Optimized nucleic acid molecule encoding a t-responder causing high sex ratio distortion

A nucleic acid molecule encoding a t-Responder with a specific sequence and promoter active during spermiogenesis optimizes sex chromosome transmission, addressing the challenge of undesired allele presence in offspring and improving breeding outcomes.

WO2026057190A1PCT designated stage Publication Date: 2026-03-19MAX PLANCK GESELLSCHAFT ZUR FOERDERUNG DER WISSENSCHAFTEN EV
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-06-16
Publication Date
2026-03-19

AI Technical Summary

Technical Problem

Existing technologies have not successfully optimized the transmission ratio of sex chromosomes in animal breeding, leading to undesired alleles being present in half of the offspring, causing significant economic and ethical issues.

Method used

A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) with a nucleotide sequence at least 65-95% identical to SEQ ID NO: 2, under the control of a promoter active during spermiogenesis, and codon optimized for mammalian cell expression, is used to enhance the transmission ratio of sex chromosomes.

Benefits of technology

The solution significantly improves the preference for male or female offspring, enhancing the practical and economic value of animal breeding by specifically expressing the t-Responder in mature spermatozoa to influence the sex distortion ratio.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000058_0000
    Figure 00000058_0000
  • Figure 00000058_0001
    Figure 00000058_0001
  • Figure 00000059_0000
    Figure 00000059_0000
Patent Text Reader

Abstract

The present invention relates to an optimized nucleic acid molecule encoding a Responder protein under the control of a promoter that is post-meiotically active during spermiogenesis, a host cell or non-human organism comprising the nucleic acid molecule as well as the production of a male or female transgenic non-human organism employing the nucleic acid molecule.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] New PCT-Application Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Vossius Ref.: AJ3152 PCT Optimized nucleic acid molecule encoding a t-Responder causing high sex ratio distortion The present invention relates to a nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 65%, preferably at least 80%, more preferably at least 90% and most preferably 95% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 65%, preferably at least 80%, more preferably at least 90% and most preferably at least 95% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. In this specification, a number of documents including patent applications and manufacturer’s manuals are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference. The observation of non-Mendelian inheritance in the mouse was a fortuitous discovery published in 1936. It was observed that the recessive “allele” of the T locus, t, is transmitted at an unusually high rate from T / t males to their offspring. Five decades of genetic analysis of the t “allele” revealed that the latter consists of a chromosomal region of some 40 Mb, now called t-haplotype. It contains several distorters and a Responder, which interact to achieve the high transmission ratio of the so-called t-haplotype. The protein kinase t-Responder (sperm motility kinase (SMOK)-(t complex responder) Tcr) encoded by the t complex responder gene causes non-Mendelian inheritance (Herrmann et al. (1999), Nature;402(6758):141-146). Males heterozygous for the t-haplotype form of mouse chromosome 17preferentially transmit the t-chromosome to their progeny. Several distorter / sterility loci carried on the t- haplotype together impair flagellar function in all spermatozoa whereas the responder, Tcr, rescues t- sperm but not wild-type sperm. Thus, t-sperm have an advantage over wild-type sperm in fertilizing egg cells. However, in the absence of t-distorter loci, the chromosome carrying Tcr may be transmitted at a low ratio (Lyon, M.F. (1984), Cell 37: 621-628; Herrmann et al. (1999), Nature; 402(6758):141-146). This advantage over wild-type sperm in fertilizing egg cells may be further optimized by providing a nucleic acid molecule encoding an improved t-Responder (SMOK-Tcr). Yet, attempts to provide such improved means were not successful in the past; see also appended examples. In animal breeding a particular genetic trait encoded by one but not the other allele of a gene locus is often preferred. However, the undesired allele is present in half of the offspring resulting in significant economic and ethical issues. The most prominent trait in livestock is the sex of the animal. This need for optimization of the transmission ratio of the sex chromosomes is addressed by the present invention. Accordingly, the present invention relates in a first aspect to a nucleic acid molecule encoding a t- Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 65%, preferably at least 80%, more preferably at least 90% and most preferably 95% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 65%, preferably at least 80%, more preferably at least 90% and most preferably at least 95% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. It is preferred that the following proviso applies to the nucleic acid molecule of the first aspect of theinvention: at least 250, preferably at least 300, more preferably at least 350 and most preferably all ofthe nucleotides that distinguish SEQ ID NO: 2 (Sequence2, codon-optimized) from SEQ ID NO: 1 (Sequence1, not codon optimized) in the following alignment are conserved (e.g. the second triplet is “CAA” as in SEQ ID NO: 2 and not “CAG”, noting that both triplets coding the amino acid Gln): Sequence1 1 ATGGAGAAATTTCATGCTCAATATGAGATGCTAGAGACTATTGGCCAGGGAGGCTGCGCC Sequence2 1 ATGGAAAAGTTCCACGCCCAGTACGAGATGCTGGAAACCATCGGCCAGGGCGGCTGCGCC ***** ** ** ** ** ** ** ******** ** ** ** ******** ********* Sequence1 61 CAGGTGAAGCTGGCCCGACACCGCCTCACAGGCACCCACGTGGCTGTCAAAGTGATTGTA Sequence2 61 CAGGTCAAACTGGCCAGACACAGACTGACCGGCACCCACGTGGCCGTGAAAGTGATTGTG ***** ** ****** ***** * ** ** ************** ** *********** Sequence1 121 AAGAGGGAGTGTTGGTTCAACCCTGTCATGTCTGAGGCAGAGTTACTGATGATGACCGAT Sequence2 121 AAGAGAGAGTGCTGGTTCAACCCCGTGATGAGCGAGGCCGAGCTGCTGATGATGACCGAC ***** ***** *********** ** *** ***** *** * ************** Sequence1 181 CATCCGAATATCATCTCTCTCCTTCAAGTCATTGAGACCAAGAAGAAAGTATACCTCATT Sequence2 181 CACCCCAACATCATCAGCCTGCTGCAGGTCATCGAGACAAAGAAAAAGGTGTACCTGATC ** ** ** ****** ** ** ** ***** ***** ***** ** ** ***** ** Sequence1 241 ATGGAGTTGTGCGAGGGTAAATCACTTTACCAACACATCCAAAATGCTGGCTACCTGCAG Sequence2 241 ATGGAACTGTGCGAGGGCAAGAGCCTGTACCAGCACATCCAGAACGCCGGCTACCTGCAA ***** ********** ** ** ***** ******** ** ** *********** Sequence1 301 GAGGATGAAGCACGCCCATTATTCAAGCAGCTCTTAAGTGCTATGAACTACTGCCACAAC Sequence2 301 GAAGATGAGGCCAGACCCCTGTTCAAGCAGCTGCTGAGCGCCATGAACTACTGCCACAAC ** ***** ** * ** * *********** * ** ** ****************** Sequence1 361 CAGGGTATAGTTCACAGGGACCTGACACCTGACAATATTATGGTAGAAAAAGATGGGAAA Sequence2 361 CAGGGAATTGTGCACAGAGACCTGACCCCCGACAACATCATGGTGGAAAAGGACGGCAAA ***** ** ** ***** ******** ** ***** ** ***** ***** ** ** *** Sequence1 421 GTGAAGATCATTGATTTTGGACTCGGCACCCAAGAGAAGCCAGGGCAAAACCACAACTTA Sequence2 421 GTGAAGATCATCGACTTCGGCCTGGGCACCCAAGAAAAGCCCGGCCAGAACCACAACCTG *********** ** ** ** ** *********** ***** ** ** ********* * Sequence1 481 TTCTGTGAGATTTACCCATTTAGTACTCCTGAGGTGCTCTTTAACAGACCCTATGATATG Sequence2 481 TTCTGCGAGATCTACCCCTTCAGCACCCCCGAAGTGCTGTTCAACAGACCCTACGACATG ***** ***** ***** ** ** ** ** ** ***** ** *********** ** *** Sequence1 541 CGCAAGATCGATGTGTGGGGTCTTGGAGTTGTGCTGTATTTTATGGTAACTGGAAAGATT Sequence2 541 AGAAAGATCGACGTGTGGGGCCTGGGCGTGGTGCTGTACTTCATGGTGACAGGCAAGATC * ******** ******** ** ** ** ******** ** ***** ** ** ***** Sequence1 601 CTGTTTGATACTGCCAGCGTAGAAAAGCTGCGAAAGCAAATTGTTGCAGAAAAGTGTTCT Sequence2 601 CTGTTCGACACCGCCAGCGTGGAAAAGCTGAGAAAGCAGATCGTGGCCGAGAAGTGCAGC ***** ** ** ******** ********* ******* ** ** ** ** ***** Sequence1 661 GTTCCCTGTAGACTGTCAGTAGAGCTCCAAGACCTGATTAGACTTTTAATGACGGACATC Sequence2 661 GTGCCCTGCAGACTGAGCGTGGAACTGCAGGACCTGATCAGACTGCTGATGACAGACATC ** ***** ****** ** ** ** ** ******** ***** * ***** ******Sequence1 721 CCCGAACTTAGGCCCACTGTTGCTGAAGTTATGGTGCATCCCTGGGTCACAGAAGGCTCASequence2 721 CCCGAGCTGAGGCCCACCGTGGCCGAAGTGATGGTGCACCCCTGGGTGACAGAGGGCAGC ***** ** ******** ** ** ***** ******** ******** ***** *** Sequence1 781 GGGGTGTTACCAGATCCTTGTGAAGAACATATACCCCTCAAGCCAGACCCTGCGATTGCA Sequence2 781 GGCGTGCTGCCTGACCCCTGCGAGGAACACATCCCCCTGAAGCCCGACCCCGCTATCGCC ** *** * ** ** ** ** ** ***** ** ***** ***** ***** ** ** ** Sequence1 841 AAAGCAATGGGATTTATCGGGTTCCAAGCTCAAGACATTGAAGATTCGTTATGTCAGAGA Sequence2 841 AAGGCCATGGGCTTCATCGGATTCCAGGCCCAGGACATCGAGGACAGCCTGTGCCAGAGA ** ** ***** ** ***** ***** ** ** ***** ** ** * ** ******Sequence1 901 AAATTCAACGAAACCATGGCATCTTATTGTCTACTGAAAAAACAGATTCTTAAGGAATGT Sequence2 901 AAGTTCAACGAGACAATGGCCAGCTACTGCCTGCTGAAGAAGCAGATCCTGAAAGAGTGC ** ******** ** ***** ** ** ** ***** ** ***** ** ** ** ** Sequence1 961 GACAGGCCAATCCGGGCTCAGCCCATGAATCCATCTGTGACCCCACTCTCTTCCCTTGTT Sequence2 961 GACAGACCCATCAGAGCCCAGCCCATGAACCCCAGCGTGACCCCCCTGAGCAGCCTGGTG ***** ** *** * ** *********** ** ******** ** *** **Sequence1 1021 GATGCTCCTACTTTCCATCTCGGACTTCGGAGGACAGAGACTGAACCCACAGGTCTCAGASequence2 1021 GACGCCCCTACATTCCACCTGGGCCTGAGAAGAACCGAGACAGAGCCCACCGGCCTGAGG ** ** ***** ***** ** ** ** * ** ** ***** ** ***** ** ** ** Sequence1 1081 TTATCTGACAATAAGGAAGTGCCTGTCTGTGGCAATAGTACTAGTAAGAAAAGAGAGAGASequence2 1081 CTGAGCGACAACAAAGAAGTGCCCGTGTGCGGCAACAGCACCAGCAAGAAGAGAGAGAGA* ***** ** ******** ** ** ***** ** ** ** ***** ********* Sequence1 1141 AGTTTCAGTGGGCCGGGTGTTCTCAGCAGGCCGATTAACACAACACCCACAATGGACCAA Sequence2 1141 AGCTTCAGCGGCCCAGGAGTGCTGAGCAGGCCCATCAACACCACCCCCACCATGGACCAG ** ***** ** ** ** ** ** ******** ** ***** ** ***** ********Sequence1 1201 ACACACACCCGTACTTGGAGTGGTCCCTGCATTTACTCAAATGTTTGCACAATCCATCCA Sequence2 1201 ACCCACACCAGAACTTGGAGCGGCCCCTGCATCTACAGCAACGTGTGCACCATCCACCCT ** ****** * ******** ** ******** *** ** ** ***** ***** ** Sequence1 1261 AACAGCATCAATGAGAGTACAGAAGGCCACATCAGTACCTCAGCAGAGGATAAGCCTGTC Sequence2 1261 AACAGCATCAACGAGAGCACCGAGGGCCACATCAGCACCAGCGCCGAGGACAAGCCCGTG *********** ***** ** ** *********** *** ** ***** ***** **Sequence1 1321 CACAGCAGAGGCTGGCCCAGAGGCATCAAGGGCTGGACTAGGAAGATAGGAAATGCAATGSequence2 1321 CACAGCAGAGGCTGGCCCAGAGGCATCAAGGGCTGGACCAGAAAGATCGGCAACGCCATG ************************************** ** ***** ** ** ** *** Sequence1 1381 AGGAAGCTCTGTTGCTGTATCCCATCCAAAGAGACATCTCACCTGGGGCAGAGAAGAGTCSequence2 1381 AGAAAGCTGTGCTGCTGCATCCCCAGCAAAGAGACAAGCCACCTGGGACAGCGGAGAGTG** ***** ** ***** ***** ********** ******** *** * ***** Sequence1 1441 TGCCCAAAAATTTAA Sequence2 1441 TGCCCCAAGATCTGA ***** ** ** * *SEQ ID NO: 2 (Sequence2) and SEQ ID NO: 1 (Sequence1) are t-Responder genes. The nucleotidesthat distinguish SEQ ID NO: 2 (Sequence2) from SEQ ID NO: 1 (Sequence1) are codon optimizations of the t-Responder gene. SEQ ID NO: 2 (Sequence2) and SEQ ID NO: 1 (Sequence1) both encode the t-Responder protein having the amino acid sequence of SEQ ID NO: 3. The following embodiments are also preferred: A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 65% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 65% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 80% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 65% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 90% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 65% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 95% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 65% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 65% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 80% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 80% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 80% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 90% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 80% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 95% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 80% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 65% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 90% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 80% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 90% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 90% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 90% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 95% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 90% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 65% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 95% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 80% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 95% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cell. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 90% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 95% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 95% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 95% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells. The term “nucleic acid molecule” in accordance with the present invention includes DNA, such as cDNA or double or single stranded genomic DNA and RNA derived from such DNA, i.e. RNA molecules carrying uracil in place of thymine in any of the mentioned DNA molecules. In this regard, "DNA" (deoxyribonucleic acid) means any chain or sequence of the chemical building blocks adenine (A), guanine (G), cytosine (C) and thymine (T), called nucleotide bases, that are linked together on a deoxyribose sugar backbone. DNA can have one strand of nucleotide bases, or two complementary strands which may form a double helix structure. "RNA" (ribonucleic acid) means any chain or sequence of the chemical building blocks adenine (A), guanine (G), cytosine (C) and uracil (U), called nucleotide bases, that are linked together on a ribose sugar backbone. RNA typically has one strand of nucleotide bases, such as mRNA. Included are also single- and double-stranded hybrids molecules, i.e., DNA- DNA, DNA-RNA and RNA-RNA. The nucleic acid molecule may also be modified by many means known in the art. Non-limiting examples of such modifications include methylation, "caps", substitution of one or more of the naturally occurring nucleotides with an analog, and internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.). Nucleic acid molecules, in the following also referred as polynucleotides, may contain one or more additional covalently linked moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalators (e.g., acridine, psoralen, etc.), chelators (e.g., metals, radioactive metals, iron, oxidative metals, etc.), and alkylators. The polynucleotides may be derivatized by formation of a methyl or ethyl phosphotriester or an alkyl phosphoramidate linkage. Further included are nucleic acid mimicking molecules known in the art such as synthetic or semi-synthetic derivatives of DNA or RNA and mixed polymers. Such nucleic acid mimicking molecules or nucleic acid derivatives according to the invention include phosphorothioate nucleic acid, phosphoramidate nucleic acid, 2’-O-methoxyethyl ribonucleic acid, morpholino nucleic acid, hexitol nucleic acid (HNA), peptide nucleic acid (PNA) and locked nucleic acid (LNA) (see Braasch and Corey, Chem Biol 2001, 8: 1). LNA is an RNA derivative in which the ribose ring is constrained by a methylene linkage between the 2’-oxygen and the 4’-carbon. Also included are nucleic acids containing modified bases, for example thio-uracil, thio-guanine and fluoro-uracil. A nucleic acid molecule typically carries genetic information, including the information used by cellular machinery to make proteins and / or polypeptides. The nucleic acid molecule of the invention may additionally comprise promoters, enhancers, response elements, signal sequences, polyadenylation sequences, introns, 5'- and 3'- non-coding regions, and the like.The nucleic acid molecule according to the invention encodes a t-Responder (SMOK-Tcr) of SEQ IDNO: 3. It is therefore preferred that the nucleic acid molecule of the invention is genomic DNA or mRNA. In the case of mRNA, the nucleic acid molecule may in addition comprise a poly-A tail. The term “protein” as used herein interchangeably with the term “polypeptide” describes linear molecular chains of amino acids, including single chain proteins or their fragments, containing at least 50 amino acids. The term “peptide” as used herein describes a group of molecules consisting of up to 49 amino acids. The term “peptide” as used herein describes a group of molecules consisting with increased preference of at least 15 amino acids, at least 20 amino acids at least 25 amino acids, and at least 40 amino acids. The group of peptides and polypeptides are referred to together by using the term "(poly)peptide". (Poly)peptides may further form oligomers consisting of at least two identical or different molecules. The corresponding higher order structures of such multimers are, correspondingly, termed homo- or heterodimers, homo- or heterotrimers etc.. Furthermore, peptidomimetics of such proteins / (poly)peptides where amino acid(s) and / or peptide bond(s) have been replaced by functional analogues are also encompassed by the invention. Such functional analogues include all known amino acids other than the 20 gene-encoded amino acids, such as selenocysteine. The terms “(poly)peptide” and “protein” also refer to naturally modified (poly)peptides and proteins where the modification is effected e.g. by glycosylation, acetylation, phosphorylation and similar modifications which are well known in the art. In accordance with the present invention, the term “percent (%) sequence identity” describes the number of matches (“hits”) of identical nucleotides / amino acids of two or more aligned nucleic acid or amino acid sequences as compared to the number of nucleotides or amino acid residues making up the overall length of the template nucleic acid or amino acid sequences. In other terms, using an alignment, for two or more sequences or subsequences the percentage of amino acid residues or nucleotides that are the same (e.g. 90% or 95% identity) may be determined, when the (sub)sequences are compared and aligned for maximum correspondence over a window of comparison, or over a designated region as measured using a sequence comparison algorithm as known in the art, or when manually aligned and visually inspected. This definition also applies to the complement of any sequence to be aligned. Nucleotide and amino acid sequence analysis and alignment in connection with the present invention are preferably carried out using the NCBI BLAST algorithm (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Nucleic Acids Res. 25:3389-3402). BLAST can be used for nucleotide sequences (nucleotide BLAST) and amino acid sequences (protein BLAST). The skilled person is aware of additional suitable programs to align nucleic acid sequences. As defined herein, sequence identities of at least 90% and preferably at least 95% are envisaged by the invention. However, also envisaged by the invention are with increasing preference sequence identities of at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100%. SEQ ID NO: 3 is the amino acid sequence of the mouse (Mus musculus) protein kinase t-Responder (sperm motility kinase (SMOK)-(t complex responder)Tcr) encoded by the mouse t complex responder gene. As discussed above, sperm cells that carry the t complex responder gene encoding SEQ ID NO: 3 and t-Distorter(s) (so-called t-sperm) have an advantage over wild-type sperm in fertilizing egg cells. However, Smok-Tcr alone (without t-Distorters) causes a disadvantage of sperm carrying it relative to wild-type sperm. For instance, in case the t-responder is in the Y chromosome of the sperm preferably female (X containing) sperm fertilizes the egg cell (female offspring preferred), and in case the t- responder is in the X chromosome of the sperm preferably male (Y containing) sperm fertilizes the egg cell (male offspring preferred). When the responder alone is present, the chromosome carrying it is transmitted in a low ratio. The distorters, if present, act additively, in cis or trans, to raise the transmission of whichever chromosome carries the responder; see Lyon et al. (1984), Cell, 37(2):621-628. Examples of distorters are described, for example, in Lyon et al. (1984), Cell, 37(2):621-628 , Bauer et al. (2005), Nature Genetics, 37: 969-973; Bauer et al. (2007), Genes Dev 21: 143-147; Bauer et al. (2012), PLoS Genetics 8: e1002567; Charron et al. (2019), PLoS Genetics 15: e1007964; and WO 2007 / 020026. The amino acid sequence being at least 65%, preferably at least 80%, more preferably at least 95% identical to SEQ ID NO: 3 and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 65%, preferably at least 80%, more preferably at least 90% and most preferably at least 95% identical thereto is required to have Responder function. This means that the protein having this amino acid sequence in sperm cells that carry this protein and t-Distorter(s) (so- called t-sperm) have an advantage over wild-type sperm in fertilizing egg cells and in sperm cells that carry this protein (but no t-Distorter(s)) cause a disadvantage of sperm carrying it relative to wild-type sperm. The nucleotide sequence comprising a nucleotide sequence being at least 65%, preferably at least 80%, more preferably at least 90% and most preferably at least 95% identical to SEQ ID NO: 2 preferably comprises or consists of a nucleotide sequence being at least 65%, preferably at least 80%, more preferably at least 90% and most preferably at least 95% identical to SEQ ID NO: 12. Similarly, the nucleotide sequence comprising SEQ ID NO: 2 preferably is a nucleotide sequence comprising orconsisting of SEQ ID NO: 12. As discussed above, SEQ ID NO: 2 is a codon optimized t-Respondergene. While SEQ ID NO: 2 comprises the open reading frame from the start to the stop codon (ATG […]TAA) encoding the t-Responder protein of SEQ ID NO: 3, SEQ ID NO: 12 in addition comprises a 5’- UTR and SEQ ID NO: 13 in addition a 5’-UTR, 3’-UTR and poly-A sequence. The above preferred proviso that at least 250, preferably at least 300, more preferably at least 350 and most preferably all of the nucleotides that distinguish SEQ ID NO: 2 (Sequence 2) from SEQ ID NO: 1 (Sequence1) are conserved means that out of all nucleotides that distinguish SEQ ID NO: 2 (Sequence2) from SEQ ID NO: 1 at least 250, preferably at least 300, more preferably at least 350 and most preferably all of the nucleotides remain unchanged as in SEQ ID NO: 2 in any nucleic acid moleculeencoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 and having or comprising the sequence of SEQID NO: 2 or a nucleotide sequence being at least 90% and preferably at least 95% identical thereto. In accordance with the first aspect the nucleic acid molecule is under the control of a promoter that is post-meiotically active during spermiogenesis. A promoter is a sequence of DNA to which proteins bind to initiate transcription of a RNA transcript from the DNA downstream of the promoter. The RNA transcript may encode a protein (mRNA), or can have a function in and of itself, such as tRNA or rRNA. Promoters are located near the transcription start sites of genes, upstream or the coding sequence (towards the 5' region of the sense strand). Promoters can be about 100–1000 base pairs long, the sequence of which is highly dependent on the gene and product of transcription, type or class of RNA polymerase recruited to the site, and species of organism. Spermiogenesis is the final stage of spermatogenesis, during which the spermatids develop into maturespermatozoa. Hence, the expression of the nucleic acid molecule according to the first aspect is inhaploid spermatids during spermiogenesis after meiosis I and II. Accordingly, the use of a promoter that is post-meiotically active during spermiogenesis ensures that the nucleic acid molecule according to the first aspect is specifically expressed during spermiogenesis, so that the encoded t-Responder (SMOK-Tcr) or protein with Responder function can act exclusively in the mature spermatozoa carrying the Responder to influence the sex distortion ratio. It can be taken from the appended examples that the preference for male or female offspring as achieved by a mouse t complex responder gene can surprisingly be significantly further improved by a promoter that is post-meiotically active during spermiogenesis. As explained, this technically advantageously ensures that the nucleic acid molecule according to the first aspect is specifically expressed during spermiogenesis, so that the encoded t-Responder (SMOK-Tcr) or protein with Responder function can act exclusively in the mature spermatozoa carrying the Responder to influence the sex distortion ratio. It can furthermore be taken from the appended examples that the preference for male or female offspring as achieved by the mouse original t complex responder gene of SEQ ID NO: 1 (encoded by the TgY2 gene in the examples) can surprisingly be further improved by the modified t complex responder gene of SEQ ID NO: 2 (encoded by TgY4 for Y chromosome gene integration and TgX2 for X chromosome gene integration in the examples). In this connection it is of note that the TgY4 / TgX2 gene results from codon-optimization of the open reading frame of Tcr, replacing rare codons by more frequently used codons and by avoiding the following sequence motifs: RNA instability motifs (e.g. AU rich elements (ARE’s)), strong secondary structures (“hairpin” or “stem loop” structures), repeat sequences, (cryptic) splice consensus sequences and premature poly-A sites. Although the codon-optimization did not change the protein kinase t-Responder (SMOK-Tcr) of SEQ ID NO: 3, the distortion ratio towards female offspring upon Y chromosome integration was influenced to a significantly larger extent by TgY4 (86% females; Fig.5d) as compared to TgY2 (65%, Fig.4f). Also the distortion ratio towards male offspring upon X chromosome integration was very high (TgX280% males; Fig. 5d). It is of further note that attempts were made by the inventors to optimize the protein kinase t-Responder (SMOK-Tcr) of SEQ ID NO: 3. The construct is named tgA in the examples. It can be taken from Fig.4e and Fig.5c that the mRNA expression level of the tgA gene was even higher than the expression level of TgY4, but surprisingly the distortion ratio towards non-transgenic offspring upon tgA integration was not much better by tgA (67% non-transgenic offspring; Fig.1d) as compared to the original TgY2 (65% female offspring, Fig. 4f). Surprisingly, the codon-optimized TgY4 gene works best although tgA is higher expressed. Hence, herein a solution to the problem of sex determination of offspring is provided by manipulating the sex ratio of offspring - a trait that in many breedings determines the practical and economic value of an animal. It is also of note that the transgenic mice are healthy and fertile; i.e. their genetic manipulation does not cause distress or suffering. This is shown in the appended examples for the produced male mice and there was no reason to assume that any of the produced females would suffer as a result of their genetic manipulation. In accordance with a preferred aspect of the present invention the nucleic acid molecule is comprised in a vector. The term “vector” in accordance with the invention means preferably a plasmid, cosmid, virus, bacteriophage or another vector used e.g. conventionally in genetic engineering which carries the nucleic acid molecule of the invention. The nucleic acid molecule of the invention may, for example, be inserted into several commercially available vectors. Non-limiting examples include prokaryotic plasmid vectors, such as of the pUC-series, pBluescript (Stratagene), the pET-series of expression vectors (Novagen) or pCRTOPO (Invitrogen) and vectors compatible with an expression in mammalian cells like pREP (Invitrogen), pcDNA3 (Invitrogen), pCEP4 (Invitrogen), pMC1neo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO-pSV2neo, pBPV-1, pdBPVMMTneo, pRSVgpt, pRSVneo, pSV2-dhfr, pIZD35, pLXIN, pSIR (Clontech), pIRES-EGFP (Clontech), pEAK-10 (Edge Biosystems) pTriEx-Hygro (Novagen) and pCINeo (Promega). Examples for plasmid vectors suitable for Pichia pastoris comprise e.g. the plasmids pAO815, pPIC9K and pPIC3.5K (all Invitrogen). Particularly preferred is the pSUPERIOR.puro vector as used in the appended examples. The nucleic acid molecules inserted into the vector can e.g. be synthesized by standard methods, or isolated from natural sources. Ligation of the coding sequences to transcriptional regulatory elements and / or to other amino acid encoding sequences can also be carried out using established methods. Transcriptional regulatory elements (parts of an expression cassette) ensuring expression in prokaryotes or eukaryotic cells are well known to those skilled in the art. These elements comprise regulatory sequences ensuring the initiation of transcription (e. g., translation initiation codon, promoters, such as naturally-associated or heterologous promoters and / or insulators; see above), internal ribosomal entry sites (IRES) (Owens, Proc. Natl. Acad. Sci. USA 98 (2001), 1471-1476) and optionally poly-A signals ensuring termination of transcription and stabilization of the transcript. Additional regulatory elements may include transcriptional as well as translational enhancers. Preferably, the polynucleotide encoding the Responder is operatively linked to such expression control sequences allowing expression in prokaryotes or eukaryotic cells. The vector may further comprise a 5’-UTR ensuring or facilitating gene expression. Such sequences are well known to the person skilled in the art. Furthermore, depending on the expression system used, leader sequences capable of directing the expressed polypeptide to a cellular compartment may be added to the coding sequence of the polynucleotide of the invention. Such leader sequences are well known in the art. An expression vector according to this invention is capable of directing the replication, and the expression, of the polynucleotide and encoded peptide or fusion protein of this invention. Apart from introduction via vectors such as phage vectors or viral vectors (e.g. adenoviral, retroviral), the nucleic acid molecules as described herein above may be designed for direct introduction or for introduction via liposomes into a cell. Additionally, baculoviral systems or systems based on vaccinia virus or Semliki Forest virus can be used as eukaryotic expression systems for the nucleic acid molecules of the invention. Yet further, homologous recombination or Crispr-Cas mediated genomic integration vectors are envisioned herein. In accordance with a preferred embodiment of the first aspect of the present invention the promoter is the promoter of the mouse cysteine-rich perinuclear theca 1 (Cypt1) gene, the promoter of the mouse A-kinase anchoring protein 4 (Akap4) gene, the promoter of the cow Akap4 gene, or a promoter of a mouse gene selected from 1700008I05Rik, 4930453H23Rik, 4930557A04Rik, 4933400A11Rik, 4933436I01Rik, Arl13a, Asb9, Cpxcr1, Ctag2, Cypt2, Cypt, Fam122c, Gm14781, Gm614, Gm6760, Hypm, Ppp1r2-ps9, Satl1, Tmsb15a, Tsga8 and Zcchc13. The promoter of the mouse cysteine-rich perinuclear theca 1 (Cypt1) gene, the promoter of the mouse A-kinase anchoring protein 4 (Akap4) gene, the promoter of the cow Akap4 gene, or a promoter of a mouse gene selected from 1700008I05Rik, 4930453H23Rik, 4930557A04Rik, 4933400A11Rik, 4933436I01Rik, Arl13a, Asb9, Cpxcr1, Ctag2, Cypt2, Cypt, Fam122c, Gm14781, Gm614, Gm6760, Hypm, Ppp1r2-ps9, Satl1, Tmsb15a, Tsga8 and Zcchc13 are non-limiting but preferred examples of promoters for the specific expression of the nucleic acid molecule of the invention during spermiogenesis. Among this list the promoter of the mouse cysteine-rich perinuclear theca 1 (Cypt1) gene, the mouse A- kinase anchoring protein 4 (Akap4) gene, or the cow Akap4 gene are preferred since these promoters are illustrated by the appended examples. AKAP4 is involved in the intracellular signalling of protein kinase A. CYPT1 is a basic cysteine-rich sperm protein family that may contribute to the function of the postacrosomal perinuclear theca (PT) during nuclear shaping. As shown in the appended examples, the gene expression via the Tcr promoter of TgA on the X and Y chromosome (Fig.2b) can be further increased by using instead of the Tcr promoter the Cypt1 or Akap4 promoter (Fig.4e, 5c). The same will hold true for the other promoters according to the above preferred embodiment. In accordance with another preferred embodiment of the first aspect of the present invention, the nucleic acid molecule further comprises an enhancer favoring the specific expression of said nucleic acid molecule during spermiogenesis, wherein the enhancer is preferably the enhancer of Cypt1. An enhancer is a short (for example, 50–3000 bp) region of DNA that can be bound by proteins (activators) to increase the likelihood that transcription of a particular gene will occur. These proteins are usually referred to as transcription factors. Enhancers are cis-acting. They can be located up to 1 Mbp (1,000,000 bp) away from the gene, upstream or downstream from the transcription start site. The use of an enhancer favoring the specific expression of said nucleic acid molecule during spermiogenesis further ensures that the improved t-responder gene of the invention is specifically expressed during spermiogenesis, so that the encoded t-Responder (SMOK-Tcr) can act in the mature spermatozoa to influence the sex distortion ratio. The enhancer is preferably the enhancer of Cypt1 as illustrated by appended examples. The expression of the t-responder gene can be placed under the control of an enhancer by cloning an enhancer upstream of the gene. In accordance with a more preferred embodiment of the first aspect of the present invention, the promoter of the mouse Cypt1 gene comprises or consists of SEQ ID NO: 4 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto, the promoter of the mouse Akap4 gene comprises or consists of SEQ ID NO: 5 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto, and / or the promoter of the cow Akap4 gene comprises or consists of SEQ ID NO: 6 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto. It is understood that each of the deviating sequences retain fully or essentially (above 90%) the promoter function which can be tested by methods known in the art. In accordance with another more preferred embodiment of the first aspect of the present invention the enhancer of Cypt1 comprises or consists of SEQ ID NO: 7 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto. It is understood that each of the deviating sequences retain fully or essentially (above 90%) the enhancer function which can be tested by methods known in the art. The sequences of the mouse Cypt1 gene promoter of SEQ ID NO: 4, the mouse Cypt1 enhancer of SEQ ID NO: 7 and of the mouse Akap4 gene promoter of SEQ ID NO: 5 are used in the appended examples. The cow Akap4 gene promoter of SEQ ID NO: 6 is the cow ortholog of SEQ ID NO: 5. The present invention relates in a second aspect to a host cell or non-human organism comprising the nucleic acid molecule of the first aspect.The definitions and preferred embodiments of the first aspect of the invention apply mutatis mutandis tothe second aspect of the invention as far as being amenable with the second aspect. The term "host cell" means any cell of any organism that is selected, modified, transformed, grown, or used or manipulated in any way, for the expression of the nucleic acid molecule of the first aspect. The host cell of the invention is typically produced by introducing the nucleic acid molecule or vector(s) of the invention into the host cell which upon its / their presence mediates the expression of the nucleic acid molecule of the invention encoding the Responder. The host from which the host cell is derived or isolated may be any prokaryote or eukaryotic cell or organism, preferably with the exception of human embryonic stem cells that have been derived directly by destruction of a human embryo. The host cell may be a mammalian host cell, such as a Chinese Hamster Ovary (CHO) cell, mouse myeloma lymphoblastoid, human embryonic kidney cell (HEK-293), human embryonic retinal cell (Crucell's Per.C6), or human amniocyte cell (Glycotope and CEVEC). The cells are frequently used in the art to produce recombinant proteins. CHO cells are the most commonly used mammalian host cells for industrial production of recombinant protein therapeutics for humans. Also the non-human organism is preferably a mammal.In a preferred embodiment the host cell is an embryonic cell, oocyte, zygote, or fibroblast. The embryoniccell, oocyte, zygote is preferably a non-human embryonic cell, oocyte, zygote. The non-human organism means any organism other than human that is selected, modified, transformed, grown, or used or manipulated in any way, for the expression of the nucleic acid molecule of the first aspect. Preferred examples of non-human organisms will be provided herein below. In accordance with a preferred embodiment of the second aspect of the present invention the nucleic acid molecule is in the genome of the host cell or non-human organism. Means and methods for introducing the nucleic acid molecule into the genome of the host cell or non- human organism are known in the art. For instance, CRISPR-Cas (e.g Cas 9 or Cpf1), a meganuclease, a zinc finger nuclease, a transcription activator-like (TAL) effector (TALE) nuclease, or Bridge RNAs (Durrant et al. (2024), Nature, 630:984–993) may be used. Among these options CRISPR-Cas is preferred. In accordance with a more preferred embodiment of the second aspect of the present invention the nucleic acid molecule is comprised in the Y-chromosome or the X-chromosome of the host cell or non- human organism, preferably at a location that is euchromatic during spermiogenesis. As discussed above, in case the t-responder is in the Y-chromosome of the sperm preferably female sperm fertilizes the egg cell (female offspring preferred), and in case the t-responder is in the X chromosome of the sperm preferably male sperm fertilizes the egg cell (male offspring preferred). However, in case the t-Distorter(s) are expressed in parallel in sperm the opposite outcome occurs: in case the t-responder is in the Y-chromosome of the sperm preferably male sperm fertilizes the egg cell (male offspring preferred), and in case the t-responder is in the X chromosome of the sperm preferably female sperm fertilizes the egg cell (female offspring preferred). Hence, by introducing the nucleic acid molecule into the Y-chromosome preferably non-transgenic female offspring or transgenic male offspring can be generated, and by introducing the nucleic acid molecule into the X-chromosome preferably non-transgenic male offspring or transgenic female offspring can be generated, depending on whether the t-Distorter(s) are not or are expressed in parallel, respectively. The use of a genomic location that is euchromatic during spermiogenesis ensures that the t-responder gene can be accessed by the transcriptional machinery of the host cell or non-human organism. Euchromatin (also called "open chromatin") is a lightly packed form of chromatin (DNA, RNA, and protein) that is enriched in genes, and is generally under active transcription. Euchromatin stands in contrast to heterochromatin, which is tightly packed and less accessible for transcription. In accordance with an even more preferred embodiment of the second aspect of the present invention the nucleic acid molecule is comprised in the Y-chromosome upstream of the zinc finger protein 2, Y- linked (Zfy2) gene, and preferably within SEQ ID NO: 8 or 9 of the bull genome or SEQ ID NO: 10 of the sheep genome. In accordance with another even more preferred embodiment of the second aspect of the present invention the nucleic acid molecule is comprised in the X-chromosome downstream of the A-kinase anchoring protein 4 (Akap4) gene and preferably within SEQ ID NO: 11 of the cow or bull genome. The above preferred sites for integration into the Y-chromosome and the X-chromosome are euchromatic during spermiogenesis. The integration sites in the bull genome (SEQ ID NOs 8 or 9 or 11) or sheep genome (SEQ ID NO: 10) are particularly preferred since the determination of the sex of cows and sheep is of particular commercial interest. For instance, bulls are preferred for meat production while cows are needed for milk production. In accordance with another preferred embodiment of the second aspect of the present invention the host cell is a haploid cell, preferably a sperm cell such as a spermatocyte, spermatid or spermatozoon. A haploid cell is a cell having a single set of chromosomes in contrast to diploid cells having a double set of chromosomes. In mammals the egg and sperm cells are haploid. The sperm cell is preferably a spermatocyte, spermatid or spermatozoon. Spermatocytes are a type of male gametocytes in animals. They derive from immature stem / progenitor germ cells called spermatogonia. They are found in the testis, in a structure known as the seminiferous tubules. There are two types of spermatocytes, primary and secondary spermatocytes. Primary and secondary spermatocytes are formed through the process of spermatocytogenesis. Primary spermatocytes are diploid (2N) cells. After meiosis I, two secondary spermatocytes are formed. Secondary spermatocytes are generally described as haploid (1N) cells that contain half the number of chromosomes; see textbook “Quantitative Human Physiology”, ISBN 978-0-12-382163-8. Hence, the preferred embodiment is the spermatid. The spermatid is the haploid male gametid that results from division of secondary spermatocytes. As a result of meiosis, each spermatid contains one set of chromosomes (1N).A spermatozoon is a motile sperm cell, or moving form of the haploid cell that is the male gamete. Aspermatozoon joins an ovum to form a zygote. A zygote is a single cell, with a complete set of chromosomes, that normally develops into an embryo. The present invention relates in a third aspect to a method for the production of a male transgenic non- human organism comprising introducing the nucleic acid molecule of the first aspect into the Y- chromosome at a location that is euchromatic during spermiogenesis, wherein the location is preferably upstream of the Zfy2 gene of a germ cell, embryonic cell or an egg cell or a cell derived therefrom.The definitions and preferred embodiments of the first and second aspect of the invention apply mutatismutandis to the third aspect of the invention as far as being amenable with the third aspect. In accordance with preferred embodiment of the third aspect of the present invention the location is upstream of the zinc finger protein 2, Y-linked (Zfy2) gene, and preferably within SEQ ID NO: 8 or 9 of the bull genome or SEQ ID NO: 10 of the sheep genome. The present invention relates in a related fourth aspect to a method for the production of a male or female transgenic non-human organism comprising introducing the nucleic acid molecule of the first aspect into the X-chromosome at a location that is euchromatic during spermiogenesis, preferably downstream of the Akap4 gene of a germ cell, embryonic cell or an egg cell or a cell derived therefrom.The definitions and preferred embodiments of the first and second aspect of the invention apply mutatis mutandis to the fourth aspect of the invention as far as being amenable with the fourth aspect. In accordance with a preferred embodiment of the third aspect of the present invention the location is downstream of the A-kinase anchoring protein 4 (Akap4) gene and preferably within SEQ ID NO: 11 of the cow or bull genome. In accordance with preferred embodiment of the second, third and fourth aspect of the present invention the non-human organism is a mammal, preferably a rodent, a rabbit or a farm animal, wherein the rodent is preferably mouse or rat, and the farm animal is preferably cow, pig, sheep, camel, goat or horse. The most preferred rodent is mouse, because the wild-type t-responder gene can naturally be found in mouse. The appliance of the second, third and fourth aspect of the present invention to farm animals is of particular interest, because depending on the needs either male or female offspring might be preferred. As mentioned, for instance, bulls are preferred for meat production while cows are needed for milk production. Since the desired transmission ratio distortion has now been achieved using the mouse model as a proof-of-principle, the same strategy can now be employed by the skilled person to change the transmission ratio also in other mammals of interest, in particular in farm animals. Related to the above also the non-human host cell is preferably a mammalian cell, preferably a rodent cell, a rabbit cell or a farm animal cell, wherein the rodent cell is preferably a mouse or rat cell, and the farm animal cell is preferably a cow, pig, sheep, camel, goat or horse cell. The present invention relates in a fifth aspect to semen obtained or obtainable from the non-human organism of the second aspect.The definitions and preferred embodiments of the first to fourth aspect of the invention apply mutatismutandis to the fifth aspect of the invention as far as being amenable with the fifth aspect. Also in this connection the non-human organism is preferably a mammal and more preferably a rodent, a rabbit or a farm animal, wherein the rodent is preferably mouse or rat, and the farm animal is preferably cow, pig, sheep, camel, goat or horse. Semen, also known as seminal fluid, is a bodily fluid that contains spermatozoa. Spermatozoa are secreted by the male gonads (sexual glands) and other sexual organs of male or hermaphroditic animals and can fertilize the female ovum. In case the spermatozoa in the semen comprise the nucleic acid molecule of the first aspect in the X- chromosome at a location that is euchromatic during spermiogenesis without distorters then preferably male offspring is obtained while in case the spermatozoa in the semen comprise the nucleic acid molecule of the first aspect in the Y-chromosome at a location that is euchromatic during spermiogenesis then preferably female offspring is obtained. In case the spermatozoa in the semen comprise the nucleic acid molecule of the first aspect in the X-chromosome at a location that is euchromatic during spermiogenesis with distorters then preferably female offspring is obtained while in case the spermatozoa in the semen comprise the nucleic acid molecule of the first aspect in the Y-chromosome at a location that is euchromatic during spermiogenesis with distorters then preferably male offspring is obtained. The preferred X-chromosome and Y-chromosome integration sites as described herein above are also preferred integration sites in connection with the fifth aspect of the invention. As regards the embodiments characterized in this specification, in particular in the claims, it is intended that each embodiment mentioned in a dependent claim is combined with each embodiment of each claim (independent or dependent) said dependent claim depends on. For example, in case of an independent claim 1 reciting 3 alternatives A, B and C, a dependent claim 2 reciting 3 alternatives D, E and F and a claim 3 depending from claims 1 and 2 and reciting 3 alternatives G, H and I, it is to be understood that the specification unambiguously discloses embodiments corresponding to combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; C, E, G; C, E, H; C, E, I; C, F, G; C, F, H; C, F, I, unless specifically mentioned otherwise. Similarly, and also in those cases where independent and / or dependent claims do not recite alternatives, it is understood that if dependent claims refer back to a plurality of preceding claims, any combination of subject-matter covered thereby is considered to be explicitly disclosed. For example, in case of an independent claim 1, a dependent claim 2 referring back to claim 1, and a dependent claim 3 referring back to both claims 2 and 1, it follows that the combination of the subject-matter of claims 3 and 1 is clearly and unambiguously disclosed as is the combination of the subject-matter of claims 3, 2 and 1. In case a further dependent claim 4 is present which refers to any one of claims 1 to 3, it follows that the combination of the subject-matter of claims 4 and 1, of claims 4, 2 and 1, of claims 4, 3 and 1, as well as of claims 4, 3, 2 and 1 is clearly and unambiguously disclosed. The Figures show: Figure 1 An autosomal t complex responder (Tcr)-transgene integrated near Smok2b causes targeted non- Mendelian chromosome transmission. Structure of TgA construct and landing site near Smok2b (a); b) TgA expression identified by in situ hybridization of testis sections, or by qPCR (c). d) TRD observed in offspring of TgA / 0 males (33% carry TgA) Figure 2 Tcr transgenes on the sex chromosomes show low expression and fail to cause sex ratio distortion. Structure of transgenes TgY1 and TgX1 using the Smok-Tcr promoter (same as TgA in Fig. 1a, but integrated on Y or X chromosome); b) qPCR data showing much lower expression of TgY1 and TgX1 in comparison to TgA on autosome (Fig.1) or to Smok-Tcr expressed from the endogenous t-haplotype responder gene; c) transmission test showing lack of TRD for both Tg-lines. Figure 3 Akap4 and Zfy2 are expressed and active post-meiotically. Screen shots of the H3K27ac signatures and expression profiles of Zfy2 (a) and Akap4 (b) in post-partum testes indicate up-regulation from d24 on and identify activated enhancers and nearby regions used for defining landing sites for transgene constructs (LS-Zfy2 on Y, LS-Akap4 on X chromosome). Figure 4 Structure, expression and transmission rates of the Y-chromosomal Tcr-transgenes tgY2 and tgY3. The Cypt1 promoter and Cypt1 enhancer were identified by ChIP-seq and RNA-seq data mapping (a); b) structure of TgY2 and (c) TgY3 using the Cypt1 promoter alone or in combination with the Cypt1 enhancer for control of Tg expression. Analysis of Tg expression by in situ hybridization of testis sections (d) or qPCR (e); both TgY and TgY3A are lower expressed than autosomal TgA or Smok-Tcr, but much higher than TgY1 or TgX1 (f) Analysis of TRD effect in offspring from males carrying the Tg as indicated alone or in addition distorters encoded on the t-haplotype th51-th18 on chromosome 17. All Tg lines show significant sex ratio distortion. Figure 5 Highly efficient sex ratio distortion by tgY4 and tgX2. Cypt1-promoter with (TgY4) or without (TgX2) Cypt1 enhancer were utilized to drive the expression of an improved Tg cassette integrated in LS-Zfy2 (TgY4) or LS-Akap4 (TgX2) (a). Detection of TgY4 expression by in situ hybridization of testis sections (b) or qPCR of testis RNA (c) compared to autosomal TgA and endogenous Smok-Tcr. The expression level of TgY4 is comparable to that of TgY2. (d) High-level sex ratio distortion in favor of non-transgenic offspring exceeding the distortion effect of TgY2 (Fig.4f) is observed in descendants of Tg / 0 males from both lines. Figure 6 Identification of landing sites on the cow X and bull / sheep Y chromosome. (a) H3K27ac signatures on cow X chromosome downstream of AKAP4; the blue vertical bar indicates the landing site between conserved regions F-G in mouse. (b) Examples of genes expressed in testis of a young and a mature bull located on the Y chromosome. ZRSR2Y was chosen for selecting possible landing sites. (c) H3K27ac signatures and sequence conservation between bull and sheep regions on Y chromosome; the blue vertical bars indicate conserved Regions 1 and 2 selected as landing sites for a responder transgene. The examples illustrate the invention. Example 1 - Materials and Methods Transgenes (Tg) TgA contains the promoter of Smok-Tcr and its 5’-utr, followed by the coding sequence of a 6x myc-tag, the Smok catalytic domain, Tcr regulatory domain, a 3’-utr and the SV40 poly-A signal [1] [2]. We PCR- amplified this construct and cloned it into a homology region 3’ of the Smok2b gene. We generated TgX1 by transfer of the TgA expression cassette into a homology region of a region adjacent to Akap4. For TgY1, integration of the TgA expression cassette close to the Zfy1 gene was performed in a 2-step process, first integrating by homologous recombination a “landing site” modified from [3]. To integrate the TgA sequence, we performed cassette exchange using Flp recombinase essentially as described [3]. To obtain TgY2 we cloned a 1005 bp promoter fragment of the Cypt1-promoter upstream of the 5’-utr and coding sequence of Tcr-t6 [1]. We attached the 3’-utr of Tcr and a SV40 poly-A signal and flanked the construct with homology regions for integration in the vicinity of the Zfy2 gene. TgY3 is identical to TgY2 but carries in addition a putative enhancer sequence for Cypt1, identified by ChIP-seq analyses (see below). We PCR-amplified the enhancer sequence by PCR and inserted it 5’ of the Cypt1 promoter (Fig. 4c). In TgY4 and TgX2 we fully codon-optimized the open reading frame of Tcr, replacing rare codons by more frequently used codons avoiding the following sequence motifs: RNA instability motifs (e.g. AU rich elements (ARE’s)), strong secondary structures (“hairpin” or “stem loop” structures), repeat sequences, (cryptic) splice consensus sequences and premature poly-A sites. Information on sequence elements, integration sites and -strategies, screening and analysis are listed in Example 2, Table 1. Embryonic Stem Cell (ESC) Culture, Genetic Engineering and Genomic Analysis We carried out ESC culture of G4-F1 hybrid ES cells (obtained from A. Nagy) [4] on mitotically inactivated embryonic fibroblasts according to standard procedures [5]. We integrated transgenic constructs via homologous recombination, stimulated by Crispr / CAS mediated DNA cleavage. Guide RNA sequences were designed using CRISPOR (http: / / crispor.tefor.net / ) [6]. Oligonucleotides were annealed and ligated into the pX330 vector digested with BpiI. (pX330-U6- Chimeric_BB-CBh-hSpCas9 plasmid [7], obtained from Feng Zhang (Addgene plasmid #42230; http: / / n2t.net / addgene:42230; RRID:Addgene_42230). We plated ESCs at a density of 150,000 to 200,000 cells per 12-well plate and carried out transfection using Lipofectamine 2000 according to the manufacturer’s recommendation. We co-transfected 3-10 µg of transgenic construct, 1.5 µg of each guide RNA sequence cloned in px330 and 300 ng of pSUPERIOR.puro plasmid (novoprolabs). 3 to 5 hours after applying transfection reagents we trypsinized the transfected cells and plated them on 6 cm dishes (ratio of about 1:9). We started selection 24 hours later using 2 µg / ml of puromycin for 2 days and 1 µg / ml of puromycin for one day. We picked ESC clones about one week after transfection, and re-plated the cells after trypsinization on 96-well plates with (gelatin coated with 0.1% porcine gelatin Sigma Aldrich, cat. G1393-20ml). After 2 - 4 days we froze ESC aliquots and replica-plated them on gelatinized 96-well plates without embryonic fibroblasts allowing them to grow to high density for additional 3 to 5 days. After lysis and DNA isolation which we carried out as described [5], we digested the ESC genomic DNA over-night with the appropriate restriction enzymes (Table 1). To analyze integration of the transgenes, we carried out PCR or genomic Southern blot analysis using either isotopically labelled or DIG labelled probes (Table 1). After agarose gel electrophoresis we denatured the genomic DNA in gel by alkaline treatment (1.5 M NaCl, 0.5 N NaOH). For hybridization with DIG-labeled probes we then neutralized the gel in 0.5 M Tris pH8, 1.5 M NaCl and then transferred the DNA by capillary blotting using high salt transfer with 20x SSC on a Hybond XL or Hybond N+ membrane (cat. XL RPN 303S and N+ RPN303B respectively). For isotopically labelled probes we used alkaline transfer to these membranes with 0.4M NaOH. After transfer over-night we rinsed the blot in 50 mM sodium phosphate, pH 6.8, and then either UV- crosslinked the DNA (Stratalinker, programme “auto-crosslink”) or immobilized the DNA to the membrane by heating (baking) to 80 °C for 2 hours. We generated isotopically labelled probes using the Random Primed DNA Labeling Kit (Sigma Aldrich / Roche) cat.11004760001. Alternatively, we labelled probes non-isotopically using the PCR DIG Probe Synthesis Kit, (Sigma Aldrich / Roche) cat. 11636090910 according to the manufacturer’s recommendation. We rinsed the membrane in 50 mM sodium phosphate, pH 6.8 and pre-hybridized in Church hybridization buffer (300 mM sodium phosphate, pH 6.8, 7% SDS, 10 mM EDTA). The heat- denatured probe was chilled on ice and mixed in Church buffer (to about 1 x 106cpm / ml for isotopic probes, or to 15 ng / ml for DIG probes). Hybridization was carried out over-night at 65 °C in a sealed plastic bag. After hybridization we washed the blot 3 times for 20 minutes each with Church wash buffer (40 mM sodium phosphate, pH 6.8, 1% SDS) at 65 °C. When hybridized to isotopic probes, we then wrapped the blot in plastic foil and exposed it to a phosphoimaging screen (Fujifilm Imaging plate BAS- MS 2340) at -80 °C for 1 - 2 days. We then developed the image on a phoshpoimager (FLA-5000 imaging system, (Fujifilm) Mode: V, Gradation: 16 bit, Resolution: 100, scanning area: IP size). For detection of DIG-probes, we washed the membrane with DIG1 solution (1 x maleic acid buffer (MAB) with 0,3% Tween) and then incubated the membrane in DIG2 blocking solution (DIG1 solution with 5% skim milk powder) for 30 min. We then incubated the membrane for 30 min with anti-DIG antibody diluted 1:20,000 in blocking solution followed by 2 washes in DIG1 solution for 20 min each and 1 wash with DIG3 solution (100 mM Tris, pH 9.5, 100 mM NaCl) for 5 minutes. We covered the membrane with CDPstar solution (Sigma Aldrich / Roche), removed excess liquid and exposed the blot in a peqlab, Fusion SL Advance imaging device: We analyzed image files obtained from the phosphoimager or DIG-antibody staining with Photoshop (Adobe) for the presence of bands expected for successful integration, the absence of extra bands and disappearance of the wild-type band if a locus on the (hemizygous) sex chromosomes was targeted. We confirmed correct, single copy integration of the transgenes by Southern blotting of ES-cell clones using external genomic- or transgene specific probes respectively. Alternatively, we verified single copy integration in breedings. If required, an undesired transgene copy was crossed out. After expansion of Southern-blot positive clones we performed full-length PCR amplification of the integrated transgene using Prime STAR GXL DNApolymerase (TAKARA) with primers outside the integration site (Table 1) and sequenced the PCR product of the integrated transgene. Information on plasmids, integration strategies, screening and analysis is in Table 1. Generation, Husbandry and Transmission Test of Mouse Lines We expanded correctly targeted ESC clones from frozen 96-well plates to 3,5 cm dishes, froze stocks and, after confirming the sequence of the transgene insertion by PCR (see above), used the clone for ESC aggregation with diploid morulae in the transgenic facility of the MPIMG [8]. Mouse lines were established by backcrossing to C57BL / 6J. All animal procedures were in accordance with institutional, state, and government regulations (LAGeSo Berlin, animal licenses G0243 / 18 and G0098 / 23 for aggregation experiments and G0309 / 18 (and G0186 / 23) for G0 animals and the resulting mouse lines). To determine sex ratio and transgene transmission ratio from the transgenic lines, transgenic males were mated with wild-type females. In the mornings of the following days, females were checked for copulatory plugs and, if plug-positive and pregnant, were sacrificed at 13.5 days after conception. Biopsies of embryos were lysed in Laird’s buffer [9]. If possible, we used genotyping-PCRs specific for each transgenic line to be able to detect any mix-up of animals. In some cases, for autosomal transgenes we used dot-blot, hybridizing first with a transgene specific probe and, as a loading control with a genomic probe in the Col1A1 locus. We performed statistical tests of the observed transgene transmission rate from autosomal transgenes, by assuming an identical number of offspring, assuming the transmission to be 50%. We also compared to breeding data of a transgene that showed no expression. For transgenes integrated on the sex chromosome, comparison was made with breeding data from wild type males or males bearing an autosomal transgene on a comparable genetic background. For G0 animals the distribution was 222 males, 218 females (50.45% males) for N1 and N2 backcross generation with C57BL / 6J, the distribution was 278 males and 264 females (51,29% males) These sex ratio data were not significantly different between control G0 chimeric animals, N1 and N2 animals. Transgene Expression Test Before establishing and breeding the line, a G0 chimeric male was used for a transgene expression test. We euthanized sexually mature males by CO2 asphyxiation (GasDocUnit, Medres) and isolated both testes. We froze one testis on a hand-made aluminum foil cup floating on a dry-ice isopropanol bath. Approximately 1 / 5 of this testis was used for RNA-isolation, the remaining tissue was stored at -80°C. We cut open the tunica albuginea of the other testis and fixed it in 12 ml 4% paraformaldehyde (PFA) dissolved in PBS, pH 7.4, at 4°C over-night with slight agitation. After 2 washes with PBS and 1 wash in 70% ethanol the testis was dehydrated in an alcohol series and, after equilibration in xylol, transferred to paraffine using a spin tissue processor STP-120 (Thermo Scientific, Program (with slight agitation): 70% ethanol for 2 hours, 70% ethanol for 1 hour 50 min, 80% ethanol for 1 hour 40 min, 90% ethanol for 2 hours, 96% ethanol for 2 hours, 3 times (100% ethanol for 1 hour), 2 times (xylol for 1 hour), 2 times (paraffine for 2 hours)). Thereafter, the testis was mounted in a paraffin block on an embedding station (Microm, EC350-1) at 65°C. Solidified paraffin blocks were trimmed and 7 µm testis sections were cut on a microtome (Microm International HM 355S) and placed on Superfrost Plus glas slides (Thermo Scientific). Paraffin blocks and slides were stored at 4°C. After deparaffination (1 hour at 60°C followed by 2 x 5 minutes washes in xylol, and 2 washes for 1 min each in 100% ethanol), we used sections for in situ hybridization with probes shown in Table 1 by RNAscope 2.0 HD Detection Kit(Brown) ACD, Bio-Techne) as suggested by the manufacturer except for a longer incubation step inAmp5 solution (60 min instead of 30 min). Staining times were up to 2 hours and adjusted according to signal strength. HE counterstaining was omitted. Slides were mounted with Entellan (Merck). Stainings were photographed on an Axio Observer Z1 microscope (Zeiss). RNA isolation from testis For RNA-isolation, a testis piece, freshly isolated or stored at -80°C was homogenized using a tissueLyser (Qiagen cat.85220) in a 2 ml Eppendorf tube, 1 min, frequency 30.0 Hz. We isolated single cells from mouse testes according to

[0010] . We modified this procedure for bull testis sample of a prepubescent and an adult (24 months old) bull freshly obtained from a butchery. Incubation times in collagenase and trypsin buffers were doubled (prepubescent bull) or tripled (adult bull). We prepared total RNA from the samples mentioned above (testis tissue samples or single cell suspensions from mouse or bull) using Trizol (Invitrogen, Thermo Scientific) We removed genomic DNA contamination with the DNA-free kit AM 1906 (Ambion, Invitrogen, Thermo Fisher Scientific). RNA was quantified on a Nano-drop-device (NanoPhotometer, IMPLEN, Version 1.0). We analyzed RNA quality by gel electrophoresis or with Bioanalyzer 2100, (Agilent). We performed cDNA synthesis for RT-qPCR using 1 μg of testis RNA with the SuperScript reverse transcription system (Invitrogen) or M-MLV Reverse Transcriptase (Promega). q-PCR Primers were designed with Primer3plus. To generate specific, discriminating primers we used PrimerBLAST and carried out sequence alignment with SnapGene. RNA-Seq Previously extracted total RNA (see above) was further purified using the RNeasy Micro kit (Qiagen). In both cases, any residual genomic DNA was digested on column according to manufacturer’s instructions, with the addition of an extra 1µl of RNase-free DNase I (Roche) to ensure complete digestion. The RNA was eluted from the columns using RNase-free water and quantified using the Qubit RNA HS Assay. RNA integrity was verified using bioanalyzer RNA Pico chips. Approximately 150-200 ng of total RNA was used for the generation of strand-specific RNA-seq libraries using the ScriptSeq v2 (Epicentre) low input libarary preparation kit according to manufacturer’s instructions. During library preparation, the purification after rRNA-depletion was performed using RNeasy Micro columns and the cDNA was purified using the MinElute PCR Purification Kit (Qiagen). The final library amplification was performed with 15 PCR cycles. The RNA-seq libraries were quantified using the Qubit high sensitivity DNA assay (Life Technologies) and the size distribution was verified using the DNA HS Bioanalyzer chips (Agilent). Libraries were paired-end sequenced either on a HiSeq 2000 (Illumina) with 2x50bp read length. ChIP-Seq Crosslinking of approximately 1x106cells was performed in PBS with the addition of 1 / 10th volume of crosslinking solution (11% formaldehyde, 100mM NaCl, 1mM EDTA pH8, 0.5mM EGTA pH8, 50mM Hepes pH7.8) for 10 minutes at room temperature with agitation. The crosslinking reaction was quenched with the addition of 1 / 10th volume of 2.5M glycine and 5 minutes incubation. Cells were washed twice with cold PBS containing 0.05% Triton X-100, pelleted, snap frozen and stored at -80°C until sonication. Cells were processed using the iDeal ChIP-Seq kit (Diagenode) according to manufacturer’s instructions. Sonification was performed on a Bioruptor Pico (Diagenode) using 3 runs of 10 cycles (30s on, 30s off) in a 4°C waterbath. Sheared chromatin was purified according to manufacturer’s instructions and the size distribution was verified using a DNA HS Bioanalyzer chip (Agilent). Approximately 200,000 cells were used for ChIP with the anti-H3K27ac (ab4729, Abcam) antibody. ChIP-Seq sequencing libraries were generated using the TrueSeq ChIP-Seq kit (Ilumina) following the manufacturer’s instructions with minor modifications. Approximately 1-5 ng of ChIP or input DNA were used for library construction. After adapter ligation, a 0.95x of volume AMPure XP beads (Beckman Coulter) was used for a single round of purification and the DNA was eluted using 15 µl of resuspension buffer (RSB, Illumina). After the addition of 1 µl primer mix (25 mM each, Primer 1: 5’- AATGATACGGCGACCACCGAG-3’; Primer2: 5’- CAAGCAGAAGACGGCATACGAG-3’) and 15 µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C, 5 cycles of [15 seconds at 98°C, 30 s at 63°C and 30 s at 72°C] and a final 1 min incubation at 72°C. The PCR products were purified using a 0.95x volume of AMPure XP beads and eluted using 21 µl of RSB.19 µl of the libraries were amplified for further 13 cycles with the addition of 1 µl primers and 20 µl 2x Kapa HiFi HotStart Ready Mix (Roche). The final products were purified using a 0.95x volume of AMPure XP beads. The libraries were quantified using the Qubit DNA HS assay and the library size was validated using DNA HS bioanalyzer chips (Agilent). Libraries were sequenced on a NextSeq500 (Illumina) with 1x75bp read length. Genome Assemblies Datasets were mapped to the Mus musculus GRCm38 / mm10 genome assembly containing chromosomes 1-19, X, Y and M and the refSeq annotations (UCSC) in refflat gtf format. Bioinformatic Analysis RNA-seq reads were mapped with TopHat2 (version 2.1.0; Kim et al., 2013) using bowtie (version 1.1.2; Langmead et al., 2009), providing refSeq annotations and the options ‘–no-coverage-search –no-mixed –no-discordant -g1 –library-type fr-secondstrand’. For visualization, wiggle tracks were generated with BEDTools (version 2.23.0) (Quinlan and Hall, 2010), converted into bigwig format and loaded into the Integrated Genome Browser (Freese et al.,2016). FPKM’s were calculated using Cuffdiff, part of Cufflinks (version 2.2.1) (Trapnell et al., 2012; Trapnell et al., 2010), with the options ‘-u –no-effective- length-correction -b’. ChIP-seq data was mapped using bowtie (version 1.1.2) with the options ‘-m 1 -S -y’. We then used MACS (Zhang et al., 2008) to determine the average fragment length of the sequenced sampled and a custom perl script to elongate the mapped reads to this length. Duplicates were then removed and .wig files were generated using BEDtools (version 2.23.0) (Quinlan and Hall, 2010). The files were converted into bigwig format and loaded into the Integrated Genome Browser (Freese et al.,2016). Bioinformatic Analysis for Identification of Spermiogenesis-specific Promoters on chromosome X Genes with a haploid stage-specific expression pattern were selected based on the generated FPKM (Fragments Per Kilobase per Million mapped fragments) values of the staged testis RNA-Seq data. We then isolated genes specific for d16 with an FPKM value of < 2 at d12 and >= 2 at d16 as well as those for d24 with an FPKM value of < 2 at d12 and d16 and >=2 at day 24. We set a cutoff at expression value FPKM < 30. For the analysis of tissue-specific expression, we obtained CAGE-Seq data from 35 adult mouse tissues (accession E-MTAB-3579; https: / / www.ebi.ac.uk / biostudies / arrayexpress / studies / E-MTAB-3579): accessory axillary lymph node, adrenal gland, aorta, bone (os femoris), cecum, cerebellum, cerebral cortex, colon, corpora quadrigemina, corpus striatum, diencephalon, epididymis, eyeball, hippocampus, intestinal mucosa, intestine, lung, medulla oblongata, olfactory brain, ovary, pancreas, pituitary gland, prostate, skin, spinal cord, spleen, stomach, submandibular gland, testis, thymus, tongue, urinary bladder, uterus, vagina and vesicular gland. We then selected genes with detectable expression in either testis and / or epididymis and removed those with a combined TPM (tags per million) score across all other 33 tissues of less than 1. To obtain the final list of genomic regions, we then selected the overlap between haploid stage-specific and tissue-specific genes, extracted their respective promoters (-2kb to TSS) and removed those promoters of genes located on autosomes. Cow & Sheep RNA-Seq Total RNA was isolated from approximately 100,000 pelleted cells using the RNeasy Micro kit (Qiagen). Any residual genomic DNA was digested on column according to manufacturer’s instructions, with the addition of an extra 1µl of RNase-free DNase I (Roche) to ensure complete digestion. The RNA was eluted from the columns using RNase-free water and quantified using the Qubit RNA HS Assay. RNA integrity was verified using bioanalyzer RNA Pico chips. Approximately 170 ng of total RNA was used for the generation of strand-specific RNA-seq libraries using the ScriptSeq v2 (Epicentre) low input library preparation kit according to manufacturer’s instructions. During library preparation, the purification after rRNA-depletion was performed using RNeasy Micro columns and the cDNA was purified using the MinElute PCR Purification Kit (Qiagen). The final library amplification was performed with 15 PCR cycles. The RNA-seq libraries were quantified using the Qubit high sensitivity DNA assay (Life Technologies) and the size distribution was verified using the DNA HS Bioanalyzer chips (Agilent). Libraries were paired-end sequenced on an AVITI (Element Biosciences) sequencer with 2x75bp read length. ChIP-Seq Crosslinking of approximately 1x106cells was performed in PBS with the addition of 1 / 10th volume of crosslinking solution (11% formaldehyde, 100mM NaCl, 1mM EDTA pH8, 0.5mM EGTA pH8, 50mM Hepes pH7.8) for 10 minutes at room temperature with agitation. The crosslinking reaction was quenched with the addition of 1 / 10th volume of 2.5M glycine and 5 minutes incubation. Cells were washed twice with cold PBS containing 0.05% Triton X-100, pelleted, snap frozen and stored at -80°C until sonication. Cells were processed using the iDeal ChIP-Seq kit (Diagenode) according to manufacturer’s instructions. Sonification was performed on a Bioruptor Pico (Diagenode) using 3 runs of 10 cycles (30s on, 30s off) in a 4°C waterbath. Sheared chromatin was purified according to manufacturer’s instructions and the size distribution was verified using a DNA HS Bioanalyzer chip (Agilent). Approximately 200,000 cells were used for ChIP with the anti-H3K27ac (ab4729, Abcam) antibody. ChIP-Seq sequencing libraries were generated using the TrueSeq ChIP-Seq kit (Ilumina) following the manufacturer’s instructions with minor modifications. Approximately 1-5 ng of ChIP or input DNA were used for library construction. After adapter ligation, a 0.95x of volume AMPure XP beads (Beckman Coulter) was used for a single round of purification and the DNA was eluted using 15 µl of resuspension buffer (RSB, Illumina). After the addition of 1 µl primer mix (25 mM each, Primer 1: 5’- AATGATACGGCGACCACCGAG-3’; Primer2: 5’- CAAGCAGAAGACGGCATACGAG-3’) and 15 µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C, 5 cycles of [15 seconds at 98°C, 30 s at 63°C and 30 s at 72°C] and a final 1 min incubation at 72°C. The PCR products were purified using a 0.95x volume of AMPure XP beads and eluted using 21 µl of RSB.19 µl of the libraries were amplified for further 13 cycles with the addition of 1 µl primers and 20 µl 2x Kapa HiFi HotStart Ready Mix. The final products were purified using a 0.95x volume of AMPure XP beads. The libraries were quantified using the Qubit DNA HS assay and the library size was validated using DNA HS bioanalyzer chips (Agilent). Libraries were sequenced on an AVITI (Element Biosciences) sequencer with 2x75bp read length. Genome Assemblies Datasets were mapped to the Bos taurus ARS-UCD2.0 / bosTau9 (July 1, 2023) genome assembly (NCBI accession number: GCF_002263795.3) containing chromosomes 1-29, X, Y and M and the NCBI refSeq annotation (September 28, 2023; accession number: GCF_002263795.3-RS_2023_09) in refflat gtf format. The sheep genome used for analyses was the Ovis aries ARS-UI_Ramb_v3.0 (July 20, 2023) genome assembly (NCBI accession number: GCF_ 016772045.2) containing chromosomes 1-26, X, Y and M and the NCBI refSeq annotation (October 17, 2023; accession number: GCF_016772045.2- RS_2023_10) in refflat gtf format. Bioinformatic Analysis RNA-seq reads were mapped with TopHat2 (version 2.1.0; Kim et al., 2013) using bowtie (version 1.1.2; Langmead et al., 2009), providing refSeq annotations and the options ‘–no-coverage-search –no-mixed –no-discordant -g1 –library-type fr-secondstrand’. For visualization, wiggle tracks were generated with BEDTools (version 2.23.0) (Quinlan and Hall, 2010), converted into bigwig format and loaded into the Integrated Genome Browser (IGB; version 9.1.10; Freese et al.,2016). FPKM’s were calculated using Cuffdiff, part of Cufflinks (version 2.2.1) (Trapnell et al., 2012; Trapnell et al., 2010), with the options ‘-u –no-effective-length-correction -b’. ChIP-seq data was mapped using bowtie (version 1.3.1) with the options ‘-y -m 1 -S -X 1000 –allow- contain’. Matching paired-end reads from the .sam file were then combined into a bed file by generating the original fragments using a custom perl script. Duplicates were then removed and .wig files were generated using BEDtools (version 2.23.0) (Quinlan and Hall, 2010). The files were converted into bigwig format and loaded into the Integrated Genome Browser (Freese et al.,2016). Integration Sites Rationale: Akap4 is well conserved between mouse and cow. We selected a region corresponding to the region selected in mouse as integration site on the X chromosome of cow. For Y chromosome integration, a corresponding region conserved between mouse and bull could not be identified. Therefore, we searched for genes upregulated in RNA expression between testis RNA of the young and more mature bull, indicating that the gene remains active during spermiogenesis. Here we searched for regions with active chromatin (H3K27Ac) and conservation between bull and sheep indicating putative enhancers. The selected regions are indicated on Figure 6. Procedure: To determine the candidate integration sites, we performed pairwise alignments of the X and Y chromosomes of various species using CNEr (version 1.38.0; Tan et al., 2019), which uses the lastz aligner (version 1.04.22; Harris, 2007) running in R (version 4.3) to find conserved regions. For integration in the X chromosome, we aligned the mouse chromosome with that of the cow using the “far” distance option, due to the median derived evolutionary distance of ~94 million years between the two species (Kumar et al., 2022). The resulting lav file was converted to psl using the function “lavToPsl” built into CNEr and visualized using IGB. We then extracted the coordinates in the cow genome for regions A-H (as indicated on Figure 6a) from the psl file, generated a bed annotation and visualized them in the cow genome using IGB. The mouse integration site falls into the ~1.2kb region located between the conserved elements F and G and was used for the design of CRISPR / Cas9 guide RNAs (see below). To find a Y Chromosome integration site in the bull, we first analyzed the RNA-Seq data and filtered for genes on this chromosome with an increased expression of at least 2-fold in the mature bull sample as compared to the younger bull, while displaying at least an FPKM expression level of 2, resulting in 4 candidate genes (Figure 6b). We then performed a pairwise genome alignment between the bull and sheep Y chromosomes as detailed above, with the exception of using the “medium” distance option due to the estimated ~25 million years of evolutionary distance between the two species (Kumar et al., 2022). This analysis showed conserved regions downstream of the ZRSR2Y gene (named LOC132659056 in the sheep annotation). The genomic coordinates of these regions in the sheep genome were determined from the psl file and the resulting target sheep sequence as well as the equivalent sequences (Region 1 & 2) in the bull were extracted from the respective fasta files (Figure 6c). CRISPR / Cas9 guide RNA design We used crisflash (version 1.2.0; Jacquin et al., 2019) to design guide RNAs in the ~1.2kb region of the cow genome downstream of Akap4 (see above) using the cow genome as a reference and allowing up to 2 mismatches to occur. Only guides (+ PAM sequences) with a perfect match and which found no off- targets allowing even up to 2 mismatches were selected (listed in Example 2, Table 2). Example 2 - Transgenes, primers, probes, and plasmids The below Table 1 contains the coding sequence of each transgene, the sequence of important elements (promoter, putative enhancer), homology regions for integration, the integration site (guide- RNA sequences in bold, Pam sites bold, underlined and sequence replaced by the respective transgenes in italics). We also provide sequences of guide-RNA oligos for cloning into pX330, PCR- Primers for Southern probe generation, characterization of transgene integration, genotyping and expression analysis of mouse lines. DNA fragments were used directly or, if required, subcloned by ligation of blunt PCR fragments into pBSSK linearized with EcoRV. After blue-white selection of colonies we analyzed plasmids by restriction digest and Sanger sequencing. Table 1 TgA: 5‘-utr to poly-A signal. Coding sequence underlined (Integration 3’ of Smok2b) TGGAGTTGGTGGAGTTTGGTGGATTTGGTGGAGTTGGTGGTGCCCTTTGCGATTTCGTTGTAT CTAGTGAGCCGTGTGTGGATTTTGTGTTTGATTGGTTCGTGTGTGAGCTTTTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTAGATCAGTGTGTGTTTGGGAGGAGC TTGTGTGTGTGAGTTGTGTTTTAAGTTTATTTGCGTGTGAGTACCTTTGGGTTTTTGTGTGTGTC TGTGTGTGTTTGTGTGTGTATAACTGTGGGTGACTGTAAGTGCACCTGTGTGTTTGTACGTGAG TGTGTAAGACTGTGTGTGTGCACAAGAGCGTGTGTAGGTGCACGTGTTGTAGGTGTGAGAACA CCTGTTGTGTTTAGGCCATCAGTCAGCTTGGTCATTGTTTCTAAGGTAGCATTTATACTTTGTTA CCTCAAGTGGGCTCTGGGAGTCAGCAGAAGTCAGAAAAGCTCAGATCCAACCCCCTTTTTCTG CCATGGGATCCCATCGATTTAAAGCTATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGA AATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAGCAAAAGCTCATTTCTGAA GAGGACTTGAATGAAATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAGCAA AAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAGAGCTTGGGCGACCTCACCATGGAGCAA AAGCTCATTTCTGAAGAGGACTtgAATTCgATGGAAAATTTTCATGCTCAATACGTGATGCTAGA GACTATCGGACATGGAGGCTGCTCCAAGGTGATGCTGGCCCGGCATCGCCTCACAGGCTCCC ATGTGGCTGTCAAAATGATTCGAAAGAGTGAGTGTTGGTGCAATCCTGTCATGTCTGAGGTAG AGTTACTGATGATGGCCGATCATCCGAATATCATCTCTCTCCTTCAAGTCATTGAGACCAAGAA GAAAGTATACCTCATTATGGAGTTGTGTGAGGGTAAATCACTTTACCAACACATCAGAAACGCT GGCTACCTGCAGGAGGATGAAGCACGAGCATTATTCAAGCAGCTCTTAAGTGCTATGAACTAC TGCCACAACCAGGGTATAGTTCACAGGGACCTGAAACCTGACAATATTATGGTAGAAAAAGAT GGAAAAGTGAAGATCATTGATTTTGGACTCGGAACCCAAGTGAAGCCAGGGCAAAAACTAAAC TTATTCTGTGGGACTTACCCATTTAGTGCTCCTGAGGTGCTCCTTAGCAGACCCTATGATGGGC CCAAGATCGATGTATGGACTCTTGGAGTTGTGTTATATTTTATGGTAACTGGAAAGGTCCCGTT TGATGCTGCCAGCATACAAAAGCTGGTAAGGCAAATTTTGGCATGGAAGTATTTTGTTCCCTCT AGACTGTCTGTAGAGCTCCGAGATCTGATTAGTCTTTTAATGACGGCCAACCCCAAACTTAGGC CCACTGTTGCTGAAGTTATGGTGCATCCctGGGTCACAGAAGGCTCAGGGGTGTTACCAGATCC TTGTGAAGAACATATACCCCTCAAGCCAGACCCTGCGATTGCAAAAGCAATGGGATTTATCGG GTTCCAAGCTCAAGACATTGAAGATTCGTTATGTCAGAGAAAATTCAACGAAACCATGGCATCT TATTGTCTACTGAAAAAACAGATTCTTAAGGAATGTGACAGGCCAATCCGGGCTCAGCCCATGA ATCCATCTGTGACCCCACTCTCTTCCCTTGTTGATGCTCCTACTTTCCATCTCGGACTTCGGAG GACAGAGACTGAACCCACAGGTCTCAGATTATCTGACAATAAGGAAGTGCCTGTCTGTGGCAA TAGTActAGTAAGAAAAGAGAGAGAAGTTTCAGTGGGCTGGGTGTTCTCAGCAGGCCGATTAAC ACAACACCCACAATGGACCAAACACACACCCGTACTTGGAGTGGTCCCTGCATTTACTCAAAT GTTTGCACAATCCATCCAAACAGCATCAATGAGAGTACAGAAGGCCACATCAGTACCTCAGCA GAGGATAAGCCTGTCCACAGCAGAGGCTGGCCCAGAGGCATCAAGGGCTGGACTAGGAAGAT AGGAAATGCAATGAGGAAGCTCTGTTGCTGTATCCCATCCAAAGAGACATCTCACCTGGGGCA GAGAAGAGTCTGCCCAAAAATTTAAGACACAGGAAGGATGTCAGGAGAATGAGCATCCAGCAT GGCCCAGGTACATTTCTGTATTTGAATGTATCTATGTTACTCATGTCTGTGTCAACTGGCAGATT ATAATTATGTATATGTATATGGTGCAATGCATGGGGAAGCTAGGTCTAGACACCTTGGGAAAAT AGTTAAATTGAACCTGCCAACAGATCCAGCATCCCAGAAGGTATCTCCTGTGTGTATCCTGCAC ATTGAACAAGGAGGAGAACTGACCATGCTAGGGAGAGGAAGTGGGAGAAGGAAGAGGAGGA GATGCTGAGGGAGGAGAGGGTGGTATGTGGTGGAAGCTAGGAGAAGAGGGGAAGAGGTTCA GACAGGAGGAGGCAACTTGGGGGAGCAGTGTGAAACAGGGTAACCCCAGCTGGAGAGATGC CCTGTGCAGCTGAGGTTCTCAGAGTCCCTCTCACGTGTGCTTTGGCATTTTAGAAGATCACCA GAGGATGCCGGATGCTACGATTCAACAGTTATAATGTAGATCCAGACATGATAAGATACATTGA TGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATG CTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATT TTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAATTCGC Left homology region CTTTTATTCTTGTCAAGTCTCCATCACAACGTCAATTTGCTCCATTAGAACACTGCCCAGTTCTC CAGCAGACTGCATCTCCAAACTTCTCCAAATGCTTCCTAGAAACATAGAGCAAAGGTGTCTGAA CCATGTGCCATCAGGAACACTCCAGCATTAGCGTCATTGCTCCACATTAGATTTCCATTGCTGT AACAAAA Right homology region CAATCACGTGCGTGCCGCGAGCAATCGCCATTATAAGATGGTGCTGGCTTCCACTGCACCTAA CTAGTAAACAAGCCTTATGCGCAAGTGCAAGAGTGAAGTCACGCCTAGTCACTGCCCATCTCG CGGCATAGTAATGGGGTGATGGGTGAGCAAGGAATCAGGAGCTGTCATGCCACATCAGGTGC TGAAACGTCACGCTGCGG Integration site CCAGCTAATCATGTGATAAAGAAAAGTTTCCTTCTGGCTCACTGTTTCTGAGTTCACAGCCCAT GGGTGGCTATTTCCATGCGTTAGGTCTATGATGAGGCAGAGTGTGGAGAGCCGTGCCCCGAGCAATCACGTGCGTGCC (Homology region starts 4bp further 5’)Guide RNA-left hb385 CACCgTTCTTTATCACATGATTAGChb386 aaacGCTAATCATGTGATAAAGAAcGuide RNA-right hb387 caccGGCACGCACGTGATTGCTCGhb388 aaacCGAGCAATCACGTGCGTGCCInternal probe Smok probe. AGGCTCCCATGTGGCTGTCAAAATGATTCGAAAGAGTGAGTGTTGGTGCAATCCTGTCATGTC TGAGGTAGAGTTACTGATGATGGCCGATCATCCGAATATCATCTCTCTCCTTCAAGTCATTGAG ACCAAGAAGAAAGTATACCTCATTATGGAGTTGTGTGAGGGTAAATCACTTTACCAACACATCA GAAACGCTGGCTACCTGCAGGAGGATGAAGCACGAGCATTATTCAAGCAGCTCTTAAGTGCTA TGAACTACTGCCACAACCAGGGTATAGTTCACAGGGACCTGAAACCTGACAATATTATGGTAG AAAAAGATGGAAAAGTGAAGATCATTGATTTTGGACTCGGAACCCAAGTGAAGCCAGGGCAAA AACTAAACTTATTCTGTGGGACTTACCCATTTAGTGCTCCTGAGGTGCTCCTTAGCAGACCCTA TGATGGGCCCAAGATCGATGTATGGACTCTTGGAGTTGTGTTATATTTTATGGTAACTGGAAAG GTCCCGTTTGATGCTGCCAGCATACAAAAGCTGGTAAGGCAAATTTTGGCAGGGAAGTATTTT GTTCCCTCTAGACTGTCTGTAGAGCTCCGAGATCTGATTAGTCTTTTAATGACGGCCAACCCCA AACTTAGGCCCACTGTTGCTGAAGTTATGGTGCATCCCTGGGTCACAGAAGGCTCAGGGGTGT TCCCAGATCCTTGTGAAGAACAGATGCCCCTCAAGCCAAACCCTGCGATTGTAAAAGCAATGG GATATATCGGGTTCCAAGCTCAAGACATTGAAGATTCTTTACGTCAGAGAAAATTCAACGAAAC CATGGCATCTTATTGTCTACTGAAAAAACAGATTCTTAAGGAATGTGACAGGCCAATCCGGGCT CAGCCCATGAATCCATCGGTGACCCCATTCCCTTCCCTTGTTGATACTTCTACTTTCCATCTTG GACTTCGGAGGAGAGAGACTGAACCCACGAGTCTCAGATTATCTGCCAATAGGCAAATGTCTG TCTGTGGAAGGAGTACTAGTAAGAAAAGAGACAGAAGATTCAGTTGGCCCAGTGTTTCCGGCA GGCCACTCCACACAACACACACAATGGACCACACACACACCCGTACTAGGAGTGTTCCCTGCA TTTACTCAATGTTTTGCACAATACAGCCAAACAGCAGTGATGACAGTACAGAAGGCCACACCAG TGCCTCAGCAGAGGATAAGCCTGTCCGCAGCAGGGGCTGGCCCAGAGGCATCAAGGGCTGG ACTAG Digest: BclI. Several bands of wild-type Smok loci. Unique band for correct integration: 7.9 kb. TgX1 Coding sequence as TgA. Integration 1013bp 3’ of last exon of Akap4. Left homology region ATGTGGTACAAAAATGTAGTCTCCATCTGGGAGCCTTCATCTGTAAAATGTAGCTGAAAACCAC GCT Right homology region ACCAACTCCTGAGCCAAGGCTGTATTTATAATGCCTGAGTCTTTCCGGAGCACAGCTGGGTCC CAT Integration site CCACGCTCAACACACGTTTGAGGCTAACCTGTGAAGGGAGGAATGGGGGTGATAGTGTTTTG CACCTGGCAAATTTCGTTACAAATGTAAAGATGTGAAAAACTCCACACTTCTCAAAGCCTGCCC TAACAAAGCTGGGAGTGTTCTCTTAATTTCAGAGCTGAATACAAGAACCATCAACATAAAAGGA CTTCAGGTAAGACACAGGTAAGCTGCAAGGGTCAGAGGTCAAGATTGCCAAGCCTTCATAGTA CCTGGGGACTGGGAGGAAGGAAAGACAGGCCTCCTCAGAGTAGGACCTTTCAAATCTCCAAG CCTGCCAGGATGAATCAAAGGTTTGTCAGTCTTACCCAACCTCGTGTAAAGCTCTGGAGTTGA GGCAGCATAGATCTCTTTTTGTCCTTGAGGAAAATCCTTGATAACCAACTCCTGAGCCGuide RNA-left hb226 CACCgCCTCAAACGTGTGTTGAGCGhb227 aaacCGCTCAACACACGTTTGAGGcGuide RNA-right hb230 caccGGCTCAGGAGTTGGTTATCAhb231 aaacTGATAACCAACTCCTGAGCCLeft Southern probehbAk-LP2s TGGGGGACAAGACCTTCATA“LP2” 973 bphbAk-LP2as GCCACCCCCAAATTATCTCTLeft Southern probehbAk-LP3s GGCGGATCCTAAGAAGAAGG“LP3” 947 bphbAk-LP3as GGAGAGGTAGGGTTTCAATGChbAk-RP5s TGGAGGGATCATGAATAGGC Right SouthernhbAk-RP5-as AAACGGCACAATGAAACCTCprobe “RP5” in Akap4 locus 323 bp Right SouthernhbAk-RP6s TGATGGAATTTGCAGAGATGAprobe “RP6” in Akap4 locushbAk-RP6-as AGGGACAAAAAGTGGAGCTT601 bp Genomic Southern blot analysis: BamHI - left probe and right probe (pools of LP2, LP3 and RP5, RP6): wild-type band: 16851 bp, correct integration: 9784 bp TgY1 Coding sequence as TgA. Integration 1038 bp 3’ of last exon of Zfy1 (Ensembl transcript 202). Left homology region CTACACTGAATAGGAACTAAATTCTGAAGAGGATAA Right homology region AGCTTAGTAAAAGAATAAAAGAAATGTTTTCTTCAAAATTTATAATAGTCAAATCCAACG Integration site ATTCTGAAGAGGATAAACAAAGGTGTTAGAAAGTAGGGTTGGTTATAGTCTGGCCTTTGCTTA GCAATAACCAAATTCCTATGTAACTAAATAATTTTAGCAGTGAACTTAAATCTAGCATATTGCAG AGGATGTCAAGCATCAATTACTTAAGAGTTCTAATCCTATAAATTAAACAGCTAATAATAAGTAT CATTGGCACAAAAATAAAAGCAGCAGCAAAAACAGAATATGAAGTACCATGAAAGCCAAAGGT GCTGCTTATCAAATAGAAAAGTTCTTCCCACATACCAGTAGCTTAGTAAAGuide RNA-left hb184 CACCgATTCTGAAGAGGATAAACAAhb185 aaacTTGTTTATCCTCTTCAGAATcGuide RNA-right hb186 CACCgTTACTAAGCTACTGGTATGThb187 aaacACATACCAGTAGCTTAGTAAc2-step integration 1.) Integration of selection cassette by homologous recombination (neomycin selection) 2.) Flp-mediated cassette exchange (hygromycin selection) TgY2, TgY3, TgY4 Integration into Zfy2-enhancer locus, 20431bp 5’ of first exon of Zfy2 Transcript ensemble 201 (Cypt1 Promoter (SEQ ID NO: 4), grey: Exon1) TCATGGAATACTTTGGTTTCTCCATCTGTGGTAATTGAGAGCTTTGCTGGGTATAGTAGCCTTG GCTGGCACTTGTGTTCTCTTAGGGTCTGCATAACATCTGTCCAGGATCTTCTGGCTTTCATAGT CTCTCGTGAGAAGTCTGGTATAATTCTAATAGGCCTGCCTTTATATGTTACATGACATTTTTCCT TACTGCTTTCAATATTCTATCTTTATTTAGTGCATTTGTTGTTCTGATTATTATGTGTCAGGAGAA ATTTCTTTTCTCAGCCAGTTTATTTGGAGTTCTGTAGACTTCTTGTATGTTCATGGGCATCTCTTT CTTTAGGTTTGGGAAGTTTTCTTCCATAATTTTGTTGAAGATATTTGCTGGCCCTTTAAGTTGAG AATCTTTGTTCTCATCTACTCCTATAATTCGTAGGTTTGGTCTTCTCATTGTGTATAGGACACATT TTTTTGTTGTTATTACTTGTAGATGATCCTCATATCAATGTACTCATAATAGTGTCCTATTACTTT GAGTAGTGATTAGGTATAATATCTAAAATACAATGAGAATAATAAGGGAAAGTCAGTGTAAGCA AAAGTACAGAGTAGGGATTAAATGAAGTAGCAAACTTGCACAGAATTTCAGCATAGTCTAACAG TATAAGAGAAGGGAGTAAGCTTAAAACATTTATCTTCCAGAGGTTTAAGTAAGCCTCCTATTTTC AAGGAGACTATGTAGTTCTAGTATATTGACCCCCTAGAAAGTGTATGAAAGTGATACTTTTTGAT GAATAAGGGATATCTGAGATTCTCAGGCAGTCTTATCTGGACTCCCTTCAAGCTCAAAGTGGTC AGAGGTAGGGCATTGTGAGGTTTCAGCCACTCCTTAGCTGCCTTTGGCTGGGAGAGCTTTGCT GACCAATCAGGGCTGAGGGGTGTGGCCCACCATTGTTCTGACAGGGATATAAGCAGGGTGCT CAGAGCTCTTGGGCCAGTCTCTGGAGAGCTCTGCTA TgY2, TgY3: 5‘-utr to poly-A signal. Coding sequence (SEQ ID NO:1) underlined TTGGGAGGAGCTTGTGTGTGTGAGTTGTGTTTTAAGTTTATTTGCGTGTGAGTACCTTTGGGTT TTTGTGTGTGTCTGTGTGTGTTTGTGTGTGTATAACTGTGGGTGACTGTAAGTGCACCTGTGTG TTTGTACGTGAGTGTGTAAGACTGTGTGTGTGCACAAGAGCGTGTGTAGGTGCACGTGTTGTA GGTGTGAGAACACCTGTTGTGTTTAGGCCATCAGTCAGCTTGGTCATTGTTTCTAAGGTAGCAT TTATACTTTGTTACCTCAAGTGGGCTCTGGGAGTCAACAGAAGTCAGAAAAGCTCAGATCCAAG CCCCCTTTTTCTGACATGGAGAAATTTCATGCTCAATATGAGATGCTAGAGACTATTGGCCAGG GAGGCTGCGCCCAGGTGAAGCTGGCCCGACACCGCCTCACAGGCACCCACGTGGCTGTCAA AGTGATTGTAAAGAGGGAGTGTTGGTTCAACCCTGTCATGTCTGAGGCAGAGTTACTGATGAT GACCGATCATCCGAATATCATCTCTCTCCTTCAAGTCATTGAGACCAAGAAGAAAGTATACCTC ATTATGGAGTTGTGCGAGGGTAAATCACTTTACCAACACATCCAAAATGCTGGCTACCTGCAGG AGGATGAAGCACGCCCATTATTCAAGCAGCTCTTAAGTGCTATGAACTACTGCCACAACCAGG GTATAGTTCACAGGGACCTGACACCTGACAATATTATGGTAGAAAAAGATGGGAAAGTGAAGA TCATTGATTTTGGACTCGGCACCCAAGAGAAGCCAGGGCAAAACCACAACTTATTCTGTGAGAT TTACCCATTTAGTACTCCTGAGGTGCTCTTTAACAGACCCTATGATATGCGCAAGATCGATGTG TGGGGTCTTGGAGTTGTGCTGTATTTTATGGTAACTGGAAAGATTCTGTTTGATACTGCCAGCG TAGAAAAGCTGCGAAAGCAAATTGTTGCAGAAAAGTGTTCTGTTCCCTGTAGACTGTCAGTAGA GCTCCAAGACCTGATTAGACTTTTAATGACGGACATCCCCGAACTTAGGCCCACTGTTGCTGAA GTTATGGTGCATCCCTGGGTCACAGAAGGCTCAGGGGTGTTACCAGATCCTTGTGAAGAACAT ATACCCCTCAAGCCAGACCCTGCGATTGCAAAAGCAATGGGATTTATCGGGTTCCAAGCTCAA GACATTGAAGATTCGTTATGTCAGAGAAAATTCAACGAAACCATGGCATCTTATTGTCTACTGAA AAAACAGATTCTTAAGGAATGTGACAGGCCAATCCGGGCTCAGCCCATGAATCCATCTGTGAC CCCACTCTCTTCCCTTGTTGATGCTCCTACTTTCCATCTCGGACTTCGGAGGACAGAGACTGAA CCCACAGGTCTCAGATTATCTGACAATAAGGAAGTGCCTGTCTGTGGCAATAGTACTAGTAAGA AAAGAGAGAGAAGTTTCAGTGGGCCGGGTGTTCTCAGCAGGCCGATTAACACAACACCCACAA TGGACCAAACACACACCCGTACTTGGAGTGGTCCCTGCATTTACTCAAATGTTTGCACAATCCA TCCAAACAGCATCAATGAGAGTACAGAAGGCCACATCAGTACCTCAGCAGAGGATAAGCCTGT CCACAGCAGAGGCTGGCCCAGAGGCATCAAGGGCTGGACTAGGAAGATAGGAAATGCAATGA GGAAGCTCTGTTGCTGTATCCCATCCAAAGAGACATCTCACCTGGGGCAGAGAAGAGTCTGCC CAAAAATTTAAGACACAGGAAGGATGTCAGGAGAATGAGCATCCAGCATGGCCCAGCCTTTCA GACCGAAGGCAAGCTCTACCTGATCCTGGACTTCCTGCGGGGAGGTGACCTCTTCACCAGGC TTTCCAAAGAGGTGATGTTCACGGAGGAGGATGTCAAGTTCTACCTGGCTGAGCTGGCCTTGG CTCTAGACCACCTCCATGGCCTGGGGATCATCTACAGGGATCTGAAGCCAGAGAATATCCTCC TGGATGAAGAGGGACACATTAAGATCACAGATTTTGGCTTGAGCAAGGAGGCCACCGACCATG ACAAGAGAGCCTATTCATTCTGTGGGACTATTGAATACATGGCGCCCGAGGTGGTGAACCGGC GTGGACACACACAGAGTGCCGACTGGTGGTCCTTCGGTGTGCTCATGTTCGAGATGCTCACA GGGTCCCTGCCATTCCAGGGGAAGGACAGGAAGGAAACAATGGCCCTCATCCTCAAAGCCAA GCTGGGTATGCCTTAATTAAGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCAC AACTAGAATGCAGTGAAAAAAATGCTTTATTTGTTAAATTTGTGATGCTATTGCTTTATTTGTAAC CATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGG GGGAGGTGTGGGAGGTTTTTTAATTCGC TgY4, TgX2: 5‘-utr to poly-A signal (SEQ ID NO: 13). Coding sequence (SEQ ID NO: 2) underlined ijĴ TTGGGAGGAGCTTGTGTGTGTGAGTTGTGTTTTAAGTTTATTTGCGTGTGAGTACCTTTGGGTT TTTGTGTGTGTCTGTGTGTGTTTGTGTGTGTATAACTGTGGGTGACTGTAAGTGCACCTGTGTG TTTGTACGTGAGTGTGTAAGACTGTGTGTGTGCACAAGAGCGTGTGTAGGTGCACGTGTTGTA GGTGTGAGAACACCTGTTGTGTTTAGGCCATCAGTCAGCTTGGTCATTGTTTCTAAGGTAGCAT TTATACTTTGTTACCTCAAGTGGGCTCTGGGAGTCAACAGAAGTCAGAAAAGCTCAGATCCAAG CCCCCTTTTTCTGACATGGAAAAGTTCCACGCCCAGTACGAGATGCTGGAAACCATCGGCCAG GGCGGCTGCGCCCAGGTCAAACTGGCCAGACACAGACTGACCGGCACCCACGTGGCCGTGA AAGTGATTGTGAAGAGAGAGTGCTGGTTCAACCCCGTGATGAGCGAGGCCGAGCTGCTGATG ATGACCGACCACCCCAACATCATCAGCCTGCTGCAGGTCATCGAGACAAAGAAAAAGGTGTAC CTGATCATGGAACTGTGCGAGGGCAAGAGCCTGTACCAGCACATCCAGAACGCCGGCTACCT GCAAGAAGATGAGGCCAGACCCCTGTTCAAGCAGCTGCTGAGCGCCATGAACTACTGCCACA ACCAGGGAATTGTGCACAGAGACCTGACCCCCGACAACATCATGGTGGAAAAGGACGGCAAA GTGAAGATCATCGACTTCGGCCTGGGCACCCAAGAAAAGCCCGGCCAGAACCACAACCTGTT CTGCGAGATCTACCCCTTCAGCACCCCCGAAGTGCTGTTCAACAGACCCTACGACATGAGAAA GATCGACGTGTGGGGCCTGGGCGTGGTGCTGTACTTCATGGTGACAGGCAAGATCCTGTTCG ACACCGCCAGCGTGGAAAAGCTGAGAAAGCAGATCGTGGCCGAGAAGTGCAGCGTGCCCTG CAGACTGAGCGTGGAACTGCAGGACCTGATCAGACTGCTGATGACAGACATCCCCGAGCTGA GGCCCACCGTGGCCGAAGTGATGGTGCACCCCTGGGTGACAGAGGGCAGCGGCGTGCTGCC TGACCCCTGCGAGGAACACATCCCCCTGAAGCCCGACCCCGCTATCGCCAAGGCCATGGGCT TCATCGGATTCCAGGCCCAGGACATCGAGGACAGCCTGTGCCAGAGAAAGTTCAACGAGACA ATGGCCAGCTACTGCCTGCTGAAGAAGCAGATCCTGAAAGAGTGCGACAGACCCATCAGAGC CCAGCCCATGAACCCCAGCGTGACCCCCCTGAGCAGCCTGGTGGACGCCCCTACATTCCACC TGGGCCTGAGAAGAACCGAGACAGAGCCCACCGGCCTGAGGCTGAGCGACAACAAAGAAGT GCCCGTGTGCGGCAACAGCACCAGCAAGAAGAGAGAGAGAAGCTTCAGCGGCCCAGGAGTG CTGAGCAGGCCCATCAACACCACCCCCACCATGGACCAGACCCACACCAGAACTTGGAGCGG CCCCTGCATCTACAGCAACGTGTGCACCATCCACCCTAACAGCATCAACGAGAGCACCGAGG GCCACATCAGCACCAGCGCCGAGGACAAGCCCGTGCACAGCAGAGGCTGGCCCAGAGGCAT CAAGGGCTGGACCAGAAAGATCGGCAACGCCATGAGAAAGCTGTGCTGCTGCATCCCCAGCA AAGAGACAAGCCACCTGGGACAGCGGAGAGTGTGCCCCAAGATCTGAGACACAGGAAGGATG TCAGGAGAATGAGCATCCAGCATGGCCCAGCCTTTCAGACCGAAGGCAAGCTCTACCTGATCC TGGACTTCCTGCGGGGAGGTGACCTCTTCACCAGGCTTTCCAAAGAGGTGATGTTCACGGAG GAGGATGTCAAGTTCTACCTGGCTGAGCTGGCCTTGGCTCTAGACCACCTCCATGGCCTGGG GATCATCTACAGGGATCTGAAGCCAGAGAATATCCTCCTGGATGAAGAGGGACACATTAAGAT CACAGATTTTGGCTTGAGCAAGGAGGCCACCGACCATGACAAGAGAGCCTATTCATTCTGTGG GACTATTGAATACATGGCGCCCGAGGTGGTGAACCGGCGTGGACACACACAGAGTGCCGACT GGTGGTCCTTCGGTGTGCTCATGTTCGAGATGCTCACAGGGTCCCTGCCATTCCAGGGGAAG GACAGGAAGGAAACAATGGCCCTCATCCTCAAAGCCAAGCTGGGTATGCCTTAATTAAGATCC AGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGC TTTATTTGTTAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTT AACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAT TCGC Cypt1 putative enhancer (SEQ ID NO: 7) (TgY3, TgY4) CCTCCATGATATTGAACTCATACTCAACATTCCTTGGGTAACCAAGAGCTAGAGGCTAGATAGC CCAGAGACTGAGGGTAAAACCAAATAAAACTGGTCTTAAAAAAAAGGAACAATAAAATGACCTT CAATGATATTATGCTATACTCATGGATTGGTCCTGCAGCAGATGGTAACAAATACATAGACCCA CAGCCAGACATTATTCAGAAAGAGAGAGAGACCTTGGAACACATAATTACTGAGATGTCTCCAT CAAATACTCAGAGCTCAAGGAACTCTGCAGAAAAGAAGGCAGAAGGAATATGGGAACCATTTG TGATGACGGATATCAGGAGAACAAGGCACATTAAACCAAGTAAGCAAACTGCACATGAACTCA CAGAGATGGAGTCTGCACCAGTCCATTGCATATATATTACATCTTTCAGTTTCATCCTTTTATGG GATGACTGAATGTATAAATGACTGGGTCTCTGATTCTTGTGCTTTATCTTGGGGCTCTTTTCTTT TTCTGTTGGCTTGCCATGTCTAGCTTCAATGTGATGGTTTTGGTTTATCTCATTATACTTCATTTT GTTGTGTTTTGTGGTTAAAATAGTGAATAATAAATAGGCTCAATTTTTAAAACATGGATAGATGA ATGAAAACCTAGTCACTAAGGCAAAGGTTAACAATTAAACTGTGTCACTTATACCTACAAGGAG AGGGCAAATCCATTTGCTCCGATAGAGTGACACTGGCTATATCAATCATTCTAGGACTGTTCTC ATGGTCCAAGGTAGTTGAGCATCATATAATGGGCTCCAGTTTTTGTGTTTTTATTAGGTTACAGT TTGGTGTTGAGTTTGGTTTGATTTGGTTTTCAATTTGTGGTGTTTTGTTGTTGTTGTTGTTTTTGT TTTGTTTTGTTTTTTGTTTTTTGGGTTTTTTTTTTTTTTTTTTTTGCTTTCTTGTTTGGGAGGGTAC TCTTATTTTGTATTGGGTTTATGTTTGTTTTTTTAAAAAGGAACTTAAAGGTGGGCAGGCAAGAA GAAGAGGATCTGGAAGGATAAATGGGAGGGGAAGAACATGATCAAAATATAATTAAATTTAAAA TTGTTTTATATAATAAAATTATAATAAAAGAGAAAGAGATAATTAAAGAAAATCCAAGTGTAATAA AAGCACTCTATCCTAGTTGGCAGCATGTCTGTCTCCACAGAACATGAAGCAATTATCTCACATG GTCAATGTCTTAGGGTTAATCAATATGCTAAGTCTTTTTAAAATATTCTTAAACATTTAAGTTCTT TTTAAAAATGGCCTAGAGTGCCAAACATTAAGACTAGTACAATTTTTTACTTTTCTCTGTTGTTTT TGACACAAGATCTCACTATATAGCCTTGGCTGGCCTGGAACTTGCTATATAGGTAGGGCTAGC CTCTAATATAGAGATCTACCTGACTCTGCCTTGTGAGTATTTGAATTAAAGACATGCACTACCAC ACCAGAATACAGTTTCTTTCTTAAAAGTAAATATATTTCAACTTAATATCCTCTTTTTTCCCCTTAT AATCCAACCAGTTTCATCAAAGCTCTCCATATACTAATTGGTACAACCTGCTAAAGCATGGTCAA CAATCCAGATTCATGTCCATAAAGGAAATTGATTCTCCTCTAACAGCCATCAACTGCCACTAGC TCTTCTAACAGCCATTAACTGCCACTGGCTCCTCTAACAGCCATTAACTGCCACTGGCTCCTCT AACAGCCATTAACTGCCACTGGCTCCTCTGTTAGGGTTACATTAACTGCCACTGGCTCTTCTGG TAGGGTTATGGGCTCATGTGCCCTTCCCCCATCCATACTGGAATGCCTGCTGGCTTGTTCTTAA GTAGGCAATCACAGCTACTTTAGTTCATGAGTGCAGTAGTACTTGTCATGTTCAGAAGACAGTT TCATTCCAGTTTTCACCTTTTGTATCTTACAATCTTTAGTCCCTTTCTTCTGTGGTATACCTTGAG TTTTGTTGGGAGAGGTGTGAGGTGAATGTTTGAATGATTACTGAGCAATTCACCAATAGTTGTA GTCTTTGACCACTTGTAAGTTTCTGTAATAACCATCATCCACTTCATGAAGAAGCTTCTCTGATG AGGTTTGAATGTTGCAGCAATTCGTGGGTATAAAGATAAATATTTAGAAGGTAGCTTGATACTAT CTATATTTTGCAAAATAATAGTAGTAAGTTTAACCCTAGTGCCTAAGAACTCCCCAGCCATAGGT TCTTTGTCTGATTCACAGTAAGAGGCATGTGTTTCCTCCTGTGGATAGGTCCTTAAATCAATCAT AAAAAATTTGGTTATCAACAGAACATTTACATCACTATTATACCAATAGCCATATCTTGTCATGCT GGTTATTTTTGTAGCTCATGTCATTCACAGATGGATAAGACTGATGGTGACTTTTACCTTCCAG GGACCTGAACATTCAGCACTATAAAAGCTAGCCAACATGGAGGAAACTCACATATCATTATCAG TTTAATTTCTCCCAGACATG Left homology region ATGCTACCATGAGATCAGACATTTACAGGCTGTTCAGTAGTTTTGTTATATAACTGTGCTGCTGA ATACAACCCCCACCACAAACTTTAGAATGTAATCTGAGACCCATCCCTAGTCACACTGAGGTAT AATCTTCAAGGTCAGAAACCTAGGACCTATACTTTTTAATAGTTTCCCAGGCAGTTATTATAAAG ATGGTCCATTATCAGTTGACTCCAATAGTA Right homology region TAAGCAAAGGTTATCAGTGTGTTGTTCTACTTCCCTACTTGAAAAATGCAGAAATGCTTCACATA CTTCTCTCATTCATCTCAACTTCACATTTTCAGAGGGATATGTCTAATAAATACACAAACCCAAG AAAATACAAAAAAGACACCCTCCACATATTTTAATGTACTACATCCAATTTTATTAATCTTCAGTC TAACATC Integration site Zfy2 GTTGACTCCAATAGTAAACAAGGTTTACTTAGACAAGTAGTATTTAAGCCAATAGTAAGCAAA GGTTATCAZfy2 guide RNA-left hb732 caccGTTGACTCCAATAGTAAACAhb733 aaacTGTTTACTATTGGAGTCAACZfy2 guide RNA-hb734 caccgTGATAACCTTTGCTTACTATright hb735 aaacATAGTAAGCAAAGGTTATCAcLeft probe (LP)hb685 CTCATATGTCTTTACAGGTAGTAGGCAisotopic labelling: 727 bp PCRhb686 tccctaGATGCTAAGAAACAAGAfragment, cloned in pBSSK isolated EcoRI+SalI Right probe (RP)hb689 AAAGGCTAAATTTCTCTCTGAATGGT(isotopic labelling)hb690 TATATTTCCAAATCAATAACCCACA586bp PCR fragment, cloned (pBSSK. isolated BamHI HindIII) Right probe (DIG-hb690 TATATTTCCAAATCAATAACCCACAprobe) 416bp PCRhb1280 ATCGATAGCCTAACAAGAAGAGATfragment Test for single copyhb1261 TTGACTCCAATAGTACCCGCG-integration: genomic Southernhb1262 GCCAAGCTGGGTATGCCTTAblot SV40pA & MAZ site probe, 390 bp PCR Template: TgY2 Full lengthhb691 AGCAGGCACACTATCAGGTTamplification of transgenes in Zfy2hb692 CCTCCCAAACCCTGTCACATintegration site. (external genomic primers hb691 and hb692 flanking transgene insertion site)transgene PCR-fragment, fullDigest, band size Southern blot length amplificaton hb691 - hb692TgY2 5.2 kb XbaI, wt 11.1 kb LP 7.4 kb RP 6.7 kbTgY3, TgY4 6.9 kb XbaI, wt 11.1 kb LP 7.4 kb RP 9.3 kbTgX2 Coding sequence as of TgY3, no Cypt1 enhancer Integration close to Akap4 putative-enhancer locus Left homology region CAGCCTCCGAGAAGTACACAGTAGCCTGGACAATCCAAAATCCATTTGTATTTTCAGTCAATGA GAGAAAATAGGGATAGAGAACATGCATTATTGGCCTAGTGTATGTCAAGCTCTCTTTTTTATTG CTTTCCAAATTATGTAATCTCATCAGTAACCCTATGTGAAAACACTGGCTCAAAGAGGTAACATA ATTTGCTAAGGTTACCCAACCCTCACAGCTCACACTGTCTTATACTGCTTCCAATAG Right homology region TGCCTGGTCTTTCCCTGACCTTGGTAGGCAGGTTTCTCTCCCAGTACCATTGCCTGACCTTCCA AGTTTCCTTTCTCTTAAAAGCTAAATTGAAGAGGCTTAGCCCACACTATCTGTAAAACACCTTTG GATGTTACCTCCCCACTTTGCGCAGCAGTCTCTAGTGTCCAGAAAGTTTTGCCAGAGGGGATT CTCAATATCTTCAAGCTGGATATTTTCTTGTGTTTGGAATTGGGTTTCATCACTACCA Integration site ATAGTTTCAGAATCGATACCACTTTCTATTGAAGGAAGCCAACCACACAGTAAAAGGGCAGAT AAGGGAAAGATGTCAAACTTCTCAGACTATTCTGTCCTCTTTCTTTCATTATCCACTGCCGuide RNA-left hb728 caccGGTATCGATTCTGAAACTAThb729 aaacATAGTTTCAGAATCGATACCGuide RNA-right hb730 caccgTTCTTTCATTATCCACTGCChb731 aaacGGCAGTGGATAATGAAAGAAcLeft probehb1873 AAACGGCACAATGAAACCTCMix of fragments hb1873-hb1874hb1874 TGGAGGGATCATGAATAGGC(323 bp) and hb1875-hb1876hb1875 AGGGACAAAAAGTGGAGCTT(601 bp) hb1876 TGATGGAATTTGCAGAGATGARight probe (DIG-hb676 GCGGCGCCTTGCAATCTTAAprobe) hb677 CCACCTGAGTCTTTCTTGCCAFull lengthhb678 TGTATTTGTCTCCCTTGGGTCTamplification of TgX2.hb679 TCACTCTGGGGCTGGAGTTATABand size: 4,5 kb Genomic Southern blot analysis of integration EcoNI wt 12,6 kb, LP 7,2 kb RP 9 kb Primers for expression analysis by q-RT-PCR TgA, TgY1, TgY2 TgY3, Tcr-t6hb800 GAATCCATCTGTGACCCCACTCT122 bp hb801 AGACAGGCACTTCCTTATTGTTgY4, TgX2hb2150 CCTGCAAGAAGATGAGGCCA109bp Hb2151 CATGATGTTGTCGGGGGTCAGapdh hb576 TGTGTCCGTCGTGGATCTGA 150 bp

[0011] hb577 TTGCTGTTGAAGTCGCAGGAGGenotyping primers TgA, TgX1, TgY1hb542 GGATCCCATCGATTTAAAGC572 bp transgene band hb347 TAGCCAGCGTTTCTGATGTGTgOpt1hb411 AGACTATTGGCCAGGGAGG446 transgene band hb412 CAGGTTGTGGTTTTGCCCTGTgY2, TgY3hb1262 GCCAAGCTGGGTATGCCTTA390 bp transgene band hb1261 TTGACTCCAATAGTACCCGCGTgY4, tgX2hb1555 GTGCACCATCCACCCTAACA777 bp transgene band hb1969 TGCATTCTAGTTGTGGTTTGTCCSexing primers

[0012] hb455 CTGAAGCTTTTGGCTTTGAGX-band 331 bp Y-band: 302 bphb456 CCACTGCCAAATTCTTTGGt-haplotype, distal marker: MGIhb292-hb1 GAGTGACCTGCATGCCCACAAGCTGTGAccession ID: MGI:1327797 t-band: 220 bphb293-hb2 GACCTGTGGAGACAGGAAGGGTCAGTGwt-band:201 bp t-haplotype, proximal marker: MGIhb459-Vil2-L TCATGGACCAACACAAGCTCAccession ID: MGI:3033374 t-band: 195 bphb460-Vil2-R CACAAAACTGAAATCTCCCTCTCwt-band: 228 bp Probes for in situ hybridization by RNA-scope (ACDBio) SV40pA-probe Cat#423731 For tgY1, tgY2, tgY3, tgY4, tgX1 Tcr-cod.opt probe Cat#1179051-C1 For tgY4, tgX1 Myc-probe Cat#467601 Polr2a-probe Cat#312471 (positive control) Plasmids pX330-U6-Chimeric_BB-CBh- Obtained from Feng Zhang (Addgene plasmid # 42230 ; hSpCas9 [7] http: / / n2t.net / addgene:42230 ; RRID:Addgene_42230) pSUPERIOR.puro novoprolabsTable 2: List of CRISPR guide sequences for integration (perfect match) of Transgene construct on X chromosome of Cow (near AKAP4). AGACCTAGGGACAAAACAACNGG AGGGACAAAACAACAGGGATNGG TTAACAAAAATTACTACAACNGG AATCCCTTTCTGTTTCCTGANGG GCCCCTTCAGGAAACAGAAANGG GTAAATGTTTCCAAGTTGCCNGG GTTTCCAAGTTGCCAGGTCANGG GTCATGGCCCCTTGTCTCTGNGG TTCCATATCTCAGTCAATCCNGG TTCCAGGATTGACTGAGATANGG AAGTTGAATGCCCGGGTTTGNGG TTGGATTGTTCCACAAACCCNGG TTTGGATTGTTCCACAAACCNGG GTGGAACAATCCAAAGAAGCNGG TGGAACAATCCAAAGAAGCANGG TCCAAAGAAGCAGGGCCAAGNGG CCAAGTGGTTGAATACATGGNGG AATACATGGTGGAGAATTGANGG TTATCAGAAGGTTCAGAAAGNGG TCTCAAGTGATTTCATACAANGG ACATTAAAGAGGAGTTGTGGNGG CAACTCCTCTTTAATGTTGCNGG AGAAGCACATCAATCTCATTNGG GAATAATTCTACCAAGTCATNGG GTTCAGGGATTTCCATGAACNGG AAATCCCTGAACCTGAACAGNGG GAGGGGCCTGAAGAATATTGNGG GGGGATCCTCAATATTCTTCNGG CCAAAAGGTTTGGTTAGTAGNGG CCCCTACTAACCAAACCTTTNGG ATCCAAAAGGTTTGGTTAGTNGG ACCAAACCTTTTGGATTCTTNGG TCCCAAGAATCCAAAAGGTTNGG AGCTGTCCCAAGAATCCAAANGG TTCTTGGGACAGCTGAGCAANGG GAAGCAGCCAGTGGTGTCAANGG AAGCAGCCAGTGGTGTCAATNGG GGGCAGCAATCCTGAGCTGTNGG AGCAATCCTGAGCTGTAGGCNGG GCAATCCTGAGCTGTAGGCTNGG AGGCTGGGCCTCCATGATTGNGG CCATAAAACCTCAATCATGGNGG CCTCCATGATTGAGGTTTTANGG CTCCATGATTGAGGTTTTATNGG AACTGTCTGACTTTGCTTCCNGG CATCTTTATGAAACCAGGTANGG GCATCTTTATGAAACCAGGTNGG TACAGCATCTTTATGAAACCNGG ATGTGCTAGGAGTAGCCCTGNGG TGTGCTAGGAGTAGCCCTGANGG TACTGAGCGGGTATCCCTCANGG ATACTGAGCGGGTATCCCTCNGG GAGGGATACCCGCTCAGTATNGG GGATACCCGCTCAGTATTGGNGG TTGTACCTCCAATACTGAGCNGG TTTGTACCTCCAATACTGAGNGG ACATCACTTCACAACTCTGANGG Example 3 – Introduction / state of the art Diploid organisms transmit each of their two homologous chromosomes to an equal proportion of their offspring. However, when breeding animals, often one of the two alleles is of much higher value. Thus, to obtain a certain number of animals carrying the desired genetic trait, twice the number of offspring has to be produced, and individuals with the undesired trait – usually of little or no value to the breeder – are usually culled. This results in significant economic and ethical problems

[0013] . Overcoming limitations that Mendelian genetics imposes on breeding is therefore an important goal. A genetic trait of chief importance is sex. In many instances, in particular in livestock, only one of the sexes is of direct economic value and thus preferred. As an example, in dairy cattle, bred for high milk production, a prevalence of females is desired, while only a minimal number of males are required for generating offspring. Conversely in beef cattle, only male offspring is of value for meat production, females are only required for producing more males. Inducing selective lethality of conceptuses carrying the undesired trait is preferable to culling of animals after birth since it reduces suffering of animals and increases productivity. Also, if embryo death is induced early in pregnancy, little parental investment has taken place and embryos are resorbed in utero. Thus, negative consequences for the mother or the remaining conceptuses are avoided. Early embryonic death is usually achieved by synthetic lethal systems the two-components of which are separately maintained in different parent strains and crossed together in the unwanted offspring. In one study, an autosomal Cas9 transgene and a Y-chromosomal guide-RNA cassette, directed against essential embryonic genes, are inherited in combination only by male embryos, leading to their death.

[0014] . Due to incomplete in vivo mutagenesis, the system is not fully penetrant at the intended embryonic stage. Some embryos even develop to term, although often malformed and diseased, raising animal welfare concerns. A more recently developed synthetic lethal system shows 100% embryonic death of one sex prior to implantation

[0015] . However, the general drawbacks of these methods are the facts that all parents and offspring are transgenic and that the productivity / fertility of the breeding population is strongly reduced. Other methods for sex ratio distortion interfere with sex determining mechanisms. Introducing multiple DNA breaks in the Y-chromosome using the CRISPR / Cas system with guide-RNAs directed to Y- specific regions leads to shredding and loss of the Y-chromosome and hence X0 females

[0016] . Similarly, Sry knockout leads to feminized pigs

[0017] . However, the resulting animals display reproductive defects

[0016]

[0017] . Gene drives represent yet another way of propagating a genetic trait of interest in a population

[0018] . A transgenic cassette encoding the desired gene(s) is accompanied by a CRISPR / Cas expression unit. Cas-nuclease-expression is regulated by a germ cell specific promoter. Guide RNAs, also expressed from this transgene direct Cas to the wild-type (non-transgenic) chromosome where it introduces a DNA double strand break. If this is repaired using the transgenic chromosome as a template, homozygosity of the transgene results. These approaches, which have been applied in insects are inefficient in the male germline of mammals

[0019] , although some improvements have been made

[0020] . A further disadvantage of gene drives is their strict legal regulation, often prohibitory to their application and commercial use. For their application in mammalian sex ratio distortion, gene drives would also have to be equipped with transgenes inducing sex reversal or sex specific embryonic death with the drawbacks discussed above. In mammals, sex is determined at the time of fertilization by fusion of a sperm cell containing either an X- or a Y-chromosome with an egg cell resulting in female or male offspring respectively. Focusing interventions on sperm provides several advantages. It is less likely to result in abnormal, diseased and potentially suffering animals as opposed to methods involving in vivo mutagenesis of animals. Before fertilization no significant if any parental investment has taken place, hence the productivity of the breeding population is likely less affected. Ideally only half of the sperm population is compromised, making fertility defects of the breeding males less likely. Finally, selection on sperm level does not necessitate a fully transgenic breeding population which may be beneficial for public acceptance. A method for biasing sex ratio applied in cattle is sperm sorting by FACS, producing sperm fractions with either X- or Y-sperm, used for subsequent in vitro fertilization or artificial insemination for producing animals of the desired gender at a reasonably high rate

[0021]

[0022] . However, sperm sorting technology is costly for the breeder and not well established in other livestock species. Incubation of sperm samples with an antibody against an epitope on Y-sperm is another method for skewing the sex ratio claimed recently (US 10,550,177 B2). Similarly, sperm pre-treatment with commercially available products of undisclosed composition has been reported to shift offspring sex ratio towards either males or females in cattle and pigs to various degrees (reviewed in

[0023] ). Manipulation of Toll-like receptors (Tlr’s) has been reported to differentially affect the swimming behavior of X vs. Y sperm and alter the sex ratio of offspring in subsequent in vitro fertilization [24, 25]. While these methods rely on treatment of isolated sperm followed by artificial insemination, a genetic system that employs dCas9 mediated suppression of a gene required for spermatid maturation in mouse has also been described recently

[0026] . Several naturally occurring genetic systems influencing sperm fertilization potential in their favor have been reported

[0027] . The most prominent element causing transmission ratio distortion known in mammals is the mouse t-haplotype, a naturally occurring chromosomal variant able to strongly increase its transmission from t / + heterozygous males to their offspring at the expense of the wild type chromosome

[0028] . The t-haplotype achieves high transmission by a “killer-antidote” mechanism. Its “killer” genes, so-called t-distorters, act harmfully on sperm by deregulating Rho signaling pathways to hyper-activate Sperm-motility kinase

[0029] [30-32]. Since gene products are usually shared between meiotic partners, all developing sperm are compromised. t also expresses an “antidote” to these harmful t-distorter effects, termed t-complex-responder (Tcr). Tcr encodes a dominant-negative version of Smok able to bring Smok activity level back to a normal, thereby rescuing sperm function [1]. Smok-Tcr gene products are restricted to t-sperm (and not shared between spermatids), and thus, only t-sperm are rescued leading to a prevalence of t-offspring (up to 100%) [2]. A partial t-haplotype containing only Tcr but no distorters is transmitted at a lower than Mendelian ratio. This can be interpreted such that the dominant negative action of Tcr in the absence of t-disorter- mediated Smok upregulation leads to a Smok level below optimum and an advantage of the wild-type chromosome. This low transmission ratio can be phenocopied by Tcr transgenes. We have been the first reporting successful sex ratio distortion in favor of the Y chromosome with a Smok-Tcr based transgene construct randomly integrated on the Y chromosome [1]. We achieved a surplus of male offspring at a 2:1 (male / female) ratio when t-distorters were used to enhance the transmission rate of the transgenic Y chromosome, while the Tg-construct alone did not effect sex ratio distortion. In this study we used single copy integration of Tcr transgenes integrated into defined landing sites on the X or Y chromosome to achieve sex ratio distortion by design, either in favor of the non-transgenic or of the transgenic chromosome, and at a high level. Example 4 – Results Conditions for achieving the goal When designing the experiments underlying the present invention, the inventors started from several assumptions acknowledging that success of their experiments was totally speculative. Indeed, if one of their speculations did not come true, the whole set-up would likely turn out a failure. A transgene (Tg) achieving sex ratio distortion by providing one type of sperm, e.g. carrying the X or the Y chromosome, with a selective advantage over the other must fulfill several conditions. First, the expression of the Tg should take place post-meiotically, in haploid spermatids, and should be specific to spermatids, not occurring in somatic cells of the organism. Expression at the haploid stage is an important precondition for restricting the RNA to one type of sperm (which differentiate in a syncytium) and excluding it from the other. In addition, since transgenes in one way or the other need to interfere with naturally occurring gene activity, it is highly desirable that the transgene is not active in somatic tissue. If active in the latter, the health of the carrier male may be affected. Second, the transgene products, mRNA and protein, should not or only minimally be shared between Tg+ and Tg- spermatids, thereby restricting the Tg function to Tg+ sperm. Since sharing of mRNA between spermatids is the rule, non-sharing is a rare exception hard to achieve, and so far has been proven only for Smok-Tcr. Third, the expression level of the Tg must be high enough to achieve an effect. Since the X and Y chromosome are mostly silenced post meiosis, the Tg may also be affected by silencing or at least attenuation of its expression. Too high expression, on the other hand, may result in sharing of mRNA expressed from the Tg between Tg+ and Tg- spermatids, which would interfere with the selective advantage or disadvantage (depending on the strategy) of Tg+ sperm. Fourth, the Tg construct should not interfere with expression of an endogenous gene. Therefore, Tg integration into an existing gene locus may on the one hand provide an easy landing point avoiding silencing of the Tg during spermatogenesis, but on the other hand also result in inactivation of the endogenous gene, which may cause health issues in the Tg carrier. In this project we have surprisingly been able to identify appropriate landing sites on the X and Y chromosome for a Smok-Tcr construct enabling Tg expression without interfering with endogenous gene loci. We have also identified promoter-enhancer control elements allowing tissue-specific Tg expression late during spermiogenesis and at an appropriate level and specificity to achieve sex ratio distortion. Finally, we have optimized a Smok-Tcr Tg construct by identifying adequate regulatory elements enabling non-sharing and late translation of its mRNA expression product, thereby achieving high sex ratio distortion in favor of either the X or the Y chromosome. The various steps are explained in detail in the following. First attempts. We have constructed a Smok-Tcr transgene, TgA, (Fig. 1a) supposed to achieve transmission ratio distortion (TRD), and integrated it on an autosome, just downstream of Smok2a / Smok2b on chromosome 17, since we knew that this locus is active during spermiogenesis. This was confirmed by qPCR and in situ hybridization of testis sections. As expected, TgA was expressed in spermatids (Fig. 1b), though at a lower level than Smok-Tcr (Fig. 1c), but caused TRD in favor of the non-transgenic chromosome 17 (Fig 1d, Table 4). The RNA expression level of TgA and of Smok-Tcr served as reference in further studies. Since TgA was working, we aimed to induce targeted sex ratio distortion by integrating this transgene on the sex chromosomes. First, we used an integration site in the vicinity of the Y-chromosomal gene Zfy1 (Fig.2a). We employed the CRISPR / Cas9 system for site-specific transgene integration. We also integrated the same transgene in proximity of the Akap4 locus (Akap-close). However, in both lines, we surprisingly and unexpectedly observed low expression of the transgene and no significant sex ratio distortion (Fig.2b, c). Finding appropriate landing sites on the X and the Y chromosome. Both sex chromosomes are at large silenced post meiosis

[0033] , thus, finding an appropriate landing site is delicate. Since integration into a gene known to be expressed during spermatogenesis is to be avoided due to possible side effects of gene inactivation on the Tg carrier animal, the landing site must be outside gene bodies and sufficiently distant to the gene promoter to avoid interference with control elements. Therefore, we looked for landing sites in regions that become active during spermiogenesis, based on epigenetic chromatin signatures. Moreover, we intended to avoid repetitive sequences. To this end we performed Chromatin Immunoprecipitation Sequencing (ChIP-seq) experiments on nuclear material isolated from mouse testis at three time points after birth (post partum; p.p.): day (d) 12, 16, 24, and from adult testis. The first wave of spermatogenesis starts right after birth, and therefore this differentiation process can be staged. Day12 reflects the meiotic stage, day 16 marks the start of spermiogenesis (the haploid stage), day 24 a later stage of spermiogenesis in which a particular set of genes is first expressed (e.g. Smok). In addition, we investigated the transcriptomes of the same stages, day 12, 16, 24 p.p. testes and adult testis by RNA-sequencing (RNA-seq; Table 3). The combination of ChIP-seq and RNA-seq data identified the appropriate landing sites. We chose a region upstream of Zfy2 on the Y (LS-Zfy2) chromosome, which becomes active during spermiogenesis and is close to an enhancer driving late expression of Zfy2 (upregulated between d24 and adult; Fig.3a; Table 3). For the X landing site we chose a region downstream of Akap4 (LS-Akap4), also activated late during spermiogenesis and near an enhancer (Fig.3b, Table 3). In the following transgenic lines we used the landing sites LS-Zfy2 and LS-Akap4. Finding the appropriate promoter and enhancer. We searched for a more appropriate promoter. We searched for genes expressed at a moderate level from 24 days p.p. on, higher than Smok2a / Smok2b. Since the Smok-Tcr promoter was not effective enough on the Y chromosome, we speculated that a promoter escaping X / Y inactivation and becoming active on the X or Y chromosome in late spermiogenesis should be more appropriate for achieving stage-specific Tg expression at a sufficiently high level. Since most Y expressed genes activated during spermiogenesis are repetitive and promoter strength is therefore difficult to assign to a particular promoter, we focused on single copy genes located on the X chromosome. Cypt1 fulfilled all criteria for an appropriate gene discussed above. It is spermiogenesis-specific (see MGI database) and expressed from day 24 p.p. at a moderate level (Table 3). Therefore, we selected its promoter for the construction of future transgenes (Fig.4, 5). In addition, using our ChIP-seq data we identified a putative enhancer region located upstream of Cypt1, which becomes active when Cypt1 is first transcribed, as based on histone modification data (H3K27Ac+), (H3K4me1+ data not shown) indicating active enhancers (Fig.4a). In one Tg construct (TgY2) we used the Cypt1 promoter (Fig.4b), and in another construct (TgY3) we integrated in addition the putative Cypt1 enhancer upstream of the Cypt1 promoter driving Smok-Tcr expression (Fig. 4c). Correct expression in spermatids was confirmed on testis sections (Fig.4d). The expression level was now higher than for TgX1 or TgY1 (Fig.2b), but somewhat lower than for TgA (Fig.4e). We tested TgY2 and TgY3 males for TRD and achieved ratio distortion comparable to TgA integrated on the autosome, 65% non-transgenic offspring for both TgY2 and TgY3A (Fig.4f). Optimizing the TRD effect by altering the expression product of Smok-Tcr. We have tested a number of different constructs for TRD. We altered the structure (long 5’-UTR, short 5’-UTR; with or without intron following the ORF; with or without protein-TAG at the N-terminus; data not shown) to finally arrive at a construct causing sex ratio distortion. Also, during our transcriptome analysis, we identified the Zfy2 locus as stronger and more specifically germ cell expressed compared to Zfy1, in agreement with published data (Table 3,

[0034]

[0035] . We therefore used the Zfy2 locus for integration of both transgenes, tgY2 (no Cypt1 enhancer), and tgY3 (including the Cypt1 enhancer; for the latter we analyzed two independent lines, tgY3A and tgY3B). In these constructs we used a short 5’-UTR, no TAG, the ORF encoding Smok-Tcr, and no intron prior to the 3’-end. Transgenic constructs were integrated into LS-Zfy2 on the Y chromosome (Line tgY2, tgY3, tgY4) and into LS-Akap4 on the X chromosome (Line tgX1, tgX2). Highly chimaeric males were produced and tested for Tg expression and sex ratio distortion (Fig 5. and Table 4). In both cases sex ratio distortion was achieved in favor of non-transgenic offspring (Table 4). We did not observe negative effects on the growth or health of the transgenic carrier animals. We found that the effect was stable at least through (so far) two generations of backcrossing to C57BL / 6 or CD1 (Table 4). Since the effect of the Tg was not very high, approximately a 2:1 ratio of non-Tg / Tg+ offspring, we set out to increase the ratio distortion effect by trying to optimize the protein expression of the Tg mRNA. We used a codon-optimized version of Smok-Tcr, combined with the Cypt1-promoter / enhancer regulatory elements, and integrated the Tg construct into LS-Zfy2 (tgY4) and LS-Akap4 (tgX2), respectively (Fig.5a). We tested TgY4 males for transgene expression in testis sections (Fig.5b) and by qPCR (Fig.5c). The expression level was as observed for TgY2 and lower than for TgA. We tested transgenic males for sex ratio distortion. The breeding test showed that the codon-optimized versions achieved considerably higher sex ratio distortion than the previous transgenes (Fig.5d). In particular, integration of TgY4 on the Y chromosome resulted in 86% female offspring, while integration on the X chromosome led to 80% male offspring (Figure 5, Table 4). This level of sex ratio distortion is remarkable and, at least with respect to distortion in favor of the Y chromosome, is the first sex ratio distortion at such a high level achieved to date. Sex ratio distortion in favor of the transgenic chromosome. In some applications it may be desirable to transmit the transgenic chromosome at a high ratio to the offspring of Tg+ males. This could be achieved by combining the Tg constructs with one or several distorters. Previously, we have achieved high ratio transmission of an autosome or the Y chromosome by integrating the Smok-Tcr Tg construct randomly on an autosome or the Y chromosome and using in addition the t-haplotype th51-th18 encoding several t-distorters but not Tcr in animal breeding (Herrmann et al.1999). We achieved up to 85% transmission in favor of the Tg construct integrated on an autosome or 65% in favor of the transgenic Y chromosome. Here we have combined TgY2 and tgY3 integrated into LS-Zfy2 with th51-th18 on chromosome 17 to cause high ratio distortion in favor of the transgenic Y chromosome as proof of principle. We achieved up to 87% transgenic male offspring (Fig. 4f, Table 4). The effect was stable at least for so far two backcross generations (82% or 79% male offspring in two N2 backcross lines). The data show that the transmission ratio of the sex chromosomes can be manipulated at will in favor of non-transgenic or transgenic offspring. This also applies to autosomes, where we have shown TRD before using Tg constructs. We expect close to 100% transgenic male offspring in the combination of TgY4 with th51- th18. Table 3: Temporal expression profile of post-meiotically activated genes determined by RNA-seq of staged testis samples. Numbers are FPKM values.Gene location day 12 p.p. day 16 p.p. day 24 p.p. adultSmok2a chr17:13221187-13227658 0 0 1,10971 6,49179Smok2b chr17:13230262-13237189 0 0 1,0363 5,61925Cypt1 chrX:16522871-16523689 0 0,34395 13,9851 55,9598Akap4 chrX:7067514-7078606 0,270998 0,108218 97,6474 567,025Zfy2 chrY:2106174-2170409 5,27707 5,26088 4,80141 9,87906Table 4: Tg-transmission and sex-ratio distortion. Transmission rates of Tcr-transgenes from males without (tg / 0; + / +) or in presence of distorter genes (tg / 0; th51,th18).Line tg Non- tg %tg ResulttgA 102 203 33 *significantly different from wt chromosome transmission ♂♀ % ♂Sex ratio of offspring278 264 51 *from control G0 males Control group for Test of G0 animals Sex ratio of offspring214 201 52 Control group for Test of N1 and N2from N1 and N2 x B / 6 animals backcross control malestgY1 174 139 56 *Not significantly different from control grouptgX1 95 76 56 *Not significantly different from control group tgY2; + / +109 203 35 *G0; (Cypt1-pro ) Significantly different from control group tgY2 / 0; th51,th1880 29 73 *N1; (Cypt1-pro) Significantly different from control group tgY3A / 0; + / +85 159 35 *G0 generation Not significantly different from (Cypt1 pro+enh) tgY1; significantly different from control group tgY3A / 0; th51,th18129 20 87 *N1 generation Significantly different from tgY1 (Cypt1 pro+enh) Significantly different from control group tgY3A / 0; th51,th1867 15 82 *N2 backcross Not significantly different from generation x B / 6 TgY2-N1 generation tgY3A / 0; th51,th1854 14 79 *N2 backcross Not significantly different from generation x CD1 TgY2-N1 generation x B / 6 tgY3B / 0; th51,th1895 39 71 *N1 Generation Not significantly different from (Cypt1 pro+enh) tgY1 tgY425 154 14 *(Cypt1 pro+enh) Significantly different from tgY1, tgY2; significantly different from control group tgX2142 35 80 *(Cypt1 pro+enh) Significantly different from control group Transgenic males are healthy and fertile In addition, our Tg males are healthy and breed at a normal rate. Distortion in favor of the X chromosome is excellent and only paralleled by a competing approach reported recently

[0026] ; however, males of the latter are affected by slow growth with respect to wild type males and by significantly reduced fertility. Besides a strong and stable SRD effect the value of a transgenic line highly depends on the health and fertility of the transgenic males. A transgene might affect the wellbeing of a carrier animal by unintended consequences of integration, such as on- or off-target effects during Crispr / CAS mediated integration or, less likely, genomic lesions caused by the site of integration. In addition, transgene expression can be detrimental to the animal’s health. To address issues of general wellbeing, we scored G0 founder animals as well as N1 and N2 backcross animals according to the guidelines of the German Federal Institute for Risk Assessment (BfR). The health status of our transgenic lines did not differ in any way from non-transgenic lines. Thus, neither our integration procedure, nor the transgenes had a negative impact that manifests in this scoring. For the applicability of our approach in animal breeding, fertility parameters of transgenic males are of particular interest. Manipulating sperm performance could potentially have negative effects on male fertility, as observed in a recent study (Yosef, Mahata et al.2023). To investigate this, we compared the average number of embryos produced in test matings by transgenic males from our SRD lines with those from transgenic lines that did not exhibit SRD (Table 5) Successful plug rates and average embryo per pregnancy numbers were high and not significantly different between the two groups. Table 5: Fertility parameters of males Table legend: Fertility parameters of transgenic lines showing sex ratio distortion are compared to lines without effect. To test for sex ratio distortion and fertility, each male was mated with a single female for 3 to 5 days during the week and plugs were recorded. Females were checked for pregnancy visually and / or by ultrasound examination. Pregnant females were euthanized until d13.5dpc, embryos dissected and scored. Litters for line establishment and maintenance are not included here (note difference in numbers to Table 3)*Tg11-1: 2 of 5 males (m4, m5) with one plug only. Notably, lines expressing optimized Smok-Tcr, which exhibited the highest distortion effects, also maintained high fertility (Table 5). These findings indicate that our transgenic males are healthy, fertile, and consistently maintain the SRD effect across subsequent generations. Example 5 – Discussion Here a genetic system for efficient sex ratio distortion is presented. The data herein also indicate strategies to further strengthen the effect: Since fertilization success in the meiotic drag system is inversely correlated with Tcr-transgene dosage, alterations that further increase expression, improve translation and RNA stability or enhance the potency of TCR protein are likely to lead to an even stronger effect. The meiotic drag strategy we describe is most attractive, since offspring with the desired genotype / gender is non-transgenic which may improve the acceptance of our method. A small number of transgenic males may be desirable and sufficient for maintaining the pool of breeding stud males, while the vast majority of offspring has the desired sex. In addition, transgenic males are not affected by health problems. The transgene effects are stable in different genetic backgrounds. The transgene integration strategy being applied is simple and robust. It does not require stable selection, which would necessitate co-integration of selection cassettes and their subsequent removal – labor intense steps involving extensive passaging of cells. To introduce our system into livestock this will prove particularly advantageous: ES-cell technology is not available in most farm animals, instead primary cultures of somatic cells are used for generating transgenic lines by cloning. The straightforwardness of our integration strategy may allow application in such cells, which have limited proliferation potential. References Examples 1 and 2 Artus, J. and A. K. Hadjantonakis (2011). "Generation of chimeras by aggregation of embryonic stemcells with diploid or tetraploid mouse embryos." Methods Mol Biol 693: 37-56.Beard, C., K. Hochedlinger, K. Plath, A. Wutz and R. Jaenisch (2006). "Efficient method to generatesingle-copy transgenic mice by site-specific integration in embryonic stem cells." Genesis 44(1): 23-28.Clapcote, S. J. and J. C. Roder (2005). "Simplex PCR assay for sex determination in mice."Biotechniques 38(5): 702, 704, 706.Concordet, J. P. and M. Haeussler (2018). "CRISPOR: intuitive guide selection for CRISPR / Cas9genome editing experiments and screens." Nucleic Acids Res 46(W1): W242-W245.Cong, L., F. A. Ran, D. Cox, S. Lin, R. Barretto, N. Habib, P. D. Hsu, X. Wu, W. Jiang, L. A. Marraffiniand F. Zhang (2013). "Multiplex genome engineering using CRISPR / Cas systems." Science 339(6121):819-823. George, S. H., M. Gertsenstein, K. Vintersten, E. Korets-Smith, J. Murphy, M. E. Stevens, J. J. Haigh and A. Nagy (2007). "Developmental and adult phenotyping directly from mutant embryonic stem cells."Proc Natl Acad Sci U S A 104(11): 4455-4460.Getun, I. V., B. Torres and P. R. Bois (2011). "Flow cytometry purification of mouse meiotic cells." J Vis Exp(50). Gong, Z. K., S. J. Wang, Y. Q. Huang, R. Q. Zhao, Q. F. Zhu and W. Z. Lin (2014). "Identification and validation of suitable reference genes for RT-qPCR analysis in mouse testis development." Mol GenetGenomics 289(6): 1157-1169.Herrmann, B. G., B. Koschorz, K. Wertz, K. J. McLaughlin and A. Kispert (1999). "A protein kinaseencoded by the t complex responder gene causes non-mendelian inheritance." Nature 402(6758): 141-146. Laird, P. W., A. Zijderveld, K. Linders, M. A. Rudnicki, R. Jaenisch and A. Berns (1991). "Simplifiedmammalian DNA isolation procedure." Nucleic Acids Res 19(15): 4293.Ramirez-Solis, R., A. C. Davis and A. Bradley (1993). "Gene targeting in embryonic stem cells." MethodsEnzymol 225: 855-878. Veron, N., H. Bauer, A. Y. Weisse, G. Luder, M. Werber and B. G. Herrmann (2009). "Retention of gene products in syncytial spermatids promotes non-Mendelian inheritance as revealed by the t complexresponder." Genes Dev 23(23): 2705-2710.Freese, N.H., Norris, D.C., and Loraine, A.E. (2016). Integrated genome browser: visual analytics platform for genomics. Bioinformatics 32, 2089-95. Kim, D., Pertea, G., Trapnell, C., Pimentel, H., Kelley, R., and Salzberg, S.L. (2013). TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biology 14, R36. Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009). Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10, R25. Quinlan, A.R., and Hall, I.M. (2010). BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-2. Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., Salzberg, S.L., Wold, B.J., and Pachter, L. (2010). Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nature Biotechnol.28, 511-5. Trapnell, C., Hendrickson, D.G., Sauvageau, M., Goff, L., Rinn, J.L., and Pachter, L. (2012). Differential analysis of gene regulation at transcript resolution with RNA-seq. Nature Biotechnol.31, 46-53. Zhang, Y., Liu, T., Meyer, C.A., Eeckhoute, J., Johnson, D.S., Bernstein, B.E., Nusbaum, C., Myers, R.M., Brown, M., Li, W., and Liu, X.S. (2008). Model-based analysis of ChIP-Seq (MACS). Genome Biology 9, R137. Examples 3 and 41. Herrmann, B.G., et al., A protein kinase encoded by the t complex responder gene causes non-mendelian inheritance. Nature, 1999.402(6758): p.141-6.2. Veron, N., et al., Retention of gene products in syncytial spermatids promotes non-Mendelianinheritance as revealed by the t complex responder. Genes Dev, 2009.23(23): p.2705-10.3. Beard, C., et al., Efficient method to generate single-copy transgenic mice by site-specificintegration in embryonic stem cells. Genesis, 2006.44(1): p.23-8.4. George, S.H., et al., Developmental and adult phenotyping directly from mutant embryonicstem cells. Proc Natl Acad Sci U S A, 2007.104(11): p.4455-60.5. Ramirez-Solis, R., A.C. Davis, and A. Bradley, Gene targeting in embryonic stem cells. MethodsEnzymol, 1993.225: p.855-78.6. Concordet, J.P. and M. Haeussler, CRISPOR: intuitive guide selection for CRISPR / Cas9 genomeediting experiments and screens. Nucleic Acids Res, 2018.46(W1): p. W242-W245.7. Cong, L., et al., Multiplex genome engineering using CRISPR / Cas systems. Science, 2013.339(6121): p.819-23.8. Artus, J. and A.K. Hadjantonakis, Generation of chimeras by aggregation of embryonic stemcells with diploid or tetraploid mouse embryos. Methods Mol Biol, 2011.693: p.37-56.9. Laird, P.W., et al., Simplified mammalian DNA isolation procedure. Nucleic Acids Res, 1991.19(15): p.4293.10. Getun, I.V., B. Torres, and P.R. Bois, Flow cytometry purification of mouse meiotic cells. J VisExp, 2011(50).11. Gong, Z.K., et al., Identification and validation of suitable reference genes for RT-qPCR analysisin mouse testis development. Mol Genet Genomics, 2014.289(6): p.1157-69.12. Clapcote, S.J. and J.C. Roder, Simplex PCR assay for sex determination in mice. Biotechniques,2005.38(5): p.702, 704, 706.13. Douglas, C. and J.M.A. Turner, Advances and challenges in genetic technologies to producesingle-sex litters. PLoS Genet, 2020.16(7): p. e1008898.14. Yosef, I., et al., A genetic system for biasing the sex ratio in mice. EMBO Rep, 2019. 20(8): p.e48269.15. Douglas, C., et al., CRISPR-Cas9 effectors facilitate generation of single-sex litters and sex-specific phenotypes. Nat Commun, 2021.12(1): p.6926.16. Zuo, E., et al., CRISPR / Cas9-mediated targeted chromosome elimination. Genome Biol, 2017.18(1): p.224.17. Kurtz, S., et al., Knockout of the HMG domain of the porcine SRY gene causes sex reversal ingene-edited pigs. Proc Natl Acad Sci U S A, 2021.118(2).18. Bier, E., Gene drives gaining speed. Nat Rev Genet, 2022.23(1): p.5-22.19. Grunwald, H.A., et al., Super-Mendelian inheritance mediated by CRISPR-Cas9 in the femalemouse germline. Nature, 2019.566(7742): p.105-109.20. Weitzel, A.J., et al., Meiotic Cas9 expression mediates gene conversion in the male and femalemouse germline. PLoS Biol, 2021.19(12): p. e3001478.21. Holden, S.A. and S.T. Butler, Review: Applications and benefits of sexed semen in dairy and beefherds. Animal, 2018.12: p. S97-S103.22. Obuchi, T., et al., Comparative evaluation of the cost and efficiency of four types of sexingmethods for the production of dairy female calves. J Reprod Dev, 2019.65(4): p. 345-352.23. Quelhas, J., et al., Sustainable animal production: exploring the benefits of sperm sexingtechnologies in addressing critical industry challenges. Front Vet Sci, 2023.10: p.1181659.24. Umehara, T., N. Tsujita, and M. Shimada, Activation of Toll-like receptor 7 / 8 encoded by the Xchromosome alters sperm motility and provides a novel simple technology for sexing sperm. PLoS Biol, 2019.17(8): p. e3000398.25. Ren, F., et al., TLR7 / 8 signalling affects X-sperm motility via the GSK3 alpha / beta-hexokinasepathway for the efficient production of sexed dairy goat embryos. J Anim Sci Biotechnol, 2021. 12(1): p.89.26. Yosef, I., et al., Engineering mice for female-biased progeny without impacting genetic integrityand litter size. bioRxiv, 2023: p.2023.11.21.568055.27. Burt, A. and R. Trivers, Genes in conflict : the biology of selfish genetic elements. 2006,Cambridge, Mass.: Belknap Press of Harvard University Press. viii, 602 p., [8] p. of plates.28. Lyon, M.F., Transmission ratio distortion in mice. Annu Rev Genet, 2003.37: p. 393-408.29. Amaral, A. and B.G. Herrmann, RAC1 controls progressive movement and competitiveness ofmammalian spermatozoa. PLoS Genet, 2021.17(2): p. e1009308.30. Bauer, H., et al., The t complex-encoded GTPase-activating protein Tagap1 acts as atransmission ratio distorter in mice. Nat Genet, 2005.37(9): p.969-73.31. Bauer, H., et al., The t-complex-encoded guanine nucleotide exchange factor Fgd2 reveals thattwo opposing signaling pathways promote transmission ratio distortion in the mouse. Genes Dev, 2007.21(2): p. 143-7.32. Bauer, H., et al., The nucleoside diphosphate kinase gene Nme3 acts as quantitative trait locuspromoting non-Mendelian inheritance. PLoS Genet.8(3): p. e1002567.33. Turner, J.M., Meiotic sex chromosome inactivation. Development, 2007.134(10): p.1823-31.34. Nagamine, C.M., et al., The two candidate testis-determining Y genes (Zfy-1 and Zfy-2) aredifferentially expressed in fetal and adult mouse tissues. Genes Dev, 1990.4(1): p.63-74.35. Namekawa, S.H., et al., Postmeiotic sex chromatin in the male germline of mice. Curr Biol, 2006.16(7): p.660-7. Additional References Freese, N.H., Norris, D.C., and Loraine, A.E. (2016). Integrated genome browser: visual analytics platform for genomics. Bioinformatics 32, 2089-95. Harris, R.S. (2007) Improved pairwise alignment of genomic DNA. Ph.D. Thesis, The Pennsylvania State University. Jacquin, A.L.S., Odom, D.T., and Lukk, M. (2019) Crisflash: open-source software to generate CRISPR guide RNAs against genomes annotated with individual variation. Bioinformatics 35, 3146–3147 Kim, D., Pertea, G., Trapnell, C., Pimentel, H., Kelley, R., and Salzberg, S.L. (2013). TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biology 14, R36. Kumar, S., Suleski, M., Craig, J.E., Kasprowicz, A.E., Sanderford, M., Li, M., Stecher, G., and Hedges, S.B., (2022) TimeTree 5: An Expanded Resource for Species Divergence Times. Molecular Biology and Evolution, DOI: 10.1093 / molbev / msac174 Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009). Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10, R25. Quinlan, A.R., and Hall, I.M. (2010). BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-2. G. Tan, D. Polychronopoulos, B.Lenhard. (2019). CNEr: A toolkit for exploring extreme noncoding conservation. PLoS Comput Biol.15(8):e1006940. Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., Salzberg, S.L., Wold, B.J., and Pachter, L. (2010). Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nature Biotechnol.28, 511-5. Trapnell, C., Hendrickson, D.G., Sauvageau, M., Goff, L., Rinn, J.L., and Pachter, L. (2012). Differential analysis of gene regulation at transcript resolution with RNA-seq. Nature Biotechnol.31, 46-53. Zhang, Y., Liu, T., Meyer, C.A., Eeckhoute, J., Johnson, D.S., Bernstein, B.E., Nusbaum, C., Myers, R.M., Brown, M., Li, W., and Liu, X.S. (2008). Model-based analysis of ChIP-Seq (MACS). Genome Biology 9, R137.

Claims

CLAIMS 1. A nucleic acid molecule encoding a t-Responder (SMOK-Tcr) of SEQ ID NO: 3 or an amino acid sequence having Responder function being at least 65%, preferably at least 80%, more preferably at least 90% and most preferably 95% identical thereto and having or comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence being at least 65%, preferably at least 80%, more preferably at least 90% and most preferably at least 95% identical thereto, under the control of a promoter that is post-meiotically active during spermiogenesis, and wherein the nucleotide sequence is preferably codon optimized for the expression in mammalian cells.

2. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule is comprised in a vector.

3. The nucleic acid molecule of claim 2, wherein the promoter is the promoter of the mouse cysteine- rich perinuclear theca 1 (Cypt1) gene, the promoter of the mouse A-kinase anchoring protein 4 (Akap4) gene, the promoter of the cow Akap4 gene, or a promoter of a mouse gene selected from 1700008I05Rik, 4930453H23Rik, 4930557A04Rik, 4933400A11Rik, 4933436I01Rik, Arl13a, Asb9, Cpxcr1, Ctag2, Cypt2, Cypt, Fam122c, Gm14781, Gm614, Gm6760, Hypm, Ppp1r2-ps9, Satl1, Tmsb15a, Tsga8 and Zcchc13.

4. The nucleic acid molecule of any one of claims 1 to 3 further comprising an enhancer favoring the specific expression of said nucleic acid molecule during spermiogenesis wherein the enhancer is preferably the enhancer of Cypt1.

5. The nucleic acid molecule of claim 3 or 4, wherein the promoter of the mouse Cypt1 gene comprises or consists of SEQ ID NO: 4 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto; the promoter of the mouse Akap4 gene comprises or consists of SEQ ID NO: 5 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto; and / or the promoter of the cow Akap4 gene comprises or consists of SEQ ID NO: 6 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto.

6. The nucleic acid molecule of any one of claims 4 or 5, wherein the enhancer of Cypt1 comprises or consists of SEQ ID NO: 7 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto.

7. A host cell or non-human organism comprising the nucleic acid molecule of any one of claims 1 to 6.

8. The host cell or non-human organism of claim 7 comprising the nucleic acid molecule in thegenome of the host cell or non-human organism.

9. The host cell or non-human organism of claim 8, wherein the nucleic acid molecule is comprised in the Y-chromosome or the X-chromosome of the host cell or non-human organism, preferably at a location that is euchromatic during spermiogenesis.

10. The host cell or non-human organism of claim 9, wherein the nucleic acid molecule is comprised in the Y-chromosome upstream of the zinc finger protein 2, Y-linked (Zfy2) gene, and preferably within SEQ ID NO: 8 or 9 of the bulls genome or SEQ ID NO: 10 of the sheep genome; or wherein the nucleic acid molecule is comprised in the X-chromosome downstream of the A-kinase anchoring protein 4 (Akap4) gene and preferably within SEQ ID NO: 11 of the cow or bull genome.

11. The host cell of any one of claims 7 to 10, wherein the host cell is a haploid cell, preferably asperm cell such as a spermatocyte, spermatid or spermatozoon.

12. A method for the production of a male transgenic non-human organism comprising introducing the nucleic acid molecule of any one of claims 1 to 6 into the Y-chromosome at a location that is euchromatic during spermiogenesis, wherein the location is preferably upstream of the Zfy2 gene of a germ cell, embryonic cell or an egg cell or a cell derived therefrom.

13. A method for the production of a male or female transgenic non-human organism comprising introducing the nucleic acid molecule of any one of claims 1 to 6 into the X-chromosome at a location that is euchromatic during spermiogenesis, preferably downstream of the Akap4 gene of a germ cell, embryonic cell or an egg cell or a cell derived therefrom.

14. The non-human organism of any one of claims 8 to 11 or the method of claim 12 or 13, wherein the non-human organism is a mammal, preferably a rodent, a rabbit or a farm animal, wherein the rodent is preferably mouse or rat, and the farm animal is preferably cow, pig, sheep, camel, goat or horse.

15. Semen obtained or obtainable from the non-human organism of claim 14.

Citation Information

Patent Citations

  • Antibody for determining sex of sperm, and use thereof

    US10550177B2

  • Isolation of the t-complex distorters and applications thereof

    WO2007020026A1

  • Isolation of the t-complex distorters and applications thereof

    EP1752040A1

  • Nucleic acids involved in the responder phenotype and applications thereof

    US6642369B1