods of Making Synthetic Peptides

[0317] Methods of making a synthetic NCK1-binding peptide as described herein are known in the art. For example, DNA molecules encoding a synthetic peptide can be synthesized chemically or by recombinant DNA methodologies. The sequences of interest can be cloned by conventional hybridization techniques or polymerase chain reaction (PCR) techniques, using the appropriate synthetic nucleic acid primers. The resulting DNA molecules encoding the synthetic peptide can be ligated to other appropriate nucleotide sequences, including, for example, expression control sequences, to produce conventional gene expression constructs (i.e., expression vectors) encoding the desired peptides. Production of defined gene constructs is within routine skill in the art.

[0318] Nucleic acids encoding a synthetic peptide can be incorporated (ligated) into expression vectors, which can be introduced into host cells through conventional transfection or transformation techniques. Exemplary host cells are E. coli cells, S. cerevisiae cells, Chinese hamster ovary (CHO) cells, human embryonic kidney 293 (HEK 293) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), and myeloma cells. Transformed host cells can be grown under conditions that permit the host cells to express the genes that encode the synthetic peptide.

[0319] Specific expression and purification conditions will vary depending upon the expression system employed. For example, if a gene is to be expressed in E. coli, it is first cloned into an expression vector by positioning the engineered gene downstream from a suitable bacterial promoter, e.g., Trp or Tac, and a prokaryotic signal sequence. The expressed protein may be secreted. The expressed protein may accumulate in refractile or inclusion bodies, which can be harvested after disruption of the cells by French press or sonication. The refractile bodiesthen are solubilized, and the protein may be refolded and / or cleaved by methods known in the art.

[0320] If the engineered gene is to be expressed in eukaryotic host cells, e.g., Saccharomyces cerevisiae cells or CHO cells, it is first inserted into an expression vector containing a suitable eukaryotic promoter, a secretion signal, a poly A sequence, and a stop codon. Optionally, the vector or gene construct may contain enhancers and introns. The gene construct can be introduced into eukaryotic host cells using conventional techniques.

[0321] A peptide as described herein can be produced by growing (culturing) a host cell transfected with an expression vector encoding such a variable region, under conditions that permit expression of the polypeptide. Following expression, the peptide can be harvested and purified or isolated using techniques known in the art, e.g., affinity tags such as glutathione-S- transferase (GST) or histidine tags. In certain embodiments, an N-terminal signal sequence is included in the protein construct. Exemplary N-terminal signal sequences include signal sequences from interleukin-2, CD-5, IgG kappa light chain, trypsinogen, serum albumin, and prolactin.

[0322] The peptides can be isolated and purified using methods known in the art including centrifugation, depth filtration, cell lysis, homogenization, freeze-thawing, affinity purification, gel filtration, ion exchange chromatography, hydrophobic interaction exchange chromatography, and mixed-mode chromatography.

[0323] In certain embodiments, peptides of the disclosure may be chemically synthesized. Methods of chemically synthesizing polypeptides are well known in the art and include, but are not limited to, solid-phase peptide synthesis, liquid-phase peptide synthesis, and organic synthesis methods. In some peptide synthesis methods, an amino group of one amino acid (or amino acid derivative) is linked to a carboxyl group of another amino acid (or amino acid derivative) that has been activated by reacting it with a reagent such as dicyclohexylcarbodiimide (DCC). When the free amino group attacks the activated carboxyl group, a peptide bond is formed and dicyclohexylurea is released. In such methods, other potentially reactive groups (such as the α-amino group of the N-terminal amino acid or amino acid derivative and the carboxyl group of the C-terminal amino acid or amino acid derivative) may be blocked (“protected”) from participating in the chemical reaction. Thus, only particular active groups react such that the desired product is formed. Blocking groups useful for this purpose include, without limitation, tertbutoxycarbonyl groups (t-Boc) and benzoyloxycarbonyl groups to protect amine groups; and simple esters (such as methyl and ethyl groups) and benzylesters to protect carboxyl groups. Blocking groups can typically be subsequently removed with a treatment that leaves peptide bonds intact (for example, treatment with dilute acid). This process of protecting reacting groups that should not react, coupling to form a peptide bond, and deprotecting reactive groups may be repeated. A peptide may be synthesized by sequentially adding amino acids to a growing peptide chain. Both liquid-phase and solid phase peptide synthesis methods are suitable for use in accordance with the invention. In solid-phase peptide synthesis methods, the growing peptide chain is typically linked to an insoluble matrix (such as, for example, polystyrene beads) by linking the carboxyterminal amino acid to the matrix. At the end of synthesis, the peptide can be released from the matrix using a cleaving reagent that does not disrupt peptide bonds, such as hydrofluoric acid (HF). Protecting groups are also typically removed at this time. Automated, high throughput, and / or parallel peptide synthesis methods may also be used in accordance with the invention. For more information about peptide synthesis methods, see, e.g., Merrifield (1969) ADV. ENZYMOL. RELAT. AREAS MOL. BIOL., 32: 221-96; Fridkin et al. (1974) ANNU. REV. BIOCHEM.43(0): 419-43; Merrifield (1997) METH. ENZYMOL.289: 3-13; Sabatino et al. (2009) CURR. OPIN. DRUG DISCOV. DEVEL., 11(6): 762-70, the entire contents of each of which are herein incorporated by reference.

[0324] Throughout the description, where compositions are described as having, including, or comprising specific components, or where processes and methods are described as having, including, or comprising specific steps, it is contemplated that, additionally, there are compositions of the present invention that consist essentially of, or consist of, the recited components, and that there are processes and methods according to the present invention that consist essentially of, or consist of, the recited processing steps. Similarly, throughout the description, where compositions are described as consisting essentially of specific components, or where processes and methods are described as consisting essentially of specific steps, it is contemplated that, additionally, there are compositions of the present invention that consist of the recited components, and that there are processes and methods according to the present invention that consist of the recited processing steps.

[0325] In the application, where an element or component is said to be included in and / or selected from a list of recited elements or components, it should be understood that the element or component can be any one of the recited elements or components, or the element or component can be selected from a group consisting of two or more of the recited elements or components.

[0326] Further, it should be understood that elements and / or features of a composition or a method described herein can be combined in a variety of ways without departing from the spirit and scope of the present invention, whether explicit or implicit herein. For example, where reference is made to a particular compound, that compound can be used in various embodiments of compositions of the present invention and / or in methods of the present invention, unless otherwise understood from the context. In other words, within this application, embodiments have been described and depicted in a way that enables a clear and concise application to be written and drawn, but it is intended and will be appreciated that embodiments may be variously combined or separated without parting from the present teachings and invention(s). For example, it will be appreciated that all features described and depicted herein can be applicable to all aspects of the invention(s) described and depicted herein.

[0327] It should be understood that the expression “at least one of” includes individually each of the recited objects after the expression and the various combinations of two or more of the recited objects unless otherwise understood from the context and use. The expression “and / or” in connection with three or more recited objects should be understood to have the same meaning unless otherwise understood from the context.

[0328] The use of the term “include,” “includes,” “including,” “have,” “has,” “having,” “contain,” “contains,” or “containing,” including grammatical equivalents thereof, should be understood generally as open-ended and non-limiting, for example, not excluding additional unrecited elements or steps, unless otherwise specifically stated or understood from the context.

[0329] It should be understood that the order of steps or order for performing certain actions is immaterial so long as the present invention remain operable. Moreover, two or more steps or actions may be conducted simultaneously.

[0330] The use of any and all examples, or exemplary language herein, for example, “such as” or “including,” is intended merely to illustrate better the present invention and does not pose a limitation on the scope of the invention unless claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the present invention. EXAMPLES

[0331] The following Examples are merely illustrative and are not intended to limit the scope or content of the invention in any way.Example 1. Binding interaction between PTP1B and NCK1

[0332] This example demonstrates the interaction between PTP1B and NCK1 and where within NCK1 this interaction takes place using in vitro immunoprecipitation experiments performed with tagged PTP1B and NCK1 proteins.

[0333] Materials and Methods

[0334] Plasmid Construction: Human PTP1B cDNA (NM_002827) and human NCK1 cDNA (NM_006153) were obtained (Origene, MD, USA). FLAG-tagged PTP1B (FLAG-PTP1B) and HA-tagged NCK1 (HA-NCK1) were amplified from the PTP1B and NCK1 cDNA, respectively. Amplicons were double digested (EcoRI and XhoI, New England Biolabs), ligated into pcDNA3.1 vector (#M2200S, New England Biolabs; vector from Invitrogen) and transformed into DH5α E. coli cells (#C2987H, NEB). Constructs were purified and eluted using a plasmid preparation kit according to manufacturer’s instructions (#T1010, New England Biolabs).

[0335] Cell culture and co-transfection: Human embryonic kidney 293 (HEK293) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) containing 10% fetal bovine serum (FBS), at 37 °C in a 5% CO2 environment. Plasmids encoding FLAG-PTP1B and HA- NCK1 were transiently expressed in HEK293 cells using Lipofectamine 2000 (Invitrogen), and DMEM supplemented with 200 μg / mL G418 was used to grow transfected cells.

[0336] Cell lysates, immunoblotting and co-immunoprecipitation: Cells were washed with PBS and soluble proteins were extracted using immunoprecipitation (IP) buffer (0.1% Triton x100, 150 mM NaCl, 25 mM KCl, 10 Mm Tri HCl, 1 mM CaCl2in dH2O (pH 7.4)) with protease inhibitors. Cells were centrifuged at 12,500 g for 10 min at 4 °C and supernatants were collected. For FLAG-PTP1B and HA-NCK1 coimmunoprecipitation, cell lysates were incubated overnight at 4 °C with anti-FLAG HRP antibody (#A8592, Sigma) or anti-HA (#MMS-101P, BioLegend) antibodies and glutathione-agarose beads (#G4510, Sigma). Immunoprecipitated proteins were washed three times with IP buffer and eluted in SDS- Laemmli buffer by heating at 95 °C for 10 min. Samples were spun at 12,000 rpm for 2 min, and the liquid fraction was transferred into 1 mL Eppendorf tubes. Chemiluminescent Western blotting was used to separate and visualize proteins (PEQLAB, Germany).

[0337] Construction of GST-fusion constructs: Full-length NCK1 fused to GST and NCK1 SH3-2 domain fused to GST were amplified from NCK1 cDNA (Addgene). Amplicons were double digested (EcoRI and XhoI, New England Biolabs), ligated into pGEX-6P-2 vector (#M2200S, New England Biolabs; #GE28-9546-50, Merck) and transformed into DH5α E. colicells (#C2987H, New England Biolabs). Constructs were purified using a plasmid preparation kit according to manufacturer’s instructions (#T1010, New England Biolabs).

[0338] Purification of GST-fusion proteins: GST-constructs were transformed into BL21-Gold E. coli cells (#230134, Agilent), and protein synthesis was induced using isopropyl-beta-D- thiogalactopyranoside (IPTG) stimulation (#I6758, Merck). GST-fusion proteins were extracted by sonication in STE buffer (10 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA in dH2O, pH 8) supplemented with protease inhibitor tablets for bacteria, DTT and lysozyme. Samples were spun at 8,000 rpm for 25 min, and lysates were incubated with glutathione-agarose beads overnight (#G4510, Sigma). The following day, beads were washed three times with STE buffer and stored at 4 °C.

[0339] Construction, synthesis and purification of His-tagged PTP1B and His-tagged NCK1 SH3-2 domain:

[0340] Human PTP1B cDNA (NM_002827) and human NCK1 cDNA (NM_006153) were obtained (Origene, MD, USA). PTP1B Primers were designed to amplify the ORFs with added homology to the cut vector (EcoRI-digested pSF-OXB20-NH2-10HIS) in the forward primer sequence. To amplify full-length PTP1B, the primers ptp1b_FL_fwd (acctgtacttccagggcatggagatggaaaaggagttc) (SEQ ID NO: 159) and ptp1b_FL_rev (gtgcaggaggagttcgaattctatgtgttgctgttgaac) (SEQ ID NO: 160) were used. To amplify truncations of PTP1B, the following primer pairs were used: ptp1b_FL-Fwd and one of Ptp1b_323stop_rev (gtgcaggaggagttcgaattTCATTTCCCATTGTGTGG) (SEQ ID NO: 161), ptp1b_344stop_rev (gtgcaggaggagttcgaatttcagtctttatcctcctg) (SEQ ID NO: 162) or ptp1b_278stop_rev(gtgcaggaggagttcgaattttaggcaccttcgatcac) (SEQ ID NO: 163). To amplify the NCK1 SH3-2 domain, the primers nck1sh32_fwd (acctgtacttccagggcatgatgcccgcttatgtgaaatttaac) (SEQ ID NO: 164) and nck1sh32_rev (gtgcaggaggagttcgaattctagtcaccttcttcagttacatag) (SEQ ID NO: 165) were used. The amplified fragments were purified using a DNA clean-up kit according to manufacturer’s instructions (QIAquick PCR purification kit, Qiagen).

[0341] The plasmid pSF-OXB20-NH2-10HIS (Sigma Aldrich) was linearized using EcoRI (New England Biolabs). Each amplified fragment was ligated into the expression vector using NEBuilder® HiFi DNA (New England Biolabs) assembly kit to create the expression constructs, according to the manufacturer’s instructions. The reaction was transformed into competent E. coli (NEB-5α, New England Biolabs) and the presence of the gene fragments was confirmed via colony PCR amplification using GoTaq Hotstart polymerase (Promega) using the primers OGPF2 (TGTCGATCCTACCATCCA) (SEQ ID NO: 166) (45 bp from start codon) andOGPR2 (AGTCAGTCAGTGCAGGAG) (SEQ ID NO: 167) (65 bp from 3’). Constructs containing the target protein coding sequences were transformed into E. coli strain C43(DE3) (Sigma Aldrich). The transformed E. coli cells were spread on L-agar plates containing 50 μg / ml kanamycin. The plates were incubated overnight at 37 °C and colony formation was visually assessed.

[0342] For expression solubility screening, an overnight culture was prepared by growing a single transformed E. coli colony in 10 mL of autoclaved lysogeny broth (LB) medium containing 50 μg / mL of kanamycin overnight at 37 °C. Small scale (50 mL) expression trials were carried out in a 250 mL baffled flask. Cell cultures were grown at 37 °C in an incubator with a shaking speed of 180 rpm 37 °C for 4 hours, and expression was permitted to continue overnight at 20 °C or 25 °C. Following overnight incubation, cells were collected by centrifugation, resuspended in 5 mL of lysis buffer (10 mM Tris, pH 7.4 or 10 mM Sodium Phosphate, pH 8.0, 300 mM NaCl, 1 mM DTT or TCEP, 0-10% glycerol) and sonicated three times for 10 s over ice with 1 min interval using a small probe at 15 amplitude microns (Soniprep 150, MSE). The soluble fraction was collected by centrifugation for 10-60 min at 20,000 rpm in a microfuge. Constructs expressing soluble protein were identified by SDS- PAGE.

[0343] To produce and purify fusion proteins, a culture was inoculated with 1% of overnight- cultured inoculum. Protein expression was carried out under the conditions described above, scaled up as necessary. Cells expressing the recombinant proteins were harvested in 50 mL tubes by centrifugation and stored at -80 °C. Cells containing the expressed gene product were thawed over ice and resuspended in Extraction buffer (10 mM Tris, pH 7.4 or 10 mM Sodium Phosphate, pH 8.0; 300 mM NaCl, 1 mM DTT or TCEP; 0-10% glycerol and 1 µg lysozyme) and sonicated over ice (4 ℃) for 3 min total using pulses of 5 s with 15 s intervals, using a wide probe at 15 amplitude microns (Soniprep 150, MSE). Insoluble material was removed from the lysate by centrifugation at 20K rpm for 20-60 min at 4 ℃. Supernatant was filtered through a 0.22 µm PVDF filter membrane and applied to 1-25 mL HisTrap FF Crude (Cytiva) prepacked Ni columns and connected to an AKTA explorer. After thorough washing with binding buffer (10 mM Tris, pH 7.4 or 10 mM Sodium Phosphate, pH 8.0; 300 mM NaCl; 1 mM DTT or TCEP and 25 mM Imidazole), protein was eluted using elution buffer (10 mM Tris, pH 7.4 or 10 mM Sodium Phosphate, pH 8.0; 150-300 mM NaCl; 1 mM DTT or TCEP and 250 mM Imidazole). Fractions containing protein of interest were confirmed by SDS PAGE. Protein was diluted with GF buffer (10 mM Tris, pH 7.4 or 10 mM Sodium Phosphate, pH 8.0; 150-300 mM NaCl) and subjected to TEV protease treatment overnight at 4-10 ℃. Following proteolytic digestion, HIS-tag and TEV protease were removed by filtration through a clean 5 mL HisTrap FF Crude (Cytiva) prepacked Ni column. Protein was concentrated on a PES ultrafiltration device by centrifugation at 4000 rpm at 4 ℃, and protein was polished via a HiPrep S-10026 / 60 (Cytiva) using GF buffer (as described above). Purified proteins were concentrated using ultrafiltration, and protein concentration was determined using ultraviolet-visible spectroscopy. The integrity and identity of all proteins were verified by mass spectrographic analysis.

[0344] GST pull-down experiments: GST-bound agarose beads of SH3-2 domain and full length NCK1 were incubated with different concentrations of His-tagged PTP1B protein overnight. Beads were three times washed in STE buffer in the morning and proteins eluted in SDS-Laemmli buffer by heating at 95 °C for 10 min. Samples were spun at 12,000 rpm for 2 min, and the liquid fraction was transferred into 1 mL Eppendorf tubes. Chemiluminescent Western blotting was used to separate and visualize proteins (PEQLAB, Germany).

[0345] Results and Discussion

[0346] FLAG-PTP1B and HA-NCK1 fusion constructs were generated, and HEK293 cells were co-transfected with both constructs. Non-transfected HEK293 cells were used as negative controls (FIGURES 2A-2B, lanes 1 and 3). Either FLAG-PTP1B (FIGURE 2A) or HA-NCK1 (FIGURE 2B) was immunoprecipitated from co-transfected cells with anti-FLAG or anti-HA antibody, respectively, and the amount of the second protein was measured in the total lysate (lane 2) and IP eluate (lane 4) by Western blotting. As shown in FIGURE 2A, HA-NCK1 co- immunoprecipitated with FLAG-PTP1B. Likewise, as shown in FIGURE 2B, FLAG-PTP1B co-immunoprecipitated with HA-NCK1. These results demonstrate that full-length PTP1B and full-length NCK1 proteins interact in vitro.

[0347] GST-tagged full-length NCK1, GST-tagged NCK1 SH3-2 domain, and His-tagged PTP1B were generated as described hereinabove. GST-tagged NCK1 and NCK1 SH3-2 domain were to bound to GSH-agarose beads and subsequently incubated with varying concentrations of HIS-tagged PTP1B. Non-loaded agarose beads were used as a control (“X” in FIGURE 3). Following overnight incubation, the beads were washed three times, the proteins were eluted, and the amount of PTP1B in the eluate was measured by Western blotting. As shown in FIGURE 3, PTP1B co-immunoprecipitated with both full length NCK1 (“N”) and with the SH3-2 domain of NCK1 (“SH3-2”). The PTP1B signal increased with increasing PTP1B concentration.

[0348] These results confirm that PTP1B interacts with full-length NCK1 and demonstrate that PTP1B binds the SH3-2 domain of NCK1. The interaction between PTP1B and the SH3-2domain of NCK1 was further confirmed in different in vitro assays, including Isothermal Titration Calorimetry (ITC), Surface Plasmon Resonance (SPR) and cell-based assay.

[0349] This Example confirms that PTP1B and NCK1 form a complex and furthermore identifies the SH3-2 domain of NCK1 as the site of interaction between the two proteins. Example 2. Identification of peptides that disrupt the interaction between PTP1B and NCK1

[0350] This Examples describes the identification of peptides that disrupt the interaction between PTP1B and the SH3-2 domain of NCK1. Peptides were screened using an immunoprecipitation assay, which identified peptides that disrupt the interaction. Surface plasmon resonance (SPR) was also used to confirm that these peptides bind to full-length NCK1.

[0351] Materials and Methods

[0352] Construction and Purification of GST constructs: Human NCK1 (NM_006153) human cDNA was obtained (Origene, MD, USA). GST fusion constructs (GST-only control, GST full length NCK1, GST all SH3 domains of NCK1, GST SH2 domain of NCK1, GST SH3-1, GST SH3-2 and GST SH3-3) were amplified, double digested (EcoRI and XhoI, New England Biolabs), ligated into pGEX-6P-2 vector (#M2200S, New England Biolabs; #GE28-9546-50, Merck), transformed into DH5α E. coli cells (#C2987H, NEB) and purified using a plasmid preparation kit according to manufacturer’s instructions (#T1010, New England Biolabs). GST- constructs were transformed into BL21-Gold E.coli cells (#230134, Agilent), and GST-fusion proteins were produced, extracted, and bound to GST beads as described in Example 1. Beads were washed three times with STE buffer and stored at 4 °C.

[0353] GST pull-down experiments for compounds screening against FLAG PTP1B interaction with SH3-2 domain of NCK1. GST-bound agarose beads of SH3-2 domain were incubated overnight at 4 ℃ with lysates from HEK293 cells overexpressing FLAG PTP1B protein, together with various peptide compounds (1 mM) to screen for inhibition of PTP1B- NCK1 binding. Following overnight incubation, agarose beads were three times washed in STE buffer, and proteins were eluted in SDS-Laemmli buffer by heating at 95 °C for 10 min. Samples were spun at 12,000 rpm for 2 min, and the liquid fraction was transferred into 1 mL Eppendorf tubes. Proteins were separated and detected by chemiluminescent Western Blotting (PEQLAB, Germany) using anti-FLAG HRP antibody (#A8592, Sigma).

[0354] Results and Discussion

[0355] Peptides (1 mM) were screened using a co-immunoprecipitation assay for the ability to interrupt the interaction between the (GST-tagged) SH3-2 domain of NCK1 and (FLAG-tagged)PTP1B. As shown in FIGURES 4A-4D, the experiments described in this Example identified two peptides, MD17 (A) and MD20 (C and G), that disrupt the interaction between PTP1B and the SH3-2 domain of NCK1. These results confirmed that MD17 and MD20 bind to full-length NCK1, specifically, at SH3-2 domain. Example 3. Alanine-scanning and truncation analysis of MD17, a peptide that disrupts the interaction between PTP1B and NCK1

[0356] This Example describes a study to identify critical structural features of the peptides that impact the function of the peptides. As described in Example 2, MD17 (a 15-mer) was identified as a peptide that binds to the SH3-2 domain of NCK1 and disrupts the interaction of PTP1B and NCK1. To explore which residues within the MD17 peptide that are critical for the activity of the MD17 peptide, alanine scanning and truncation analysis were performed on the MD17 peptide. Alanine scanning and truncation analysis were also performed on a 6-mer peptide (“MD20”) comprising the 6 C-terminal amino acid residues of MD17.

[0357] Materials and methods

[0358] All peptides were synthesized using Rink amide MBHA resin (0.68 mmol / g or 0.42 mmol / g loading). Peptides were generated using one of two methods.

[0359] Certain peptides were synthesized using a CEM LibertyBlue microwave-assisted peptide synthesizer. Couplings were conducted in N,N’-dimethylformamide (DMF) using N,N’- diisopropylcarbodiimide (DIC, 1 M solution) and OxymaPure (1 M solution) as coupling reagents, with Fmoc-AA-OH concentrations of 0.2 M. N-terminal Fluoren-9- ylmethyloxycarbonyl (Fmoc) deprotection was achieved using 20% (v / v) piperidine in DMF. N- terminal acetyl capping was achieved using a solution of DMF / acetic anhydride / N,N- diisopropylethylamine (70 / 20 / 5). Arg & His couplings were conducted at 70 °C and 55 °C, respectively, and Arg was double-coupled. All other amino acid couplings were conducted at 90 °C.

[0360] Alternatively, peptides were generated using a CEM MultiPep2 parallel synthesizer. Couplings were conducted in DMF using DIC (1 M) and OxymaPure (2 M) as coupling reagents, with Fmoc-AA-OH concentrations of 0.5 M. N-terminal Fmoc deprotection was achieved using 20% (v / v) piperidine in DMF. All couplings were conducted at 60 °C and double coupled as standard. Capping after each coupling was accomplished using 5% (v / v) acetic anhydride in DMF. Upon completion of synthesis and final deprotection, N-terminal acetyl capping was achieved using 10% (v / v) acetic anhydride in DMF.

[0001] Final peptides that did not contain Cys or Met were cleaved from the resin using a solution of trifluoroacetic acid / triisopropylsilane / H2O (95 / 2.5 / 2.5) under mechanical shaking for 3 hours. Cys- and Met-containing peptides were cleaved using trifluoroacetic acid / triisopropylsilane / 2,2′-(Ethylenedioxy)diethanethiol / H2O (92.5 / 2.5 / 2.5 / 2.5). Upon evaporation of solvent, the solid crude peptide was precipitated by addition of ether.

[0361] Peptide purification was achieved using an Agilent preparative HPLC system with a Phenomenex Luna C18(2) 5 µm 21x250 mm 100 Å column. LCMS analysis of peptides was achieved using an Agilent 1200 system with a Phenomenex Luna C18(2) 5µm 4.6x250 mm 100 Å column.

[0362] Isothermal titration calorimetry (ITC) was used to determine binding affinities for peptides against the SH3-2 domain of NCK1. Experiments were conducted at 25 °C using either a MicroCal iTC200 or MicroCal PEAQ-ITC calorimeter. The buffer used for all ITC experiments was 10 mM sodium phosphate, 100 mM sodium chloride (pH = 8.0). A series of peptides (concentration 3 – 7.5 mM) was titrated in to NCK1 SH3-2 domain (concentration 0.125 – 0.3 mM) using the following conditions: one injection of 0.2 µL followed by 19 injections of 2 µL, 120-150 seconds spacing between injections, at 25 °C. The data were fit using analysis software provided by the manufacturer and affinity values were calculated. The best fitting occurred when the number of sites was between 0.8 and 1.2. The experiments were repeated twice for a total of three times, and the average binding affinity for each peptide was generated.

[0363] The sequences and structures of each of the tested peptides are detailed in Tables 3-12 below.

[0364] Results and Discussion

[0365] The sequence and binding affinities of each of the tested peptides are detailed in Tables 3, 4, 5, and 6, below. In general, a peptide having a KDof less than or equal to 300 µM was considered to have a good ability to bind NCK1 (Group A), a peptide having a KDgreater than 300 µM and less than or equal to 600 µM was considered to have a moderate ability to bind NCK1 (Group B), and a peptide having a KDgreater than 600 µM and less than or equal to 1,000 µM was considered to be a poor binder of NCK1 (Group C). “Group D" indicates that the peptide either had a KDof greater than 1,000 µM, or that no binding was detected.Table 3. Alanine scanning of the MD1715-mer peptideTable 4. Alanine scanning of the MD206-mer peptideTable 5. Peptide truncation analysisTable 6. Sliding Window Peptide Analysis

[0366] The ITC experiments conducted show that a sequence of five or fewer amino acids in length is not tolerated (see Table 5). Alanine screening of MD17 revealed a core 6-mer sequence containing certain residues that appear important for NCK1-binding. In the context of the MD1715-mer peptide, the Pro, Pro, and Arg in positions 10, 13, and 15, respectively are required for the peptide to bind to the SH3-2 domain of NCK1 (see Table 3). The same three residues in the MD206-mer (corresponding to the Pro, Pro, and Arg in positions 1, 4, and 6, respectively) were likewise required for NCK1-binding in all of the peptides tested (see Table 4). Interestingly, the Pro in position 12 of MD17 was not required for binding in the context of the 15-mer (Table 3, MH004), although NCK1-binding was abolished when the Pro in the corresponding position of the 6-mer MD20 (position 3) was substituted for Ala. This may indicate that substitution of that proline (position 3 in MD20, position 12 in MD17) is tolerated better in longer peptides than in shorter peptides. In all of the relevant peptides tested, removing the Arg at position 15 in MD17 abolished binding of the peptide to bind to the SH3-2 domain of NCK1 (see MH013 in Table 4, MH022 in Table 5, and MH035 and MH041 in Table 6). The addition of an amino acid residue (e.g., Pro or Ala) to the N-terminus of MD20 has a positive effect on binding when compared to MD20. The addition of further residues to the N-terminal end did not have a detrimental effect on binding (see Table 5).

[0367] Thus, the present Example demonstrates that a core internal fragment of MD17 of six or seven residues (designated MD20 and MD18, respectively) retained the ability to bind to the SH3-2 domain of NCK1, each with a KD< 193 µM. Moreover, these results indicate that the Pro, Pro, and Arg residues at positions 1, 4, and 6, respectively, of MD20 (positions 2, 5, and 7 of MD18) are important for this binding activity. The requirement for Pro at position three of MD20 (position four of MD18) may vary depending on the length of the peptide (e.g., a Pro in that position may be required in a 6-mer, but not a 15-mer). These experiments also suggest that the residues at positions two and five of MD20 (or positions three and six, of MD18) can tolerate a substitution. The addition of an N-terminal amino acid to the core 6-mer sequence (e.g., Pro or Ala) improves binding to the SH3-2 domain of NCK1. Example 4. Screening of additional NCK1-binding peptides

[0368] This example describes a study to identify additional peptides that bind to NCK-1 and potentially disrupt NCK1’s interaction with PTP1B. In this study, additional single-substitutionvariants of MD18 (the 7-mer peptide identified as a core binding peptide in Example 3) were synthesized and analyzed for their ability to bind to NCK1’s SH3-2 domain. Additional peptides, including peptides having additional amino acid residues at the N-terminal or C- terminal ends of the of the core 6 / 7-mer sequence or the 15-mer sequence, were also synthesized and analyzed for their ability to bind the SH3-2 domain of NCK1.

[0369] Material and methods

[0370] ITC binding assays were performed as described in Example 3, except that the 30-mer peptides listed in Table 12 and certain peptides in Table 13 were tested between one and three times.

[0371] Results and Discussion The sequence and binding affinities of each of the additional tested peptides are detailed in Tables 7-14, below. As in Example 3, in general, a peptide having a KDof less than or equal to 300 µM was considered to have a good ability to bind NCK1 (Group A), a peptide having a KDgreater than 300 µM and less than or equal to 600 µM was considered to have a moderate ability to bind NCK1 (Group B), and a peptide having a KDgreater than 600 µM was considered to be a poor binder of NCK1 (Group C). “Group D” indicates that the peptide either had a KDof greater than 1,000 µM, or that no binding was detected. Sequences of the peptides MD17, MD18, and MD20 are included in certain of the Tables below, for reference. Table 7. Modified MD18 / MD20 Peptides:Table 8. Tolerability of substitutions at position 1 of MD18Table 9. Tolerability of substitutions at position 3 of MD18 (position 2 of MD20)1Tested peptides had <90% purity; predicted to be mixture of conformers.Table 10. Tolerability of substitutions at position 4 of MD18 in a 7-merTable 11. Tolerability of substitutions at position 6 of MD18 (position 5 of MD20)2Peptide was tested at 87% purityTable 12. Testing peptides with N- or C-terminal extensionsTable 13. Tolerability of substitutions at position 8 of the 8-mer MH063Table 14. Testing of exemplary control peptides

[0372] The results of Example 3 demonstrated that the addition of either proline or alanine to the N-terminus of the core MD206-mer sequence improved binding to SH3-2. The results of the further ITC experiments in this Example demonstrate that substitution of the Pro residue at position 1 of MD18 for various different amino acids is well tolerated, with most substitutions having similar binding affinity to MD18 (see Table 8). In further testing, the N-terminal proline in position 1 of MD18 was replaced with a pyroglutamic acid moiety (see Table 7, MH043), which comprises a five-membered ring (analogously to proline). This peptide was able to bind NCK1 with comparable efficiency as MD18.

[0373] The results of Example 3 demonstrated that the proline at position 2 of MD18 (position 1 of the MD206-mer) is important for binding to the SH3-2 domain of NCK1. The results of the further ITC experiments in this Example demonstrate that replacing this proline in MD20 with a pyroglutamic acid moiety (see Table 7, MH044) results in undetectable binding to NCK1. Additionally, a further variant of MD20 with a free N-terminus was also synthesized and tested, and had a KDfalling into Group D (see Table 7, MH080). These results suggest that, in peptides in which the amino acid at position 1 of MD20 is the N-terminal amino acid of the peptide, the additional carbonyl moiety attached to the amino acid residue at position 1 of MD20 is important for NCK1-binding.

[0374] The results of Example 3 demonstrated that substituting the Arg at position 3 of MD18 (position 2 of the MD20) with alanine is well-tolerated. The results of the further ITC experiments in this Example demonstrate that substitutions with various other amino acids are also well-tolerated (see Table 9). Substituting the Arg at this position with any amino acid, including uncharged, bulky, or charge-flipped amino acids, did not abolish binding to NCK1. However, substitution with tryptophan or glycine somewhat decreased binding to NCK1, indicating that increased bulk (Trp) or increased flexibility (Gly) is not favorable in this position.3Tested peptides had <90% purity; predicted to be mixture of conformers.

[0375] The results of prior Example 3 indicated that the proline at position 4 of MD18 (position 3 of the MD206-mer) is important for binding to the SH3-2 domain of NCK1 in the context of a 6-mer, but not a 15-mer. The results of the further ITC experiments demonstrate that, in the context of a 7-mer peptide, replacing the proline in position 4 of MD18 is not well tolerated, with some exceptions. Replacing the proline in this position with valine or isoleucine was well tolerated in a 7-mer. The results also demonstrate that replacing the proline in this position with an arginine, leucine, lysine, threonine, or tyrosine somewhat reduced, but did not abolish, peptide binding to the SH3-2 domain of NCK1 (see Table 10). Replacing the proline in this position with phenylalanine further reduced (but did not abolish) binding to the SH3-2 domain of NCK1 (see Table 10). Replacing the proline in this position with a glycine, serine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, methionine, or tryptophan abolished detectable binding to the SH3-2 domain of NCK1. No substitutions at this position resulted in a greater binding affinity than MD18 (see Table 10). These results suggest that certain, but not all, substitutions of the Pro in this position (position 3 in the 6-mer) are tolerated in a 7-mer.

[0376] The results of Example 3 demonstrated that substituting the Lys at position 6 of MD17 (position 5 of the 6-mer MD20) with alanine is well-tolerated. The data from the further ITC experiments in this Example demonstrate that substitutions with various other amino acids are also well-tolerated (see Table 11). Substituting the Lys at this position with uncharged, bulky, or charge-flipped amino acids did not abolish binding to NCK1. However, substitution of the lysine in this position with glycine reduced (but did not abolish) binding, as compared to MD18.

[0377] As shown in Table 12, the addition of one, two, or three amino acids to the C-terminal end of MD18 did not reduce binding to NCK1. Additionally, the addition of three, five, ten, or fifteen C-terminal amino acids to the end of the 15-mer peptide MD17 (thereby forming an 18- mer, a 20-mer, a 25-mer, and a 30-mer, respectively) did not reduce binding to NCK1. The addition of five, ten, or fifteen N-terminal amino acids to the end of the 15-mer peptide MD17 (thereby forming a 20-mer, 25-mer, and a 30-mer, respectively) also did not reduce binding to NCK1.

[0378] As shown in Table 13, an 8-mer (comprising the amino acid sequence of SEQ ID NO: 9, and further comprising a C-terminal isoleucine residue) was shown to effectively bind NCK1. Additionally, the replacement of the C-terminal isoleucine residue with various charged, uncharged, or hydrophobic amino acid residues did not reduce binding to NCK1 (see Table 13).Replacement of the C-terminal isoleucine residue with proline reduced, but did not abolish, binding to NCK1.

[0379] Three exemplary control peptides shown in Table 14 were tested for their ability to bind NCK1. As summarized in Table 14, none of the three tested control peptides detectably bound NCK1. Example 5. Pharmacokinetic analysis of MD20

[0380] This Examples describes in vitro and in vivo experiments performed to assess the stability, cell permeability, and bioavailability of MD20.

[0381] Materials and Methods

[0382] Microsomal Metabolic Stability (human liver microsomes): Human liver microsomes (final protein concentration 0.5 mg / mL), 0.1 M phosphate buffer pH 7.4 and test compound MD20 (final substrate concentration 1 µM; final DMSO concentration 0.25 %) were pre- incubated at 37 °C prior to the addition of NADPH (final concentration 1 mM) to initiate the reaction. A minus cofactor control incubation was included for each compound tested where 0.1 M phosphate buffer pH 7.4 was substituted for NADPH (“minus NADPH”).

[0383] Each compound was incubated for 0, 5, 15, 30 and...

Claims

WHAT IS CLAIMED IS:

1. A synthetic peptide comprising an amino acid sequence of at least seven consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises an amino acid sequence according to Formula I: X1P'2X3X4P'5X6R (Formula I) wherein X1is selected from any amino acid and a proline analog; P'2is proline or a proline analog; X3is selected from any amino acid and a proline analog; X4is selected from alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, and a proline analog; P'5is proline or a proline analog; X6is selected from any amino acid and a proline analog; and wherein the synthetic peptide comprises at least one proline analog.

2. The synthetic peptide of claim 1, wherein the synthetic peptide consists essentially of an amino acid sequence of seven to ten consecutive amino acids or amino acid analogs.

3. The synthetic peptide of claim 1 or 2, wherein each proline analog is independently selected from the group consisting of L-pipecolic acid, (2S,3aS,7aS)-octahydroindole-2- carboxylic acid, (S)-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (R)-thiazolidine-4- carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, trans-4- hydroxyproline, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, L-azetidine-2-carboxylic acid, (S)- 4-oxopyrrolidine-2-carboxylic acid , (2S,4S)-4-aminopyrrolidine-2-carboxylic acid, (2S,4R)-4- aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, (S)-indoline-2-carboxylic acid, (S)- oxazolidine-4-carboxylic acid, cis-4-hydroxyproline, (2S,3R)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,3S)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2- carboxylic acid, (2S,4S)-4-(difluoromethyl)pyrrolidine-2-carboxylic acid, 2,4-methanoproline, (2S,4R)-4-(difluoromethoxy)pyrrolidine-2-carboxylic acid, (2S,4R)-4- (trifluoromethoxy)pyrrolidine-2-carboxylic acid, (S)-isoxazolidine-3-carboxylic acid, 4-trans- guanidinoproline, 4-cis-guanidinoproline, alpha-methyl-L-proline, and α-aminoisobutyric acid.

4. The synthetic peptide of any one of claims 1-3, wherein each proline analog is independently selected from the group consisting of L-pipecolic acid, (2S,3aS,7aS)- octahydroindole-2-carboxylic acid, (S)-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (R)- thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, trans-4-hydroxyproline, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, L-azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid , (2S,4S)-4-aminopyrrolidine-2-carboxylic acid, (2S,4R)-4-aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, (S)-indoline-2-carboxylic acid, (S)-oxazolidine-4-carboxylic acid, cis-4-hydroxyproline, (2S,3R)-3-hydroxypyrrolidine-2- carboxylic acid, (2S,3S)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,4S)-4- (trifluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4S)-4-(difluoromethyl)pyrrolidine-2- carboxylic acid, 2,4-methanoproline, (2S,4R)-4-(difluoromethoxy)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2-carboxylic acid, (S)-isoxazolidine-3-carboxylic acid, 4-trans-guanidinoproline, 4-cis-guanidinoproline, and alpha-methyl-L-proline.

5. The synthetic peptide of any one of claims 1-3, wherein each proline analog is independently selected from the group consisting of L-pipecolic acid, (S)-1,2,3,4- tetrahydroisoquinoline-3-carboxylic acid, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, (R)- thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, trans-4-hydroxyproline, (2S,4R)-4- aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, alpha-methyl-L-proline, L- azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid, (S)-oxazolidine-4- carboxylic acid, (S)-indoline-2-carboxylic acid, (2S,4S)-4-aminopyrrolidine-2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2-carboxylic acid, α-aminoisobutyric acid, (2S,4S)-4- (difluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(difluoromethoxy)pyrrolidine-2- carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2-carboxylic acid, cis-4- hydroxyproline, and 2,4-methanoproline.

6. The synthetic peptide of any one of claims 1-5, wherein each proline analog is independently selected from the group consisting of L-pipecolic acid, (S)-1,2,3,4- tetrahydroisoquinoline-3-carboxylic acid, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, (R)- thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, and trans-4-hydroxyproline.

7. The synthetic peptide of any one of claims 1-6, wherein each proline analog is an internal residue of the synthetic peptide.

8. The synthetic peptide of claim 7, wherein each proline analog is independently selected from the list of proline analogs set forth in Table A1.

9. The synthetic peptide of any one of claims 1-6, wherein the at least one proline analog is the N-terminal residue of the synthetic peptide.

10. The synthetic peptide of claim 9, wherein the at least one proline analog is selected from the list of proline analogs set forth in Table A2.

11. The synthetic peptide of any one of claims 1-10, wherein X1is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

12. The synthetic peptide of claim 11, wherein X1is proline.

13. The synthetic peptide of any one of claims 1-10, wherein X1is a proline analog.

14. The synthetic peptide of any one of claims 1-13, wherein P'2is proline.

15. The synthetic peptide of any one of claims 1-13, wherein P'2is a proline analog.

16. The synthetic peptide of any one of claims 1-15, wherein X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine.

17. The synthetic peptide of claim 16, wherein X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, and valine.

18. The synthetic peptide of claim 17, wherein X3is arginine.

19. The synthetic peptide of any one of claims 1-15, wherein X3is a proline analog.

20. The synthetic peptide of any one of claims 1-19, wherein X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, proline, threonine, tyrosine, and valine.

21. The synthetic peptide of claim 20, wherein X4is selected from the group consisting of alanine, isoleucine, proline, and valine.

22. The synthetic peptide of claim 21, wherein X4is proline.

23. The synthetic peptide of any one of claims 1-19, wherein X4is a proline analog.

24. The synthetic peptide of any one of claims 1-23, wherein P'5is proline.

25. The synthetic peptide of any one of claims 1-23, wherein P'5is a proline analog.

26. The synthetic peptide of any one of claims 1-25, wherein X6is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

27. The synthetic peptide of claim 26, wherein X6is selected from the group consisting of alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, and valine.

28. The synthetic peptide of claim 27, wherein X6is lysine.

29. The synthetic peptide of any one of claims 1-25, wherein X6is a proline analog.

30. The synthetic peptide of any one of claims 1-29, further comprising an amino acid or amino acid analog (X0) at a position that is immediately N-terminal to position X1.

31. The synthetic peptide of claim 30, wherein X0is selected from any amino acid.

32. The synthetic peptide of claim 31, wherein X0is selected from the group consisting of proline and alanine.

33. The synthetic peptide of claim 32, wherein X0is proline.

34. The synthetic peptide of claim 30, wherein X0is a proline analog.

35. The synthetic peptide of any one of claims 1-34, further comprising an amino acid or amino acid analog (X8) at a position that is immediately C-terminal to the arginine at position 7 of Formula I.

36. The synthetic peptide of claim 35, wherein X8is selected from any amino acid.

37. The synthetic peptide of claim 36, wherein X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine.

38. The synthetic peptide of claim 37, wherein X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, serine, tryptophan, and tyrosine.

39. The synthetic peptide of claim 38, wherein X8is selected from the group consisting of arginine, cysteine, and alanine.

40. The synthetic peptide of claim 38, wherein X8is isoleucine.

41. The synthetic peptide of claim 35, wherein X8is a proline analog.

42. A synthetic peptide comprising an amino acid sequence of at least seven consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises an amino acid sequence according to Formula II: X1P X3X4P X6R'7(Formula II) wherein X1is selected from any amino acid and an arginine analog; X3is selected from any amino acid and an arginine analog; X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, and an arginine analog; X6is selected from any amino acid and an arginine analog; R'7is arginine or an arginine analog; and the synthetic peptide comprises at least one arginine analog.

43. The synthetic peptide of claim 42, wherein the synthetic peptide consists essentially of an amino acid sequence of seven to ten consecutive amino acids or amino acid analogs.

44. The synthetic peptide of claim 42 or 43, wherein each arginine analog is independently selected from the group consisting of L-homoarginine, L-citrulline, L-ornithine, 4- guanidinophenylalanine, 4-trans-guanidinoproline, 4-cis-guanidinoproline, methylarginine, asymmetric dimethylarginine, symmetric dimethylarginine, beta,beta-dimethylarginine, 2- amino-4-guanidino- L-butyric acid, and 2-amino-3-guanidino- L-propionic acid.

45. The synthetic peptide of any one of claims 42-44, wherein each arginine analog is independently selected from the group consisting of L-homoarginine, L-citrulline, L-ornithine, 4- guanidinophenylalanine, 4-trans-guanidinoproline, 4-cis-guanidinoproline, methylarginine, asymmetric dimethylarginine, symmetric dimethylarginine, and beta,beta-dimethylarginine.

46. The synthetic peptide of any one of claims 42-44, wherein each arginine analog is independently selected from the group consisting of L-homoarginine, L-citrulline, L-ornithine, methylarginine, symmetric dimethylarginine, 2-amino-4-guanidino- L-butyric acid, 2-amino-3- guanidino- L-propionic acid, 4-cis-guanidinoproline, beta,beta-dimethylarginine, asymmetric dimethylarginine, 4-trans-guanidinoproline, and 4-guanidinophenylalanine.

47. The synthetic peptide of any one of claims 42-46, wherein each arginine analog is independently selected from the group consisting of L-homoarginine and L-citrulline.

48. The synthetic peptide of any one of claims 42-47, wherein each arginine analog is an internal residue of the synthetic peptide.

49. The synthetic peptide of claim 48, wherein each arginine analog is independently selected from the list of arginine analogs set forth in Table B1.

50. The synthetic peptide of any one of claims 42-47, wherein the at least one arginine analog is the N-terminal residue of the synthetic peptide.

51. The synthetic peptide of claim 50, wherein the at least one arginine analog is selected from the list of arginine analogs set forth in Table B3.

52. The synthetic peptide of any one of claims 42-47, wherein the at least one arginine analog is the C-terminal residue of the synthetic peptide.

53. The synthetic peptide of claim 52, wherein the at least one arginine analog is selected from the list of arginine analogs set forth in Table B2.

54. The synthetic peptide of any one of claims 42-53, wherein X1is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

55. The synthetic peptide of claim 54, wherein X1is proline.

56. The synthetic peptide of any one of claims 42-53, wherein X1is an arginine analog.

57. The synthetic peptide of any one of claims 42-56, wherein X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine.

58. The synthetic peptide of claim 57, wherein X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, and valine.

59. The synthetic peptide of claim 58, wherein X3is arginine.

60. The synthetic peptide of any one of claims 42-56, wherein X3is an arginine analog.

61. The synthetic peptide of any one of claims 42-60, wherein X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, proline, threonine, tyrosine, and valine.

62. The synthetic peptide of claim 61, wherein X4is selected from the group consisting of alanine, isoleucine, proline, and valine.

63. The synthetic peptide of claim 62, wherein X4is proline.

64. The synthetic peptide of any one of claims 42-60, wherein X4is an arginine analog.

65. The synthetic peptide of any one of claims 42-64, wherein X6is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

66. The synthetic peptide of claim 65, wherein X6is selected from the group consisting of alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, and valine.

67. The synthetic peptide of claim 66, wherein X6is lysine.

68. The synthetic peptide of any one of claims 42-64, wherein X6is an arginine analog.

69. The synthetic peptide of any one of claims 42-68, wherein R'7is arginine.

70. The synthetic peptide of any one of claims 42-68, wherein R'7is an arginine analog.

71. The synthetic peptide of any one of claims 42-70, further comprising an amino acid or amino acid analog (X0) at a position that is immediately N-terminal to position X1.

72. The synthetic peptide of claim 71, wherein X0is selected from any amino acid.

73. The synthetic peptide of claim 72, wherein X0is selected from the group consisting of proline and alanine.

74. The synthetic peptide of claim 73, wherein X0is proline.

75. The synthetic peptide of claim 71, wherein X0is an arginine analog.

76. The synthetic peptide of any one of claims 42-75, further comprising an amino acid or amino acid analog (X8) at a position that is immediately C-terminal to position R'7of Formula II.

77. The synthetic peptide of claim 76, wherein X8is selected from any amino acid.

78. The synthetic peptide of claim 77, wherein X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine.

79. The synthetic peptide of claim 78, wherein X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, serine, tryptophan, and tyrosine.

80. The synthetic peptide of claim 79, wherein X8is selected from the group consisting of arginine, cysteine, and alanine.

81. The synthetic peptide of claim 79, wherein X8is isoleucine.

82. The synthetic peptide of claim 76, wherein X8is an arginine analog.

83. A synthetic peptide comprising an amino acid sequence of at least seven consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises an amino acid sequence according to Formula III:X1P X3X4P X6R (Formula III) wherein X1is selected from any amino acid and a lysine analog; X3is selected from any amino acid and a lysine analog; X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, and a lysine analog; X6is selected from any amino acid and a lysine analog; and the synthetic peptide comprises at least one lysine analog.

84. The synthetic peptide of claim 83, wherein the synthetic peptide consists essentially of an amino acid sequence of seven to ten consecutive amino acids or amino acid analogs.

85. The synthetic peptide of claim 83 or 84, wherein each lysine analog is independently selected from the group consisting of L-ornithine, L-citrulline, L-homolysine, (S)-2-amino-3-(3- aminophenyl)propanoic acid, S-(2-aminoethyl)-L-cysteine, and 2,4-diamino-L-butryic acid.

86. The synthetic peptide of any one of claims 83-85, wherein each lysine analog is independently selected from the group consisting of L-ornithine, L-citrulline, L-homolysine, (S)- 2-amino-3-(3-aminophenyl)propanoic acid, and S-(2-aminoethyl)-L-cysteine.

87. The synthetic peptide of any one of claims 83-85, wherein each lysine analog is independently selected from the group consisting of L-ornithine, L-citrulline, 2,4-diamino-L- butryic acid, L-homolysine, and S-(2-aminoethyl)-L-cysteine.

88. The synthetic peptide of any one of claims 83-87, wherein each lysine analog is L- ornithine.

89. The synthetic peptide of any one of claims 83-88, wherein each lysine analog is an internal residue of the synthetic peptide.

90. The synthetic peptide of claim 89, wherein each lysine analog is independently selected from the list of lysine analogs set forth in Table C1.

91. The synthetic peptide of any one of claims 83-88, wherein the at least one lysine analog is the N-terminal residue of the synthetic peptide.

92. The synthetic peptide of claim 91, wherein the at least one lysine analog is selected from the list of lysine analogs set forth in Table C2.

93. The synthetic peptide of any one of claims 83-88, wherein the at least one lysine residue is the C-terminal residue of the synthetic peptide.

94. The synthetic peptide of any one of claims 83-93, wherein X1is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

95. The synthetic peptide of claim 94, wherein X1is proline.

96. The synthetic peptide of any one of claims 83-91, wherein X1is a lysine analog.

97. The synthetic peptide of any one of claims 82-96, wherein X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine.

98. The synthetic peptide of claim 97, wherein X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, and valine.

99. The synthetic peptide of claim 98, wherein X3is arginine.

100. The synthetic peptide of any one of claims 83-96, wherein X3is a lysine analog.

101. The synthetic peptide of any one of claims 83-100, wherein X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, proline, threonine, tyrosine, and valine.

102. The synthetic peptide of claim 101, wherein X4is selected from the group consisting of alanine, isoleucine, proline, and valine.

103. The synthetic peptide of claim 102, wherein X4is proline.

104. The synthetic peptide of any one of claims 83-100, wherein X4is a lysine analog.

105. The synthetic peptide of any one of claims 83-104, wherein X6is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine,histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

106. The synthetic peptide of claim 105, wherein X6is selected from the group consisting of alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, and valine.

107. The synthetic peptide of claim 106, wherein X6is lysine.

108. The synthetic peptide of any one of claims 83-104, wherein X6is a lysine analog.

109. The synthetic peptide of any one of claims 83-108, further comprising an amino acid or amino acid analog (X0) at a position that is immediately N-terminal to position X1.

110. The synthetic peptide of claim 109, wherein X0is selected from any amino acid.

111. The synthetic peptide of claim 110, wherein X0is selected from the group consisting of proline and alanine.

112. The synthetic peptide of claim 111, wherein X0is proline.

113. The synthetic peptide of claim 109, wherein X0is a lysine analog.

114. The synthetic peptide of any one of claims 83-113, further comprising an amino acid or amino acid analog (X8) at a position that is immediately C-terminal to the arginine at position 7 of Formula III.

115. The synthetic peptide of claim 114, wherein X8is selected from any amino acid.

116. The synthetic peptide of claim 115, wherein X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine.

117. The synthetic peptide of claim 116, wherein X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, serine, tryptophan, and tyrosine.

118. The synthetic peptide of claim 117, wherein X8is selected from the group consisting of arginine, cysteine, and alanine.

119. The synthetic peptide of claim 117, wherein X8is isoleucine.

120. The synthetic peptide of claim 114, wherein X8is a lysine analog.

121. The synthetic peptide of any one of claims 1-120, wherein the synthetic peptide comprises at least one D-amino acid.

122. A synthetic peptide comprising an amino acid sequence of at least seven consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises an amino acid sequence according to Formula IV: X1P'2X3X4P'5X6R'7(Formula IV) wherein X1is selected from any amino acid, a proline analog, an arginine analog, and a lysine analog; P'2is proline or a proline analog; X3is selected from any amino acid, a proline analog, an arginine analog, and a lysine analog; X4is selected from alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, valine, a proline analog, an arginine analog, and a lysine analog; P'5is proline or a proline analog; X6is selected from any amino acid, a proline analog, an arginine analog, and a lysine analog; and R'7is selected from arginine and an arginine analog; wherein: (i) the synthetic peptide comprises at least one amino acid analog, and / or (ii) the synthetic peptide comprises at least one D-amino acid.

123. The synthetic peptide of claim 122, wherein the synthetic peptide consists essentially of an amino acid sequence of seven to ten consecutive amino acids or amino acid analogs.

124. The synthetic peptide of claim 122 or 123, wherein the synthetic peptide comprises at least one proline analog.

125. The synthetic peptide of claim 124, wherein each proline analog is independently selected from the group consisting of L-pipecolic acid, (2S,3aS,7aS)-octahydroindole-2- carboxylic acid, (S)-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, trans-4- hydroxyproline, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, L-azetidine-2-carboxylic acid, (S)- 4-oxopyrrolidine-2-carboxylic acid , (2S,4S)-4-aminopyrrolidine-2-carboxylic acid, (2S,4R)-4- aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, (S)-indoline-2-carboxylic acid, (S)- oxazolidine-4-carboxylic acid, cis-4-hydroxyproline, (2S,3R)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,3S)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2- carboxylic acid, (2S,4S)-4-(difluoromethyl)pyrrolidine-2-carboxylic acid, 2,4-methanoproline, (2S,4R)-4-(difluoromethoxy)pyrrolidine-2-carboxylic acid, (2S,4R)-4- (trifluoromethoxy)pyrrolidine-2-carboxylic acid, (S)-isoxazolidine-3-carboxylic acid, 4-trans- guanidinoproline, 4-cis-guanidinoproline, alpha-methyl-L-proline, and α-aminoisobutyric acid.

126. The synthetic peptide of claim 124 or 125, wherein each proline analog is independently selected from the group consisting of L-pipecolic acid, (2S,3aS,7aS)-octahydroindole-2- carboxylic acid, (S)-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, (R)-thiazolidine-4- carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, trans-4- hydroxyproline, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, L-azetidine-2-carboxylic acid, (S)- 4-oxopyrrolidine-2-carboxylic acid , (2S,4S)-4-aminopyrrolidine-2-carboxylic acid, (2S,4R)-4- aminopyrrolidine-2-carboxylic acid, 3,4-dehydro-L-proline, (S)-indoline-2-carboxylic acid, (S)- oxazolidine-4-carboxylic acid, cis-4-hydroxyproline, (2S,3R)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,3S)-3-hydroxypyrrolidine-2-carboxylic acid, (2S,4S)-4-(trifluoromethyl)pyrrolidine-2- carboxylic acid, (2S,4S)-4-(difluoromethyl)pyrrolidine-2-carboxylic acid, 2,4-methanoproline, (2S,4R)-4-(difluoromethoxy)pyrrolidine-2-carboxylic acid, (2S,4R)-4- (trifluoromethoxy)pyrrolidine-2-carboxylic acid, (S)-isoxazolidine-3-carboxylic acid, 4-trans- guanidinoproline, 4-cis-guanidinoproline, and alpha-methyl-L-proline.

127. The synthetic peptide of claim 124 or 125, wherein each proline analog is independently selected from the group consisting of L-pipecolic acid, (S)-1,2,3,4-tetrahydroisoquinoline-3- carboxylic acid, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, (R)-thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, (2S,3aS,7aS)- octahydroindole-2-carboxylic acid, trans-4-hydroxyproline, (2S,4R)-4-aminopyrrolidine-2- carboxylic acid, 3,4-dehydro-L-proline, alpha-methyl-L-proline, L-azetidine-2-carboxylic acid, (S)-4-oxopyrrolidine-2-carboxylic acid, (S)-oxazolidine-4-carboxylic acid, (S)-indoline-2- carboxylic acid, (2S,4S)-4-aminopyrrolidine-2-carboxylic acid, (2S,4S)-4- (trifluoromethyl)pyrrolidine-2-carboxylic acid, α-aminoisobutyric acid, (2S,4S)-4- (difluoromethyl)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(difluoromethoxy)pyrrolidine-2-carboxylic acid, (2S,4R)-4-(trifluoromethoxy)pyrrolidine-2-carboxylic acid, cis-4- hydroxyproline, and 2,4-methanoproline.

128. The synthetic peptide of any one of claims 124-127, wherein each proline analog is independently selected from the group consisting of L-pipecolic acid, (S)-1,2,3,4- tetrahydroisoquinoline-3-carboxylic acid, (S)-2-amino-3-(thiophen-2-yl)propanoic acid, (R)- thiazolidine-4-carboxylic acid, cis-4-fluoroproline, trans-4-fluoroproline, 4,4-difluoroproline, (2S,3aS,7aS)-octahydroindole-2-carboxylic acid, and trans-4-hydroxyproline.

129. The synthetic peptide of any one of claims 122-128, wherein the synthetic peptide comprises at least one arginine analog.

130. The synthetic peptide of claim 129, wherein each arginine analog is independently selected from the group consisting of L-homoarginine, L-citrulline, L-ornithine, 4- guanidinophenylalanine, 4-trans-guanidinoproline, 4-cis-guanidinoproline, methylarginine, asymmetric dimethylarginine, symmetric dimethylarginine, beta,beta-dimethylarginine, 2- amino-4-guanidino- L-butyric acid, and 2-amino-3-guanidino- L-propionic acid.

131. The synthetic peptide of claim 129 or 130, wherein each arginine analog is independently selected from the group consisting of L-homoarginine, L-citrulline, L-ornithine, 4- guanidinophenylalanine, 4-trans-guanidinoproline, 4-cis-guanidinoproline, methylarginine, asymmetric dimethylarginine, symmetric dimethylarginine, and beta,beta-dimethylarginine.

132. The synthetic peptide of claim 129 or 130, wherein each arginine analog is independently selected from the group consisting of L-homoarginine, L-citrulline, L-ornithine, methylarginine, symmetric dimethylarginine, 2-amino-4-guanidino- L-butyric acid, 2-amino-3-guanidino- L- propionic acid, 4-cis-guanidinoproline, beta,beta-dimethylarginine, asymmetric dimethylarginine, 4-trans-guanidinoproline, and 4-guanidinophenylalanine.

133. The synthetic peptide of any one of claims 129-132, wherein each arginine analog is independently selected from the group consisting of L-homoarginine and L-citrulline.

134. The synthetic peptide of any one of claims 122-133, wherein the synthetic peptide comprises at least one lysine analog.

135. The synthetic peptide of claim 134, wherein each lysine analog is independently selected from the group consisting of L-ornithine, L-citrulline, L-homolysine, (S)-2-amino-3-(3- aminophenyl)propanoic acid, S-(2-aminoethyl)-L-cysteine, and 2,4-diamino-L-butryic acid.

136. The synthetic peptide of claim 134 or 135, wherein each lysine analog is independently selected from the group consisting of L-ornithine, L-citrulline, L-homolysine, (S)-2-amino-3-(3- aminophenyl)propanoic acid, and S-(2-aminoethyl)-L-cysteine.

137. The synthetic peptide of claim 134 or 135, wherein each lysine analog is independently selected from the group consisting of L-ornithine, L-citrulline, 2,4-diamino-L-butryic acid, L- homolysine, and S-(2-aminoethyl)-L-cysteine.

138. The synthetic peptide of any one of claims 134-137, wherein each lysine analog is L- ornithine.

139. The synthetic peptide of any one of claims 122-138, wherein each proline analog is an internal residue of the synthetic peptide.

140. The synthetic peptide of claim 139, wherein each proline analog is independently selected from the list of proline analogs set forth in Table A1.

141. The synthetic peptide of any one of claims 122-140, wherein each arginine analog is an internal residue of the synthetic peptide.

142. The synthetic peptide of claim 141, wherein each arginine analog is independently selected from the list of arginine analogs set forth in Table B1.

143. The synthetic peptide of any one of claims 122-142, wherein each lysine analog is an internal residue of the synthetic peptide.

144. The synthetic peptide of claim 143, wherein each lysine analog is independently selected from the list of lysine analogs set forth in Table C1.

145. The synthetic peptide of any one of claims 122-138, wherein the N-terminal residue of the synthetic peptide is a proline analog, an arginine analog, or a lysine analog.

146. The synthetic peptide of claim 145, wherein the N-terminal residue is selected from the list of proline analogs set forth in Table A2.

147. The synthetic peptide of claim 145, wherein the N-terminal residue is selected from the list of arginine analogs set forth in Table B3.

148. The synthetic peptide of claim 145, wherein the N-terminal residue is selected from the list of lysine analogs set forth in Table C2.

149. The synthetic peptide of any one of claims 122-140, wherein the C-terminal residue of the synthetic peptide is an arginine analog.

150. The synthetic peptide of claim 149, wherein the C-terminal residue is selected from the list of arginine analogs set forth in Table B2.

151. The synthetic peptide of any one of claims 122-150, wherein X1is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

152. The synthetic peptide of claim 151, wherein X1is proline.

153. The synthetic peptide of any one of claims 122-150, wherein X1is a proline analog, an arginine analog, or a lysine analog.

154. The synthetic peptide of claim 153, wherein X1is a proline analog.

155. The synthetic peptide of any one of claims 122-154, wherein P'2is proline.

156. The synthetic peptide of any one of claims 122-154, wherein P'2is a proline analog.

157. The synthetic peptide of any one of claims 122-156, wherein X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine.

158. The synthetic peptide of claim 157, wherein X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, and valine.

159. The synthetic peptide of claim 158, wherein X3is arginine.

160. The synthetic peptide of any one of claims 122-156, wherein X3is a proline analog, an arginine analog, or a lysine analog.

161. The synthetic peptide of claim 160, wherein X3is an arginine analog 162. The synthetic peptide of any one of claims 122-161, wherein X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, proline, threonine, tyrosine, and valine.

163. The synthetic peptide of claim 162, wherein X4is selected from the group consisting of alanine, isoleucine, proline, and valine.

164. The synthetic peptide of claim 163, wherein X4is proline.

165. The synthetic peptide of any one of claims 122-161, wherein X4is a proline analog, an arginine analog, or a lysine analog.

166. The synthetic peptide of claim 165, wherein X4is a proline analog.

167. The synthetic peptide of any one of claims 122-166, wherein P'5is proline.

168. The synthetic peptide of any one of claims 122-166, wherein P'5is a proline analog.

169. The synthetic peptide of any one of claims 122-168, wherein X6is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

170. The synthetic peptide of claim 169, wherein X6is selected from the group consisting of alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, and valine.

171. The synthetic peptide of claim 170, wherein X6is lysine.

172. The synthetic peptide of any one of claims 122-168, wherein X6is a proline analog, an arginine analog, or a lysine analog.

173. The synthetic peptide of claim 172, wherein X6is a lysine analog.

174. The synthetic peptide of any one of claims 122-173, wherein R'7is arginine.

175. The synthetic peptide of any one of claims 122-173, wherein R'7is an arginine analog.

176. The synthetic peptide of any one of claims 122-175, further comprising an amino acid or amino acid analog (X0) at a position that is immediately N-terminal to position X1.

177. The synthetic peptide of claim 176, wherein X0is selected from any amino acid.

178. The synthetic peptide of claim 177, wherein X0is selected from the group consisting of proline and alanine.

179. The synthetic peptide of claim 178, wherein X0is proline.

180. The synthetic peptide of claim 176, wherein X0is a proline analog, an arginine analog, or a lysine analog.

181. The synthetic peptide of claim 180, wherein X0is a proline analog.

182. The synthetic peptide of any one of claims 122-181, further comprising an amino acid or amino acid analog (X8) at a position that is immediately C-terminal to the arginine at position R'7.

183. The synthetic peptide of claim 182, wherein X8is selected from any amino acid.

184. The synthetic peptide of claim 183, wherein X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine.

185. The synthetic peptide of claim 184, wherein X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, serine, tryptophan, and tyrosine.

186. The synthetic peptide of claim 185, wherein X8is selected from the group consisting of arginine, cysteine, and alanine.

187. The synthetic peptide of claim 185, wherein X8is isoleucine.

188. The synthetic peptide of claim 182, wherein X8is selected from a proline analog, an arginine analog, and a lysine analog.

189. The synthetic peptide of 188, wherein X8is a proline analog.

190. The synthetic peptide of any one of claims 30, 71, 109, or 176, wherein X0is a D-amino acid.

191. The synthetic peptide of claim 190, wherein X0is selected from D-proline and D-alanine.

192. The synthetic peptide of any one of claims 35, 76, 114, or 182, wherein X8is a D-amino acid.

193. The synthetic peptide of claim 192, wherein X8is selected from D-alanine, D-arginine, and D-isoleucine.

194. The synthetic peptide of any one of claims 1-10, 42-53, 83-93, or 122-150, wherein X1is a D-amino acid.

195. The synthetic peptide of claim 194, wherein X1is D-proline.

196. The synthetic peptide of any one of claims 1-195, wherein the N-terminal residue of the synthetic peptide comprises a modification.

197. The synthetic peptide of claim 196, wherein the N-terminal residue is acetylated.

198. The synthetic peptide of claim 196 or 197, wherein the N-terminal residue comprises a fatty acid modification.

199. The synthetic peptide of claim 198, wherein the N-terminal fatty acid modification is selected from the group consisting of N-epsilon-palmitoyl-L-lysine, N-epsilon-((S)-4-carboxy-4- palmitamidobutanoyl)-L-lysine, (1S,28S)-1-amino-7,16,25,30-tetraoxo-9,12,18,21-tetraoxa- 6,15,24,29-tetraazahexatetracontane-1,28,46-tricarboxylic acid, (1S,28S)-1-amino-7,16,25,30- tetraoxo-9,12,18,21-tetraoxa-6,15,24,29-tetraazaoctatetracontane-1,28,48-tricarboxylic acid, N- epsilon-heptanoyl-L-lysine, N-epsilon-octanoyl-L-lysine, N-epsilon-lauroyl-L-lysine, N-epsilon- (12-aminolauroyl)- L-lysine, N-gamma-lauroyl-L-glutamine, N-epsilon-myristoyl-L-lysine, (S)- 16-((5-amino-5-carboxypentyl)amino)-16-oxohexadecanoic acid, 16-(((S)-4-(((S)-5-amino-5- carboxypentyl)amino)-1-carboxy-4-oxobutyl)amino)-16-oxohexadecanoic acid, N-epsilon- stearoyl-L-lysine, propionic acid, butyric acid, valeric acid, caproic acid, adipic acid, heptanoic acid, caprylic acid, octanedioic acid, capric acid, decanedioic acid, lauric acid, dodecanedioic acid, 12-aminododecanoic acid, tridecylic acid, myristic acid, tetradecanedioic acid, pentadecylic acid, pentadecanedioic acid, palmitic acid, thapsic acid, margaric acid, heptadecanedioic acid,stearic acid, octadecanedioic acid, nonadecylic acid, nonadecanedioic acid, arachidic acid, icosanedioic acid, behenic acid, and docosanedioic acid.

200. The synthetic peptide of claim 198 or 199, wherein the fatty acid modification is selected from the group consisting of N-epsilon-palmitoyl-L-lysine, N-epsilon-((S)-4-carboxy-4- palmitamidobutanoyl)-L-lysine, and (1S,28S)-1-amino-7,16,25,30-tetraoxo-9,12,18,21-tetraoxa- 6,15,24,29-tetraazahexatetracontane-1,28,46-tricarboxylic acid.

201. The synthetic peptide of any one of claims 198-200, wherein the fatty acid modification is selected from the list of fatty acid modifications set forth in Table D.

202. The synthetic peptide of any one of claims 1-201, wherein the synthetic peptide comprises the amino acid sequence of any one of SEQ ID NOs: 171-202, 209-328, 330-357, or 366.

203. A synthetic peptide comprising an amino acid sequence of at least seven consecutive amino acids or amino acid analogs, including an N-terminal amino acid or amino acid analog and a C-terminal amino acid or amino acid analog, wherein the amino acid sequence comprises an amino acid sequence according to Formula III: X1P X3X4P X6R (Formula III) wherein X1is selected from any amino acid; X3is selected from any amino acid; X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, phenylalanine, proline, threonine, tyrosine, and valine; X6is selected from any amino acid; and the synthetic peptide comprises an N-terminal fatty acid modification.

204. The synthetic peptide of claim 203, wherein the synthetic peptide consists essentially of an amino acid sequence of seven to ten consecutive amino acids or amino acid analogs.

205. The synthetic peptide of claim 203 or 204, wherein the N-terminal fatty acid modification is selected from the list of fatty acid modifications set forth in Table D.

206. The synthetic peptide of any one of claims 203-205, wherein the N-terminal fatty acid modification is selected from the group consisting of N-epsilon-palmitoyl-L-lysine, N-epsilon- ((S)-4-carboxy-4-palmitamidobutanoyl)-L-lysine, (1S,28S)-1-amino-7,16,25,30-tetraoxo-9,12,18,21-tetraoxa-6,15,24,29-tetraazahexatetracontane-1,28,46-tricarboxylic acid, (1S,28S)-1- amino-7,16,25,30-tetraoxo-9,12,18,21-tetraoxa-6,15,24,29-tetraazaoctatetracontane-1,28,48- tricarboxylic acid, N-epsilon-heptanoyl-L-lysine, N-epsilon-octanoyl-L-lysine, N-epsilon-lauroyl- L-lysine, N-epsilon-(12-aminolauroyl)- L-lysine, N-gamma-lauroyl-L-glutamine, N-epsilon- myristoyl-L-lysine, (S)-16-((5-amino-5-carboxypentyl)amino)-16-oxohexadecanoic acid, 16- (((S)-4-(((S)-5-amino-5-carboxypentyl)amino)-1-carboxy-4-oxobutyl)amino)-16- oxohexadecanoic acid, N-epsilon-stearoyl-L-lysine, propionic acid, butyric acid, valeric acid, caproic acid, adipic acid, heptanoic acid, caprylic acid, octanedioic acid, capric acid, decanedioic acid, lauric acid, dodecanedioic acid, 12-aminododecanoic acid, tridecylic acid, myristic acid, tetradecanedioic acid, pentadecylic acid, pentadecanedioic acid, palmitic acid, thapsic acid, margaric acid, heptadecanedioic acid, stearic acid, octadecanedioic acid, nonadecylic acid, nonadecanedioic acid, arachidic acid, icosanedioic acid, behenic acid, and docosanedioic acid.

207. The synthetic peptide of claim 206, wherein the N-terminal fatty acid modification is selected from the group consisting of N-epsilon-palmitoyl-L-lysine, N-epsilon-((S)-4-carboxy-4- palmitamidobutanoyl)-L-lysine, and (1S,28S)-1-amino-7,16,25,30-tetraoxo-9,12,18,21-tetraoxa- 6,15,24,29-tetraazahexatetracontane-1,28,46-tricarboxylic acid.

208. The synthetic peptide of any one of claims 203-207, wherein the N-terminal residue of the synthetic peptide is acetylated.

209. The synthetic peptide of any one of claims 203-208, wherein X1is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

210. The synthetic peptide of claim 209, wherein X1is proline.

211. The synthetic peptide of any one of claims 203-210, wherein X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan, and valine.

212. The synthetic peptide of claim 211, wherein X3is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, and valine.

213. The synthetic peptide of claim 212, wherein X3is arginine.

214. The synthetic peptide of any one of claims 203-213, wherein X4is selected from the group consisting of alanine, arginine, isoleucine, leucine, lysine, proline, threonine, tyrosine, and valine.

215. The synthetic peptide of claim 214, wherein X4is selected from the group consisting of alanine, isoleucine, proline, and valine.

216. The synthetic peptide of claim 215, wherein X4is proline.

217. The synthetic peptide of any one of claims 203-216, wherein X6is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

218. The synthetic peptide of claim 217, wherein X6is selected from the group consisting of alanine, arginine, asparagine, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, proline, serine, threonine, tryptophan, tyrosine, and valine.

219. The synthetic peptide of claim 218, wherein X6is lysine.

220. The synthetic peptide of any one of claims 203-219, further comprising an amino acid (X0) at a position that is immediately N-terminal to position X1.

221. The synthetic peptide of claim 220, wherein X0is selected from any amino acid.

222. The synthetic peptide of claim 221, wherein X0is selected from the group consisting of proline and alanine.

223. The synthetic peptide of claim 222, wherein X0is proline.

224. The synthetic peptide of any one of claims 203-223, further comprising an amino acid (X8) at a position that is immediately C-terminal to the arginine at position 7 of Formula III.

225. The synthetic peptide of claim 224, wherein X8is selected from any amino acid.

226. The synthetic peptide of claim 225, wherein X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, tryptophan, and tyrosine.

227. The synthetic peptide of claim 226, wherein X8is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, serine, tryptophan, and tyrosine.

228. The synthetic peptide of claim 227, wherein X8is selected from the group consisting of arginine, cysteine, and alanine.

229. The synthetic peptide of claim 227, wherein X8is isoleucine.

230. The synthetic peptide of any one of claims 203-229 , wherein the synthetic peptide comprises the amino acid sequence of any one of SEQ ID NOs: 203-208, 358-360, or 367.

231. The synthetic peptide of any one of claims 1-29, 42-70, 83-108, 122-175, or 203-219, wherein X1is the N-terminal amino acid or amino acid analog of the synthetic peptide.

232. The synthetic peptide of any one of claims 1-230, wherein the synthetic peptide comprises 1, 2, or 3 amino acids N-terminal to position X1.

233. The synthetic peptide of any one of claims 1-34, 42-75, 83-113, 122-181, or 203-223, wherein the amino acid or amino acid analog at position 7 is the C-terminal amino acid or amino acid analog of the synthetic peptide.

234. The synthetic peptide of any one of claims 1-232, wherein the synthetic peptide comprises 1, 2, or 3 amino acids C-terminal to position X7.

235. The synthetic peptide of any one of claims 1-29, 42-70, 83-108, 122-175, or 203-219, wherein the amino acid sequence of the synthetic peptide consists essentially of seven consecutive amino acids or amino acid analogs.

236. The synthetic peptide of any one of claims 1-234, wherein the amino acid sequence of the synthetic peptide consists essentially of eight consecutive amino acids or amino acid analogs.

237. The synthetic peptide of any one of claims 1-234, wherein the amino acid sequence of the synthetic peptide consists essentially of nine consecutive amino acids or amino acid analogs.

238. The synthetic peptide of any one of claims 1-234, wherein the amino acid sequence of the synthetic peptide consists essentially of ten consecutive amino acids or amino acid analogs.

239. The synthetic peptide of any one of claims 1-238, wherein if X3is alanine and X4is valine, then X6is not proline.

240. The synthetic peptide of any one of claims 1-238, wherein if X4is proline and X6is arginine, then X3is not arginine or glutamine.

241. The synthetic peptide of any one of claims 1-238, wherein if X4is proline and X6is methionine, then X3is not histidine.

242. The synthetic peptide of any one of claims 1-241, wherein the C-terminal amino acid or amino acid analog comprises a modification.

243. The synthetic peptide of claim 242, wherein the C-terminal amino acid or amino acid analog is amidated.

244. The synthetic peptide of claim 242, wherein the C-terminal amino acid or amino acid analog comprises an ethylamide (NHEt) group.

245. The synthetic peptide of any one of claims 1-244, wherein the synthetic peptide exhibits binding to the SH3-2 domain of NCK1 with a KDof < 1,000 µM.

246. The synthetic peptide of claim 245, wherein the synthetic peptide exhibits binding to the SH3-2 domain of NCK1 with a KDof ≤ 600 µM.

247. The synthetic peptide of claim 246, wherein the synthetic peptide exhibits binding to the SH3-2 domain of NCK1 with a KDof ≤ 300 µM.

248. A composition comprising the synthetic peptide of any one of claims 1-247 and a salt.

249. The composition of claim 248, wherein the salt is an acetate.

250. The composition of claim 249, wherein the acetate is bis-acetate.

251. The composition of claim 249, wherein the acetate is tri-acetate.

252. A composition comprising the synthetic peptide of any one of claims 1-247, or the composition of any one of claims 248-251, wherein the purity of the synthetic peptide in the composition is at least 95% (e.g., 95%, 96%, 97%, 98%, 99%).

253. A pharmaceutical composition comprising the synthetic peptide of any one of claims 1- 247, or the composition of any one of claims 248-252, and a pharmaceutically acceptable carrier.

254. The pharmaceutical composition of claim 253, wherein the composition is sterile.

255. The pharmaceutical composition of claim 253 or 254, wherein the composition is dried (e.g., freeze dried or lyophilized).

256. The pharmaceutical composition of any one of claims 253-255, wherein the composition is an aqueous composition.

257. The pharmaceutical composition of claim 256, wherein the aqueous composition is injectable.

258. A delivery system comprising (i) a delivery device and (ii) the composition of any one of claims 248-252 or the pharmaceutical composition of any one of claims 253-257.

259. The delivery system of claim 258, wherein the delivery device comprises a syringe.

260. A method of modulating the activity of NCK1, the method comprising contacting NCK1 with a synthetic peptide of any one of claims 1-252 or the composition of any one of claims 253- 259, thereby to modulate the activity of NCK1.

261. The method of claim 260, wherein the step of contacting disrupts the interaction between PTP1B and NCK1.

262. The method of claim 260 or 261, wherein the step of contacting results in modulating the activity of PTP1B.

263. A method of decreasing body fat mass in a subject in need thereof, the method comprising administering to the subject an effective amount of the synthetic peptide of any one of claims 1-247, the composition of any one of claims 248-252, or the pharmaceutical composition of any one of claims 253-257, thereby to decrease body fat mass of the subject.

264. A method of treating or preventing obesity in a subject in need thereof, the method comprising administering to the subject an effective amount of the synthetic peptide of any one of claims 1-247, the composition of any one of claims 248-252, or the pharmaceutical composition of any one of claims 253-257, thereby to treat or prevent obesity in the subject.

265. A method of treating or preventing diabetes in a subject in need thereof, the method comprising administering to the subject an effective amount of the synthetic peptide of any one of claims 1-247, the composition of any one of claims 248-252, or the pharmaceutical composition of any one of claims 253-257, thereby to treat or prevent diabetes in the subject.

266. The method of claim 265, wherein the diabetes is type 2 diabetes.

267. The method of any one of claims 263-266, wherein the subject is a mammal.

268. The method of claim 267, wherein the mammal is a human.

269. The method of any one of claims 263-268, wherein the administration comprises systemic administration.

270. The method of claim 269, wherein the administration comprises subcutaneous administration.

Images