Systematic classification method and application of Allium vegetable resources based on different molecular markers

Abstract

The present invention belongs to the technical field of resource system classification, and discloses a system classification method and application of Allium vegetable resources based on different molecular markers. The system classification method of Allium vegetable resources based on different molecular markers includes: selection of test materials; extraction and detection of plant genomic DNA; sequence amplification and sequencing; sequence splicing and feature analysis; and construction of phylogenetic tree. The present invention selects an evolutionary tree constructed by a Bayesian method to analyze the classification and systematic evolution of Allium vegetable resources, and uses the rps16 intron of the chloroplast gene fragment, the trnL-F gene spacer, the nuclear gene ITS fragment, and the combination of three gene fragments to construct a phylogenetic tree for 78 common Allium vegetable resources, analyzes the differences in classification results of Allium vegetable resources based on different sequence sets, seeks a method suitable for the classification and identification of Allium vegetable resources and systematic evolution, and provides new ideas for the research of Allium vegetable resources.

Description

Technical Field

[0001] The invention belongs to the technical field of resource system classification, and in particular relates to a resource system classification method of Allium vegetable based on different molecular markers and application thereof. Background Art

[0002] At present, phylogenetic trees are also called phylogenetic trees, phylogenetic trees, phylogenetic trees, etc. They describe the genetic evolution history and kinship between operational taxonomic units (populations, species, individuals, genes, genomes, etc.) through topological structural diagrams of branches and nodes. Some scholars believe that there are two main research purposes of phylogenetics. One is to discover all possible branches on the phylogenetic tree and record the variations of these branches in the process of genetic evolution, and select the description method that contains all species to the maximum extent to describe these branch ends; the other is to construct the tree of life to transmit the classification information of branch ends and their mutual relationships through plant classification systematic analysis based on the variation pattern of traits, aiming to study the kinship between existing species. Commonly used phylogenetic analysis methods include distance-based methods and optimal principle-based methods. The former mainly includes the neighbor-joining method and UPGMA; the latter mainly includes the maximum parsimony method, the maximum likelihood method and the Bayesian inference method. The existing mainstream tools are based on a single optimal principle. Usually, multiple methods are executed on a morphological data set. However, the results of multiple phylogenetic inferences may be conflicting or consistent. When goals conflict with each other, usually no method can meet all goals.

[0003] Allium is a group with extremely ancient origins. In the long-term evolution process, differences at the molecular level are bound to occur, and some of the differences at the molecular level cannot be significantly expressed in morphology, so it is necessary to study Allium plants at the molecular level. At present, most of the molecular level classification of Allium vegetables is based on single gene fragments. Due to the limited amount of data and less genetic information, there are often certain defects in the classification of species with very small interspecific differences, which restricts the development of classification and identification of Allium vegetables and resource utilization.

[0004] Through the above analysis, the problems and defects of the existing technology are as follows: At present, the molecular level classification of Allium vegetables is mostly based on single gene fragments. Due to the limited amount of data and less genetic information carried, there are often certain defects in the classification of species with extremely small interspecific differences, which restricts the development of Allium vegetable classification and identification and resource utilization.

[0005] The difficulty in solving the above problems and defects is: first, sufficient Allium resources are needed to ensure sufficient genetic information; second, an organic combination of multi-gene fragment molecular markers is selected for analysis.

[0006] The significance of solving the above problems and defects is to analyze the differences in classification results of Allium vegetable resources based on different sequence sets, to seek methods suitable for the classification and identification and phylogeny of Allium vegetable resources, and to provide new ideas and methods for the subsequent research on Allium vegetable resources. Summary of the invention

[0007] In view of the problems existing in the prior art, the present invention provides a method and application of systematic classification of Allium vegetable resources based on different molecular markers.

[0008] The present invention is achieved by a method for systematically classifying Allium vegetable resources based on different molecular markers, comprising the following steps:

[0009] Step 1: Selection of test materials;

[0010] Step 2: Extraction and detection of plant genomic DNA;

[0011] Step 3: sequence amplification and sequencing;

[0012] Step 4: sequence assembly and feature analysis;

[0013] Step 5: Construction of phylogenetic tree.

[0014] Furthermore, in step one, the Allium vegetable resources of the test materials are derived from the National Vegetable Germplasm Resources Medium-term Bank, the National Asexual Reproduction and Perennial Vegetable Germplasm Resources Garden, and the Southwest China Wild Biological Germplasm Resources Bank. A small part is collected and brought back from Inner Mongolia, including common Allium vegetables such as leek, scallion, shallot, onion, etc., covering 7 groups classified under the genus Allium in my country.

[0015] Further, in step 2, the extraction and detection of the plant genomic DNA includes:

[0016] After the plant genomic DNA was extracted, it was subjected to 1% agarose gel electrophoresis to determine whether it was successfully extracted and its quality.

[0017] Further, in step 3, the amplification and sequencing of the sequence includes:

[0018] In the amplification of the ITS sequence, the amplification reaction system was set to 50 μL: 75 ng DNA template 1 μL, 0.75 μL each of forward and reverse primers, 2× Taq MasterMix 25 μL, ddH 2 O 22.5μL; reaction program: 94℃ pre-denaturation for 5min, 94℃ denaturation for 45s, 50℃ annealing for 60s, 72℃ extension for 1min, a total of 30 cycles, and finally 72℃ extension for 5min, and stored at 4℃;

[0019] In the amplification of the rps16 intron sequence, the amplification reaction system was set to 50 μL: 75 ng DNA template 1 μL, 0.75 μL of forward and reverse primers, 2× Taq MasterMix 25 μL, ddH 2 O 22.5μL; reaction procedure: 94℃ pre-denaturation for 5min, 94℃ denaturation for 45s, 60℃ annealing for 60s, 72℃ extension for 1min, a total of 30 cycles, and finally 72℃ extension for 5min, and stored at 4℃;

[0020] In the amplification of the trnL-F intergenic region sequence, the amplification reaction system was set to 50 μL: 75 ng DNA template 1 μL, 0.75 μL each of forward and reverse primers, 2× Taq MasterMix 25 μL, ddH 2 O 22.5μL; reaction program: 94℃ pre-denaturation for 5min, 94℃ denaturation for 45s, 58℃ annealing for 60s, 72℃ extension for 1min, a total of 30 cycles, and finally 72℃ extension for 5min, and stored at 4℃.

[0021] Furthermore, the amplification primers for the ITS sequence use universal primers, the universal primer sequence is SEQ ID NO: 1, including forward primer ITS1 and reverse primer ITS4; the amplification primer sequence for the rps16 intron sequence is SEQ ID NO: 2, including forward primer rpsF and reverse primer rpsR; the amplification primer sequence for the trnL-F gene spacer sequence is SEQ ID NO: 3, including forward primer F and reverse primer R.

[0022] Furthermore, after the PCR program is completed, the target fragment is detected, and 5 μL of the amplified product is taken for 2% agarose gel electrophoresis to detect whether the target band is amplified. After the concentration of the product is sufficient and there is no interference from other bands, the amplified product is purified and sequenced. Each sample is sequenced in both forward and reverse directions, and the sequencing primers used are the same as the amplification primers.

[0023] Further, in step 4, the sequence splicing and feature analysis include:

[0024] (1) Seqman was used to splice the sequencing sequences, and the primer sequences at both ends and unreliable base sequences were cut off. The sites with inconsistent results were manually corrected according to the peak graph to obtain the target sequence in fasta format;

[0025] (2) Use EditSeq software to count the length and A, T, C, and G base contents of the obtained target sequence;

[0026] (3) MEGA7.1 software was used to analyze and calculate the conserved sites, variable sites and parsimony informative sites of ITS sequences, rps16 introns and trnL-F intergenic region sequences.

[0027] Further, in step 5, the construction of the phylogenetic tree includes:

[0028] (1) The obtained sequences were aligned using the MAFFT method in PhyloSuit software, and gaps were treated as deletions;

[0029] (2) The optimal model of ITS, rps16, trnL-trnF sequences and the combination of the three sequences was calculated using the model calculation software ModelFinder;

[0030] (3) The Bayesian method of MrBayes3.2.6 software was used to construct Bayesian trees, with the number of generations set to mcmc=2000000, and the constructed evolutionary trees were evaluated by the posterior probability values ​​on the nodes;

[0031] (4) The maximum likelihood method in Iqtree software was used to construct an evolutionary tree. Bootstrap = 5000 was set during the analysis, and the constructed evolutionary tree was evaluated by the bootstrap values ​​on the nodes.

[0032] Another object of the present invention is to provide an application of the Allium vegetable resource system classification method based on different molecular markers in the classification and identification of Allium vegetable resources.

[0033] Another object of the present invention is to provide an application of the Allium vegetable resource system classification method based on different molecular markers in the Allium vegetable resource classification resource system development.

[0034] In combination with all the above technical solutions, the advantages and positive effects of the present invention are as follows: the systematic classification method of Allium vegetable resources based on different molecular markers provided by the present invention, through comparative analysis of the chloroplast genomes of major Allium plants, found that there are obvious sequence differences in the rps16 intron and the trnL-F gene spacer in the chloroplast genome, which are highly variable regions, providing more site information for the classification and identification, genetic differences, and phylogeny of species, and in previous studies, these two gene fragments are also common molecular markers, so in the present invention, the chloroplast gene fragment rps16 intron, the trnL-F gene spacer, the nuclear gene ITS fragment and the combination of the three gene fragments are used to construct a phylogenetic tree of 78 common Allium vegetable resources, analyze the differences in the classification results of Allium vegetable resources based on different sequence sets, seek methods suitable for the classification and identification and phylogeny of Allium vegetable resources, and provide new ideas and methods for the subsequent research of Allium vegetable resources.

[0035] After comparing the sequences, the present invention found that the sequences were relatively complex, so the Bayesian method and the maximum likelihood method were selected to construct a phylogenetic tree for 78 Allium vegetable resources. The two tree-building methods are highly dependent on the model, and there are differences in the model selection of different sequence data sets, and there are also differences in the model selection of different methods of the same sequence data set, so the most suitable model must be selected by model detection before constructing the evolutionary tree. The evolutionary tree results constructed by the two methods are relatively consistent, so the evolutionary tree constructed by the Bayesian method is selected to analyze the classification identification, systematic evolution, etc. of 78 Allium vegetable resources.

[0036] When the present invention reconstructs a phylogenetic tree for 78 Allium vegetable resources using data sets including ITS sequences, rps16 introns, trnL-F gene spacers, and ITS+rps16 introns+trnL-F gene spacers, it is found that the ridge-leaf Allium and Allium macrostemon of the solitary group are clustered into one branch only in the evolutionary tree constructed by the rps16 intron data set, and are not clustered into one branch in the evolutionary trees constructed by other data sets, but are scattered in the rhizome group; the Allium sibiricum of the broad-leaf group is a separate branch only in the evolutionary tree constructed by the rps16 intron data set, is clustered into one branch with wild onion materials with uncertain evolutionary positions in the evolutionary tree constructed by the ITS sequence and ITS+rps16 introns+trnL-F gene spacer data set, and is crossed with species in the rhizome group in the evolutionary tree constructed by the trnL-F gene spacer data set. This is mainly due to the fact that horizontal gene transfer, hybridization or introgression, incomplete pedigree screening, etc. between organisms cause different genes to have asynchronous genetic variation rates and different degrees of conservation during species evolution. These phenomena often affect the accuracy of the results in the process of systematic evolutionary analysis. Therefore, in order to obtain results that are closer to the true species relationship and eliminate the interference of complex evolutionary events, diverse and comprehensive evidence can be used when exploring systematic evolutionary relationships.

[0037] In the present invention, a method combining different gene fragments (ITS sequence, rps16 intron, trnL-F intergenic region, ITS+rps16 intron+trnL-F intergenic region) was used in the classification and identification and phylogenetic analysis of 78 Allium vegetable resources, which successfully distinguished the relationship between the various groups classified under the Allium genus, and clearly divided the long-tooth group, onion group, onion group, rhizome group, and thick root group. The differences and similarities between the green onions, shallots, and chives in the onion group and the onions and shallots in the onion group were clearly defined during the classification and division; the Allium vegetable resources in the long-tooth group were also gathered into one branch. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0039] Figure 1 It is a flow chart of a method for systematically classifying Allium vegetable resources based on different molecular markers provided in an embodiment of the present invention.

[0040] FIG. 2( a ) is a schematic diagram of the results of ITS gene amplification of a test plant sample provided in an embodiment of the present invention.

[0041] FIG. 2( b ) is a schematic diagram of the rps16 gene amplification results of the test plant samples provided in an embodiment of the present invention.

[0042] FIG. 2( c ) is a schematic diagram of the amplification results of the trnL-F gene of the test plant sample provided in an embodiment of the present invention.

[0043] Figure 3 It is a schematic diagram of the phylogenetic tree of Allium vegetable resources constructed based on ITS fragments provided in an embodiment of the present invention.

[0044] Figure 4 It is a schematic diagram of the phylogenetic tree of Allium vegetable resources constructed based on the rps16 fragment provided in an embodiment of the present invention.

[0045] Figure 5 It is a schematic diagram of the phylogenetic tree of Allium vegetable resources constructed based on the trnL-F fragment provided in an embodiment of the present invention.

[0046] Figure 6 It is a schematic diagram of the phylogenetic tree of Allium vegetable resources constructed based on the ITS+rps16+trnL-F fragment provided in an embodiment of the present invention.

[0047] Figure 7 It is a schematic diagram of classification comparison of 78 Allium vegetable resources based on different molecular markers provided by an embodiment of the present invention. DETAILED DESCRIPTION

[0048] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0049] In view of the problems existing in the prior art, the present invention provides a method for systematically classifying Allium vegetable resources based on different molecular markers and its application. The present invention is described in detail below in conjunction with the accompanying drawings.

[0050] like Figure 1 As shown, the method for systematic classification of Allium vegetable resources based on different molecular markers provided by the embodiment of the present invention comprises the following steps:

[0051] S101, selection of test materials;

[0052] S102, extraction and detection of plant genomic DNA;

[0053] S103, sequence amplification and sequencing;

[0054] S104, sequence assembly and feature analysis;

[0055] S105, construction of phylogenetic tree.

[0056] The present invention will be further described below in conjunction with the embodiments. 1. Summary of the invention

[0058] In the present invention, through comparative analysis of the chloroplast genomes of main Allium plants, it is found that there are obvious sequence differences in the rps16 intron and the trnL-F gene spacer in the chloroplast genome, which belong to highly variable regions and provide more site information for the classification and identification, genetic differences and phylogeny of species. In previous studies, these two gene fragments are also common molecular markers. Therefore, in this experiment, the chloroplast gene fragment rps16 intron, the trnL-F gene spacer, the nuclear gene ITS fragment and the combination of the three gene fragments are used to construct a phylogenetic tree for 78 common Allium vegetable resources, analyze the differences in the classification results of Allium vegetable resources based on different sequence sets, seek methods suitable for the classification and identification and phylogeny of Allium vegetable resources, and provide new ideas and methods for the subsequent research of Allium vegetable resources.

[0059] 2. Materials and methods

[0060] 2.1 Test materials

[0061] The 78 Allium vegetable resources used as test materials were mainly sourced from the National Vegetable Germplasm Resources Medium-term Bank, the National Asexual Reproduction and Perennial Vegetable Germplasm Resources Nursery, and the Southwest China Wildlife Germplasm Resources Bank. A small portion was collected and brought back from Inner Mongolia, including 28 species of common Allium vegetables such as leek, scallion, shallot, onion, etc., covering the 7 groups classified under the genus Allium in my country (see Table 1).

[0062] Table 1 Test materials of the present invention

[0063]

[0064]

[0065] 2.2 Extraction and detection of plant genomic DNA

[0066] After the plant genomic DNA was extracted, it was subjected to 1% agarose gel electrophoresis to determine whether it was successfully extracted and its quality.

[0067] 2.3 Sequence amplification and sequencing

[0068] SEQ ID NO: 1

[0069] tccgtaggtgaacctgcgg

[0070] tcctccgcttattgatatgc.

[0071] SEQ ID NO: 2

[0072] gtggtagaaagcaacgtgcgactt

[0073] tcgggatcgaacatcaattgcaac.

[0074] SEQ ID NO: 3

[0075] cgaaatcggtagacgctacg

[0076] atttgaactggtgacacgag.

[0077] The amplification primers of the ITS sequence in the present invention are universal primers designed by WHITE et al., forward primer ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and reverse primer ITS4 (5'-TCCTCCGCTTATTGATATGC-3'), and the primers are synthesized by Beijing Liuhe BGI Gene Technology Co., Ltd. The amplification reaction system is set to 50 μL: DNA template (about 75 ng) 1 μL, forward and reverse primers 0.75 μL each, 2×Taq MasterMix 25 μL, ddH 2 O 22.5 μL. Reaction program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 45 s, 50℃ annealing for 60 s, 72℃ extension for 1 min, a total of 30 cycles, and finally 72℃ extension for 5 min, and stored at 4℃.

[0078] The forward primer rpsF (5'-GTGGTAGAAAGCAACGTGCGACTT-3') and the reverse primer rpsR (5'-TCGGGATCGAACATCAATTGCAAC-3') designed by OXELMAN et al. were used to amplify the intron sequence of rps16. The primers were synthesized by Beijing Liuhe BGI Technology Co., Ltd. The amplification reaction system and procedure were the same as those for ITS sequence amplification, except that the annealing temperature was changed to 60°C.

[0079] The primers for amplification of the trnL-F intergenic region sequence in this study were forward primer F (5'-CGAAATCGGTAGACGCTACG-3') and reverse primer R (5'-ATTTGAACTGGTGACACGAG-3') designed by TABERLET et al., and the primers were synthesized by Beijing Liuhe BGI Technology Co., Ltd. The amplification reaction system and procedure were the same as those for ITS sequence amplification, except that the annealing temperature was changed to 58°C.

[0080] After the PCR program is completed, the target fragment is detected, and 5 μL of the amplified product is taken for 2% agarose gel electrophoresis to detect whether the target band is amplified. When the concentration of the product is sufficient and there is no interference from stray bands, the amplified product is sent to Beijing Liuhe BGI Gene Technology Co., Ltd. for purification and sequencing. To ensure the accuracy of the sequence, each sample is sequenced in both forward and reverse directions, and the sequencing primers used are the same as the amplification primers.

[0081] 2.4 Sequence assembly and feature analysis

[0082] Seqman was used to splice the sequencing sequences, and the primer sequences at both ends and unreliable base sequences were cut off. The inconsistent sites were manually corrected according to the peak graph, and finally the target sequence in fasta format was obtained. EditSeq software was used to count the length and A, T, C, and G base content of the obtained target sequence. MEGA7.1 software was used to analyze and calculate the conserved sites, variable sites, and parsimony informative sites of the ITS sequence, rps16 intron, and trnL-F intergenic region sequence.

[0083] 2.5 Construction of phylogenetic tree

[0084] The obtained sequences were aligned using the MAFFT method in PhyloSuit software, and gaps were treated as missing. The best model of ITS, rps16, trnL-trnF sequences and the combination of the three sequences was calculated using the model calculation software ModelFinder. The Bayesian Inference (BI) method of MrBayes3.2.6 software was used to construct Bayesian trees, and the running number of generations was set to mcmc=2000000, and the constructed evolutionary trees were evaluated by the posterior probability values ​​(posteriorprobabilities) on the nodes. The maximum likelihood (ML) method in Iqtree software was used to construct the evolutionary tree, and bootstrap=5000 was set in the analysis, and the constructed evolutionary tree was evaluated by the bootstrap values ​​on the nodes.

[0085] 3. Results and analysis

[0086] 3.1 Sequence amplification results

[0087] Using genomic DNA from 78 Allium vegetable resource samples as templates, the ITS sequence was amplified using primers ITS1 and ITS4. Figure 2(a) shows some of the amplification results. At the standard molecular weight of around 700bp, a clear band appeared in each sample, which is consistent with the result recorded by Tian Baohua et al. that the ITS sequence of some Allium plants was about 626bp-645bp long. No band was amplified from the negative control CK, so it can be considered that this band is the ITS sequence of our target band.

[0088] Similarly, the rps16 intron sequence was amplified using primers rps16F and rps16R with genomic DNA of 78 Allium vegetable resource samples as templates. Figure 2(b) shows some of the amplification results. At the standard molecular weight of about 800 bp, a clear band appeared in each sample, which is consistent with the result recorded by LI QQ et al. that the length of the rps16 intron sequence of some Allium plants was between 556 bp and 901 bp. No band was amplified by the negative control CK, so it can be considered that this band is our target band rps16 intron sequence.

[0089] Similarly, the PCR products of the trnL-F gene spacer region of 78 Allium vegetable resources are shown in Figure 2(c), which only shows the amplification results of some materials. A clear band appears in each sample at the standard molecular weight close to 700bp, which is consistent with the result recorded by Huang Deqing et al. that the trnL-F gene spacer region sequence of some Allium plants is about 584bp-655bp long, and the negative control CK did not amplify the band, so it can be considered that this band is our target band trnL-F gene spacer region sequence.

[0090] 3.2 Sequence feature analysis

[0091] The length and GC content of ITS, rps16 intron, and trnL-F intergenic region sequences of 78 different Allium vegetable resources were statistically analyzed (see Table 2). The ITS sequence lengths of all the tested materials ranged from 625bp to 687bp, with the longest being Allium polystellatum (I012) in the thick root group and the shortest being Allium louensis (I047) in the onion group, with a difference of only 62bp; the GC content ranged from 42.58% to 52.57%, with a large difference, with the lowest being Allium taishanensis (I028) in the rhizome group and the highest being Allium scabra (I027) in the solitary group, with both Allium ridgeleaf and Allium scabra in the solitary group exceeding 50%. The length of the rps16 intron sequence of all the tested materials was between 554bp and 858bp, the longest one was the long-tooth group of leek (E003, E004, E006, E008), and the shortest one was the solitary group of ridged leaf leek (I004); the GC content was between 28.35% and 32.67%, the lowest one was the scallion (B224) of the onion group, and the highest one was the solitary group of ridged leaf leek (I004). The length of the trnL-F gene spacer sequence of all the tested materials was between 592bp and 698bp, the longest one was 8 materials, namely onion (I049, I050, I053, D006, D027, D048, D055, D067), all of which were 698bp, and the shortest one was the rhizome group of alpine leek (I025); the GC content was between 35.05% and 36.35%, with small differences. In the statistical process of different basic characteristics of sequences, the results are not constant because the genetic evolution processes of ITS, rps16 intron, and trnL-F gene spacer sequences in the same Allium vegetable resource are not synchronized.

[0092] After alignment, the ITS sequence set of 78 Allium vegetable resources was 750bp in length, and the gaps were considered missing. Only 89 sites were conservative sites. Among the 647 variable sites, 595 were parsimony informative sites. It can be seen that the ITS sequence in the test materials has extremely rich variation. Parsimony informative sites provide more information for the construction of phylogenetic trees. However, under such rich variation, whether the sequence can be used as a data source for phylogenetic trees needs to be verified by subsequent results. After alignment, the rps16 intron sequence set was 977bp in length, and the gaps were considered missing. There were 462 sites that were conservative sites. Among the 505 variable sites, 404 were parsimony informative sites. The number of conservative sites and parsimony informative sites was equal, indicating that the sequence was relatively consistent in terms of conservation and variation during evolution. After alignment, the trnL-F intergenic region sequence set was 866 bp in length, with gaps considered as missing. There were 313 conservative sites, and 323 of the 532 variable sites were parsimony informative sites, with the number of conservative sites and parsimony informative sites being equal. In the genetic evolution of 78 Allium vegetable resources, the conservatism of the three sequences, ITS, rps16 intron, and trnL-F intergenic region, may be that the rps16 intron is higher than the trnL-F intergenic region, and the trnL-F intergenic region is higher than the ITS sequence.

[0093] Table 2 Basic characteristics of ITS, rps16 and trnL-F sequences in different species

[0094]

[0095]

[0096] 3.3 Phylogenetic analysis

[0097] The results of model selection before constructing the evolutionary tree of 78 Allium vegetable resources using the Bayesian method were as follows: the best model for ITS sequence was SYM+G4, the best model for rps16 intron sequence was GTR+F+G4, and the best model for trnL-F gene spacer sequence was HKY+F+R3; the results of model selection before constructing the evolutionary tree using the maximum likelihood method were as follows: the best model for ITS sequence was SYM+G4, the best model for rps16 intron sequence was GTR+F+R2, and the best model for trnL-F gene spacer sequence was K3Pu+F+R3; because the results of the evolutionary trees constructed by the two methods were relatively consistent, the evolutionary tree constructed by one of the methods (Bayesian method) was selected to analyze the classification, identification, and systematic evolution of 78 Allium vegetable resources.

[0098] 3.3.1 Classification results of Allium vegetable resources based on ITS sequences

[0099] The phylogenetic tree of 78 Allium vegetable resources was constructed by nuclear gene ITS sequences (see Figure 3 ). The results showed that the Allium vegetable resources in each group can be basically distinguished. Most of the materials, including garlic (A. sativum), ampaloprasum, longicuspis, and leek (A. porrum), were clustered into the same branch, forming the long-toothed group (Sect. Porrum), but a few materials were clustered into other groups. Leek (E007) was classified into the onion group (Sect. Schoenoprasum), and garlic (N0353) and longicuspis (N0905) were classified into the rhizome group (Sect. Rhizirdium).

[0100] Allium fistulosum, A. schoenoprasum, and A. ascalonicum named in the National Medium-term Library are all grouped together, forming the Schoenoprasum Group, while A. cepa and A. ascalonicum introduced from Harbin, Heilongjiang are all grouped together, forming the Onion Group. However, the allium numbered (B224) is classified into the Long Tooth Group, and the Allium fisulosum var. viviparum is classified into the Rhizome Group. Although A. schoenoprosum is not grouped with the Allium Group, it is in the large categories of the Allium Group and the Onion Group.

[0101] A. tuberosum, A. ramosum, A. tenuissimum, A. cyathophorum var. farreri, A. taishanense, A. mongolicum, A. polyrhizum, A. anisopodium, A. przewalskianum, A. sikkimense, A. strictum and A. plurifoliatum are grouped together to form the Rhizome Section (Sect. Rhizirdium). However, the A197 leek is grouped together with the resources in the Long-tooth Section.

[0102] Allium wallichii (I012) and Allium hookeri clustered together to form the Bromatorrhiza group, but Allium wallichii (168) clustered with the resources of the rhizome group.

[0103] The species A.caeruleum and A.macrostemon in the solitary group (Sect.Haplostemon) were not grouped together, but were grouped together with species in the rhizome group.

[0104] The A. victorialis of Sect. Anguium and the A. chrysanthum collected from the wild in Inner Mongolia were clustered into a separate branch.

[0105] Compared with the evolutionary tree constructed based on the chloroplast genome, except for Allium polystellatum (168) which was clustered in the rhizome group, the positions of the remaining chloroplast sequencing resources in the evolutionary tree were consistent with those in the evolutionary tree constructed based on the chloroplast genome.

[0106] 3.3.2 Classification results of Allium vegetable resources based on rps16 intron sequences

[0107] The phylogenetic tree of 78 Allium vegetable resources was constructed by using the intron sequence of the chloroplast gene rps16 (see Figure 4 ). The long-toothed group (Sect. Porrum) materials are clustered into one branch, including four species: garlic (A. sativum), southern European garlic (A. ampaloprasum), Longicus garlic (A. longicuspis), and leek (A. porrum). The southern European garlic numbered N1013 is clustered with some resources of the rhizome group.

[0108] Allium fistulosum, A. schoenoprasum, A. schoenoprosum and A. ascalonicum named in the National Medium-term Library are all grouped together to form the Schoenoprasum Group, while A. cepa and A. ascalonicum introduced from Harbin, Heilongjiang are all grouped together to form the Onion Group. However, the allium numbered B224 is classified into the Long-toothed Group, and although A. fisulosum var. viviparum and A. chrysanthum are not grouped together with the Schoenoprasum Group, they are in the large categories of the Schoenoprasum Group and the Onion Group.

[0109] The materials in the rhizome group (Sect. Rhizirdium) were mainly divided into three parts. The materials of leek (A. tuberosum), wild leek (A. ramosum), fine-leaf leek (A. tenuissimum), splendid leek (A. strictum), multi-leaf leek (A. plurifoliatum), Sichuan leek (A. cyathophorum var. farreri), Mongolian leek (A. mongolicum) and Taishan leek (A. taishanense) were grouped together, and alpine leek (I025) (A. sikkimense), Qinggan leek (A. przewalskianum) and alkali leek (A. polyrhizum) were divided into the onion group. Two wild leek, one Mongolian leek and dwarf leek (A. anisopodium) were closer to the long-tooth group. Moreover, the leek numbered A197 was grouped together with the resources in the long-tooth group.

[0110] All the starry leek (A. wallichii) and broad-leaved leek (A. hookeri) are clustered together to form the thick root group (Sect. Bromatorrhiza).

[0111] The ridge-leaved Allium caeruleum and Allium macrostemon of the solitary group (Sect. Haplostemon) were not clustered into one branch, but were clustered with some resources in the rhizome group respectively.

[0112] The Allium victorialis of the broadleaf group (Sect. Anguium) has become a separate branch and is closely related to the rhizome group.

[0113] The position of the Allium vegetable resources used for chloroplast sequencing in this evolutionary tree is consistent with that in the evolutionary tree constructed from the chloroplast genome.

[0114] 3.3.3 Classification results of Allium vegetable resources based on trnL-F intergenic region sequences

[0115] The phylogenetic tree of 78 Allium vegetable resources was constructed by using the chloroplast gene trnL-F intergenic region sequence (see Figure 5 ). The garlic (A. sativum), southern European garlic (A. ampaloprasum), Longicus garlic (A. longicuspis), and leek (A. porrum) in the material are clustered into the same branch, forming the long tooth group (Sect. Porrum), which has a closer relationship, but one leek (E007) is classified into the onion group (Sect. Schoenoprasum).

[0116] Allium fistulosum, A. schoenoprasum and A. ascalonicum named in the National Medium-term Library are all clustered into one branch, forming the Schoenoprasum Group, while A. cepa and A. ascalonicum introduced from Harbin, Heilongjiang are all clustered into one branch, forming the Cepa Group. Although A. fisulosum var. viviparum and A. schoenoprosum are not clustered with the Schoenoprasum Group, they are in the Schoenoprasum and Onion Group categories. However, the allium numbered B224 was classified into the Long-tooth Group, and the wild onion (A. chrysanthum) collected in the wild in Mongolia was classified into the Rhizome Group.

[0117] The materials in the rhizome group (Sect. Rhizirdium) are mainly divided into two parts. The materials of A. tuberosum, A. ramosum, A. plurifoliatum, A. tenuissimum and A. anisopodium are clustered together, which are closer to the long-toothed group; A. mongolicum, A. polyrhizum, A. taishanense, A. cyathophorum var. farreri, A. przewalskianum, A. sikkimense and A. strictum are clustered together, which have a closer relationship. However, the materials of A197 are clustered together with the materials in the long-toothed group.

[0118] A. wallichii and A. hookeri are clustered together to form Sect. Bromatorrhiza, but are classified into the rhizome group.

[0119] The ridge-leaved allium (A.caeruleum) and the scallion (A.macrostemon) of the solitary group (Sect.Haplostemon) are clustered into one branch and are more closely related to the onion group.

[0120] The Allium victorialis of the broadleaf group (Sect. Anguium) is not clearly divided into a separate branch, but is grouped together with some Allium vegetable resources in the rhizome group.

[0121] The position of the Allium vegetable resources used for chloroplast sequencing in this evolutionary tree is consistent with that in the evolutionary tree constructed from the chloroplast genome.

[0122] 3.3.4 Classification results of Allium vegetable resources based on ITS+rps16+trnL-F sequences

[0123] The phylogenetic tree of 78 Allium vegetable resources was constructed by combining ITS+rps16+trnL-F sequences (see Figure 6 Most of the materials, including garlic (A. sativum), European garlic (A. ampaloprasum), Longicuspis garlic (A. longicuspis), and leek (A. porrum), were clustered into the same branch, forming the long-toothed group (Sect. Porrum), which had a closer relationship. A few materials were also clustered into other groups. Leek (E007) was classified into the onion group (Sect. Schoenoprasum), European garlic (N0353, N1013) and Longicuspis garlic (N0905) were classified into the rhizome group.

[0124] Allium fistulosum, A. schoenoprasum, A. schoenoprosum and A. ascalonicum named in the National Medium-term Library are all grouped together to form the Schoenoprasum Group, but A. fisulosum var. viviparum and A. chrysanthum are not grouped together with the Schoenoprasum Group, but are grouped together with the Rhizome Group, and the allium numbered B224 is grouped into the Long Tooth Group. Allium cepa and A. ascalonicum introduced from Harbin, Heilongjiang are all grouped together to form the Onion Group (Sect. Cepa).

[0125] The rhizirdium group A. strictum, A. sikkimense, A. cyathophorum var. farreri and A. plurifoliatum are clustered into one branch, and the remaining species are clustered into one branch and have a closer relationship with the long-toothed group.

[0126] A. wallichii and A. hookeri are clustered together to form Sect. Bromatorrhiza, but are classified into the rhizome group.

[0127] The ridged-leaf allium (A.caeruleum) and scallion (A.macrostemon) of the solitary group (Sect.Haplostemon) and the allium (A.victorialis) of the broad-leaf group (Sect.Anguium) were not grouped together as a single branch, but were classified into the rhizome group.

[0128] 3.3.5 Comparison of Allium vegetable resource classification based on different sequence sets

[0129] Comparison of the classification of 78 Allium vegetable resources based on different sequences: (1) ITS sequence, (2) rps16 intron, (3) trnL-F intergenic region, and (4) ITS+rps16 intron+trnL-F intergenic region (see Figure 7 , Table 3). There are 19 Allium vegetable resources in Sect. Porrum that coexist in all molecular marker results, namely E003, E004, E006, E008, H002, N0157, N0220, N0540, N0608, N0733, N0817, N0896, N0897, N0900, N0908, N1076, T141, A197, B224, including garlic (A. sativum), southern European garlic (A. ampaloprasum), Longicus garlic (A. longicuspis), and leek (A. porrum). There is one resource, N1013, that exists in the phylogenetic tree results constructed by ITS, rps16 and trnL-F sequence sets; there are two resources, N0353 and N0905, that exist in the phylogenetic tree results constructed by rps16, trnL-F and gene combination sequence sets; and there is one resource, E007, that exists only in the phylogenetic tree results constructed by rps16 sequence set. No matter which phylogenetic tree is constructed by which sequence set, this group always includes one leek (A197) and one green onion (B224). After inquiry, the leek numbered A197 is Xinjiang leek introduced from Xinjiang in the National Medium-term Library, but its phenotypic traits are far different from most leeks and are closer to garlic. In addition, Central Asia is the origin of the long-toothed group of Allium plants. The material was in the seed state when it was stored, and its species cannot be clearly distinguished by the naked eye. Therefore, it is very likely that there was an error when it was stored, which needs to be corrected later. Material No. B224 is Huinong leek from the Ningxia Agricultural and Forestry Vegetable Room. It was placed in the green onion category when it was put into storage, and it needs to be corrected later.

[0130] It is worth mentioning that in the evolutionary trees constructed from different sequence sets, the Allium group is always more closely related to the Onion group than to other groups. In the Allium group (Sect. Schoenoprasum), there are 10 Allium vegetable resources that coexist in all molecular marker results, namely B010, B038, B043, B045, C001, C021, C032, C040, I039, and I039-1, including A. fistulosum, A. schoenoprasum, and A. ascalonicum named in the National Medium-term Library. There is one resource that exists in the evolutionary trees constructed by the sequence sets of ITS, trnL-F and gene union, namely E007; there is one resource that exists in the evolutionary trees constructed by the sequence sets of rps16 and gene union, namely Allium schoenoprosum I046, which is classified into the Allium group and the Onion group in the evolutionary trees constructed by the other two sequence sets; there are three resources that exist only in the evolutionary tree constructed by the rps16 sequence set, namely I025, I030 and I021; there are two resources that exist only in the evolutionary tree constructed by the gene union sequence set, namely I044 and I012. In the onion group (Sect. Cepa), there are 9 Allium vegetable resources that coexist in all molecular marker results, namely D006, D027, D048, D055, D067, I049, I050, I051, and I053, which are onion (A.cepa) and shallot (A.ascalonicum) introduced from Harbin, Heilongjiang. The two kinds of shallots from different sources are not the same species. After verification, the Latin name of the shallot germplasm in the National Medium-term Library is Allium fistulosum L.var caespitosum Makino, which is a variant of shallot, while the shallot introduced from Harbin, Heilongjiang is called shallot. This phenomenon of homonymous heteronyms is not uncommon in the Allium plant population, which has added difficulties to its classification. There is one resource that exists in both the phylogenetic trees constructed by the rps16 and trnL-F sequence sets, namely, A. fisulosum var. viviparum I047, but in the phylogenetic trees constructed by the other two sequence sets, it has a closer relationship with the rhizome group, and its true evolutionary position needs to be studied in combination with other materials. The resource that only exists in the phylogenetic tree constructed by the rps16 sequence set is A. chrysanthum, namely, I041; the resource that only exists in the phylogenetic tree constructed by the gene joint sequence set is I011.

[0131] As the rhizome group (Sect. Rhizirdium) with the most species in the genus Allium, there are 21 Allium vegetable resources that coexist in all molecular marker results, namely A003, A056, A187, A256, GSYJ, I009, I018, I026, I028, I033, I034, I036, I038, I042, I043, I048, I055, I056, I057, I060, and I061. In the rhizome group resources, leek (A. tuberosum), wild leek (A. ramosum), fine-leaf leek (A. tenuissimum) and dwarf leek (A. anisopodium) are more closely related, because cultivated leek is a variant of wild leek and is artificially cultivated on the basis of wild leek. It is taller than wild leek plants, but the leaves are relatively thinner. Mongolian chives (A.mongolicum), Taishan chives (A.taishanense), and alkali chives (A.polyrhizum) are closely related. All three are edible wild vegetables. They have clustered bulbs, semi-cylindrical leaves, hemispherical inflorescences, and are mostly lavender. They grow on hillsides, sandy land, and arid grasslands. In terms of phenotypic traits, growth environment, and nutritional value, Mongolian chives, Taishan chives, and alkali chives are extremely similar, so they are very likely to come from the same ancestor. A.strictum and A.sikkimense show closer relationships in the evolutionary trees constructed from the other three sequence sets except for the rps16 intron. Although Sichuan and Gansu chives (A.cyathophorum var.farreri) and Qinggan chives (A.przewalskianum) are in the rhizome group, they are relatively independent compared to other species in the group.

[0132] There are two resources of the Bromatorrhiza group that exist in the phylogenetic tree results constructed by both ITS and rps16 sequence sets, namely A. wallichii I012 and A. hookeri I058. The resource that only exists in the phylogenetic tree results constructed by rps16 sequence set is A. wallichii No. 168. The phylogenetic trees constructed by the trnL-F intergenic region and ITS+rps16 intron+trnL-F intergenic region sequence sets intersect with the rhizome group, which may be caused by different data sources, and the evolutionary rates of different genes in the same species are not synchronized.

[0133] The resources in the Haplostemon group (Sect. Haplostemon) included A.caeruleum (I004), A.macrostemon (I027) and a rhizome group material (I040) in the phylogenetic tree constructed by the trnL-F gene spacer sequence set. In the phylogenetic trees constructed by other sequence sets, they were not classified in the Haplostemon group, but were scattered in the rhizome group. It may be that the selected sequence set is not suitable for the classification and identification of Allium species in this group.

[0134] The resources in the broadleaf group (Sect. Anguium) include Allium victorialis (I044) in the phylogenetic tree results constructed by the ITS and rps16 sequence sets; the phylogenetic tree constructed by the ITS sequence set also includes the wild onion material with an uncertain evolutionary position. In the phylogenetic trees constructed by other sequence sets, it even intersects with species in the rhizome group, so the specific evolutionary position of Allium victorialis is uncertain, and we need to add other research content to further clarify its evolutionary history.

[0135] Table 3 Comparison of classification of 78 Allium vegetable resources based on different molecular markers

[0136]

[0137]

[0138] 4. With the rapid development of sequencing technology, researchers will choose to use molecular data more when constructing phylogenetic trees of species, so choosing the right tree construction method is particularly important for the results. At present, the main tree construction methods include distance-based tree construction methods represented by neighbor-joining (NJ) and discrete feature-based tree construction methods represented by maximum parsimony (MP), maximum likelihood, Bayesian method, etc. When constructing phylogenetic trees under complex sequence conditions, Bayesian method is often higher than maximum likelihood method in terms of accuracy and applicability, maximum likelihood method is higher than maximum parsimony method, and maximum parsimony method is higher than neighbor-joining method, while the running speed is just the opposite. In this study, after comparing the sequences, it was found that the sequences were relatively complex, so Bayesian method and maximum likelihood method were selected to construct phylogenetic trees for 78 Allium vegetable resources. These two tree construction methods are highly dependent on models. There are differences in model selection for different sequence data sets, and there are also differences in model selection for different methods for the same sequence data set. Therefore, it is necessary to select the most suitable model through model detection before constructing the evolutionary tree. The results of the evolutionary trees constructed by the two methods were relatively consistent, so the evolutionary tree constructed by the Bayesian method was selected to analyze the classification, identification, and systematic evolution of 78 Allium vegetable resources.

[0139] Nowadays, there are more and more studies on phylogenetics, and they are becoming more and more in-depth. When reconstructing phylogenetic relationships among a large number of species, it is found that phylogenetic trees constructed by different gene fragments may conflict with each other. When Wang Yue used ITS sequences and rps16 introns as data sources to study 10 species of Allium plants in Inner Mongolia, the systematic positions of different species in different evolutionary trees in the classification results did not completely overlap, and the aggregation methods were also quite different. The above phenomenon also occurred when the phylogenetic tree of 78 Allium vegetable resources was reconstructed using the ITS sequence, rps16 intron, trnL-F gene spacer, and ITS+rps16 intron+trnL-F gene spacer datasets in this study. The solitary group's ridged-leaf Allium and Allium macrostemon were only clustered into one branch in the evolutionary tree constructed using the rps16 intron dataset, and were not clustered into one branch in the evolutionary trees constructed using other datasets, but were scattered in the rhizome group; the broad-leaf group's Allium sibiricum was a separate branch only in the evolutionary tree constructed using the rps16 intron dataset, and was clustered into one branch with the wild onion material of uncertain evolutionary position in the evolutionary tree constructed using the ITS sequence and ITS+rps16 intron+trnL-F gene spacer dataset, and even crossed with species in the rhizome group in the evolutionary tree constructed using the trnL-F gene spacer dataset. This is mainly due to the fact that horizontal gene transfer, hybridization or introgression, incomplete pedigree screening, etc. between organisms cause different genes to have asynchronous genetic variation rates and different degrees of conservation during species evolution. These phenomena often affect the accuracy of the results in the process of systematic evolutionary analysis. Therefore, in order to obtain results that are closer to the true species relationship and eliminate the interference of complex evolutionary events, diverse and comprehensive evidence can be used when exploring systematic evolutionary relationships.

[0140] The evolution of contemporary phylogenetic analysis has undergone tremendous changes with the development of sequencing technology. Researchers are no longer limited to studying a single DNA fragment, but have developed to combining multiple gene fragments or exploring the classification and systematic evolution of species based on the transcriptome level and the whole genome level. For example, the DNA barcodes that are now more commonly used are the embodiment of the combination of multiple gene fragments. These combined fragments have the characteristics of short sequences, high versatility, sufficient variable sites, and easy amplification. SONG et al. used three different DNA barcodes developed from the variable regions of the rice chloroplast genome to construct a phylogenetic tree for 18 rice species, with a resolution of 100%. In this study, different gene fragments (ITS sequence, rps16 intron, trnL-F intergenic spacer, ITS+rps16 intron+trnL-F intergenic spacer) were combined for the classification and identification of 78 Allium vegetable resources and the systematic evolution analysis. The relationship between the various groups classified under the genus Allium was successfully distinguished, and the long tooth group, onion group, onion group, rhizome group, and thick root group were clearly divided. The differences and similarities between the scallions, shallots, and chives in the onion group and the onions and shallots in the onion group were clearly defined during classification; the allium vegetable resources in the long-tooth group were also gathered into one group.

[0141] After comparing the sequences in the present invention, it was found that the sequences were relatively complex, so the Bayesian method and the maximum likelihood method were selected to construct a phylogenetic tree for 78 allium vegetable resources. The evolutionary tree results constructed by the two methods were relatively consistent, so the evolutionary tree constructed by the Bayesian method was selected to analyze the classification and identification, phylogeny, etc. of 78 allium vegetable resources. In this study, the classification and identification of 78 allium vegetable resources and the phylogeny analysis were carried out by combining different gene fragments (ITS sequence, rps16 intron, trnL-F intergenic region, ITS+rps16 intron+trnL-F intergenic region), and the relationship between the various groups classified under the genus Allium was successfully distinguished, and the long tooth group, onion group, onion group, rhizome group, and thick root group were clearly divided. The differences and convergences between the green onions, shallots, chives in the onion group and the onions and shallots in the onion group were clarified during the classification and division; the allium vegetable resources in the long tooth group were also gathered into one branch. The differences in classification results of Allium vegetable resources based on different sequence sets were analyzed, and methods suitable for classification, identification and phylogeny of Allium vegetable resources were sought, providing new ideas and methods for subsequent research on Allium vegetable resources.

[0142] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principle of the present invention should be covered by the protection scope of the present invention. Sequence Listing <110> Institute of Vegetable and Flower Research, Chinese Academy of Agricultural Sciences <120> Systematic classification method and application of Allium vegetable resources based on different molecular markers <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 39 <212> DNA <213> Artificial Sequence <400> 1 tccgtaggtg aacctgcggt cctccgctta ttgatatgc 39 <210> 2 <211> 48 <212> DNA <213> Artificial Sequence <400> 2 gtggtagaaa gcaacgtgcg actttcggga tcgaacatca attgcaac 48 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <400> 3 cgaaatcggt agacgctacg atttgaactg gtgacacgag 40

Claims

1. A systematic classification method for Allium vegetable resources based on different molecular markers, characterized in that: The Allium vegetable resource system classification method based on different molecular markers includes: Selection of test materials; Extraction and detection of plant genomic DNA; Amplification and sequencing of sequences; Sequence assembly and feature analysis; Construction of phylogenetic trees; The amplification and sequencing of the sequence comprises: In the amplification of the ITS sequence, the amplification reaction system was set to 50 μL: 75 ng DNA template 1 μL, 0.75 μL forward and reverse primers, 2×Taq MasterMix 25 μL, ddH2O 22.5 μL; reaction procedure: 94°C pre-denaturation for 5 min, 94°C denaturation for 45 s, 50°C annealing for 60 s, 72°C extension for 1 min, a total of 30 cycles, and finally 72°C extension for 5 min, and storage at 4°C; In the amplification of the rps16 intron sequence, the amplification reaction system was set to 50 μL: 75 ng DNA template 1 μL, 0.75 μL forward and reverse primers, 2×Taq MasterMix 25 μL, ddH2O 22.5 μL; reaction procedure: 94°C pre-denaturation for 5 min, 94°C denaturation for 45 s, 60°C annealing for 60 s, 72°C extension for 1 min, a total of 30 cycles, and finally 72°C extension for 5 min, and storage at 4°C; In the amplification of the trnL-F gene spacer sequence, the amplification reaction system was set to 50 μL: 75 ng DNA template 1 μL, 0.75 μL forward and reverse primers, 2×Taq MasterMix 25 μL, ddH2O 22.5 μL; reaction procedure: 94°C pre-denaturation for 5 min, 94°C denaturation for 45 s, 58°C annealing for 60 s, 72°C extension for 1 min, a total of 30 cycles, and finally 72°C extension for 5 min, and storage at 4°C; The amplification primers for the ITS sequence are universal primers, the universal primer sequence is SEQ ID NO: 1, including forward primer ITS1 and reverse primer ITS4; the amplification primer sequence for the rps16 intron sequence is SEQ ID NO: 2, including forward primer rpsF and reverse primer rpsR; the amplification primer sequence for the trnL-F intergenic region sequence is SEQ ID NO: 3, including forward primer F and reverse primer R; The construction of the phylogenetic tree comprises: (1) The obtained sequences were aligned using the MAFFT method in PhyloSuit software, and gaps were treated as deletions; (2) The optimal model of ITS, rps16, trnL-trnF sequences and the combination of the three sequences was calculated using the model calculation software ModelFinder; (3) The Bayesian method of MrBayes3.2.6 software was used to construct Bayesian trees, the number of generations was set to mcmc = 2000000, and the constructed evolutionary trees were evaluated by the posterior probability values ​​on the nodes; (4) The maximum likelihood method in Iqtree software was used to construct an evolutionary tree. Bootstrap = 5000 was set during the analysis, and the constructed evolutionary tree was evaluated by the bootstrap values ​​on the nodes.

2. The method for systematic classification of Allium vegetable resources based on different molecular markers as claimed in claim 1, characterized in that: The Allium vegetable resources used as test materials are from the National Vegetable Germplasm Resources Medium-term Bank, the National Asexual Reproduction and Perennial Vegetable Germplasm Resources Garden, and the Southwest China Wildlife Germplasm Resources Bank, and a small part is collected and brought back from Inner Mongolia.

3. The method for systematic classification of Allium vegetable resources based on different molecular markers as claimed in claim 1, characterized in that: The extraction and detection of the plant genomic DNA comprises: After the plant genomic DNA was extracted, it was subjected to 1% agarose gel electrophoresis to determine whether it was successfully extracted and its quality.

4. The method for systematic classification of Allium vegetable resources based on different molecular markers as claimed in claim 1, characterized in that: After the PCR program is completed, the target fragment is detected. 5 μL of the amplified product is taken and subjected to 2% agarose gel electrophoresis to detect whether the target band is amplified. After the product concentration is sufficient and there is no interference from other bands, the amplified product is purified and sequenced. Each sample is sequenced in both forward and reverse directions, and the sequencing primers used are the same as the amplification primers.

5. The method for systematic classification of Allium vegetable resources based on different molecular markers as claimed in claim 1, characterized in that: The sequence splicing and feature analysis include: (1) Seqman was used to splice the sequencing sequences, and the primer sequences at both ends and unreliable base sequences were cut off. The sites with inconsistent results were manually corrected according to the peak graph to obtain the target sequence in fasta format; (2) Use EditSeq software to count the length and A, T, C, and G base contents of the obtained target sequence; (3) MEGA7.1 software was used to analyze and calculate the conserved sites, variable sites, and parsimony informative sites of the ITS sequence, rps16 intron, and trnL-F intergenic region.

6. An application of the Allium vegetable resource system classification method based on different molecular markers as described in any one of claims 1 to 5 in the classification and identification of Allium vegetable resources.

7. An application of the Allium vegetable resource systematic classification method based on different molecular markers as described in any one of claims 1 to 5 in the systematic development of Allium vegetable resource classification resources.

Images