Microorganism with enhanced activity of monovalent cation / h+ antiporter subunit e, and use thereof

Abstract

The present disclosure relates to: a microorganism with enhanced activity of monovalent cation / H+ antiporter subunit E; a composition for producing L-amino acid comprising the microorganism; and a method for producing L-amino acid, the method comprising a step for culturing the microorganism.

Description

Microorganisms with enhanced activity of monovalent cation / hydrogen antiporter subunit E and their uses

[0001] Cross-citation with related application(s)

[0002] This disclosure claims the benefit of priority to Korean Patent Publication No. 10-2024-0119315, filed September 3, 2024, the entire contents of which are incorporated herein by reference.

[0003] The present disclosure relates to a microorganism having enhanced activity of a monovalent cation / hydrogen transporter subunit E, a composition for producing L-amino acids comprising the microorganism, and a method for producing L-amino acids comprising a step of culturing the microorganism.

[0004]

[0005] L-amino acids are used in the animal feed, pharmaceutical, and cosmetic industries, and are primarily produced through fermentation using strains of the Corynebacterium genus or Escherichia genus. Various studies are being conducted to develop high-efficiency production strains and fermentation process technologies for L-amino acids (US 2022-0228179 A1).

[0006]

[0007] An example of the present disclosure provides a microorganism producing L-amino acids with enhanced activity of monovalent cation / H+ antiporter subunit E.

[0008] Another example of the present disclosure provides a composition for producing L-amino acids comprising a microorganism having enhanced activity of the monovalent cation / hydrogen transporter subunit E.

[0009] Another example of the present disclosure provides a method for producing L-amino acids, comprising the step of culturing a microorganism having enhanced activity of the monovalent cation / hydrogen transporter subunit E.

[0010] Another example of the present disclosure provides the use of the microorganism for the production of L-amino acids.

[0011] Another example of the present disclosure provides a use of the microorganism, a medium in which the microorganism is cultured, or a combination thereof, for preparing a composition for producing L-amino acids.

[0012]

[0013] The present disclosure provides a microorganism having enhanced activity of monovalent cation / H+ antiporter subunit E. The microorganism may be a microorganism that produces L-amino acids, or may be a microorganism having increased L-amino acid production capacity.

[0014] In the present disclosure, the term “monovalent cation / H+ antiporter subunit E” refers to a membrane protein that transports monovalent cations into cells and hydrogen ions out of cells. The ions transported at this time can affect the activity and osmotic pressure of the cell. The “monovalent cation / H+ antiporter subunit E” of the present disclosure can be used interchangeably with “MnhE”. The sequence of the monovalent cation / H+ antiporter subunit E in the present disclosure can be obtained from the known database NCBI’s GenBank (e.g., NCBI Reference Sequence: WP_003863336.1). Specifically, it may be a polypeptide having the activity of the monovalent cation / H+ antiporter subunit E encoded by the CglE0320 gene, but is not limited thereto.

[0015] In one example, the monovalent cation / hydrogen antiporter subunit E and / or the gene encoding it may be derived from a microorganism of the genus Corynebacterium, and in one example, the monovalent cation / hydrogen antiporter subunit E and / or the gene encoding it may be derived from Corynebacterium glutamicum, but is not limited thereto.

[0016] In one example, the monovalent cation / hydrogen transporter subunit E can have, comprise, consist of, or consist essentially of the amino acid sequence of SEQ ID NO: 9.

[0017] In one example, the monovalent cation / hydrogen antiporter subunit E may comprise or consist of an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% sequence identity or homology with the amino acid sequence of SEQ ID NO: 9. In addition, if it is a protein that has such homology or identity and exhibits the activity of the monovalent cation / hydrogen antiporter subunit E, a variant of the monovalent cation / hydrogen antiporter subunit E having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added may also be included in the monovalent cation / hydrogen antiporter subunit E. For example, this includes cases in which the amino acid sequence N-terminus, C-terminus and / or internally has sequence additions or deletions that do not alter the activity of the monovalent cation / hydrogen antiporter subunit E, naturally occurring mutations, silent mutations or conservative substitutions.

[0018] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid with similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0019] The microorganism having enhanced activity of the monovalent cation / hydrogen antiporter subunit E may be a recombinant microorganism into which a polynucleotide encoding the monovalent cation / hydrogen antiporter subunit E described above has been introduced. In one example, the polynucleotide encoding the monovalent cation / hydrogen antiporter subunit E may be a polynucleotide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% sequence identity or homology with the nucleic acid sequence of SEQ ID NO: 10, and specifically, the polynucleotide encoding the monovalent cation / hydrogen antiporter subunit E may be composed of (consisting of) the nucleic acid sequence of SEQ ID NO: 10.

[0020]

[0021] The above monovalent cation / hydrogen antiporter subunit E and / or the gene encoding it can be introduced into a microorganism using a recombinant vector. The recombinant vector can be used as an expression vector. Expression of the polypeptide in a microorganism can be performed by culturing a recombinant cell (e.g., a microorganism) containing a gene encoding the monovalent cation / hydrogen antiporter subunit E (e.g., CglE0320 gene) or a recombinant vector containing it.

[0022] The introduction of a gene or recombinant vector encoding the monovalent cation / hydrogen antiporter subunit E into a microorganism can be performed by a person skilled in the art by appropriately selecting a known transformation method. As used herein, the term "transformation" means introducing a vector containing a polynucleotide encoding the monovalent cation / hydrogen antiporter subunit E into a host cell so that a polypeptide encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide can include both an integrated location within the chromosome of the host cell and an extrachromosomal location, as long as it can be expressed in the host cell. There is no limitation on the form in which the polynucleotide is introduced, as long as it can be introduced into the host cell and expressed. For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for its own expression. The above expression cassette may typically include expression control elements such as a promoter, a transcription termination signal, a ribosome binding site, and / or a translation termination signal, which are operably linked to the polynucleotide. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell. The term "operably linked" as described above may mean that the polynucleotide is functionally linked to an expression control element (e.g., a promoter) so as to perform transcriptional regulation (e.g., transcription initiation) of the polynucleotide. Operable linkage can be performed using a genetic recombination technique known in the art.

[0023] The method for transforming the above polynucleotide into a host cell can be performed by any method for introducing a nucleic acid into a cell (microorganism), and can be performed by appropriately selecting a transformation technique known in the art depending on the host cell. Examples of the known transformation methods include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) precipitation, DEAE-dextran, cationic liposome, lipofection, and lithium acetate-DMSO.

[0024] As used herein, the term "vector" refers to a DNA construct containing a polynucleotide sequence operably linked to suitable regulatory sequences so as to enable expression of a target protein in a suitable host. The regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence regulating the termination of transcription and / or translation. After being transformed into a suitable host cell, the vector may be expressed independently of the host cell's genome (genetic material), or may be integrated into the host cell's genome.

[0025] The vector usable in the present disclosure is not particularly limited as long as it is replicable in a host cell, and may be selected from all commonly used vectors. Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc., in a natural or recombinant state. For example, as the vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc., can be used as a phage vector or a cosmid vector, and as a plasmid vector, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series, etc., can be used. Specifically, examples include, but are not limited to, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pDCM2, and pDC24 vectors.

[0026] The vector may further comprise a selection marker to confirm whether the vector has been inserted into the chromosome. The selection marker is used to select cells transformed with the vector, i.e., to confirm whether the polynucleotide has been inserted. The selection marker may be selected from genes that confer a selectable phenotype, such as drug resistance, nutritional requirement, cytotoxic agent resistance, or surface protein expression. In an environment treated with a selective agent, only cells expressing the selection marker will survive or exhibit other phenotypic characteristics, thereby enabling the selection of transformed cells.

[0027]

[0028] In the present disclosure, the phrase “a polynucleotide or polypeptide has, includes, consists of, or consists essentially of a specific nucleic acid sequence (base sequence) or amino acid sequence” may mean that the polynucleotide or polypeptide essentially includes the specific nucleic acid sequence (base sequence) or amino acid sequence, and may be interpreted as including (or not excluding) a “substantially equivalent sequence” in which a mutation (deletion, substitution, modification, and / or addition) is added to the specific nucleic acid sequence (base sequence) or amino acid sequence to the extent that the original function and / or desired function of the polynucleotide or polypeptide is maintained. In one example, a polynucleotide or polypeptide “has, includes, consists of, or consists essentially of a particular nucleic acid sequence (base sequence) or amino acid sequence” may mean that the polynucleotide or polypeptide (i) essentially includes the particular nucleic acid sequence (base sequence) or amino acid sequence, or (ii) consists of or essentially includes a nucleic acid sequence or amino acid sequence that has at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% homology or identity with the particular nucleic acid sequence (base sequence) or amino acid sequence, and maintains its original function and / or desired function. In one example, the desired function may mean a function of increasing (improving) or imparting L-amino acid production ability of a microorganism.

[0029] In this disclosure, 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0030] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0031] Whether any two polynucleotide or polypeptide sequences are homologous or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information database.

[0032] Homology or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or in, for example, Needleman et al. (1970), J Mol Biol. 48:443. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a coding sequence matrix, as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0033]

[0034] The microorganism with enhanced activity of the above-mentioned monovalent cation / hydrogen transporter subunit E may be a microorganism that produces L-amino acids.

[0035] In the present disclosure, the term “microorganism having enhanced activity of monovalent cation / hydrogen antiporter subunit E” may be a microorganism in which the activity of the monovalent cation / hydrogen antiporter subunit E described above is enhanced compared to the intrinsic activity, so that a microorganism without L-amino acid production can have L-amino acid production, or can have L-amino acid production higher than its original L-amino acid production. In the present disclosure, “microorganism” encompasses unicellular bacteria and may be used interchangeably with “cell.”

[0036] In one example, the L-amino acid may be at least one selected from the group consisting of L-alanine, L-glycine, L-valine, L-leucine, L-isoleucine, L-proline, L-serine, L-threonine, L-asparagine, L-glutamine, L-cysteine, L-methionine, L-phenylalanine, L-tyrosine, L-tryptophan, L-aspartic acid, L-glutamic acid, L-histidine, L-lysine, and L-arginine, but is not limited thereto.

[0037] According to an example, a microorganism having enhanced activity of the monovalent cation / hydrogen antiporter subunit E may have enhanced L-amino acid production ability compared to a microorganism before enhancement (mutation), i.e., an unmodified microorganism of the same species. In the present disclosure, the term "unmodified microorganism" does not exclude a strain containing a mutation that may naturally occur in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation due to natural or artificial factors. For example, the unmodified microorganism may refer to a strain into which the monovalent cation / hydrogen antiporter subunit E or a gene encoding the same is not introduced, or whose activity is not enhanced, or before its activity is enhanced. The term "unmodified microorganism" may be used interchangeably with "pre-modified strain", "pre-modified microorganism", "unmutated strain", "unmodified strain", "unmutated microorganism", or "reference microorganism". The enhancement of the above-mentioned 1-valent cation / hydrogen transporter subunit E is as described above.

[0038] In one example, the target strain for comparing whether the L-amino acid production ability is increased, the unmodified microorganism, may be a wild-type Corynebacterium glutamicum ATCC13869 strain or a Corynebacterium glutamicum strain further modified to increase the production ability of L-amino acids (e.g., L-alanine) in the Corynebacterium glutamicum ATCC13869 strain. In one specific example, the unmodified microorganism may be, but is not limited to, a Corynebacterium glutamicum CJ0230 strain.

[0039] In one example, the microorganism may be a microorganism of the genus Corynebacterium, and may be selected from all microorganisms of the genus Corynebacterium having the ability to produce L-amino acids.

[0040] The above Corynebacterium genus microorganism may include, but is not limited to, Corynebacterium glutamicum, Corynebacterium stationis, Corynebacterium Thermoaminogenes, Brevibacterium flavum, Brevibacterium lactofermentum, or a strain prepared therefrom. Specifically, the Corynebacterium genus microorganism may be Corynebacterium glutamicum or Corynebacterium stationis.

[0041]

[0042] In the present disclosure, the term “intrinsic activity” may mean the active state of a protein that a microorganism originally has in an unmodified state, i.e., in a natural state.

[0043] As used herein, the term “enhancement” of polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The term “enhancement” may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or activity before modification. The term “intrinsic activity” refers to the activity of a specific polypeptide that a parent strain or unmodified microorganism originally possessed before the trait change, when the trait change is due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification.” “Enhanced,” “upregulated,” “overexpressed,” or “increased” the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression level) of a particular polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.

[0044] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the level of activity, expression level, or amount of product excreted from the polypeptide.

[0045] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but are not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0046] Specifically, the enhancement of the polypeptide of the present disclosure is

[0047] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;

[0048] 2) Replacing the gene expression control region on the chromosome that codes for a polypeptide with a highly active sequence;

[0049] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0050] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;

[0051] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);

[0052] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

[0053] 7) Codon optimization of polynucleotides encoding polypeptides;

[0054] 8) Analyzing the tertiary structure of the polypeptide and selecting the exposed portion to modify or chemically modify; or

[0055] 9) Control of cellular localization of proteins (polypeptides); or

[0056] 10) It may be a combination of two or more of the above 1) to 9), but is not particularly limited thereto.

[0057] More specifically,

[0058] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0059] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.

[0060] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, the yccA promoter, and the lysCP1 promoter (US Patent No. US 8426577 B2).

[0061] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0062] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not chromosomal insertion has occurred. The selection marker is as described above.

[0063] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0064] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.

[0065] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0066] 9) Control of the intracellular location of a protein (polypeptide) above may be to target the protein (polypeptide) to a specific organelle or specific intracellular space within the cell. For example, it may be to target the protein (polypeptide) to the periplasm or cytoplasm by adding or removing a leader sequence that functions to target the protein (polypeptide), but is not limited thereto.

[0067] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.

[0068] In the microorganism of the present disclosure, modification of part or all of the polynucleotide may be induced by, but is not limited to, (a) homologous recombination using a vector for chromosomal integration into the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation. The method for modifying part or all of the gene may include a method using DNA recombination technology. For example, a nucleotide sequence or vector containing a nucleotide sequence homologous to a target gene may be injected into the microorganism to cause homologous recombination, thereby causing deletion of part or all of the gene. The injected nucleotide sequence or vector may include, but is not limited to, a dominant selection marker.

[0069]

[0070] Another example of the present disclosure provides a method for increasing L-amino acid production capacity of a microorganism, or a method for imparting L-amino acid production capacity to a microorganism, comprising the step of enhancing the activity of a monovalent cation / hydrogen antiporter subunit E of the microorganism.

[0071] The step of enhancing the activity of the monovalent cation / hydrogen antiporter subunit E of the above microorganism may include the step of introducing a mutation into the microorganism that causes it to express a polypeptide having monovalent cation / hydrogen antiporter subunit E activity.

[0072] The step of introducing the above mutation may include a step of introducing (transforming) a microorganism with a polynucleotide encoding a polypeptide having monovalent cation / hydrogen antiporter subunit E activity or a recombinant vector containing the polynucleotide.

[0073] The above-mentioned single-valent cation / hydrogen transporter subunit E, polynucleotide, and microorganism are as described above.

[0074]

[0075] Another example of the present disclosure provides a method for producing L-amino acids, comprising the step of culturing a microorganism having enhanced activity of a monovalent cation / hydrogen transporter subunit E in a medium.

[0076] The above method may further include, after the culturing step, a step of recovering L-amino acid from the cultured microorganism, the medium, or both.

[0077] In one example, the L-amino acid may be at least one selected from the group consisting of L-alanine, L-glycine, L-valine, L-leucine, L-isoleucine, L-proline, L-serine, L-threonine, L-asparagine, L-glutamine, L-cysteine, L-methionine, L-phenylalanine, L-tyrosine, L-tryptophan, L-aspartic acid, L-glutamic acid, L-histidine, L-lysine, and L-arginine, but is not limited thereto.

[0078] In the above method, the step of culturing the microorganism is not particularly limited thereto, but may be performed by a known batch culture method, continuous culture method, fed-batch culture method, etc. At this time, the culture conditions are not particularly limited thereto, but may be adjusted to an appropriate pH (e.g., pH 5 to 9, specifically pH 6 to 8, most specifically pH 6.8) using a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid or sulfuric acid), and an aerobic condition may be maintained by introducing oxygen or an oxygen-containing gas mixture into the culture. The culture temperature may be maintained at 20 to 45°C, or 25 to 40°C, and the culture may be performed for about 10 to 160 hours, but is not limited thereto. The L-amino acid produced by the culture may be secreted into the medium or may remain within the cells.

[0079] The medium usable for the above culture may be selected from the group consisting of sugars and carbohydrates (e.g., glucose, sucrose, lactose, fructose, maltose, molasses, starch, and cellulose), oils and fats (e.g., soybean oil, sunflower seed oil, peanut oil, and coconut oil), fatty acids (e.g., palmitic acid, stearic acid, and linoleic acid), alcohols (e.g., glycerol and ethanol), and organic acids (e.g., acetic acid) as a carbon source, and may be used individually or in combination of two or more, but is not limited thereto. The medium may be selected from the group consisting of nitrogen-containing organic compounds (e.g., peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea), inorganic compounds (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate), and may be used individually or in combination of two or more, but is not limited thereto. As a phosphorus source, one or more selected from the group consisting of potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and corresponding sodium-containing salts may be used individually or in combination of two or more, but is not limited thereto. In addition, the medium may include essential growth-promoting substances such as other metal salts (e.g., magnesium sulfate or iron sulfate), amino acids, and / or vitamins.

[0080] The step of recovering the L-amino acid may be to collect the desired amino acid from a medium, culture solution, or microorganism using a suitable method known in the art, depending on the culture method. For example, the step of recovering the L-amino acid may be performed using one or more methods selected from centrifugation, filtration, anion exchange chromatography, crystallization, HPLC, etc. The method of recovering the L-amino acid may additionally include a purification step before, simultaneously with, or after the step.

[0081] The purification step can be performed using any suitable method known in the art. In one example, if the L-amino acid production method of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of order, or simultaneously or integrated into a single step, but is not limited thereto.

[0082] In the method of the present disclosure, the contents of the monovalent cation / hydrogen transporter subunit E and the microorganism are as described above.

[0083]

[0084] Another example of the present disclosure provides a composition for producing L-amino acids comprising a microorganism having enhanced activity of a monovalent cation / hydrogen transporter subunit E, a medium in which the microorganism is cultured, or a combination thereof.

[0085] The composition of the present disclosure may further comprise any suitable excipient commonly used in compositions for producing L-amino acids, including, but not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0086]

[0087] Another example of the present disclosure provides the use of a microorganism having enhanced activity of the monovalent cation / hydrogen transporter subunit E for the production of L-amino acids.

[0088]

[0089] Another example of the present disclosure provides the use of a microorganism having enhanced activity of a monovalent cation / hydrogen transporter subunit E, a medium in which the microorganism is cultured, or a combination thereof, for the preparation of a composition for producing L-amino acids.

[0090]

[0091] Other examples of the present disclosure provide microorganisms, methods, compositions, products, processes, or uses characterized by one or more elements disclosed in the present disclosure.

[0092]

[0093] It was confirmed that the microorganism with enhanced activity of the monovalent cation / hydrogen antiporter subunit E increased the productivity of L-amino acids, and thus the microorganism with enhanced activity of the monovalent cation / hydrogen antiporter subunit E of the present disclosure can be widely utilized to produce L-amino acids at a high yield.

[0094] The present disclosure is described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present disclosure and are therefore not intended to limit the scope of the present disclosure. Furthermore, technical details not described in this disclosure can be readily understood and implemented by those skilled in the technical field of the present disclosure or similar technical fields.

[0095]

[0096] Example 1. Production of microorganisms with enhanced activity of monovalent cation / hydrogen transporter subunit E and evaluation of L-alanine production ability.

[0097] Example 1-1. Construction of a recombinant vector for enhancing the copy number of the CglE0320 gene.

[0098] A strain with enhanced activity of monovalent cation / hydrogen antiporter subunit E was created by introducing the CglE0320 gene into Corynebacterium glutamicum ATCC13869.

[0099] First, the integrin region was selected as the copy insertion site. Restriction enzyme NotI and XbaI sequences were inserted into the downstream position of NCgl1234, and 1.0 kb of homologous region was added on both sides. The chromosomal gene of Corynebacterium glutamicum ATCC13869 strain was isolated using Intron's G-spin Total DNA extraction mini kit (Cat. No. 17045) according to the protocol provided in the kit, and gene fragments (NCgl1234down_A, NCgl1234down_B) were obtained through polymerase chain reaction using primer pairs of SEQ ID NOs: 1 and 2 and primer pairs of SEQ ID NOs: 3 and 4, respectively. Polymerase chain reaction conditions were as follows: denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and polymerization at 72°C for 30 s, followed by polymerization at 72°C for 5 min. The two fragments were ligated to linear pDC24 (SEQ ID NO: 13) digested with BamHI and SalI using T4 ligase (New England Biolab, Beverly, Ala.). The vector thus constructed was designated pDC24-ΔNCgl1234down.

[0100] In addition, the chromosomal gene of Corynebacterium glutamicum ATCC13869 was isolated using the G-spin Total DNA extraction mini kit (Cat. No. 17045) from Intron according to the protocol provided in the kit, and the Pn_CglE0320 gene fragment was obtained through polymerase chain reaction using the primer pair of SEQ ID NO: 5 and SEQ ID NO: 6. The polymerase chain reaction conditions were as follows: denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 30 seconds, and then polymerization at 72°C for 5 minutes. As a result, a polynucleotide of Pn_CglE03201,056 bp, including a 500 bp self-promoter (SEQ ID NO: 11) and a 100 bp terminator (SEQ ID NO: 12), was obtained. This fragment was ligated to pDC24-ΔNCgl1234down, which had been cut with No1I and XbaI, using T4 ligase (New England Biolab, Beverly, Ala.). The vector thus constructed was named pDC24-ΔNCgl1234down::Pn_CglE0320.

[0101] The sequences of the primers used in Example 1-1 are shown in Table 1 below:

[0102] Name Sequence (5'-> 3') Sequence number N1234down_AFctcggtacccggggatccTGGCGACTGCGCGTGCATTCSequence number 1 N1234down_ARCAAGCtctagagcggccgcGAGCCCGAAGCTCCCCGAAACSequence number 2 N1234down_BFGGGCTCgcggccgctctagaGCTTGTTGGCAATGTGAGCGSequence number 3 N1234down_BRgcatgcctgcaggtcgacACGTTGTCCAAGCCCACGSequence number 4 Pn_E0320_FCTTCGGGCTCgcggccgcATCGAAGAAACCTACGGSequence number 5 Pn_E0320_RCATTGCCAACAAGCtctagaAATCTTTGGTGCGCAGAATAAGSequence number 6

[0103] Example 1-2. Production of microorganisms with enhanced activity of monovalent cation / hydrogen antiporter subunit E through enhanced copy number of the CglE0320 gene.

[0104] The pDC24-ΔNCgl1234down::Pn_CglE0320 vector constructed in Example 1-1 was transformed into the CJ0230 strain (Korean Patent Publication No. 10-2023-0053545) deposited under the accession number KCCM13305P, which is a parent strain, by electroporation. Then, a strain in which the mutant gene and the vector were inserted together on the chromosome was selected as a primary candidate on a selection medium containing 25 mg / L of kanamycin. Thereafter, a second crossover process using the homology of the gene on the existing chromosome and the gene inserted through the vector was performed, thereby adding copies to the endogenous ΔNCgl1234down intergenic region on the chromosome, and obtaining a final strain in which the vector including the kanamycin resistance gene was removed. The strain with increased copy number was initially confirmed through PCR using the primer pair of SEQ ID NO: 7 and SEQ ID NO: 8, and then finally confirmed through genetic sequence analysis. The strain with enhanced Pn_CglE0320 obtained through the above method was named CJ0435.

[0105] The sequences of the primers used in Example 1-2 are shown in Table 2 below:

[0106] Name sequence (5'-> 3') Sequence number N1234down_CFGAGCCCGAACTACTTCATGGC Sequence number 7 N1234down_CRCAAGGCCGTTAAACCAGACAGGAATGC Sequence number 8

[0107] Example 1-3. Evaluation of L-alanine production by microorganisms with enhanced activity of monovalent cation / hydrogen antiporter subunit E.

[0108] To confirm the L-alanine productivity of Corynebacterium glutamicum CJ0435 obtained in the above Example 1-2, it was cultured as follows. The parent strain Corynebacterium glutamicum CJ0230 strain and the above Corynebacterium glutamicum CJ0435 strain were each inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium, and the culture was shaken at 200 rpm for 20 hours at 30°C to obtain a seed culture. Thereafter, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of the above production medium, and cultured at 30°C for 48 hours at 200 rpm to produce L-alanine.

[0109] After completion of cultivation, the amount of L-alanine produced was measured using liquid high-performance chromatography, and the amount of L-alanine produced in the culture medium for each strain tested was measured. The compositions of the seed medium and production medium are as follows, and the concentration of L-alanine in the culture medium for each strain tested is shown in Table 3 below.

[0110]

[0111] <Jongbaeji>

[0112] Glucose (anhydrous glucose) 20 g / L, Polypeptone 10 g / L, Yeast extract 10 g / L, (NH4)2SO410 g / L, Urea 1.5 g / L, KH2PO45.2 g / L, K2HPO410.7 g / L, d-Biotin 1.8 mg / L, Thiamine-HCl 9 mg / L, CAPA 9 mg / L, NCA 60 mg / L, MGSO4 0.5 g / L

[0113]

[0114] <Production medium>

[0115] CaCO330 g / L, Sucrose 57 g / L, BM 6 g / L, MgSO40.5 g / L, (NH4)2SO450 g / L, KH2PO41 g / L, Yeast extract 2 g / L, Ammonium acetate 6.28 g / L, d-Biotin 0.05 mg / L, Thiamine-HCl 0.1 mg / L, MnSO46.7 mg / L, FeSO410 mg / L

[0116] Evaluation of L-alanine productivity of Corynebacterium glutamicum CJ0435CJ0230 (parent strain)CJ0435L-alanine concentration (g / L)10.512.6

[0117] As a result, as shown in Table 3 above, the parent strain, Corynebacterium glutamicum CJ0230, produced L-alanine at a concentration of 10.5 g / L, but the Corynebacterium glutamicum CJ0435 strain produced L-alanine at a concentration of 12.6 g / L, confirming that L-alanine productivity increased by 120% compared to the parent strain.

[0118] From the above results, it was confirmed that the enhancement of the activity of the monovalent cation / hydrogen antiporter subunit E due to the enhanced expression of the CglE0320 gene increased the L-alanine production ability of microorganisms of the genus Corynebacterium.

[0119]

[0120] Above, each description and embodiment disclosed in this disclosure can also be applied to each other description and embodiment. All possible combinations of the various elements disclosed in this disclosure fall within the scope of the invention proposed in this disclosure. Furthermore, the scope of the invention proposed in this disclosure is not limited by the specific descriptions described below, and to the extent that a person skilled in the art recognizes or can ascertain numerous equivalents to the specific embodiments described in this disclosure, such equivalents are intended to be included in the invention proposed in this disclosure.

Claims

1. 1 Microorganisms that produce L-amino acids with enhanced activity of monovalent cation / H+ antiporter subunit E.

2. A microorganism producing L-amino acids according to claim 1, wherein the monovalent cation / hydrogen reverse transporter subunit E comprises an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO.

9.

3. In claim 1, the microorganism of the genus Corynebacterium is a microorganism that produces L-amino acids, into which a polynucleotide encoding the monovalent cation / hydrogen reverse transporter subunit E has been introduced.

4. A microorganism producing L-amino acids, wherein, in paragraph 3, the polynucleotide comprises a nucleic acid sequence having 90% or more sequence identity with the nucleic acid sequence of SEQ ID NO.

10.

5. In any one of claims 1 to 4, the microorganism producing L-amino acid is a microorganism of the genus Corynebacterium.

6. A microorganism that produces L-amino acid, wherein, in any one of claims 1 to 4, the L-amino acid is L-alanine.

7. A method for producing L-amino acid, comprising the step of culturing a microorganism of any one of claims 1 to 4 in a culture medium.

8. A method for producing L-amino acids according to claim 7, further comprising, after the culturing step, a step of recovering L-amino acids from the cultured microorganisms, the medium, or both.

9. A method for producing L-amino acids according to claim 7, wherein the microorganism is a microorganism of the genus Corynebacterium.

10. A method for producing L-amino acid according to claim 7, wherein the L-amino acid is L-alanine.

11. A composition for producing L-amino acid comprising a microorganism according to any one of claims 1 to 4.

12. A composition for producing L-amino acids, wherein the microorganism in claim 11 is a microorganism of the genus Corynebacterium.

13. A composition for producing L-amino acid, wherein, in paragraph 11, the L-amino acid is L-alanine.

14. Use of a microorganism according to any one of claims 1 to 4 for the production of L-amino acids.