Artificial design and application of intercellular communication systems

Abstract

The present invention relates to a new design method for an intercellular communication system, an intercellular communication system designed according to the method and its use. Specifically, the intercellular communication system of the present invention is composed of a signal sending element and a signal receiving element, wherein the signal sending element and the signal receiving element are located in different cells; wherein the signal sending element is a signal molecule biosynthesis gene expression cassette; the signal receiving element comprises an allosteric transcription factor expression cassette and an inducible promoter; wherein the allosteric transcription factor interacts with the signal molecule, and the inducible promoter comprises an operating sequence that interacts with the allosteric transcription factor; wherein the signal molecule is selected from one or more of 2,4-diacetylphloroglucinol (DAPG), p-coumaroyl-homoserine lactone (pC), isovaleryl-homoserine lactone (IV), salicylate (Sal), methicillin furan (MMF) and naringenin (NG).

Description

Technical Field

[0001] The present invention relates to the fields of bioengineering and genetic engineering. More specifically, the present invention provides a de novo design method for an intercellular communication system, an intercellular communication system designed and experimentally verified according to the method, and the use of the system in constructing a multicellular signaling network and an engineered multicellular tissue. Background Art

[0002] Cell-cell communication is essential for multicellular group behaviors such as division of labor, cooperation, and development into tissues. Intercellular signaling systems that mediate such information transmission and signal exchange functions are widely present in both prokaryotes and eukaryotes. For example, the quorum sensing system of prokaryotic cells coordinates the behavior of individual cells in the group by secreting signal molecules to respond to the environment to form biofilms, achieve bioluminescence, or control the expression of virulence factors. The various intercellular signaling transduction systems in multicellular organisms are involved in complex processes such as cell fate differentiation, morphogenesis, and coordination of multiple immune responses. The large number of different types of signaling systems naturally present in these organisms provides a variety of possibilities for the engineering of intercellular communication systems.

[0003] Several engineered cell-to-cell communication systems have been reported in the field to build genetic circuits in single-cell populations to achieve simple multicellular functions, including spatial pattern formation, prey-predator ecosystems, synchronized oscillators, biological computers, antibiotic-free pathogen control, and induced autonomous metabolism. Most of these systems are based on the well-characterized bacterial quorum sensing system. In this system, the signal molecule acyl homoserine lactone (AHL) generated from S-adenosylmethionine (SAM) and acyl carrier protein diffuses across the membrane and is sensed by allosteric transcription factors in another cell [1]. A large number of studies have shown that AHL-based multi-channel communication systems have extensive crosstalk at both the signal and promoter levels, which may be due to the overly similar structures of the various signal molecules and / or allosteric transcription factors in these systems. Various strategies have been tried to eliminate crosstalk, such as rational design of promoters [6] or directed evolution of allosteric transcription factors [7]. In addition to AHL signals, engineered cell-to-cell communication systems have also been constructed based on yeast peptide pheromones and some endogenous signal molecules [3-5]. However, since the complete biosynthetic pathways of signaling molecules in these systems are unclear or difficult to transfer to another species [2-3], their modularity and translatability are limited to a few specific cell types, or their essential precursors must be supplemented in the culture medium in order to synthesize the signaling molecules in the host cells.

[0004] In the present invention, potential intercellular communication systems are screened based on a new concept, and the signal sending and signal receiving elements are rationally designed to construct an intercellular signal communication system that can achieve highly sensitive multiple orthogonal signal communication across species. Summary of the invention

[0005] In a first aspect, the present invention provides an intercellular communication system, the intercellular communication system comprising a signal sending element and a signal receiving element, wherein the signal sending element and the signal receiving element are located in different cells; wherein,

[0006] The signal molecule is selected from one or more of 2,4-diacetylphloroglucinol (DAPG), p-coumaryl-homoserine lactone (pC), isovaleryl-homoserine lactone (IV), salicylate (Sal), methymycin furan (MMF) and naringenin (NG);

[0007] The signal sending element is a signal molecule biosynthesis gene expression cassette;

[0008] The signal receiving element comprises an allosteric transcription factor expression cassette and an inducible promoter; wherein the allosteric transcription factor interacts with the signal molecule, and the inducible promoter comprises an operator sequence that interacts with the allosteric transcription factor;

[0009] Wherein, the DAPG biosynthesis gene is the coding sequence of PhlD, PhlA, PhlB and PhlC; the allosteric transcription factor interacting with DAPG is PhlF; the operator sequence of PhlF is SEQ ID NO: 34;

[0010] Wherein, the pC biosynthesis gene is the coding sequence of TAL, 4CL and RpaI; the allosteric transcription factor interacting with pC is RpaR; the operator sequence of RpaR is SEQ ID NO: 35;

[0011] Wherein, the IV biosynthesis gene is the coding sequence of branched chain α-ketoacid dehydrogenase complex BCDH and BjaI; the allosteric transcription factor interacting with IV is BjaR; the operator sequence of BjaR is SEQ ID NO: 36;

[0012] Wherein, the Sal biosynthesis gene is selected from the coding sequence of isochorismate-pyruvate lyase and isochorismate synthase, the coding sequence of salicylate synthase or a combination thereof; the allosteric transcription factor interacting with Sal is NahR; the operator sequence of NahR is SEQ ID NO: 37;

[0013] Wherein, the MMF biosynthesis gene is the coding sequence of MmfL, MmfH and MmfP; the allosteric transcription factor interacting with MMF is MmfR; the operator sequence of MmfR is SEQ ID NO: 38;

[0014] The NG biosynthesis genes are coding sequences of TAL, 4CL, chalcone synthase A and chalcone isomerase 1; the allosteric transcription factor interacting with NG is FdeR; and the operator sequence of FdeR is SEQ ID NO: 39.

[0015] In a second aspect, the present invention provides a multicellular gene circuit, the gene circuit comprising a signal sending element and a signal receiving element present in different cells, so that each cell is coupled with the help of a signal molecule; wherein the signal molecule is selected from one or more of 2,4-diacetylphloroglucinol (DAPG), p-coumaroyl-homoserine lactone (pC), isovaleryl-homoserine lactone (IV), salicylate (Sal), methymycin furan (MMF) and naringenin (NG); the signal sending element is a signal molecule biosynthesis gene expression cassette; the signal receiving element comprises an allosteric transcription factor expression cassette and an inducible promoter; wherein the allosteric transcription factor interacts with the signal molecule, and the inducible promoter comprises an operator sequence that interacts with the allosteric transcription factor.

[0016] In a third aspect, the present invention provides use of the intercellular communication system of the first aspect in artificially constructing a multi-cellular signaling network, a multi-cellular gene circuit and / or a multi-cellular tissue.

[0017] Beneficial Effects

[0018] Synthetic biology uses biological module standardization and conceptual abstraction to "program" cells, allowing artificially designed gene networks to perform various tasks. In recent years, with the rapid development of synthetic biology, the connection between network structure and function has gradually been established, so the predictability of gene circuits and pathways has been greatly improved, making it possible to accurately and dynamically control intracellular protein nodes, pathways, and even networks. However, when single-cell functions are extended to artificial tissues and systems containing multiple cells for the purpose of building more complex networks or realizing the spatial distribution and control of signals, the multi-cellular functions that can be achieved are very limited due to the imperfect orthogonality and modularity of currently known signal systems.

[0019] In order to solve the problems of scarce module types, low modularity, signal crosstalk and poor cross-species conversion in the current multiple signal communication system, the present invention uses common intracellular metabolites between different species as precursors, selects a group of signal molecules with different structures, and redesigns its core biosynthesis gene expression box based on a new design concept, successfully constructing a cross-species multi-channel intercellular signal communication system, wherein the six signal molecules as intercellular communication media do not have signal level crosstalk with each other. Compared with the most common intercellular communication system that uses bacterial AHL molecules for signal transmission, the system of the present invention has lower crosstalk at the signal and promoter levels. In a preferred embodiment, the response sensitivity of allosteric transcription factors is improved by directed evolution, reducing the metabolic burden of host cells. In addition, by optimizing the combination of core promoter and operator sequences, the dynamic range of the induction curve (i.e., the maximum induction multiple) is expanded, and the signal-to-noise ratio of the system is improved. In particular, the six signal communication modules used in the system of the present invention do not have signal-level crosstalk with the C4, C8, 3OC6, and 3OC12 communication modules based on quorum sensing reported in the art. The system of the present invention can be used in combination with these known quorum sensing-based signal systems to construct complex logic gates, thereby realizing logical storage and output, thereby expanding the intercellular communication modules and toolboxes available in the art. As an example, we constructed dual-channel, three-channel, and four-channel multi-cellular gene circuits and a cell communication network containing seven NOR gates / co-inverters (NOR / buffers) and having AND gates and XOR gate logic to achieve spatiotemporal control of the network, the formation of spatial patterns within the group, and biological computing functions. This is also the first time in the art that four orthogonal signals between cells have been used to construct a biological calculator. The multi-channel signal communication system of the present invention can be used for more complex gene circuits to construct engineered human tissues or multi-cellular systems for other therapeutic purposes.

[0020] In particular, the intercellular communication system of the present invention can also be transferred to eukaryotic cells in a modular manner to achieve cross-species and even cross-biological communication between prokaryotes, unicellular eukaryotic organisms, and higher mammalian cells (such as human cell lines). Researchers have previously attempted to transfer the bacterial AHL communication system to mammalian cells. However, since fatty acid synthase (FAS) in mammals exists in the form of a multi-domain type II fatty acid synthase complex, the necessary precursor acyl carrier protein of the AHL communication system is locked in the complex and cannot be used for the biosynthesis of AHL molecules. Therefore, it is difficult to achieve tissue and organ reconstruction in vitro based on AHL signals. In the design of the present invention, the pC and IV signal systems use natural amino acids (L-tyrosine and L-leucine) as precursors, while the Sal, DAPG, MMF and NG signal systems are all synthesized by intracellular universal metabolites, so there is no problem of no free precursors mentioned above. In this regard, in the system of the present invention, signal molecules can be synthesized by signal sending elements without supplementing precursors, that is, the signal communication system of the present invention is a complete communication system. Compared with the previously reported dopamine and histamine-based systems [2], the cell communication system of the present invention also has better intercellular communication capabilities across species and even across biological kingdoms. The system of the present invention can be used to design and develop multi-layer gene circuits and logic gates in mammalian cells to produce complex multicellular behaviors, construct artificial tissues, or human cell lines for smart therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The present invention shows the design of the biosynthetic pathway for synthesizing signal molecules DAPG, pC, IV, Sal, MMF, NG, SCB1, uric acid, factor A, pyrone, C4, C8, 3OC6 and 3OC12 from the central metabolic pathway, as well as the allosteric transcription factors that interact with the above signal molecules.

[0022] Figure 2The characterization and optimization of the intercellular communication system of the present invention are shown. (a) Construction of each signal sending element and signal receiving element in the E. coli system. The sender cell contains a signal sending element, thereby expressing and secreting signal molecules. The illustration shows the quantitative results of the concentration of signal molecules expressed by the sender cell (top) and synthesized by chemical methods (bottom) determined by HPLC-MS. After different proportions of sender cells were added to the receiver cells for induction, the dose response curve was determined by flow cytometry (right figure), and the numbers are the dynamic range of the induction curve. The promoter Pc in the sender cell is the constitutive promoter J23111. (b) The performance of the intercellular communication system of the present invention in different host cells. The schematic diagram indicates the types of signal molecules, sender cells and receiver cells. 293T is a human HEK-293T cell line, S.cere is a cerevisiae yeast cell, and E.coli is an E. coli cell. Different proportions of sender cells were added to the receiver cells for induction and the induction curve was determined by flow cytometry, and the numbers are the dynamic range of the induction curve. For 293T receiver cells, the yellow fluorescence intensity of the reporter was normalized to the red fluorescence intensity of the constitutively expressed on the same plasmid. (c) EC50 of induction by chemically synthesized signaling molecules and induction by sender cell culture medium in a system with E. coli as transmitter and receiver. (d) EC50 obtained by induction of receivers containing wild-type or directed-evolved allosteric transcription factors using sender cell culture medium in a system with E. coli as transmitter and receiver. The directed-evolved allosteric transcription factors are PhlF with D128G and D154G mutations; and NahR with H57Q, Q168R and V216A mutations. The data given are the average fluorescence values ​​of three replicates, and the error bars correspond to the standard deviation of each measurement.

[0023] Figure 3The orthogonality of the intercellular communication system of the present invention is shown. (a)-(d) are characterizations of the signal orthogonality of the system of the present invention. (a) shows the principle diagram. When the signal molecule A secreted by the transmitter cell only activates the corresponding receiver, there is no signal level crosstalk; when the signal molecule also activates other receivers, there is signal level crosstalk. (b) The heat map shows the results of measuring the fold change of the induction intensity by flow cytometry after co-culture of different types of transmitters and receivers (10×10). (c) Among them, 8 signal channels are completely orthogonal to each other. (d) Qualitative characterization of signal orthogonality by plate diffusion method. The transmitter cell that can stably express RFP is inoculated in the middle of the plate, and ten types of receiver cells with sfGFP as the reporter are arranged around it. Numbers 1-10 indicate the corresponding receiver cells. The underlined numbers indicate the types of transmitter cells. The result figure is an overlay of TxRed, FITC channels and bright field. When the signal molecule can activate the promoter in the receiver cell, green fluorescence is expressed in the receiver cell. (e)-(g) are characterizations of the promoter orthogonality of the system of the present invention. (e) shows a schematic diagram, when the signal molecule A only activates the corresponding inducible promoter P A , there is no promoter-level crosstalk. B (f) Hybrid receiver cells containing each inducible promoter and each allosteric transcription factor combination (10×10) were constructed and induced using the corresponding signaling molecules of the allosteric transcription factors. The heat map shows the fold change of induction strength determined by flow cytometry. (g) Promoter level orthogonality of DAPG, pC, IV, Sal, MMF, NG, 3OC6 and 3OC12. All results are the average fluorescence values ​​of three flow cytometric replicates.

[0024] Figure 4is a spatial pattern formed by multi-channel intercellular gene circuits. (a) Schematic diagram of the signal transduction pattern of dual-channel, three-channel and four-channel networks. The dual-channel circuit contains two orthogonal channels, and each node (strain) contains a receiving element of one signal and a sending element of another signal. For example, the signal molecule A synthesized by strain A can activate the reporter in strain B, and the signal molecule B synthesized by strain B can activate the reporter in strain A. In the three-channel and four-channel circuits, each node (strain) contains a receiving element of one signal for receiving signals from upstream, and a sending element of another signal for sending signals to downstream nodes. In addition, adjacent nodes express a signal sending element and a signal receiving element of one channel. For example, the signal molecule A synthesized by strain A can activate the reporter in strain B, and the signal molecule B synthesized by strain B can activate the reporter in strain C. (b) Plate results of ten dual-channel circuits constructed with two of the DAPG, Sal, pC, IV and 3OC6 communication systems. The schematic diagram shows that when two orthogonal signal systems activate each other, a gradient pattern will be generated in two colonies. (c) The results of the three-channel series circuit of pC-Sal-DAPG and the three-channel series circuit of 3OC6-Sal-DAPG. (d) The results of the four-channel series circuit of pC-DAPG-3OC6-Sal. The experimental images in (b)-(d) are the superposition images of the FITC channel and the bright field. The scale bar is 0.5 cm.

[0025] Figure 5 A four-channel, three-input, seven-node communication network with AND+XOR logic gates built with pC, DAPG, Sal, and 3OC6 communication systems. (a) is the circuit diagram of the network. (b) is the truth table of the three-input AND+XOR logic gate. (c) is the output achieved by adding various input signal combinations in a flat panel system. The experimental images in (b)-(c) are the superposition images of the FITC channel and the bright field. The scale bar is 0.5 cm. DETAILED DESCRIPTION

[0026] In an organism, exogenous signals are introduced into cells by transmembrane receptors or endogenous induction factors (such as allosteric transcription factors), and downstream response programs are triggered to respond to exogenous stimuli. In the case where the exogenous signal comes from other cells or tissues, this signal transduction mechanism can realize information exchange between cells and regulate the behavior of individual cells accordingly to realize the self-organizing function required for multicellular tissues and organs. In the field of synthetic biology, modular gene circuits are usually constructed in single cells to perform specific functions (such as heavy metal ion recovery, secondary metabolite production, etc.). However, when the gene circuit is complex (for example, containing multi-layer logic gates), it is difficult to construct a complete gene circuit required to achieve a specific function in a single cell due to problems such as load limit and signal crosstalk. It has been reported in the art that each functional element is constructed in different cells, and small molecules are used as "wires" to couple and coordinate each functional element, thereby constructing a modular multicellular gene circuit. Specifically, the biosynthetic gene expression cassette of the signal molecule is placed in a cell as a signal sending element as a whole, so that the signal sending cell expresses all the enzymes required for the synthesis of the signal molecule in vivo. On the other hand, the sensing mechanism of the signal molecule is placed in another cell as a signal receiving element. Therefore, when the signal molecules synthesized and secreted by the signal sending cells are sensed by the signal receiving cells, the downstream response program is triggered, realizing the division of labor and cooperation among the cells in the group. In this article, cells containing signal sending elements are also called signal transmitters, signal sending cells or transmitter cells; cells containing signal receiving elements are also called signal receivers, signal receiving cells or receiver cells. Taking into account the modularization of the elements in the present invention, the signal communication system composed of a certain signal sending element and a receiving element can also be called the communication module of the signal.

[0027] In this field, the most commonly used system for intercellular signal transduction is the quorum sensing signal system of Gram-negative bacteria. In this system, the transmission of signals is mediated by the autoinducer synthase LuxI and the allosteric transcription factor LuxR. LuxI catalyzes the reaction in vivo with S-adenosylmethionine and acyl carrier protein as substrates to produce the signal molecule acyl homoserine lactone (N-acylhomoserine lactone, AHL), which can freely diffuse through the cell membrane; the allosteric transcription factor LuxR can bind to the AHL that diffuses into the bacteria and regulate the transcription of downstream genes. More than 10 AHL derivatives with different carbon chain lengths and substituents have been identified in Gram-negative bacteria, including N-butyryl-L-homoserine lactone (C4), N-hexanoyl-L-homoserine lactone (C6), 3-oxo-hexanoyl-L-homoserine lactone (3OC6), N-octanoyl-L-homoserine lactone (C8), 3-oxo-octanoyl-L-homoserine lactone (3OC8), N-decanoyl-L-homoserine (C10) and 3-oxo-dodecanoyl-L-homoserine lactone (3OC12). Because the structures of the signal molecules and / or the corresponding allosteric transcription factors in these systems are too similar, it is difficult to use them together in multiple signal communication systems.

[0028] Based on this, the inventors of the present invention proposed for the first time that the signal molecules of the cross-species multi-channel communication system can be screened by the following criteria: (i) the signal molecule is non-cytotoxic and can freely pass through the cell membranes of various cells (i.e., no additional expression vector is required); (ii) the corresponding allosteric transcription factor has a high sensitivity to the response of the signal molecule; (iii) the precursors required for the biosynthesis of the signal molecule are intracellular metabolites that are common in both prokaryotic and eukaryotic cells, and preferably exist in the central metabolic pathway; (iv) in order not to increase the metabolic burden of the host cell, the total number of enzymes in the simplest biosynthetic pathway of the signal molecule is preferably less than 5. By searching the KEGG database and literature, we initially selected 10 candidate signal small molecules ( Figure 1 The pathways shown in light grey are central metabolic pathways), and six of them have been successfully modularized. Placing the corresponding signaling elements and signal receiving elements in different cells can advantageously achieve intercellular communication.

[0029] In the present invention, the function of the signal sending element is to synthesize the signal molecule in vivo, and the function of the signal receiving element is to sense the signal molecule entering the cell and trigger the transcription of the downstream gene. Among them, the signal receiving element includes an allosteric transcription factor (aTF) that interacts with the signal molecule and an inducible promoter that interacts with the allosteric transcription factor, and its working principle is well known in the art. As a signal receptor, the allosteric transcription factor has a structure that includes a domain that binds to a small signal molecule (inducer) and a domain that binds to a promoter operator sequence. The binding of the allosteric transcription factor to the small molecule causes a conformational change, so that the transcription of the downstream gene controlled by the promoter is enhanced or reduced. In the art, allosteric transcription factors are also called regulatory proteins. Among them, the allosteric transcription factor that triggers or enhances the transcription of the target gene by binding to DNA is called an activator, and vice versa. The inducible promoter includes an operator sequence that can interact with the allosteric transcription factor. The operator sequence is generally located near the transcription start site of the target gene, or spatially adjacent to the transcription start site. Herein, the terms "operator site" and "operator sequence" are used interchangeably. Without wishing to be bound by theory, in the present invention, the inducible promoter may comprise more than one pair of operator sequences, and the operator site pair may be located simultaneously upstream or downstream of the transcription start site, or respectively on both sides of the transcription start site.

[0030] The term "promoter" refers to a DNA region that drives the expression or transcription of a nucleic acid sequence, and is located upstream of the synonymous strand of the gene transcription start site. RNA polymerase and regulatory proteins or transcription factors can bind to DNA at the promoter. A promoter generally comprises a transcription regulatory region (inducible promoter), an RNA polymerase recognition region, and a transcription start site. It is known in the art that the coding sequence is operably connected to the downstream of an inducible promoter, and an inducer is added at the desired time, and the transcription of the gene can be dynamically turned on or off. The term "minimal promoter" refers to a minimal transcription control unit that can initiate transcription, such as a promoter core region that only comprises an RNA polymerase recognition region and a transcription start site. In the present invention, at least one manipulation site can be added to the upstream and / or downstream of the minimal promoter to construct an inducible promoter with excellent switching performance. Without being limited by theory, multiple manipulation sites are conducive to the multimerization of repressor proteins, and therefore the switching performance of the promoter can be improved.

[0031] The term "expression cassette" used herein refers to a DNA fragment consisting of one or more genes and a sequence controlling the expression of the gene, so that the protein encoded by the gene can be expressed in a desired host cell. It is known in the art that the sequence controlling expression contained in the expression cassette optionally includes a promoter sequence, a 3' non-coding region, a transcription termination site, and polyadenylic acid (eukaryotic cells), etc. In the present invention, the expression cassette comprising a promoter and a coding sequence can be integrated into the genome or present in a plasmid vector.

[0032] A nucleic acid molecule (e.g., DNA) is said to be "capable of expressing" a polypeptide if it comprises a nucleotide sequence containing transcriptional and translational regulatory information, and such sequence is "operably linked" to a nucleotide sequence encoding the polypeptide. An operable link is a link between a regulatory DNA sequence and a DNA sequence intended to be expressed in a manner that allows the gene to be expressed in recoverable quantities as a peptide or protein. It is well known in the art that the nature of the regulatory regions required for gene expression may vary from organism to organism.

[0033] Design of signal transmitting and receiving components

[0034] There are a large number of allosteric transcription factors in the metabolic regulation of natural biological systems, which recognize and bind to signal molecules to regulate the transcriptional activity of downstream genes. Considering the cross-species applicability of the signal communication system, the present invention selects signal molecules derived from central metabolic pathways so that signal molecules can be synthesized using common intermediates (such as intermediates of amino acid metabolism or central carbon metabolism) as starting materials. In particular, bioinformatics methods can be used to mine the biosynthetic pathways of such signal molecules in a variety of organisms, reconstruct and assemble signal transmission elements.

[0035] The intercellular communication system of the present invention provides up to six new intercellular signal communication modules, as shown in Table 1, each communication module includes a signal sending element and a signal receiving element, and the signal sending element and the signal receiving element are respectively located in the signal sending cell and the signal receiving cell. The signal sending element includes a signal molecule biosynthesis gene expression cassette, so the signal sending cell can express the enzyme required to catalyze the biosynthesis of the signal molecule, thereby synthesizing a small signal molecule in the cell. Since the signal molecule has the ability to freely pass through the cell membrane, the small molecules generated thereby can diffuse into the cell culture medium and then pass through the cell membrane of, for example, the signal receiving cell. On the other hand, the signal receiving element includes an allosteric transcription factor and an inducible promoter that interact with the signal molecule. In the present invention, the binding of the allosteric transcription factor to the signal molecule triggers the transcription of the downstream gene controlled by the inducible promoter. In this way, using the signal molecule as a carrier, signal communication between different cells and the assembly of multi-cellular gene circuits are realized. In view of the orthogonality between the signal modules of the present invention, a cell may include a signal sending element of one or more signals and a signal receiving element of one or more other signals. In the present invention, the signal sending cells and signal receiving cells are only for specific signals, that is, the signal sending cells of one signal can be the signal receiving cells of another signal at the same time, such as the intermediate nodes in the logic circuit.

[0036] Table 1 Modules of engineered intercellular communication systems

[0037]

[0038]

[0039] The numbers in Table 1 give the species origins of the corresponding genes. The sequences of the signal transmitting element and the signal receiving element are shown in Table 2.

[0040] Table 2 Sequences of signal sending elements and signal receiving elements

[0041]

[0042] In some embodiments, 2,4-diacetylphloroglucinol (DAPG) is used as a signal molecule. The DAPG biosynthesis is catalyzed by polyketide synthase PhlD and 2,4-diacetylphloroglucinol synthesis proteins PhlA, PhlB and PhlC, and the allosteric transcription factor responsive to the DAPG is PhlF. Preferably, the PhlD, PhlA, PhlB, PhlC and PhlF proteins are all from Pseudomonas fluorescens. Preferably, the coding sequences of the PhlD, PhlA, PhlC, PhlB and PhlF proteins are the phlD gene, the phlACB operon and the phlF gene from Pseudomonas fluorescens, respectively.

[0043] In some embodiments, p-coumaroyl-homoserine lactone (pC) is used as a signal molecule. It is known in the art that the pC synthesis pathway in the plant-symbiotic Rhodopseudomonas palustris is incomplete [8-9, 20], so exogenous starting materials need to be added to the culture medium to achieve the biosynthesis of pC. In the present invention, tyrosine ammonia lyase TAL, 4-coumarate coenzyme A ligase 4CL and p-coumaroyl-homoserine lactone synthase RpaI are used to catalyze the synthesis of p-coumaroyl-homoserine lactone from tyrosine. RpaR that responds to pC is a LuxR family transcriptional regulator. Preferably, the TAL is from Rhodobacter sphericalus; the 4CL, RpaI and RpaR are from Rhodopseudomonas palustris. Preferably, the coding sequence of the TAL is the tal gene from Rhodopseudomonas sphericalus; the coding sequences of the 4CL, RpaI and RpaR are the 4cl, rpaI and rpaR genes from Rhodopseudomonas palustris, respectively.

[0044] In some embodiments, isovaleryl-homoserine lactone (IV) is used as a signal molecule. In the present invention, the synthesis of IV from branched-chain amino acids (isoleucine) is catalyzed by the branched-chain α-ketoacid dehydrogenase complex BCDH and the isovaleryl-homoserine lactone synthetase BjaI. The allosteric transcription factor responsive to IV is the transcription activator protein BjaR. Preferably, the branched-chain α-ketoacid dehydrogenase complex BCDH is from Streptomyces avermitilis; the isovaleryl-homoserine lactone synthetase BjaI is from Bradyrhizobium japonicum. Preferably, the coding sequence of the branched-chain α-ketoacid dehydrogenase complex BCDH is the IpdA1-bdkFGH operon from Streptomyces avermitilis [10, 21]; the coding sequences of the isovaleryl-homoserine lactone synthetase BjaI and the transcription activator protein BjaR are the bjaI and bjaR genes of Bradyrhizobium japonicum, respectively.

[0045] In some embodiments, salicylate (Sal) is used as a signal molecule. In nature, salicylate can be recognized by the allosteric transcription factor NahR of Pseudomonas putida. NahR bound to salicylate can bind to P salThe promoter interacts with each other to activate the naphthalene decomposition operon, so that the Pseudomonas putida can use salicylate as a carbon source

[13] . Based on the analysis of the KEGG database, we found two possible salicylate biosynthetic pathways, both of which use the common precursor (chorismate) of the shikimate pathway as the starting material. In some embodiments, salicylate is synthesized from chorismate derivatives with the help of isochorismate-pyruvate lyase and isochorismate synthase

[14] . In other embodiments, the above reaction is catalyzed by salicylate synthase

[15] . In other embodiments, the transmitter cell simultaneously expresses isochorismate-pyruvate lyase, isochorismate synthase and salicylate synthase. Preferably, the isochorismate-pyruvate lyase and isochorismate synthase are from Pseudomonas aeruginosa. Preferably, the salicylate synthase is from Yersinia enterocolitica. Preferably, the coding sequence of the isochorismate-pyruvate lyase and the isochorismate synthase is the pchBA two-gene operon from Pseudomonas aeruginosa. Preferably, the coding sequence of salicylic acid synthase is irp9 from Yersinia enterocolitica. The coding sequence of NahR is nahR gene from Pseudomonas putida.

[0046] In some embodiments, methicillin furan (MMF) is used as a signal molecule. Wherein, methicillin furan is generated from dihydroxyacetone phosphate by catalysis of 2-alkyl-4-hydroxymethylfuran-3-carboxylic acid biosynthetic proteins MmfL, MmfH and MmfP, and the allosteric transcription factor responding to the MMF is the TetR / AcrR family transcription regulator MmfR. Preferably, the MmfL, MmfH, MmfP and MmfR proteins are all from Streptomyces coelicolor. Preferably, the coding sequence of the MmfL, MmfH and MmfP proteins is the mmfLHP operon from Streptomyces coelicolor. The coding sequence of the MmfR is the mmfR gene from Streptomyces coelicolor.

[0047] In some embodiments, naringenin (NG) is used as a signal molecule. In the present invention, first, tyrosine ammonia lyase TAL and 4-coumarate coenzyme A ligase 4CL use malonyl coenzyme A as a precursor to synthesize p-coumaroyl-CoA from the tyrosine synthesis pathway, and then chalcone synthase A and chalcone flavonone isomerase 1 catalyze the synthesis of naringenin from p-coumaroyl-CoA. The allosteric transcription factor responsive to the MMF is the LysR family transcriptional regulator FdeR. Preferably, the TAL is from Rhodobacter sphaeroides; the 4CL is from Rhodopseudomonas palustris; the chalcone synthase is from the higher plant petunia; the chalcone isomerase is from alfalfa; and the FdeR is from the rice endophytic nitrogen-fixing bacterium Herbaspirillum seropedicae. Preferably, the coding sequence of TAL is the tal gene from Rhodobacter sphaeroides; the coding sequence of 4CL is the 4cl gene from Rhodopseudomonas palustris; the coding sequence of chalcone synthase A is the chs gene from Petunia hybrida; the coding sequence of chalcone isomerase is the chi gene from Medicago sativa L. The coding sequence of FdeR is fdeR from Herbaspirillum seropedicae.

[0048] In addition, as shown in the embodiments, the six signals in the system of the present invention do not have signal-level crosstalk with the reported C4, C8, 3OC6 and 3OC12 signals, and each communication module of the present invention can be used in combination with the C4, C8, 3OC6 or 3OC12 signal communication module. The corresponding signal sending elements and signal receiving elements are shown in Tables 1 and 2. These modules have been characterized in the art.

[0049] It will be understood by those skilled in the art that, for the signal sending element and the signal receiving element of the present invention, proteins substantially homologous to the enzymes catalyzing the biosynthesis of the above-mentioned signal molecules and the allosteric transcription factors may also be used. The term "substantially homologous" means that the protein sequence level is at least 95%, at least 98% or at least 99% identical. Homologous sequences can be coding sequences with the same function in different species. Homologs of the genes or proteins of the present invention can be easily determined by those skilled in the art.

[0050] Considering the differences in promoter structures in different species (especially prokaryotes and eukaryotes), it will be understood by those skilled in the art that when the signal sending element and the signal receiving element of the present invention are transformed into other hosts, the promoter needs to be adaptively adjusted. For example, the promoters in the biosynthetic pathway and the regulatory protein expression cassette can be adjusted. With respect to prokaryotes, different species usually have different preferences for -10 region sequences, which may affect the transcription efficiency. Therefore, the adjustment of the -10 region in the new host can increase the transcription intensity. When the promoter of prokaryotes is transferred to eukaryotic cells, the promoter needs to be adaptively designed to adapt to the transcription initiation mechanism in eukaryotic cells. The promoter that drives the expression of the biosynthetic gene of the signal molecule and the promoter that drives the expression of the aTF can be selected separately according to the species type to adjust the production of the signal small molecule and aTF. For example, in Escherichia coli, P Tet , P New , J23100, J23111, J23119, virus-derived PA1, and PN25 promoters control the biosynthesis of signaling molecules and / or the expression of allosteric transcription factors; in Saccharomyces cerevisiae, P gal , P adh or P tet The promoter controls the biosynthesis of the signal molecule and / or the expression of the allosteric transcription factor; in mammalian cells, CMV1 or CMV3G can be used to control the synthesis of the signal molecule and / or the expression of the allosteric transcription factor. The above promoters are all constitutive or inducible promoters commonly used in the art. In addition, tissue-specific promoters or inducible promoters can also be selected. With respect to the inducible promoter in the signal receiving element, as described above, the operating sequence can be combined with the above or other species-specific minimal promoters to express the signal receiving element of the present invention in a new host.

[0051] In a preferred embodiment, the sensitivity of the signal response is improved by targeted mutagenesis of the regulatory protein. In particular, Ph1F may include a D128G mutation, and NahR may include a Q168R mutation.

[0052] The purpose of intercellular communication systems

[0053] Due to the orthogonality, modularity, adjustability and combinability of the system of the present invention, the system can be easily used to construct, adjust or functionally integrate multicellular gene networks; with the help of multiple signal communications between cells, the network function can be precisely controlled to form functional artificial tissues, or to reconstruct or expand the functions of natural tissues or organs.

[0054] In some embodiments, the multicellular gene network can be used as a sensor, switch, counter, timer, converter or trigger. In some embodiments, the multicellular gene network comprises one or more logic gates selected from the following: AND gate, NOT gate, OR gate, NOR gate, NAND gate, XOR gate, XAND gate, IMPLY, NIMPLY, BUF, or a combination thereof. Methods for designing biological elements into synthetic gene circuits that perform logical functions are known in the art, for example, see WO2014093852. The terms "gene circuit", "gene network", "synthetic gene network" or "synthetic gene circuit" are used interchangeably herein and refer to any engineered composition comprising at least one nucleic acid material or construct and can perform functions including but not limited to: sensing, logic functions and regulatory functions. The nucleic acid material or construct can be naturally occurring or synthetic. Generally, an input is required to activate the synthetic biological circuit, which performs calculations and produces outputs. Some examples of synthetic gene networks include a nucleic acid operably linked to a promoter. The gene circuit may also not include additional inputs (loops).

[0055] The sending element and the receiving element of the cell-to-cell multiple signal communication system of the present invention can be transformed into another species, and the corresponding protein is expressed in the new host species and the corresponding operation is performed. Therefore, the cell-to-cell multiple signal communication system of the present invention can be used to realize signal transmission between prokaryotic cells, eukaryotic cells, and prokaryotic-eukaryotic cells, such as bacteria-bacteria, bacteria-yeast, bacteria-mammalian cells, and mammalian cells. The multi-channel cell-to-cell signal communication system of the present invention can be used to construct disease models (such as symbiotic bacteria, bacterial or fungal infection models).

[0056] Implementation of the various aspects described herein may be described by the following numbered paragraphs:

[0057] 1. An intercellular communication system, the intercellular communication system comprising a signal sending element and a signal receiving element, wherein the signal sending element and the signal receiving element are located in different cells; wherein,

[0058] The signal molecule is selected from one or more of 2,4-diacetylphloroglucinol (DAPG), p-coumaryl-homoserine lactone (pC), isovaleryl-homoserine lactone (IV), salicylate (Sal), methymycin furan (MMF) and naringenin (NG);

[0059] The signal sending element is a signal molecule biosynthesis gene expression cassette;

[0060] The signal receiving element comprises an allosteric transcription factor expression cassette and an inducible promoter; wherein the allosteric transcription factor interacts with the signal molecule, and the inducible promoter comprises an operator sequence that interacts with the allosteric transcription factor;

[0061] Wherein, the DAPG biosynthesis gene is the coding sequence of PhlD, PhlA, PhlB and PhlC; the allosteric transcription factor interacting with DAPG is PhlF; the operator sequence of PhlF is SEQ ID NO: 34;

[0062] Wherein, the pC biosynthesis gene is the coding sequence of TAL, 4CL and RpaI; the allosteric transcription factor interacting with pC is RpaR; the operator sequence of RpaR is SEQ ID NO: 35;

[0063] Wherein, the IV biosynthesis gene is the coding sequence of the branched-chain α-ketoacid dehydrogenase complex BCDH and BjaI; the allosteric transcription factor interacting with IV is BjaR; the operator sequence of BjaR is SEQ ID NO: 36;

[0064] Wherein, the Sal biosynthesis gene is selected from the coding sequence of isochorismate-pyruvate lyase and isochorismate synthase, the coding sequence of salicylate synthase or a combination thereof; the allosteric transcription factor interacting with Sal is NahR; the operator sequence of NahR is SEQ ID NO: 37;

[0065] Wherein, the MMF biosynthesis gene is the coding sequence of MmfL, MmfH and MmfP; the allosteric transcription factor interacting with MMF is MmfR; the operator sequence of MmfR is SEQ ID NO: 38;

[0066] The NG biosynthesis genes are coding sequences of TAL, 4CL, chalcone synthase A and chalcone isomerase 1; the allosteric transcription factor interacting with NG is FdeR; and the operator sequence of FdeR is SEQ ID NO: 39.

[0067] 2. The system as described in paragraph 1, wherein the coding sequences of PhID and PhIF are the phlD gene and the phlF gene of Pseudomonas fluorescens, respectively; and the coding sequences of PhlA, Phlb, and PhlC are the phlACB operon of Pseudomonas fluorescens.

[0068] 3. The system of paragraph 2, wherein the Ph1F has a D128G mutation.

[0069] 4. The system as described in paragraph 1, wherein the coding sequence of TAL is the tal gene of Rhodobacter sphaeroides; and the coding sequences of 4CL, RpaI and RpaR are the 4cl, rpaI and rpaR genes of Rhodopseudomonas palustris, respectively.

[0070] 5. The system as described in paragraph 1, wherein the coding sequence of the branched-chain α-ketoacid dehydrogenase complex BCDH is the IpdA1-bdkFGH operon of Streptomyces avermitilis; and the coding sequences of BjaI and BjaR are the bjaI and bjaR genes of Bradyrhizobium japonicum, respectively.

[0071] 6. A system as described in paragraph 1, wherein the coding sequences of isochorismate-pyruvate lyase and isochorismate synthase are the pchBA two-gene operon of Pseudomonas aeruginosa; the coding sequence of salicylate synthase is the irp9 gene of Yersinia enterocolitica; and the coding sequence of NahR is the nahR gene of Pseudomonas putida.

[0072] 7. The system of paragraph 6, wherein the NahR has a Q168R mutation.

[0073] 8. The system of paragraph 1, wherein the coding sequences of MmfL, MmfH and MmfP are the mmfLHP operon of Streptomyces coelicolor; and the coding sequence of MmfR is the mmfR gene of Streptomyces coelicolor.

[0074] 9. The system as described in paragraph 1, wherein the coding sequence of TAL is the tal gene of Rhodobacter sphaeroides; the coding sequence of 4CL is the 4cl gene of Rhodobacter palustris; the coding sequence of chalcone synthase A is the chs gene of Petunia hybrida; the coding sequence of chalcone isomerase 1 is the chi gene of Medicago sativa; and the coding sequence of FdeR is the fdeR gene of Herbaspirillum seropedicae.

[0075] 10. The system of any one of paragraphs 1-9, wherein the intercellular communication system further comprises a signal sending element and a signal receiving element of 3-oxo-hexanoyl-L-homoserine lactone (3OC6), wherein the 3OC6 biosynthesis gene is a coding sequence of LuxI; the allosteric transcription factor that interacts with 3OC6 is LuxR; and the operator sequence of LuxR is SEQ ID NO: 41.

[0076] 11. The system of any one of paragraphs 1-10, wherein the intercellular communication system further comprises a signal sending element and a signal receiving element of 3-oxo-dodecanoyl-L-homoserine lactone (3OC12), wherein the 3OC12 biosynthesis gene is a coding sequence of LasI; the allosteric transcription factor interacting with 3OC12 is LasR; and the operator sequence of LasR is SEQ ID NO: 43.

[0077] 12. The system of any of paragraphs 1-11, wherein the intercellular communication system has 1, 2, 3, 4, 5, 6, 7 or 8 channels.

[0078] 13. The system of any one of paragraphs 1-12, wherein the signal sending element and the signal receiving element each independently exist in a prokaryotic cell or a eukaryotic cell.

[0079] 14. The system of paragraph 13, wherein the prokaryotic cell is selected from an Escherichia coli cell or a Pseudomonas entomophila cell.

[0080] 15. The system of paragraph 14, wherein the promoter in the expression cassette is selected from P Tet , P New , J23100, J23111, J23119, PA1 or PN25.

[0081] 16. The system of paragraph 13, wherein the eukaryotic cell is a yeast cell.

[0082] 17. The system of paragraph 16, wherein the promoter in the expression cassette is selected from P gal , P adh or P tet .

[0083] 18. The system of paragraph 13, wherein the eukaryotic cell is a mammalian cell.

[0084] 19. The system of paragraph 18, wherein the mammalian cell is a human cell.

[0085] 20. The system of paragraph 18, wherein the mammalian cell is an immortalized cell, a primary cell, or a stem cell.

[0086] 21. The system of paragraph 18, wherein the promoter in the expression cassette is selected from CMV1 or CMV3G promoter.

[0087] 22. The system of paragraph 21, wherein the allosteric transcription factor is a fusion protein fused with VTR3.

[0088] 23. A multicellular gene circuit, the gene circuit comprising a signal sending element and a signal receiving element present in different cells, so that the cells are coupled by means of a signal molecule; wherein the signal molecule is selected from one or more of 2,4-diacetylphloroglucinol (DAPG), p-coumaroyl-homoserine lactone (pC), isovaleryl-homoserine lactone (IV), salicylate (Sal), methymycin furan (MMF) and naringenin (NG);

[0089] The signal sending element is a signal molecule biosynthesis gene expression cassette;

[0090] The signal receiving element comprises an allosteric transcription factor expression cassette and an inducible promoter; wherein the allosteric transcription factor interacts with the signal molecule, and the inducible promoter comprises an operator sequence that interacts with the allosteric transcription factor;

[0091] Wherein, the DAPG biosynthesis gene is the coding sequence of PhlD, PhlA, PhlB and PhlC; the allosteric transcription factor interacting with DAPG is PhlF; the operator sequence of PhlF is SEQ ID NO: 34;

[0092] Wherein, the pC biosynthesis gene is the coding sequence of TAL, 4CL and RpaI; the allosteric transcription factor interacting with pC is RpaR; the operator sequence of RpaR is SEQ ID NO: 35;

[0093] Wherein, the IV biosynthesis gene is the coding sequence of the branched-chain α-ketoacid dehydrogenase complex BCDH and BjaI; the allosteric transcription factor interacting with IV is BjaR; the operator sequence of BjaR is SEQ ID NO: 36;

[0094] Wherein, the Sal biosynthesis gene is selected from the coding sequence of isochorismate-pyruvate lyase and isochorismate synthase, the coding sequence of salicylate synthase or a combination thereof; the allosteric transcription factor interacting with Sal is NahR; the operator sequence of NahR is SEQ ID NO: 37;

[0095] Wherein, the MMF biosynthesis gene is the coding sequence of MmfL, MmfH and MmfP; the allosteric transcription factor interacting with MMF is MmfR; the operator sequence of MmfR is SEQ ID NO: 38;

[0096] The NG biosynthesis genes are coding sequences of TAL, 4CL, chalcone synthase A and chalcone isomerase 1; the allosteric transcription factor interacting with NG is FdeR; and the operator sequence of FdeR is SEQ ID NO: 39.

[0097] 24. The gene circuit of paragraph 23, wherein the coding sequences of PhID and PhIF are the phlD gene and the phlF gene of Pseudomonas fluorescens, respectively; and the coding sequences of PhIA, PhIB, and PhIC are the phlACB operon of Pseudomonas fluorescens.

[0098] 25. The gene circuit of paragraph 24, wherein the Ph1F has a D128G mutation.

[0099] 26. The gene circuit of paragraph 23, wherein the coding sequence of TAL is the tal gene of Rhodobacter sphaeroides; and the coding sequences of 4CL, RpaI and RpaR are the 4cl, rpaI and rpaR genes of Rhodopseudomonas palustris, respectively.

[0100] 27. The gene circuit of paragraph 23, wherein the coding sequence of the branched-chain α-ketoacid dehydrogenase complex BCDH is the IpdA1-bdkFGH operon of Streptomyces avermitilis; and the coding sequences of BjaI and BjaR are the bjaI and bjaR genes of Bradyrhizobium japonicum, respectively.

[0101] 28. The gene circuit of paragraph 23, wherein the coding sequences of isochorismate-pyruvate lyase and isochorismate synthase are the pchBA double gene operon of Pseudomonas aeruginosa; the coding sequence of salicylate synthase is the irp9 gene of Yersinia enterocolitica; and the coding sequence of NahR is the nahR gene of Pseudomonas putida.

[0102] 29. The gene circuit of paragraph 28, wherein the NahR has a Q168R mutation.

[0103] 30. The gene circuit of paragraph 23, wherein the coding sequences of MmfL, MmfH and MmfP are the mmfLHP operon of Streptomyces coelicolor; and the coding sequence of MmfR is the mmfR gene of Streptomyces coelicolor.

[0104] 31. The gene circuit of paragraph 23, wherein the coding sequence of TAL is the tal gene of Rhodobacter sphaeroides; the coding sequence of 4CL is the 4cl gene of Rhodobacter palustris; the coding sequence of chalcone synthase A is the chs gene of Petunia hybrida; the coding sequence of chalcone isomerase 1 is the chi gene of Medicago sativa; and the coding sequence of FdeR is the fdeR gene of Herbaspirillum seropedicae.

[0105] 32. The gene circuit of any of paragraphs 23-31, further comprising a signal transmitting element and a signal receiving element of 3-oxo-hexanoyl-L-homoserine lactone (3OC6), wherein the 3OC6 biosynthesis gene is a coding sequence of LuxI; the allosteric transcription factor that interacts with 3OC6 is LuxR; and the operator sequence of LuxR is SEQ ID NO: 41.

[0106] 33. The system of any of paragraphs 23-32, wherein the gene circuit further comprises a signal sending element and a signal receiving element of 3-oxo-dodecanoyl-L-homoserine lactone (3OC12), wherein the 3OC12 biosynthesis gene is a coding sequence of LasI; the allosteric transcription factor that interacts with 3OC12 is LasR; and the operator sequence of LasR is SEQ ID NO: 43.

[0107] 34. The gene circuit of any of paragraphs 23-33, wherein the gene circuit has 1, 2, 3, 4, 5, 6, 7, or 8 channels.

[0108] 35. The gene circuit of any of paragraphs 23-34, wherein the gene circuit comprises one or more of the following logic gates: an AND gate, a NOT gate, an OR gate, a NOR gate, a NAND gate, an XOR gate, an XAND gate, an INCLUSIVE gate, an INCLUSIVE NOT gate, a DIFFERENT, or a combination thereof.

[0109] 36. The gene circuit of any of paragraphs 23-35, wherein the gene circuit performs one or more functions selected from the group consisting of a sensor, a switch, a counter, a timer, a transducer, or a trigger.

[0110] 37. The gene circuit of any one of paragraphs 23-36, wherein each node of the gene circuit is independently selected from a prokaryotic cell or a eukaryotic cell.

[0111] 38. The gene circuit of paragraph 37, wherein the prokaryotic cell is selected from Escherichia coli cells or Pseudomonas entomophila cells; and the eukaryotic cell is a yeast cell or a mammalian cell.

[0112] 39. The genetic circuit of paragraph 38, wherein the mammalian cell is a human cell.

[0113] 40. The gene circuit of paragraph 39, wherein the mammalian cell is an immortalized cell, a primary cell, or a stem cell.

[0114] 41. The gene circuit of paragraph 37, wherein the gene circuit is a bacterial circuit, a bacteria-yeast cell circuit, a bacteria-mammalian cell circuit, a yeast cell-mammalian cell circuit, or a mammalian cell circuit.

[0115] 42. Use of the cell communication system of any one of paragraphs 1 to 22 or the gene circuit of any one of paragraphs 23 to 42 in implementing signal transduction between bacteria-bacteria, bacteria-yeast, bacteria-mammalian cells, yeast-mammalian cells and mammalian cells.

[0116] 43. Use of the cell communication system described in any one of paragraphs 1 to 22 or the gene circuit described in any one of paragraphs 23 to 42 in constructing artificial tissues, artificial organs or disease models.

[0117] 44. Use of the cell communication system described in any one of paragraphs 1 to 22 or the gene circuit described in any one of paragraphs 23 to 42 in smart therapy.

[0118] Example

[0119] Design concept of signal transmitting element and / or signal receiving element

[0120] For DAPG, pC, IV, Sal, MMF and NG transmitters and receivers ( Figure 2 a), design optimization is carried out based on the following concepts.

[0121] Sal signal: reported in the putative Pseudomonas putida promoter P sal (SEQ ID NO: 54) is active in Escherichia coli

[28] . The inventors of the present invention found that Sal transmitter cells expressing both isochorismate-pyruvate lyase (AEO73196.1) and isochorismate synthase (WP_003114686.1) or only salicylate synthase (WP_005168693.1) can activate P sal Recipient cells for inducible promoters ( Figure 2 a).

[0122] DAPG signal: This paper has reported the use of P phlF(SEQ ID NO: 53) was used to screen for TetR family repressor proteins

[29] . We heterologously expressed the phlACBD gene cluster of Pseudomonas fluorescens in E. coli. Co-culture experiments showed that the DAPG receiver can be activated by the DAPG transmitter.

[0123] NG signal: P has been reported fdeA The promoter (SEQ ID NO: 55) is active in Escherichia coli

[31] . In the present invention, it is used as an inducible promoter in the signal receiving element. The receiver can produce a 165-fold change in fluorescence intensity under the induction of 1 mM NG. According to our design, the synthesis of NG first requires the synthesis of p-coumaryl-CoA from the tyrosine synthesis pathway by tyrosine ammonia lyase TAL and 4-coumarate-CoA ligase 4CL. In addition, the NG signal sending element should also contain the chs and chi genes encoding from the higher plants Petunia X hybrid and alfalfa (Medicago sativa), so that NG can be synthesized using malonyl-CoA as a precursor ( Figure 1 ). Co-culture experiments showed that NG receivers can be activated by NG transmitters.

[0124] IV Inducible system: We found that the annotated putative bjaI promoter of Rhizobium japonicum (P bjaI-ptv , SEQ ID NO: 1) had a low sensitivity to IV induction. To improve the sensitivity, we redesigned the promoter. Although the BjaR operator sequence was found to have an inverted repeat sequence similar to the LuxR operator sequence

[21] , it is not known whether BjaR functions as an activator or a repressor. Based on the assumption that BjaR is a repressor, we inserted two BjaR operator sequences into P lux* The center and proximal end of the promoter backbone constructed the P bja* In addition, two BjaR operator sequences were inserted into the EsaR type promoter to construct the P bja-mut2 Promoter (SEQ ID NO: 3). bja The induction curves of a series of promoters were measured and it was found that P bja-mut2 Promoter sensitivity and P bjaI-ptv The promoters are almost identical, and P bja* The promoter has a high response sensitivity to IV induction.

[0125] pC inducible system: Similar to BjaI, the RpaI promoter from Rhodopseudomonas palustris (P rpaI-ptv, SEQ ID NO: 4) had a low sensitivity to PC induction. Since RpaR is a LuxR-type transcriptional activator protein, we speculated that the working mode of RpaR is similar to LuxR. Therefore, based on the published RpaR universal binding sequence

[22] , we adopted the same approach as that used to construct P bja* The promoter was designed in a similar manner to P rpa* Promoter (SEQ ID NO: 5). In addition, considering that P rpaI-ptv Incompatible with E. coli in the -10 zone, by replacing P rpaI-ptv The -10 region of the mutated to TACTTT while maintaining P rpaI-ptv The other parts remain unchanged, construct P bpa-mut2 Promoter (SEQ ID NO: 6). The sensitivity test results showed that P rpa-mut2 Promoter sensitivity and P rpaI-ptv The promoters are almost identical, and P rpa* The promoter has a high response sensitivity to pC induction.

[0126] MMF inducible system: MmfR is a TetR family repressor protein, and its recognition of the MmfR operator sequence has been reported

[23] . We designed 16 operator sequences by randomizing two nucleotides in the MmfR operator sequence and inserted them into P tac Promoters were obtained to obtain 12 promoters (SEQ ID NOs: 7-18). Under the conditions of 0 and 0.01 mM IPTG induction of MmfR (promoter: Ptac), the fluorescence intensity of the reporter genes downstream of the 12 promoters changed by 0-33 times. The Ptac promoter with the best performance was selected. mmf5 Named P mmf .

[0127] In addition, the four existing AHL-based induction systems were optimized as follows.

[0128] C8-inducible system: The putative C8-inducible cepI promoter of Burkholderia cenocepacia has been reported to be active in E. coli

[24] , however, the dynamic range of the C8 receptor is limited. We combined CepO with P lux* The core region of the promoter was combined to obtain a promoter P with a dynamic range of 150 cep* (SEQ ID NO: 19), as a modular inducible system for use in combination with other cellular communication systems.

[0129] 3OC6 induction system: P from Vibrio fischeri lux

[25] The -10 region of the promoter was replaced by TACTTT from TAGAGT.lux* (SEQ ID NO: 20) showed a higher dynamic range due to the reduction of background expression. lux* The dynamic range is 185.

[0130] C4 induction system: It has been reported in the art that P lux The operator sequence of Pseudomonas aeruginosa was replaced with the rhlA operator sequence (for RhlR) to construct the C4 inducible promoter P rhl*-catLVA

[26] . We will rhl*-catLVA The -10 region of the promoter was replaced with TACTTT to reduce the background expression and obtain P rhl* (SEQ ID NO: 21), C4 induced P rhl* The dynamic range is 124.

[0131] 3OC12 inducible system: by inserting the LasI operator sequence

[27] that specifically binds to LasR into the P lux * The promoter was designed as an inducible promoter responsive to 3OC12 las* (SEQ ID NO: 22), 3OC12 induced P las* The dynamic range is 82.

[0132] The construction of each transmitter plasmid and receiver plasmid is detailed in the Methods section.

[0133] Characterization of each communication system

[0134] First, the dynamic range of each inducible promoter in the receiver cells in response to different concentrations of signal molecules secreted by the corresponding sender cells was quantitatively measured using two strategies: (i) adding sender cells to receiver cells at different initial ratios to construct a co-culture system; or (ii) diluting the supernatant of sender cells cultured overnight with fresh culture medium at different ratios and adding receiver cells to it; then measuring the fluorescence intensity of GFP in the receiver cells by flow cytometry, and calculating the dynamic range of induction based on the change in the intensity of GFP in the receiver with the concentration of sender cells. The quantitative results obtained by the two methods are basically consistent. Figure 2 As shown in a, the inducible promoters in each receiver cell were significantly activated by the signal molecules produced by the sender cell. For the DAPG, Sal, pC, IV, NG and MMF signal communication systems, the dynamic range was 10-fold to 1380-fold ( Figure 2 a) In addition, if Figure 2 As shown in FIG. 1 , the Sal sending elements constructed by two strategies in the present invention can effectively produce salicylic acid.

[0135] For the sensitivity of the inducible promoter, the induction curve was fitted with the Hill equation to calculate the half-maximum effective concentration, i.e., the EC50 value. Figure 2 c shows that when chemically synthesized small molecules were added as inducers, the EC50 of the pC-RpaR, IV-BjaR, Sal-NahR, DAPG-PhlF, and NG-FdeR induction systems were 4×10 -10 mol / L、3×10 -8 mol / L、6×10 -6 mol / L、1.7×10 -5 mol / L and 5.1×10 -5 mol / L. Without wishing to be bound by theory, lower EC50 values ​​correspond to higher sensitivity and therefore less metabolic burden on the host cells. Furthermore, signaling molecules in the culture supernatant of the sender cells were quantified by high performance liquid chromatography-mass spectrometry (HPLC-MS) ( Figure 2 The amount of signaling molecules produced by sender cells measured in this way was plotted against the induction strength, and the EC50 values ​​obtained by fitting the obtained induction curve were consistent with the EC50 values ​​measured using chemically synthesized signaling molecules (Table 3, Figure 2 c) Since MMF cannot be synthesized by chemical methods, the concentration of signal molecules in the MMF-MmfR induction system cannot be quantified.

[0136] Table 3: EC10, EC50 and EC90 calculated from dose response curves of receptor activation by chemically synthesized small molecules and transmitter supernatant culture fluid

[0137]

[0138]

[0139] Improvements in intercellular communication systems

[0140] In the present invention, the signal molecule biosynthetic capacity of sender cells has been optimized by combining different core promoter sequences with ribosome binding sites (RBS) (Methods section below) to increase the production efficiency of signal molecules by 10-1000 times.

[0141] In addition, the sensitivity of the signal communication system of the present invention can be improved by directed evolution. As an example, we randomly mutated the genes encoding allosteric transcription factors (phlF and nahR) in the DAPG-PhlF and Sal-NahR induction systems and analyzed the reporter (PhlF) under the condition of adding / not adding signal molecules by flow cytometry. phlF – sfGFP and Psal –sfgfp) fluorescence was used to positively and negatively select the strain. After 3-6 rounds of screening, the EC50 values ​​of the selected six PhlF mutants and three NahR mutants were determined. The six PhlF mutants obtained by screening were: D128G point mutation; D128G and Q181R mutations; D128G and T24A mutations; D128G and D154G mutations; K127N and V194A mutations; and E132D point mutation. The three NahR mutants obtained by screening were: H57Q, Q168R and V216A mutations; H57Q, Q168R and V267D mutations; I25V and Q168R mutations. Surprisingly, the D128G mutation was found in the four selected PhlF mutants and was able to reduce the EC50 of DAPG-PhlF by approximately 10-fold ( Figure 2 d). For the NahR mutant, the Q168R mutation is essential for the improvement of the NahR induction system performance, which can reduce its EC50 value by about 15 times ( Figure 2 d) These results all indicate that a single site mutation is sufficient to change the performance of the allosteric transcription factor in response to the inducer, and the sensitivity of the communication system of the present invention can be improved through further directed evolution and screening.

[0142] Orthogonality of cellular communication systems

[0143] When multiple signal transduction pathways exist in a gene circuit at the same time, it is necessary to ensure that the signal pathways are orthogonal and there is no mutual interference at the signal sensing and promoter response levels. In the art, these two levels of crosstalk are defined as signal crosstalk and promoter crosstalk, respectively

[28] . We characterized the orthogonality of the six signal communication modules constructed in the present invention and the four reported AHL-based signal communication modules.

[0144] To examine the crosstalk at the signal level, the six newly constructed signal communication modules and four AHL-based modules, a total of ten signal transmitters and ten signal receivers, were paired and co-cultured to measure the induced expression of the inducible promoter and the nonspecific expression in each transmitter-receiver pair ( Figure 3 a). As is known in the art, the responses of specific induction and non-specific induction in the C4, 3OC6, C8 and 3OC12 signal communication modules based on quorum sensing are not much different, and there is strong signal crosstalk between them (the maximum induction multiple of non-specific induction is 49.7 times, and the average is 18.5 times) ( Figure 3b) [8, 16-17]. In addition, the 3OC12 transmitter is orthogonal to the C4 or 3OC6 receiver at the signal level, but not to the C8 signal receiving element. The six newly constructed signal communication modules showed good orthogonality with each other (maximum nonspecific induction was 5.4 times, average was 1.7 times), and there was no crosstalk between the four AHL-based signal communication modules. This good orthogonality may be due to the large differences in the chemical structures of these signal molecules. Figure 3 As shown in c, since there is no signal level crosstalk between the eight signal modules of DAPG, Sal, pC, IV, NG, MMF and 3OC6 and 3OC12 constructed by the present invention, the system of the present invention can be used in combination with the AHL-based signal communication systems 3OC6 and 3OC12. The orthogonality can be visualized by a plate diffusion experiment. Ten signal receiver colonies are placed around a signal transmitter colony on an agar plate. When the signal molecules synthesized by the transmitter are recognized and sensed by the receiver, the expression of the reporter sfGFP can be activated. Whether the reporter expresses GFP fluorescence can be observed with the help of a multi-channel fluorescence imager. Figure 3 As shown in d, each signal sending element can specifically activate the inducible promoter in the corresponding signal receiving element. When signal crosstalk exists, more than one receiver cell expresses GFP (for example, sender 2 activates receivers 1 and 2 at the same time). This result is consistent with the results in liquid culture medium ( Figure 3 b) consistent.

[0145] For promoter-level crosstalk, we transformed ten allosteric transcription factors into the same cells in pairs with ten inducible promoter-reporter gene cassettes to obtain 100 hybrid receivers ( Figure 3 e) By adding signal molecules corresponding to allosteric transcription factors to the culture medium, it is detected whether these allosteric transcription factors will also respond to other signal molecules to activate the inducible promoter and then express the downstream reporter. Figure 3 f, the six communication systems constructed by the present invention have good orthogonality at the promoter level (non-specific induction of up to 2 times and an average of 1.7 times), while most of the traditional fatty acid AHL signal systems have serious crosstalk (non-specific induction of up to 377 times and an average of 67.3 times). Figure 3 As shown in f, RpaR and LuxR can bind to each other's responsive promoters, so RpaR-P rpa* and LuxR-P lux* However, in intercellular signaling, this problem can be easily avoided by placing the receiving elements of the two signals in different cells.

[0146] Cross-species cell-to-cell communication system

[0147] To verify the transferability of the intercellular communication system of the present invention, we transferred the intercellular communication system of the present invention from Escherichia coli to other model organisms, such as Saccharomyces cerevisiae cells and human cell lines. As an example of human intercellular communication, the sending and receiving elements of the pC-RpaR system were transformed into HEK-293T cells respectively. For the receiving element, the VTR3 activation domain

[18] was fused to RpaR as an allosteric transcription factor, and two RpaR operator sites were placed upstream of the minimal CMV promoter to construct pC-RpaR. rpaO-CMV1 The results showed that the pC signal synthesized by the HEK-293T transmitter activated the R paO-CMV1 The dynamic range of promoter activation is 10( Figure 2 b) If Figure 2 As shown in Figure 2, the inventors also constructed yeast cell-E. coli, human cell-E. coli and yeast cell-yeast cell communication systems. In these systems, the signal molecules synthesized by the sender cells successfully activated the inducible promoter in the receiver cells, which shows the modularity and transferability potential of the system of the present invention.

[0148] Construction of spatial distribution model

[0149] A multi-channel gene circuit can be constructed based on the orthogonality of the intercellular communication system of the present invention. In the case of a dual-channel signal circuit, two strains are constructed, such that the first strain contains a transmitting element of the first signal and a receiving element of the second signal, and the second strain contains a receiving element of the first signal and a transmitting element of the second signal ( Figure 4 a) When two strains are inoculated on a plate, due to the free diffusion of the signal molecules, a concentration gradient of the two signals is formed between the two colonies, so that the two strains can activate each other. The first strain and the second strain are inoculated on a plate with a diameter of 1.5 cm, respectively. Figure 4 As shown in b, seven of the dual-channel gene circuits (Sal-pC, Sal-DAPG, Sal-IV, Sal-3OC6, pC-3OC6, DAPG-IV and 3OC6-IV) formed obvious fluorescence gradients within the colony, while the gradients of three (pC-DAPG, pC-IV and 3OC6-DAPG) were not obvious.

[0150] Based on the same principle, we constructed two three-channel transmit-receive circuits using the pC-Sal-DAPG and 3OC6-Sal-DAPG signal systems, and constructed a four-channel transmit-receive circuit using the pC-Sal-DAPG-3OC6, successfully realizing the triangle or quadrilateral activation function ( Figure 4 cd).

[0151] Construction of complex logic gates

[0152] like Figure 5 As shown in a, we constructed a three-input XOR+AND logic gate gene circuit. This gene circuit uses four orthogonal signal systems, and seven Escherichia coli colonies perform the function of computing nodes. First, the strains with NOR gates (cells 1 and 6) or isostat (cell 7) were spatially arranged as described in

[19] . The first three NOR gates (cells 1, 2, and 3) upstream are combined into an AND gate, and the other three NOR gates (cells 4, 5, and 6) and the isostat (cell 7) form an XOR gate circuit

[19] . Each NOR gate is configured to control the expression of the lambda repressor protein CI by a promoter that responds to the upstream input signal, and the lambda promoter (Pr) controls the downstream gfp gene and the sending element of another signal

[19] . The constructed AND gates or NOR gates were inoculated on agar plates in a spatially distributed manner to perform XOR or AND functions. Both successfully performed their logical operation functions and gave correct output values. The two were then combined ( Figure 5 ), seven node strains were inoculated on agar plates to perform logical operations. Not only was the final output of the gene circuit exactly the same as the truth table, but each intermediate node also gave the correct calculation result. This is the first successful construction of a multicellular logic circuit with four channels at the same time.

[0153] method

[0154] Microbial strains and culture conditions

[0155] The host Escherichia coli was DH5α strain (fhuA2 lac(del)U169phoA gln V44Φ80′lacZ(del)M15 gyrA96 recA1 relA1 endA1 thi-1hsdR17), purchased from Beijing Quanshijin Biotechnology Co., Ltd. (Cat. No.: CD201-02); Saccharomyces cerevisiae was WP125 strain (W303 MATa rtTA far1Δhis3 trp1 leu2 ura3), constructed from Saccharomyces cerevisiae W303 strain. The W303 strain was purchased from China General Microbiological Culture Collection Center (CGMCC). For Escherichia coli, LB medium or M9 basal medium was used for shaking culture (1000 rpm) at 37°C in a 96-well plate. The M9 basal medium contains 6.8 g / L Na2HPO4, 3 g / L KH2PO4, 0.5 g / L NaCl, 1 g / L NH4Cl, 2 mM MgSO4, 100 μM CaCl2, 0.4% glucose, 0.2% casamino acids, 340 mg / L thiamine (vitamin B1). For yeast cells, 50 mL YPD medium was added to a 500 mL culture bottle and shaken at 30° C. (225 rpm). The YPD medium contains 1% yeast extract, 2% peptone, and 2% glucose.

[0156] Unless otherwise specified, antibiotics were added to all media at the following concentrations: 100 μg / ml ampicillin, 50 μg / ml kanamycin, and / or 25 μg / ml chloramphenicol. tac The promoter was induced by adding 0.1 mM or 1 mM isopropyl-β-D-thiogalactoside (IPTG) to the culture medium. tet When the promoter was expressed, 200 ng / ml anhydrotetracycline (aTc) was added to the culture medium for induction.

[0157] Construction of E. coli transmitter and receiver elements

[0158] All E. coli strains were constructed based on the E. coli DH5α strain and were assembled using the RGP and PTP series plasmids (sequences are SEQ ID NO: 31 and SEQ ID NO: 33 in CN107344962A, respectively). The RGP plasmid incorporates the p15A replication initiation site and AmpR, wherein the BsaI site on AmpR has been mutated and eliminated; the two BsaI sites are located on the flanks of the lacZα fragment, thereby removing the recognition site from the plasmid after digestion. In addition, bases 2306 to 2361 of the RGP plasmid are P tacPromoter and RBS; bases 1091 to 2173 are CDS of LacI. With the help of the Golden Gate cloning method, the LacZα fragment can be replaced with any gene to construct the RGP series plasmids. Specifically, for the construction of a plasmid for expressing aTF (regulatory protein gene) in the receiver, the LacZα fragment (bases 2444 to 2565) is replaced with each regulatory protein gene coding sequence. The regulatory protein sequence is given in Table 2. Each coding sequence is obtained by chemical synthesis of the corresponding aTF coding sequence in Table 2. As for the construction of the transmitter plasmid, the LacZα fragment is replaced with each biosynthetic gene expression cassette. Among them, the enzymes required for each complete biosynthetic pathway are shown in Tables 1 and 2. Each coding sequence of the enzyme in the biosynthetic pathway is obtained by amplifying the corresponding sequence of the strain genome in Table 1 or chemically synthesizing the coding sequence in Table 2. It should be noted that the phlA fragment in the experiment was directly amplified from the phlACBD gene cluster of Pseudomonas fluorescens 2p24 strain

[35] , and the bdkFGH fragment was from Streptomyces avermitilis MA-4680 strain

[10] . After sequencing, the sequences of the amplified phlA, bdkF and bdkG fragments were SEQ ID NO: 31-SEQ ID NO: 33, respectively, which were slightly different from the sequences given in the NCBI protein library. It is understood by those skilled in the art that the inconsistency of less than 1% may come from individual differences in bacteria. In terms of promoters, biosynthetic gene expression cassettes controlled by constitutive J23110, J23111, J23119 (iGEM parts registry), PA1 or PN25 promoters and inducible promoter P tet Promoter or P new Promoter-controlled biosynthetic gene expression cassette. tet The expression cassette controlled by the promoter also contains a TetR repressor protein expression cassette (promoter is J23101, iGEM part registry). The TetR gene sequence is as described in the literature

[29] . new The promoter-controlled expression cassette also contains a CymR repressor protein expression cassette (promoter is J23106, iGEM part registry). The CymR gene sequence is SEQ ID NO: 10 of CN107344962A. Genes in the same expression cassette may optionally contain a 20-40 bp RBS (ribosome binding site) as a spacer.

[0159] The PTP plasmid is integrated with the pSC101 replication origin and CmR. In addition, PTP also has two BsaI sites flanking the lacZα fragment, which can be inserted into any promoter to replace the lacZα fragment by the Golden Gate cloning method to express the reporter gene sfGFP (the sfGFP coding sequence is described in CN107344962A). Each promoter DNA fragment is prepared by chemical synthesis. For the receiver cells, the lacZα fragment is replaced by an inducible promoter. The sequences of the inducible promoters are SEQ ID NOs: 1-22 and SEQ ID NOs: 53-55 in Table 4. For the transmitter, the sfGFP coding sequence on the PTP plasmid is replaced with the mRFP1 gene (iGEM part: BBa_J04450), and the lacZα fragment is replaced with the J23119 promoter (SEQ ID NO: 27) to mark the transmitter. All promoters involved in the embodiment are given in Table 4.

[0160] The transmitter strain is obtained by co-transformation of an RGP plasmid with a biosynthetic gene expression cassette and a PTP plasmid with an mRFP1 gene, and has ampicillin and chloramphenicol resistance; the receiver strain is obtained by co-transformation of an RGP plasmid with a regulatory protein gene expression cassette and a PTP plasmid with an sfGFP reporter gene, and also has ampicillin and chloramphenicol resistance. RGP and PTP plasmids can coexist in transmitter and receiver cells. In addition, due to the same resistance, transmitter cells and receiver cells can be co-cultured.

[0161] Table 4 Promoters involved in the examples

[0162]

[0163]

[0164]

[0165] Spatial distribution model and complex logic gate strain construction

[0166] For complex logic gates, cells 4-6 each contain a PTP series plasmid for receiving input and a RGP series plasmid for output, wherein the resistance gene of the PTP series plasmid is modified to kanamycin resistance. The LacZα on each PTP series plasmid is replaced by the expression cassette of two regulatory proteins and an inducible promoter responsive to two upstream signals by the Golden gate method, and the sfGFP on the plasmid is replaced by the coding sequence of lambda repressor protein CI (SEQ ID NO: 52). Figure 5As shown, for cells 4-6, the upstream signals are Ara+Sal, Ara+pC, and pC+Sal, respectively, and the inducible promoters responsive to the two upstream signals are formed by connecting the promoters responsive to the respective signals in series. bad (SEQ ID NO: 57), and its regulatory protein is AraC (SEQ ID NO: 58). On the other hand, the LacZα on the RGP series plasmids was replaced with an expression cassette for the expression of downstream biosynthetic genes and sfGFP reporters controlled by the Pr promoter. Among them, the Pr promoter (SEQ ID NO: 51) is regulated by the CI protein. That is, the input signal of each NOR gate depends on the type of small molecule signal to which the two promoters on the tandem promoter respond, and the output signal is determined by the type of small molecule signal synthesized by the sending element controlled by the Pr promoter. For cells 1-3, the LacZα on each PTP series plasmid was replaced with an expression cassette of a regulatory protein and an inducible promoter that responds to an input signal by the Golden gate method, and the sfGFP on the plasmid was replaced with a lambda-type repressor protein CI coding sequence. The modification method for the RGP series plasmids is the same as described above. All input signals and output signals are as follows. Figure 5 In addition, cell 7 is a DAPG receptor.

[0167] As for the spatial distribution model, the LacZα on each PTP series plasmid was replaced by the expression cassette of the regulatory protein corresponding to the upstream signal and the inducible promoter that responds to the upstream input signal through the Golden gate method, and the LacZα on the RGP series plasmid was replaced by the expression cassette of the downstream biosynthetic gene to receive the upstream signal and output the downstream signal. Figure 4 Winning bid.

[0168] Construction of the transmitter and receiver elements of Saccharomyces cerevisiae

[0169] The rtTA coding sequence is integrated into the genome of the Saccharomyces cerevisiae WP125 strain [5], and its expression product can effectively inhibit P tet07 Promoter expression, aTc can be used to tet07 Induction. In addition, the WP125 strain genome is integrated with his3, trp1, leu2, and ura3 mutant genes, and nutritional deficiency screening can be performed using histidine, tryptophan, leucine, and uracil. The transmitter and receiver plasmids were constructed based on yeast pNH603[5] and pNH604[5] plasmids, respectively, which carry the 5'UTR and 3'UTR of the his3 gene and trp1 gene, as well as AmpR.

[0170] For the DAPG receiver, the PhlF operator was ligated to the Saccharomyces cerevisiae Pgal Promoter combination, designed DAPG inducible promoter. gal Promoter (also called P gal1-10 promoter) drive P gal10 and P gal1 The upstream and downstream gene expression of the P gal1 Two PhlF operator sequences were inserted between the TATA box and the transcription start site of the promoter, and P phlF-Y Promoter. At the same time, P Gal10 The promoter drives the expression of PhlF fusion protein to achieve hypersensitive response. Specifically, the following assembly was completed between the XbaI and SpeI restriction sites in the Biobrick region of the pSB1K3 plasmid (iGEMpart registry) using the Gibson assembly method: the phlF gene (AAF20928.1) was assembled into the p gal1-10 The promoter (SEQ ID NO: 56) gal10 end, and the yEGFP reporter gene was assembled into the P phlF-Y The promoter (SEQ ID NO: 30) was followed by the Tadh1 terminator at the end of the phlF gene and the yEGFP gene. The Tadh1 terminator was derived from the 1108749-1109443 bp segment of chromosome 5A (CP025154.1) of the Candida albicans strain SC5314-P0 [5]. After the above assembly was completed, the fragment between the XbaI and SpeI restriction sites was transferred to the 5'UTR and 3'UTR of the his3 gene of the pNH603 plasmid by Gibson assembly to obtain the yeast DAPG receiver plasmid. Finally, the plasmid was transformed into the yeast W125 strain (CN105624146A), and the receiver strain was selected by histidine auxotrophy. The results showed that when the culture medium contained 2% galactose, P phlF-Y The activity of the promoter is tightly inhibited by PhlF. Synthetic DAPG small molecules and the E. coli DAPG transmitter can activate the S. cerevisiae DAPG receiver ( Figure 2 b).

[0171] For the Sal transmitter, the following three assemblies were completed between the XbaI and SpeI restriction sites in the Biobrick region of the pSB1K3 plasmid using the Gibson assembly method: the pchB gene (AEO73196.1), the pchA gene (WP_003114686.1), or the irp9 gene (WP_005168693.1) was assembled into P tet07 After the promoter (SEQ ID NO: 44), the Tadh1 terminator was then assembled at the end of each of the above genes. After the above assembly was completed, the fragments between the XbaI and SpeI restriction sites on the three plasmids were PCR amplified respectively, and then the fragments carrying the pchB gene or the irp9 gene were connected to the 5'UTR and 3'UTR of the his3 gene of the pNH603 plasmid by Gibson assembly, and the fragment carrying the pchA gene was connected to the 5'UTR and 3'UTR of the trp1 gene of the pNH604 plasmid to complete the construction of the three transmitter plasmids. Finally, the pchB plasmid and the pchA plasmid were successively transformed into the yeast WP125 strain, and nutritional deficiency screening was performed using histidine and tryptophan in turn, thereby obtaining the pchB plasmid with P on the genome. tet07 In addition, the irp9 plasmid was transformed into the WP125 strain alone, and histidine auxotrophy was used to select for the gene carrying P tet07 The yeast transmitter strains that control the expression of irp9. After culturing the two strains for about 4 days, the culture fluid was collected and incubated with the E. coli Sal receiver. The results showed that the E. coli receiver could be activated by the two S. cerevisiae Sal transmitters ( Figure 2 b).

[0172] Mammalian genetics, cell culture, transformation, and stable cell line generation

[0173] In the embodiment using human cells as hosts, we used the human embryonic kidney cell line HEK-293T as the host to construct the signal sending element and signal receiving element of the pC communication system. As for the pC transmitter, tal, 4cl and rpaI and the reporter gene were respectively inserted into two lentiviral vectors, and stable cell lines were screened by lentiviral transfection and fluorescence sorting. Specifically, the two plasmids of the mammalian pC transmitter were constructed based on the lentiviral plasmid pHAGE-EF1aL-hAAT-W (addgene#24527). Through Gibson assembly, the 4cl gene of the Escherichia coli pC transmitter of the present invention was connected to the mTourquoise2

[37] reporter gene through the P2A short peptide (SEQ ID NO: 49), inserted into the pHAGE-EF1aL-hAAT-W plasmid, and the hAAT gene therein was replaced to construct the first transmitter plasmid. The rpaI gene and tal gene of the E. coli pC transmitter of the present invention are connected with the iRFP reporter gene through the short peptides of P2A and T2A (SEQ ID NO: 50), and inserted into the pHAGE-EF1aL-hAAT-W plasmid to replace the hAAT gene therein to construct the second transmitter plasmid. The lentiviral vector pHAGE-EF1aL-hAAT-W already contains the constitutively expressed pEF1α promoter, so that all the inserted genes can be expressed.

[0174] Human embryonic kidney cell line 293T (HEK-293T, ATCC: CRL-11268) was inoculated in high glucose DMEM complete medium (Gibco, supplemented with 4.5 g / L glucose, 10% FBS (Life-Technologies) and 0.045 units / ml penicillin) under the culture conditions of 37°C, 100% humidity and 5% CO2. 8.5×10 5 After culturing 1 day of cells (2 ml culture medium), the host cells were co-transfected with the first and second transmitter plasmids, which were prepared according to the Lentiviral production (addgene) method and dissolved in 1 ml culture medium (https: / / www.addgene.org / protocols / lentivirus-production / ). After 48 hours of culture, the cells in each well were enriched into 1 mL of fresh culture medium, and the fluorescence of Lexa Fluor 700 and BV421 channels (iRFP and mTourquoise2) were detected using a BD FACSAria IIIu flow cytometer (BD Biosciences), and double-positive cells were collected as stable expression cell lines, i.e., pC transmitter cell lines.

[0175] For the pC receptor, the eukaryotic transcriptional activator was first constructed by fusing the allosteric transcription factor RpaR with the VTR3 activation domain

[18] , which is an activation domain derived from VPR (VP64-P65-rta)

[32] . This VTR3-RpaR is able to bind to the RpaR operator sequence to recognize the pC signal. The pC receptor was obtained by inserting the two RpaR operator sequences upstream of the miniCMV

[33] or TRE3G core promoter. rpaO-CMV1 (SEQ ID NO: 45) and P rpaO-TRE3G promoter (SEQ ID NO: 46); and the Citrine yellow fluorescent protein coding sequence was connected to the downstream as a reporter gene. rpaO-CMV1 or P rpaO-TRE3G The promoter-reporter plasmid also constitutively expresses the mCherry red fluorescent protein to allow internal monitoring of plasmid transfection. Specifically, a mammalian pC receiver plasmid was constructed based on the pcDNA3.1(+) plasmid (Invitrogen, catalog # V790-20). The components were assembled into the plasmid using Gibson assembly in the following order: rpaO-CMV1 Promoter or P rpaO-TRE3G Promoter; Citrine reporter gene

[39] ; hEF1α promoter (from the 114743-113562 bp segment of human clone RP11-505P4 chromosome 6 DNA (NCBI accession number AL603910.6)); VRT3-RpaR regulatory protein coding sequence (SEQ ID NO: 47); EF1 promoter (SEQ ID NO: 48); mCherry reporter gene

[40] . Each protein coding sequence is followed by a poly(A) sequence. Two proteins with P rpaO-CMV1 Promoter or P rpaO-TRE3G Promoter receiver plasmid.

[0176] Transient transfection was performed using optimized polyethyleneimine (1 mg / ml PEI "max", Polysciences, Germany). Approximately 1.5 × 10 5293T cells were inoculated in 12-well plates and cultured for 1 day. Subsequently, a transfection mixture was prepared so that 200 μl of the transfection mixture contained 1.6 μg of plasmid, 4.8 μl of PEI reagent and the remainder of serum-free DMEM. The transfection mixture was added to each well and incubated for about 10 minutes, and then added dropwise to the 12-well plate cultured with 293T cells. After 3 hours of transfection, the culture medium was replaced with fresh DMEM complete medium with different concentrations of chemically synthesized pC. After another 48 hours of culture, the cells were collected and the fluorescence value of the cells was tested by flow cytometry. The chemically synthesized pC had a significant effect on the expression of pC containing P. rpaO-CMV1 Promoter and P rpaO-TRE3G The dynamic ranges of induction in the recipient cells of the promoters were 48 and 238, respectively.

[0177] To detect communication between 293T cells, cell-free culture medium was collected after culturing the stable sender cell line for 48 hours, and the receiver plasmid was transiently transferred into 293T cells. Equal amounts of receiver cells were incubated with the newly collected sender culture medium 3 hours after transfection. After culturing the receiver cells for 48 hours, they were centrifuged and resuspended in PBS buffer, and the yellow and red fluorescence of the population was analyzed by flow cytometry. Considering that the receiver plasmid was transiently transfected, the ratio of yellow fluorescence to red fluorescence was defined as the readout value. Flow cytometry data were analyzed using Matlab software. Figure 2 As shown in b, it contains P rpaO-CMV1 or P rpaO-TRE3G The 293T receiver cells of the promoter can all be activated by the pC signaling molecules synthesized by the 293T sender cells.

[0178] Induction by chemically synthesized small molecules

[0179] For microbial cells, the overnight cultured receiver cells were diluted 200-fold using LB medium (E. coli) or YPD medium (yeast). After 3 hours of culture, the culture was diluted 200-fold again in M9 medium (E. coli) or LB medium (yeast) mixed with the corresponding signal molecule, and the fluorescence was measured by flow cytometry after 12 hours (E. coli) or 24 hours (yeast).

[0180] For human cells, fresh medium containing signaling molecules was added 3 h after transient transfection of the receiver plasmid as described above, and cells were harvested and analyzed for fluorescence after 48 h of culture.

[0181] Signal communication

[0182] Activation using sender cell supernatant: For E. coli sender cells, in M9 medium (for P tetFor yeast sender cells, the sender cells were cultured overnight in 500 ml flasks containing 50 ml YPD medium for 96 hours (for P tet Series promoter, supplemented with 200ng / ml aTc), and 5ml 20% glucose was added to the culture flask at 24h, 48h, and 72h. For human cell line sender cells, 293T sender cells were cultured on 10cm dishes for 48h, and the culture medium was DMEM complete medium supplemented with 0.5g / L tyrosine. After the culture was completed, the cell-free culture fluid was collected (for microbial cells, it was collected after centrifugation), the supernatant was filtered with a 0.2μm sterile filter, and diluted with an equal volume of fresh M9 medium (when the receiver was Escherichia coli), YPD medium (when the receiver was yeast) or DMEM complete medium (when the receiver was 293T cells). Before mixing with the receiver culture, further 2-fold or 10-fold serial dilutions were performed with the same diluent. For 293T cell receivers, the diluted sender culture supernatant was added 3 hours after transfection, and the transfection agent was replaced with fresh culture medium. For yeast and E. coli receivers, 200-fold dilutions of the corresponding supernatant were mixed with the receiver culture and incubated for 12 h (E. coli), 24 h (yeast), or 48 h (293T cells) before flow cytometric analysis.

[0183] Transmitter-receiver co-culture activation: For E. coli transmitter and receiver cells grown overnight in LB, dilute them 200-fold with M9 medium and culture them again for 3 hours. Receiver cells are serially diluted 2-fold or 10-fold with control cells (containing only the RFP reporter without the signaling element) before mixing with equal volumes of receiver cells. The transmitter-receiver mixture is inoculated into fresh M9 medium containing antibiotics and inducers (IPTG or aTc) at a ratio of 1:200. After 12 hours of co-culture, cells are harvested and analyzed for fluorescence by flow cytometry.

[0184] Flow cytometry assays and data analysis

[0185] Fluorescence of all samples was measured using a BD LSRII flow cytometer with HTS (BD Biosciences). Data from E. coli and yeast cells were analyzed using the FlowJo (TreeStar Inc.) program, with gates set based on the red fluorescence intensity of individual transmitter cells (RFP+) and receiver cells (RFP-). The average FITC of the RFP- population was used as the output value for each sample ( Figure 2-Figure 3). The flow cytometric data of 293T cells were analyzed using Matlab 2018b (The MathWorks Inc.). The yellow fluorescence was normalized by the red fluorescence in the same cell, and the ratio of yellow fluorescence to red fluorescence was defined as the output value of each cell. For all samples, background autofluorescence was subtracted. All flow cytometric data shown in this article are the average of at least three replicates, and SD is the standard deviation of each measurement.

[0186] Quantitative fitting of the sensitivity of intercellular communication systems

[0187] In order to determine the sensitivity and dynamic range of each intercellular communication module, the following Hill equation was used to fit each experimentally measured send-receive response curve.

[0188]

[0189] Where y is the output fluorescence intensity of the receiver, y min is the minimum value of the output, y max is the maximum value of the output. The K obtained by fitting is the input signal concentration when the output value is half the maximum value, that is, the EC50 theoretical value. The dynamic range of the induction curve is y max / y min To calculate the sensitivity of the cell communication system, the send-receive response curves measured by flow cytometry were fitted to the Hill equation and the EC10 and EC90 (i.e., the input at which the output fluorescence is 10% and 90% of the maximum) were calculated.

[0190] E. coli transmitter cells were cultured overnight in 5 ml of M9 medium and centrifuged to collect the transmitter culture supernatant. The supernatant was filtered using a 0.2 μm sterile filter. It was then lyophilized to complete dryness in a Biocool FD-1D-80 vacuum freeze dryer (Biocool) and reconstituted with 500 μl of methanol. Salicylic acid was quantified using an Agilent Eclipse plus C18 reverse phase column (2.1×100 mM, 3.5 μm), and other small molecules were quantified using a Phenomenex Synerg Hydro-RP 80A LC column (2×150 mM, 4 μm, Phenomenex). Each column was connected to an Agilent 1200 HPLC instrument (Agilent Technologies). The flow rate was set to 0.4 ml / min and the gradient elution mode was set at 25°C to separate the molecules in the sample. The mobile phases A and B were 8 / 92 acetic acid / water and acetonitrile, respectively. The conditions of gradient elution were: 25% B for 5 min, 25-100% linear gradient B for 5 min, 100% B for 3 min, 100%-25% linear gradient B for 1 min, and then 25% B for 2 min. The effluent phase was introduced into an AB SCIEX Qtrap 4500 mass spectrometer (AB Sciex LLC), which was equipped with an electrospray ionization (ESI) source and multiple reaction monitoring (MRM). For different molecules, the ionization source was operated in negative and positive modes, respectively, and the specific parameters are shown in Table 5. First, a series of chemically synthesized small molecules with a concentration gradient were measured using the HPLC-MS method, and a standard curve was made. The signal molecule generation amount of the sender cell was calculated based on the standard curve.

[0191] Table 5 HPLC-CMS / MRM parameters

[0192]

[0193] Directed evolution of regulatory proteins

[0194] Based on P phlF Regarding the activation mechanism of the promoter, we believe that the low sensitivity of the DAPG receptor is related to the PhlF repressor protein. phlF The promoter can be effectively repressed by the PhlF repressor protein, but it is clear that the amount of DAPG required to dissociate PhlF from DNA is very high. NahR is a transcriptional activator and an allosteric transcription factor. Therefore, we believe that the sensitivity of the DAPG and NG responses can be further improved by mutating the sequences of these regulators.

[0195] In the experiment, the regulatory factors were optimized by directed evolution of the complete protein sequence. First, the PhlF and NahR full sequence libraries were created by error-prone PCR. For the PTP plasmid, the PhlF or NahR mutant library fragments regulated by the J23111 promoter were inserted upstream of LacZα using the Golden Gate method

[34] , and LacZα was replaced by the inducible promoter P phlF or P sal , so that the expression of the mutant can be controlled by the J23111 promoter, and the expression of the reporter sfGFP can be controlled by the promoter corresponding to the transcriptional regulatory protein. These plasmids with mutant libraries are transformed into Escherichia coli. After culturing in LB medium for 16 hours, they are diluted in M9 medium and cultured again for 4-6 hours. Flow cytometry is used to negatively select the fluorescence signal. For the clones that have been negatively selected, they are cultured in LB medium for 16 hours again and then cultured in M9 medium supplemented with inducers, and clones with stronger fluorescence intensity than the wild type are selected by flow cytometry. Subsequently, three rounds of culture-positive selection are implemented, and the inducer concentration is reduced by 50% in each round of culture (that is, the inducer concentrations in the three rounds of culture are 50%, 25% and 12.5% ​​of the original), and mutants with fluorescence intensity equivalent to or stronger than the wild type fluorescence intensity at the original inducer concentration are selected. For the mutants selected in each round, the sensitivity is measured by flow cytometry.

[0196] Plate diffusion experiment

[0197] LB medium supplemented with all M9 components, inducer IPTG and aTc was used as an experimental agar plate. Each strain was cultured overnight in LB medium for 16 hours, and then diluted 500 times (orthogonal experiment) or 10 times (multi-channel gene circuit experiment) with fresh LB medium. The dilution multiple can be adaptively adjusted according to its growth and signal molecule synthesis rate. Subsequently, 1μl (orthogonal experiment) or 30μl (multi-channel gene circuit experiment) of bacterial liquid was inoculated into the plate to form colonies with a diameter of 0.5cm (orthogonal experiment) or 1.5cm (multi-channel gene circuit experiment). Cultured at 37°C for 24 hours, and bright field and fluorescent images were taken using a multi-channel fluorescence imager.

[0198] AND-XOR logic circuit

[0199] LB medium supplemented with all M9 components and three inducers (10mM arabinose, 100ng / ml aTc, 0.1M cumate) was used as an agar plate for the experiment. Each strain was cultured overnight in LB medium for 16h, then diluted 100 times with fresh LB medium, and cultured again for 6-8h until OD600 reached 0.6-0.8. The dilution multiple can be adaptively adjusted according to its growth and signal molecule synthesis rate. Subsequently, 3μl of bacterial solution was inoculated onto the plate to form colonies with a diameter of 0.5cm, and each colony was arranged into an equilateral triangle or quadrilateral with a distance of 10mm between each colony. After inoculation, it was cultured at 37℃ for 12 hours, and bright field and fluorescent images were taken using a multi-channel fluorescence imager. Finally, all strains were scraped with a gun tip, diluted in 1ml PBS (containing 2mg / ml kanamycin), and analyzed by flow cytometry.

[0200] Chemical synthesis of IV

[0201] IV is synthesized according to formula I. At 0 ° C, L-homoserine lactone hydrobromide (50 mg) is dissolved in 3 mL CH2Cl2 (DCM), then Et3N (70 mg) is added. After the mixture is stirred and mixed for 30 minutes, isovaleryl chloride (40 mg) is added dropwise in a time period of 5 minutes. The reaction mixture is warmed to room temperature, and the solution is stirred for 4 hours. It is then concentrated under reduced pressure and dissolved in ethyl acetate, and extracted with 1M sodium bicarbonate solution, 1M sodium potassium hydrogen sulfate and saturated sodium chloride solution successively. After drying with anhydrous sodium sulfate, the solvent is removed by rotary evaporation, and the crude product is purified by silica gel column chromatography to obtain isovaleryl homoserine lactone (45 mg), with a yield of about 88%.

[0202]

[0203] References

[0204] 1. Papenfort, K. & Bassler, BL, Nat Rev Microbiol 14, 576-588 (2016).

[0205] 2. Auslander, D. et al., Nat Methods 15, 57-60 (2018).

[0206] 3. Billerbeck, S. et al., Nat Commun 9, 5057 (2018).

[0207] 4. Morsut, L. et al., Cell 164, 780-791 (2016).

[0208] 5.Youk,H.&Lim,W.A.,Science 343,1242782(2014).

[0209] 6.Grant,P.K.et al.,Molecular systems biology 12,849(2016).

[0210] 7.Collins,C.H.,Leadbetter,J.R.&Arnold,F.H.,Nature biotechnology 24,708-712(2006).

[0211] 8.Scott,S.R.&Hasty,J.,Acs Synth Biol 5,969-977(2016).

[0212] 9.Scott,S.R.et al.,Nat Microbiol 2,17083(2017).

[0213] 10.Cui,Q.,Zhou,F.,Liu,W.&Tao,Y.,Biotechnology Letters 39,1567-1574(2017).

[0214] 11.Kojima,R.&Fussenegger,M.,Chembiochem 20,994-1002(2019).

[0215] 12.Perrimon,N.,Pitsouli,C.&Shilo,B.Z.,Cold Spring Harb Perspect Biol4,a005975(2012).

[0216] 13.Dunn,N.W.&Gunsalus,I.C.,J Bacteriol 114,974-979(1973).

[0217] 14.Serino,L.et al.,Mol Gen Genet 249,217-228(1995).

[0218] 15.Pelludat,C.,Brem,D.&Heesemann,J.,J Bacteriol 185,5648-5653(2003).

[0219] 16.Daer,R.et al.,Plos One 13,e0202294(2018).

[0220] 17.Halleran,A.D.&Murray,R.M.,Acs Synth Biol 7,752-755(2018).

[0221] 18.Ma,D.,Peng,S.,Huang,W.,Cai,Z.&Xie,Z.,Acs Synth Biol 7,978-985(2018).

[0222] 19.Tamsir,A.,Tabor,J.J.&Voigt,C.A.,Nature 469,212-215(2011).

[0223] 20.Schaefer,A.L.et al.,Nature 454,595-599(2008).

[0224] 21 Lindemann,A.et al.,Proc Natl Acad Sci USA 108,16765-16770(2011).

[0225] 22 Hirakawa,H.et al.,J Bacteriol 193,2598-2607,doi:10.1128 / JB.01479-10(2011).

[0226] 23 O'Rourke,S.et al.,Mol Microbiol 71,763-778,doi:10.1111 / j.1365-2958.2008.06560.x(2009).

[0227] 24 Wei,Y.et al.,Mol Microbiol 79,616-632,doi:10.1111 / j.1365-2958.2010.07469.x(2011).

[0228] 25 Moon,T.S.,Lou,C.,Tamsir,A.,Stanton,B.C.&Voigt,C.A.,Nature 491,249-253,(2012).

[0229] 26 Chuang,J.S.,Rivoire,O.&Leibler,S.,Science 323,272-275,doi:10.1126 / science.1166739(2009).

[0230] 27 Schuster,M.,Urbanowski,M.L.et.al.,Proc Natl Acad Sci USA 101,15833-15839,(2004).

[0231] 28 Xue,H.et al.,ACS Synth Biol 3,1011-1014,doi:10.1021 / sb500023f(2014).

[0232] 29 Stanton,B.C.et al.,Nat Chem Biol 10,99-105,doi:10.1038 / nchembio.1411(2014).

[0233] 30 Hou,J.et al.,ACS Synth Biol,doi:10.1021 / acssynbio.7b00414(2018).

[0234] 31 Siedler,S.,et.al.,Metab Eng 21,2-8,doi:10.1016 / j.ymben.2013.10.011(2014).

[0235] 32 Choi,Y.J.et al.,Appl Environ Microbiol 76,5058-5066,doi:10.1128 / AEM.00413-10(2010).

[0236] 32 Chavez,A.et al.,Nat Methods 12,326-328,doi:10.1038 / nmeth.3312(2015).

[0237] 33 Sedlmayer,F.et.al.,Nano Lett 17,5043-5050,doi:10.1021 / acs.nanolett.7b02270(2017).

[0238] 34.Cadwell,R.C.&Joyce,G.F.PCR 704Methods Appl 2,28-33(1992).

[0239] 35. Zhang, W. et. al. Appl Environ Microbiol, 3972–3981 DOI: 10.1128 / AEM.00455-14 (2014).

[0240] 36.Elison,G.et.al.Cell Rep.2018Oct 16;25(3):737–748.e4.

[0241] 37.Goedhart,J.et.al.,Nat Commun 3,751(2012).https: / / doi.org / 10.1038 / ncomms1738.

[0242] 38.Filonov,G.,et.al.,Nat Biotechnol 29,757–761(2011).

[0243] 39. Ahmed, A. et.al., PNAS 97(22)11996-12001; https: / / doi.org / 10.1073 / pnas.97.22.11996(2000).

[0244] 40.Shaner NC.et.al.,Nat Biotechnol.2004;22(12):1567-72. SEQUENCE LISTING <110> Institute of Microbiology, Chinese Academy of Sciences <120> Artificial design and application of intercellular communication systems <160> 58 <170> PatentIn version 3.5 <210> 1 <211> 65 <212> DNA <213> Bradyrhizobium japonicum <400> 1 tactgggaaa tttcccaata tcgaacctgc ctcttttcgc agaggctgcc ccccattgag 60 gctga 65 <210> 2 <211> 55 <212> DNA <213> Artificial Sequence <400> 2 tactgggaaa tttcccaatt ttacgcaaga aaatggtttg ttactttcga ataaa 55 <210> 3 <211> 56 <212> DNA <213> Artificial Sequence <400> 3 tttacgctgg gaaatttccc aatactttcg aataaatact gggaaatttc ccaata 56 <210> 4 <211> 69 <212> DNA <213> Rhodopseudomonas palustris <400> 4 acctgtccga tcggacagta gttaggttcc cgttcgcacc tgcactgttc ccgcctgcag 60 acccactgc 69 <210> 5 <211> 55 <212> DNA <213> Artificial Sequence <400> 5 acctgtccga tcggacagtt ttacgcaaga aaatggtttg ttactttcga ataaa 55 <210> 6 <211> 69 <212> DNA <213> Artificial Sequence <400> 6 acctgtccga tcggacagta gttaggttcc cgttcgcacc tgcactactt tcgcctgcag 60 acccactgc 69 <210> 7 <211> 36 <212> DNA <213> Artificial Sequence <400> 7 ttgacaaacc ttcgggaagg tatgatactc gaatag 36 <210> 8 <211> 36 <212> DNA <213> Artificial Sequence <400> 8 ttgacaaacc ttcgggaagg tctgatactc gaatag 36 <210> 9 <211> 36 <212> DNA <213> Artificial Sequence <400> 9 ttgacaaacc ttcgggaagg tgtgatactc gaatag 36 <210> 10 <211> 36 <212> DNA <213> Artificial Sequence <400> 10 ttgacatacc ttcgggaagg tatgatactc gaatag 36 <210> 11 <211> 36 <212> DNA <213> Artificial Sequence <400> 11 ttgacatacc ttcgggaagg tttgatactc gaatag 36 <210> 12 <211> 36 <212> DNA <213> Artificial Sequence <400> 12 ttgacacacc ttcgggaagg tatgatactc gaatag 36 <210> 13 <211> 36 <212> DNA <213> Artificial Sequence <400> 13 ttgacacacc ttcgggaagg tttgatactc gaatag 36 <210> 14 <211> 36 <212> DNA <213> Artificial Sequence <400> 14 ttgacacacc ttcgggaagg tctgatactc gaatag 36 <210> 15 <211> 36 <212> DNA <213> Artificial Sequence <400> 15 ttgacagacc ttcgggaagg tatgatactc gaatag 36 <210> 16 <211> 36 <212> DNA <213> Artificial Sequence <400> 16 ttgacagacc ttcgggaagg tttgatactc gaatag 36 <210> 17 <211> 36 <212> DNA <213> Artificial Sequence <400> 17 ttgacagacc ttcgggaagg tctgatactc gaatag 36 <210> 18 <211> 36 <212> DNA <213> Artificial Sequence <400> 18 ttgacagacc ttcgggaagg tgtgatactc gaatag 36 <210> 19 <211> 55 <212> DNA <213> Artificial Sequence <400> 19 accctgtaag agttaccagt ttacgcaaga aaatggtttg ttactttcga ataaa 55 <210> 20 <211> 55 <212> DNA <213> Artificial Sequence <400> 20 acctgtagga tcgtacaggt ttacgcaaga aaatggtttg ttactttcga ataaa 55 <210> twenty one <211> 55 <212> DNA <213> Artificial Sequence <400> twenty one tcctgtgaaa tctggcagtt ttacgcaaga aaatggtttg ttactttcga ataaa 55 <210> twenty two <211> 55 <212> DNA <213> Artificial Sequence <400> twenty two aactagcaaa tgagatagat ttacgcaaga aaatggtttg ttactttcga ataaa 55 <210> twenty three <211> 54 <212> DNA <213> Artificial Sequence <400> twenty three tccctatcag tgatagagat tgacatccct atcagtgata gagataatga gcac 54 <210> twenty four <211> 88 <212> DNA <213> Artificial Sequence <400> twenty four aaatcataaa aaatttattt gctttgtggc ggataacaat tataatagat tcaacaaaca 60 gacaatctgg tctgtttgta tttactag 88 <210> 25 <211> 35 <212> DNA <213> Artificial Sequence <400> 25 tttacggcta gctcagtcct aggtacaatg ctagc 35 <210> 26 <211> 35 <212> DNA <213> Artificial Sequence <400> 26 ttgacggcta gctcagtcct aggtatagtg ctagc 35 <210> 27 <211> 35 <212> DNA <213> Artificial Sequence <400> 27 ttgacagcta gctcagtcct aggtataata ctagt 35 <210> 28 <211> 70 <212> DNA <213> Artificial Sequence <400> 28 ttatcaaaaa gagtattgac ttaaagtcta acctatagga tacttacagc catcgagagg 60 gacacggcga 70 <210> 29 <211> 70 <212> DNA <213> Artificial Sequence <400> 29 tcataaaaaa tttatttgct ttcaggaaaa tttttctgta taatagattc ataaatttga 60 gagaggagtt 70 <210> 30 <211> 100 <212> DNA <213> Artificial Sequence <400> 30 tataaatgca aaaactgatg atacgaaacg taccgtatcg ttaaggtgatgatacgaaac 60 gtaccgtatc gttaaggtaa taaaagtatc aacaaaaaat 100 <210> 31 <211> 360 <212> PRT <213> Pseudomonas fluorescens <400> 31 Met Asn Lys Val Gly Ile Val Ser Tyr Gly Ala Gly Ile Pro Val Cys 1 5 10 15 Arg Leu Lys Val Asp Asp Val Ile Gln Val Trp Lys Asn Thr Asp Leu 20 25 30 Ser Leu Val Lys Gly Gln Leu Gly Val Ile Glu Arg Ala Val Leu Gln 35 40 45 Pro Asp Glu Asp Val Ile Thr Leu Gly Val Leu Ala Ala Gln Arg Ala 50 55 60 Leu Asp Lys Ala Pro Pro Cys Ser Leu Glu Ala Leu Tyr Leu Gly Thr 65 70 75 80 Cys Thr Asn Pro Tyr Asp Ser Arg Ala Ser Ala Ala Ile Ile Leu Glu 85 90 95 Met Leu Gly Cys Gly Tyr Asp Ala Phe Cys Ala Asp Val Gln Phe Ala 100 105 110 Gly Lys Ser Gly Thr Ser Ala Leu Gln Ile Ala Tyr Ala Leu Val Ala 115 120 125 Ser Gly Met Val Gly Asn Ala Leu Ala Val Gly Ala Asp Thr Ile Asn 130 135 140 Arg Asn Thr Ala Pro Gly Asp Leu Thr Glu Ser Tyr Ala Gly Ala Gly 145 150 155 160 Ala Ala Ala Leu Leu Leu Gly Thr Glu Asn Val Ile Ala His Phe Asp 165 170 175 Ala Ser Phe Ser Cys Ala Ala Asp Val Ala Asp Asn Ile Arg Pro Gln 180 185 190 Gly Asp Arg Tyr Ile Arg Ser Gly Met Gly Leu Gly Ser Asp Lys Asn 195 200 205 Ser Ile Gly Leu Glu Asp Gln Thr Arg Arg Ala Ala Ser Gly Leu Met 210 215 220 Ala Lys Ile His Ala Gln Ala Asp Asp Phe Asp Tyr Val Val Phe Gln 225 230 235 240 Gln Asn Leu Val Ser Thr Pro Tyr Ser Leu Gly Lys His Leu Gly Phe 245 250 255 Thr Lys Ala Gln Ile Glu Pro Gly Ile Tyr Ala Gln Ser Val Gly Asp 260 265 270 Ala Gly Ala Ala Ser Pro Leu Leu Gly Leu Val Asn Val Leu Asp Gln 275 280 285 Ala Arg Pro Gly Glu Arg Ile Leu Val Val Ser Tyr Gly Phe Gly Ala 290 295 300 Gly Ser Asp Ala Ile Ala Leu Thr Val Thr Asp Ala Ile Glu Ala Tyr 305 310 315 320 Gln Lys Thr Asn Val Pro Leu Arg Thr Gln Leu Glu Asp Lys Tyr Tyr 325 330 335 Val Asp Tyr Gly Thr Ser Ile Lys Tyr Glu Phe Lys Tyr Leu Arg Pro 340 345 350 Asp Tyr Ala Leu Thr Ala Tyr Leu 355 360 <210> 32 <211> 407 <212> PRT <213> Streptomyces avermitilis <400> 32 Met Arg Arg Thr Val Glu Ser Thr Ala Ala Arg Lys Pro Arg Arg Ser 1 5 10 15 Ala Gly Thr Lys Ser Ala Ala Ala Lys Arg Thr Ser Pro Gly Ala Lys 20 25 30 Lys Ser Pro Ser Thr Thr Gly Ala Glu His Glu Leu Ile Gln Leu Leu 35 40 45 Thr Pro Asp Gly Arg Arg Val Lys Asn Pro Glu Tyr Asp Ala Tyr Val 50 55 60 Ala Asp Ile Thr Pro Glu Glu Leu Arg Gly Leu Tyr Arg Asp Met Val 65 70 75 80 Leu Ser Arg Arg Phe Asp Ala Glu Ala Thr Ser Leu Gln Arg Gln Gly 85 90 95 Glu Leu Gly Leu Trp Ala Ser Met Leu Gly Gln Glu Ala Ala Gln Ile 100 105 110 Gly Ser Gly Arg Ala Thr Arg Asp Asp Asp Tyr Val Phe Pro Thr Tyr 115 120 125 Arg Glu His Gly Val Ala Trp Cys Arg Gly Val Asp Pro Thr Asn Leu 130 135 140 Leu Gly Met Phe Arg Gly Val Asn Asn Gly Gly Trp Asp Pro Asn Ser 145 150 155 160 Asn Asn Phe His Leu Tyr Thr Ile Val Ile Gly Ser Gln Thr Leu His 165 170 175 Ala Thr Gly Tyr Ala Met Gly Ile Ala Lys Asp Gly Ala Asp Ser Ala 180 185 190 Val Ile Ala Tyr Phe Gly Asp Gly Ala Ser Ser Gln Gly Asp Val Ala 195 200 205 Glu Ser Phe Thr Phe Ser Ala Val Tyr Asn Ala Pro Val Val Phe Phe 210 215 220 Cys Gln Asn Asn Gln Trp Ala Ile Ser Glu Pro Thr Glu Lys Gln Thr 225 230 235 240 Arg Val Pro Leu Tyr Gln Arg Ala Gln Gly Tyr Gly Phe Pro Gly Val 245 250 255 Arg Val Asp Gly Asn Asp Val Leu Ala Cys Leu Ala Val Thr Lys Trp 260 265 270 Ala Leu Glu Arg Ala Arg Arg Gly Glu Gly Pro Thr Leu Val Glu Ala 275 280 285 Phe Thr Tyr Arg Met Gly Ala His Thr Thr Ser Asp Asp Pro Thr Lys 290 295 300 Tyr Arg Ala Asp Glu Glu Arg Glu Ala Trp Glu Ala Lys Asp Pro Ile 305 310 315 320 Leu Arg Leu Arg Thr Tyr Leu Glu Ala Ser Asn His Ala Asp Glu Gly 325 330 335 Phe Phe Ala Glu Leu Glu Val Glu Ser Glu Ala Leu Gly Arg Arg Val 340 345 350 Arg Glu Val Val Arg Ala Met Pro Asp Pro Asp His Phe Ala Ile Phe 355 360 365 Glu Asn Val Tyr Ala Asp Gly His Ala Leu Val Asp Glu Glu Arg Ala 370 375 380 Gln Phe Ala Ala Tyr Gln Ala Ser Phe Thr Thr Glu Pro Asp Gly Gly 385 390 395 400 Ser Ala Ala Gly Gln Gly Gly 405 <210> 33 <211> 325 <212> PRT <213> Streptomyces avermitilis <400> 33 Met Ala Glu Lys Met Ala Ile Ala Lys Ala Ile Asn Glu Ser Leu Arg 1 5 10 15 Lys Ala Leu Glu Ser Asp Pro Lys Val Leu Ile Met Gly Glu Asp Val 20 25 30 Gly Lys Leu Gly Gly Val Phe Arg Val Thr Asp Gly Leu Gln Lys Asp 35 40 45 Phe Gly Glu Glu Arg Val Ile Asp Thr Pro Leu Ala Glu Ser Gly Ile 50 55 60 Val Gly Thr Ala Ile Gly Leu Ala Leu Arg Gly Tyr Arg Pro Val Val 65 70 75 80 Glu Ile Gln Phe Asp Gly Phe Val Phe Pro Ala Tyr Asp Gln Ile Val 85 90 95 Thr Gln Leu Ala Lys Met His Ala Arg Ala Leu Gly Lys Ile Lys Leu 100 105 110 Pro Val Val Val His Ile Pro Tyr Gly Gly Gly Ile Gly Ala Val Glu 115 120 125 His His Ser Glu Ser Pro Glu Ala Leu Phe Ala His Val Ala Gly Leu 130 135 140 Lys Val Val Ser Pro Ser Asn Ala Leu Asp Ala Tyr Trp Met Met Gln 145 150 155 160 Gln Ala Ile Gln Ser Asp Asp Pro Val Ile Phe Phe Glu Ser Lys Arg 165 170 175 Arg Tyr Trp Asp Lys Gly Glu Val Asn Val Glu Ala Ile Pro Asp Pro 180 185 190 Leu His Lys Ala Arg Val Val Arg Glu Gly Thr Asp Leu Thr Leu Ala 195 200 205 Ala Tyr Gly Pro Met Val Lys Val Cys Gln Glu Ala Ala Ala Ala Ala 210 215 220 Glu Glu Glu Gly Lys Ser Leu Glu Val Val Asp Leu Arg Ser Met Ser 225 230 235 240 Pro Ile Asp Phe Asp Ala Val Gln Ala Ser Val Glu Lys Thr Arg Arg 245 250 255 Leu Val Val Val His Glu Ala Pro Val Phe Leu Gly Thr Gly Ala Glu 260 265 270 Ile Ala Ala Arg Ile Thr Glu Arg Cys Phe Tyr His Leu Glu Ala Pro 275 280 285 Val Leu Arg Val Gly Gly Tyr His Ala Pro Tyr Pro Pro Ala Arg Leu 290 295 300 Glu Glu Glu Tyr Leu Pro Gly Leu Asp Arg Val Leu Asp Ala Val Asp 305 310 315 320 Arg Ser Leu Ala Tyr 325 <210> 34 <211> 30 <212> DNA <213> Pseudomonas fluorescens <400> 34 atgatacgaa acgtaccgta tcgttaaggt 30 <210> 35 <211> 20 <212> DNA <213> Rhodopseudomonas palustris <400> 35 acctgtccga tcggacagtt 20 <210> 36 <211> 20 <212> DNA <213> Bradyrhizobium japonicum <400> 36 tactgggaaa tttcccaatt 20 <210> 37 <211> 32 <212> DNA <213> Pseudomonas putida <400> 37 cgcaatattc atgttgatga tttattatat at 32 <210> 38 <211> 18 <212> DNA <213> Streptomyces coelicolor <400> 38 ataccttcgg gaaggtat 18 <210> 39 <211> 61 <212> DNA <213> Herbaspirillum seropedicae <400> 39 tggtcaatgt attgatgccg tccatatcat gaatcaaaac aatccatttg atcaatatca 60 a 61 <210> 40 <211> 20 <212> DNA <213> Pseudomonas aeruginosa <400> 40 tcctgtgaaa tctggcagtt 20 <210> 41 <211> 20 <212> DNA <213> Vibrio fischeri <400> 41 acctgtagga tcgtacaggt 20 <210> 42 <211> twenty two <212> DNA <213> Burkholderia cenocepacia <400> 42 accctgtaag agttaccagt tt 22 <210> 43 <211> 20 <212> DNA <213> Pseudomonas aeruginosa <400> 43 aactagcaaa tgagatagat 20 <210> 44 <211> 727 <212> DNA <213> Artificial Sequence <400> 44 taattcgcgc cacttctaaa tagacgaatt tcttatgatt tatgattttt attattaaat 60 aagttataaa aaaaataagt gtatacaaat tttaaagtga ctcttaggtt ttaaaacgaa 120 aattcttgtt cttgagtaac tctttcctgt aggtcaggtt gctttctcag gtatagcatg 180 aggtcgctct tattgaccac acctctaccg gcagatccgc tagggataac agggtaatat 240 agatcaattc ctcgatcgag tttaccactc cctatcagtg atagagaaaa gtgaaagtcg 300 agtttaccac tccctatcag tgatagagaa aagtgaaagt cgagtttacc actccctatc 360 agtgatagag aaaagtgaaa gtcgagttta ccactcccta tcagtgatag agaaaagtga 420 aagtcgagtt taccactccc tatcagtgat agagaaaagt gaaagtcgag tttaccactc 480 cctatcagtg atagagaaaa gtgaaagtcg agtttaccac tcctatcag tgatagagaa 540 aagtgaaagt cgagctcggt accctatggc atgcatgtgc tctgtatgta tataaaactc 600 ttgttttctt cttttctcta aatattcttt ccttatacat taggtccttt gtagcataaa 660 ttactatact tctatagaca cgcaaacaca aatacacaca ctaaattacc cggatcaatt 720 cgggatg 727 <210> 45 <211> 206 <212> DNA <213> Artificial Sequence <400> 45 ggtaccacct gtccgatcgg acagttgata tcacctgtcc gatcggacag ttctcgagag 60 ctcggtaccc gggtcgaggt aggcgtgtac ggtgggaggc ctatataagc agagctcgtt 120 tagtgaaccg tcagatcgcc tggagacgcc atccacgctg ttttgacctc catagaagac 180 accgggaccg atccagcctc cgcggc 206 <210> 46 <211> 204 <212> DNA <213> Artificial Sequence <400> 46 ggtaccacct gtccgatcgg acagttgata tcacctgtcc gatcggacag ttctcgagag 60 cctcggtacc cgggtcgagg taggcgtgta cggtgggcgc ctataaaagc agagctcgtt 120 tagtgaaccg tcagatcgcc tggagcaatt ccacaacact tttgtcttat accaactttc 180 cgtaccactt cctaccctcg taaa 204 <210> 47 <211> 574 <212> PRT <213> Artificial Sequence <400> 47 Met Gly Ser Gly Arg Ala Asp Ala Leu Asp Asp Phe Asp Leu Asp Met 1 5 10 15 Leu Gly Ser Asp Ala Leu Asp Asp Phe Asp Leu Asp Met Leu Gly Ser 20 25 30 Asp Ala Leu Asp Asp Phe Asp Leu Asp Met Leu Gly Ser Asp Ala Leu 35 40 45 Asp Asp Phe Asp Leu Asp Met Leu Ile Asn Ser Ala Leu Leu Gln Leu 50 55 60 Gln Phe Asp Asp Glu Asp Leu Gly Ala Leu Leu Gly Asn Ser Thr Asp 65 70 75 80 Pro Ala Val Phe Thr Asp Leu Ala Ser Val Asp Asn Ser Glu Phe Gln 85 90 95 Gln Leu Leu Asn Gln Gly Ile Pro Val Ala Pro His Thr Thr Glu Pro 100 105 110 Met Leu Met Glu Tyr Pro Glu Ala Ile Thr Arg Leu Val Thr Gly Ala 115 120 125 Gln Arg Pro Pro Asp Pro Ala Pro Ala Pro Leu Gly Ala Pro Gly Leu 130 135 140 Pro Asn Gly Leu Leu Ser Gly Asp Glu Asp Phe Ser Ser Ile Ala Asp 145 150 155 160 Met Asp Phe Ser Ala Leu Leu Ser Gln Ile Ser Ser Gly Ser Gly Ser 165 170 175 Gln Pro Leu Asp Pro Ala Pro Ala Val Thr Pro Glu Ala Ser His Leu 180 185 190 Leu Glu Asp Pro Asp Glu Glu Thr Ser Gln Ala Val Lys Ala Leu Arg 195 200 205 Glu Met Ala Asp Thr Val Ile Pro Gln Lys Glu Glu Ala Ala Ile Cys 210 215 220 Gly Gln Met Asp Leu Ser His Pro Pro Pro Arg Gly His Leu Asp Glu 225 230 235 240 Leu Thr Thr Thr Leu Glu Ser Met Thr Glu Asp Leu Asn Leu Asp Ser 245 250 255 Pro Leu Thr Pro Glu Leu Asn Glu Ile Leu Asp Thr Phe Leu Asn Asp 260 265 270 Glu Cys Leu Leu His Ala Met His Ile Ser Thr Gly Leu Ser Ile Phe 275 280 285 Asp Thr Ser Leu Phe Ala Lys Gly Thr Ser Arg Ala Asp Pro Lys Lys 290 295 300 Lys Arg Lys Val Glu Ala Ser Gly Ser Lys Gly Arg Ala Asp Pro Lys 305 310 315 320 Lys Lys Arg Lys Val Glu Ala Ser Gly Ser Gly Arg Ile Val Gly Glu 325 330 335 Asp Gln Leu Trp Gly Arg Arg Ala Leu Glu Phe Val Asp Ser Val Glu 340 345 350 Arg Leu Glu Ala Pro Ala Leu Ile Ser Arg Phe Glu Ser Leu Ile Ala 355 360 365 Ser Cys Gly Phe Thr Ala Tyr Ile Met Ala Gly Leu Pro Ser Arg Asn 370 375 380 Ala Gly Leu Pro Glu Leu Thr Leu Ala Asn Gly Trp Pro Arg Asp Trp 385 390 395 400 Phe Asp Leu Tyr Val Ser Glu Asn Phe Ser Ala Val Asp Pro Val Pro 405 410 415 Arg His Gly Ala Thr Thr Val His Pro Phe Val Trp Ser Asp Ala Pro 420 425 430 Tyr Asp Arg Asp Arg Asp Pro Ala Ala His Arg Val Met Thr Arg Ala 435 440 445 Ala Glu Phe Gly Leu Val Glu Gly Tyr Cys Ile Pro Leu His Tyr Asp 450 455 460 Asp Gly Ser Ala Ala Ile Ser Met Ala Gly Lys Asp Pro Asp Leu Ser 465 470 475 480 Pro Ala Ala Arg Gly Ala Met Gln Leu Val Ser Ile Tyr Ala His Ser 485 490 495 Arg Leu Arg Ala Leu Ser Arg Pro Lys Pro Ile Arg Arg Asn Arg Leu 500 505 510 Thr Pro Arg Glu Cys Glu Ile Leu Gln Trp Ala Ala Gln Gly Lys Thr 515 520 525 Ala Trp Glu Ile Ser Val Ile Leu Cys Ile Thr Glu Arg Thr Val Lys 530 535 540 Phe His Leu Ile Glu Ala Ala Arg Lys Leu Asp Ala Ala Asn Arg Thr 545 550 555 560 Ala Ala Val Ala Lys Ala Leu Thr Leu Gly Leu Ile Arg Leu 565 570 <210> 48 <211> 546 <212> Ms <213> Artificial Sequence <400> 48 aaggatctgc gatcgctccg gtgcccgtca gtgggcagag cgcacatcgc ccacagtccc 60 cgagaagttg gggggagggg tcggcaattg aacgggtgcc tagagaaggt ggcgcggggt 120 aaactgggaa agtgatgtcg tgtactggct ccgccttttt cccgagggtg ggggagaacc 180 gtatataagt gcagtagtcg ccgtgaacgt tctttttcgc aacgggtttg ccgccagaac 240 acagctgaag cttcgagggg ctcgcatctc tccttcacgc gcccgccgcc ctacctgagg 300 ccgccatcca cgccggttga gtcgcgttct gccgcctccc gcctgtggtg cctcctgaac 360 tgcgtccgcc gtctaggtaa gtttaaagct caggtcgaga ccgggccttt gtccggcgct 420 cccttggagc ctacctagac tcagccggct ctccacgctt tgcctgaccc tgcttgctca 480 actctacgtc tttgtttcgt tttctgttct gcgccgttac agatccaagc tgtgaccggc 540 gcctac 546 <210> 49 <211> 57 <212> DNA <213> Artificial Sequence <400> 49 gcaacaaact tctcactact caaacaagca ggtgacgtgg aggagaatcc cgggcct 57 <210> 50 <211> 54 <212> DNA <213> Artificial Sequence <400> 50 gagggcagag gaagtctgct aacatgcggt gacgtcgagg agaatcctgg ccca 54 <210> 51 <211> 50 <212> DNA <213> Artificial Sequence <400> 51 taacaccgtg cgtgttgact attttacctc tggcggtgat aatggttgca 50 <210> 52 <211> 237 <212> PRT <213> Artificial Sequence <400> 52 Met Ser Thr Lys Lys Lys Pro Leu Thr Gln Glu Gln Leu Glu Asp Ala 1 5 10 15 Arg Arg Leu Lys Ala Ile Tyr Glu Lys Lys Lys Asn Glu Leu Gly Leu 20 25 30 Ser Gln Glu Ser Val Ala Asp Lys Met Gly Met Gly Gln Ser Gly Val 35 40 45 Gly Ala Leu Phe Asn Gly Ile Asn Ala Leu Asn Ala Tyr Asn Ala Ala 50 55 60 Leu Leu Ala Lys Ile Leu Lys Val Ser Val Glu Glu Phe Ser Pro Ser 65 70 75 80 Ile Ala Arg Glu Ile Tyr Glu Met Tyr Glu Ala Val Ser Met Gln Pro 85 90 95 Ser Leu Arg Ser Glu Tyr Glu Tyr Pro Val Phe Ser His Val Gln Ala 100 105 110 Gly Met Phe Ser Pro Glu Leu Arg Thr Phe Thr Lys Gly Asp Ala Glu 115 120 125 Arg Trp Val Ser Thr Thr Lys Lys Ala Ser Asp Ser Ala Phe Trp Leu 130 135 140 Glu Val Glu Gly Asn Ser Met Thr Ala Pro Thr Gly Ser Lys Pro Ser 145 150 155 160 Phe Pro Asp Gly Met Leu Ile Leu Val Asp Pro Glu Gln Ala Val Glu 165 170 175 Pro Gly Asp Phe Cys Ile Ala Arg Leu Gly Gly Asp Glu Phe Thr Phe 180 185 190 Lys Lys Leu Ile Arg Asp Ser Gly Gln Val Phe Leu Gln Pro Leu Asn 195 200 205 Pro Gln Tyr Pro Met Ile Pro Cys Asn Glu Ser Cys Ser Val Val Gly 210 215 220 Lys Val Ile Ala Ser Gln Trp Pro Glu Glu Thr Phe Gly 225 230 235 <210> 53 <211> 56 <212> DNA <213> Pseudomonas fluorescens <400> 53 gattcgttac caattgacat gatacgaaac gtaccgtatc gttaaggtta ctagag 56 <210> 54 <211> 155 <212> DNA <213> Pseudomonas putida <400> 54 ggggcctcgc ttgggttatt gctggtgccc ggccgggcgc aatattcatg ttgatgattt 60 attatatatc gagtggtgta tttatcaata ttgtttgctc cgttatcgtt attaacaagt 120 catcaataaa gccatcacga gtaccataga ggatc 155 <210> 55 <211> 269 <212> DNA <213> Artificial Sequence <400> 55 cctgttgtgc ttgttcttgc cgaccctcgg atagacgacg gatggggtgg tcaatgtatt 60 gatgccgtcc atatcatgaa tcaaaacaat ccatttgatc aatatcaagc tcactcttaa 120 gcttcactca tccgctgcat ggccccacca gaaagggctg gcgcggcaag ccggcggcgc 180 actcgcactg gatgcgccgc tgttgagcct ggccatgaca acgcgccgat agcggccaca 240 ccccgccagg cagggtagga cacaaggag <210> 56 <211> 665 <212> DNA <213> Private Sequence(Artificial Sequence) <400> 56 tttcaaaaat tcttactttt tttttggatg gacgcaaaga agtttaataa tcatattaca 120. tggcattacc accatataca tatccatata catatccata tctaatctta cttatatgtt gtggaaatgt aaagagcccc attatcttag cctaaaaaaa ccttctcttt ggaactttca gtaatacgct taactgctca ttgctatatt gaagtacgga ttagaagccg ccgagcgggt gacagccctc cgaggaga ctctcctccg tgcgtcctcg tcttcaccgg tcgcgttcct gaaacgcaga tgtgcctcgc gccgcactgc tccgaacaat aaagattcta caatactagc ttttatggtt atgaagagga aaaattggca gtaacctggc cccacaaacc ttcaaatgaa cgaatcaaat taacaaccat aggatgataa tgcgattagt tttttagcct tatttctggg gtaattaatc agcgaagcga tgattttga tctattaaca gatatataaa tgcaaaaact 540 gatgatacga aacgtaccgt atcgttaagg tgatgatacg aaacgtaccg tatcgttaag 600 gtaataaaag tatcaacaaa aaattgttaa tatacctcta tactttaacg tcaaggagaa 660 aaaac 665 <210> 57 <211> 317 <212> DNA <213> Artificial Sequence <400> 57 acttttcata ctcccgccat tcagagaaga aaccaattgt ccatattgca tcagacattg 60 ccgtcactgc gtcttttact ggctctctc gctaaccaaa ccggtaaccc cgcttattaa 120 aagcattctg taacaaagcg ggaccaaagc catgacaaaa acgcgtaaca aaagtgcta 180 taatcacggc agaaaagtcc acattgatta tttgcacggc gtcacacttt gctatgccat 240 agcattttta tccataagat tagcggatcc tacctgacgc tttttatcgc aactctctac 300 tgtttctcca taccgt 317 <210> 58 <211> 292 <212> PRT <213> Artificial Sequence <400> 58 Met Ala Glu Ala Gln Asn Asp Pro Leu Leu Pro Gly Tyr Ser Phe Asn 1 5 10 15 Ala His Leu Val Ala Gly Leu Thr Pro Ile Glu Ala Asn Gly Tyr Leu 20 25 30 Asp Phe Phe Ile Asp Arg Pro Leu Gly Met Lys Gly Tyr Ile Leu Asn 35 40 45 Leu Thr Ile Arg Gly Gln Gly Val Val Lys Asn Gln Gly Arg Glu Phe 50 55 60 Val Cys Arg Pro Gly Asp Ile Leu Leu Phe Pro Pro Gly Glu Ile His 65 70 75 80 His Tyr Gly Arg His Pro Glu Ala Arg Glu Trp Tyr His Gln Trp Val 85 90 95 Tyr Phe Arg Pro Arg Ala Tyr Trp His Glu Trp Leu Asn Trp Pro Ser 100 105 110 Ile Phe Ala Asn Thr Gly Phe Phe Arg Pro Asp Glu Ala His Gln Pro 115 120 125 His Phe Ser Asp Leu Phe Gly Gln Ile Ile Asn Ala Gly Gln Gly Glu 130 135 140 Gly Arg Tyr Ser Glu Leu Leu Ala Ile Asn Leu Leu Glu Gln Leu Leu 145 150 155 160 Leu Arg Arg Met Glu Ala Ile Asn Glu Ser Leu His Pro Pro Met Asp 165 170 175 Asn Arg Val Arg Glu Ala Cys Gln Tyr Ile Ser Asp His Leu Ala Asp 180 185 190 Ser Asn Phe Asp Ile Ala Ser Val Ala Gln His Val Cys Leu Ser Pro 195 200 205 Ser Arg Leu Ser His Leu Phe Arg Gln Gln Leu Gly Ile Ser Val Leu 210 215 220 Ser Trp Arg Glu Asp Gln Arg Ile Ser Gln Ala Lys Leu Leu Leu Ser 225 230 235 240 Thr Thr Arg Met Pro Ile Ala Thr Val Gly Arg Asn Val Gly Phe Asp 245 250 255 Asp Gln Leu Tyr Phe Ser Arg Val Phe Lys Lys Cys Thr Gly Ala Ser 260 265 270 Pro Ser Glu Phe Arg Ala Gly Cys Glu Glu Lys Val Asn Asp Val Ala 275 280 285 Val Lys Leo Ser 290

Claims

1. An intercellular communication system, the intercellular communication system comprising a signal sending element and a signal receiving element, wherein: The signal sending element and the signal receiving element are located in different cells; wherein, Signaling molecules include 2,4-diacetylphloroglucinol (DAPG); The signal sending element is a signal molecule biosynthesis gene expression cassette; The signal receiving element comprises an allosteric transcription factor expression cassette and an inducible promoter; wherein the allosteric transcription factor interacts with the signal molecule, and the inducible promoter comprises an operator sequence that interacts with the allosteric transcription factor; Wherein, the DAPG biosynthesis gene is the coding sequence of PhlD, PhlA, PhlB and PhlC; the allosteric transcription factor interacting with DAPG is PhlF; the operator sequence of PhlF is SEQ ID NO: 34; Wherein, the signal molecule further includes one or more of p-coumaroyl-homoserine lactone (pC), isovaleryl-homoserine lactone (IV), salicylate (Sal), methicillin furan (MMF), naringenin (NG), 3-oxo-hexanoyl-L-homoserine lactone (3OC6) and 3-oxo-dodecanoyl-L-homoserine lactone (3OC12), Wherein, the pC biosynthesis gene is the coding sequence of TAL, 4CL and RpaI; the allosteric transcription factor interacting with pC is RpaR; the operator sequence of RpaR is SEQ ID NO: 35; Wherein, the IV biosynthesis gene is the coding sequence of the branched-chain α-ketoacid dehydrogenase complex BCDH and BjaI; the allosteric transcription factor interacting with IV is BjaR; the operator sequence of BjaR is SEQ ID NO: 36; Wherein, the Sal biosynthesis gene is selected from the coding sequence of isochorismate-pyruvate lyase and isochorismate synthase, the coding sequence of salicylate synthase or a combination thereof; the allosteric transcription factor interacting with Sal is NahR; the operator sequence of NahR is SEQ ID NO: 37; Wherein, the MMF biosynthesis gene is the coding sequence of MmfL, MmfH and MmfP; the allosteric transcription factor interacting with MMF is MmfR; the operator sequence of MmfR is SEQ ID NO: 38; Wherein, the NG biosynthesis gene is the coding sequence of TAL, 4CL, chalcone synthase A and chalcone isomerase 1; the allosteric transcription factor interacting with NG is FdeR; the operator sequence of FdeR is SEQ ID NO: 39; Wherein, the 3OC6 biosynthesis gene is the coding sequence of LuxI; the allosteric transcription factor interacting with 3OC6 is LuxR; the operator sequence of LuxR is SEQ ID NO: 41; Wherein, the 3OC12 biosynthesis gene is the coding sequence of LasI; the allosteric transcription factor interacting with 3OC12 is LasR; and the operator sequence of LasR is SEQ ID NO:

43.

2. The system of claim 1, wherein: The coding sequences of PhlD and PhlF are the phlD gene and the phlF gene of Pseudomonas fluorescens, respectively; the coding sequences of PhlA, PhlB and PhlC are the phlACB operon of Pseudomonas fluorescens.

3. The system of claim 2, wherein: The Ph1F has a D128G mutation.

4. The system of claim 1, wherein: For the signal molecule pC, the coding sequence of TAL is the tal gene of Rhodobacter sphaeroides; the coding sequences of 4CL, RpaI and RpaR are the 4cl, rpaI and rpaR genes of Rhodopseudomonas palustris, respectively.

5. The system of claim 1, wherein: The coding sequence of the branched-chain α-ketoacid dehydrogenase complex BCDH is the IpdA1-bdkFGH operon of Streptomyces avermitilis; the coding sequences of BjaI and BjaR are the bjaI and bjaR genes of Bradyrhizobium japonicum, respectively.

6. The system of claim 1, wherein: The coding sequences of isochorismate-pyruvate lyase and isochorismate synthase are the pchBA double gene operon of Pseudomonas aeruginosa; the coding sequence of salicylic acid synthase is the irp9 gene of Yersinia enterocolitica; and the coding sequence of NahR is the nahR gene of Pseudomonas putida.

7. The system of claim 6, wherein: The NahR has a Q168R mutation.

8. The system of claim 1, wherein: The coding sequences of MmfL, MmfH and MmfP are the mmfLHP operon of Streptomyces coelicolor; and the coding sequence of MmfR is the mmfR gene of Streptomyces coelicolor.

9. The system of claim 1, wherein: For the signal molecule NG, the coding sequence of TAL is the tal gene of Rhodobacter sphaeroides; the coding sequence of 4CL is the 4cl gene of Rhodobacter palustris; the coding sequence of chalcone synthase A is the chs gene of petunia; the coding sequence of chalcone isomerase 1 is the chi gene of alfalfa; and the coding sequence of FdeR is the fdeR gene of Herbaspirillum seropedicae.

10. The system of any one of claims 1 to 9, wherein: The intercellular communication system has 2, 3, 4, 5, 6, 7 or 8 channels.

11. The system of any one of claims 1 to 9, wherein: The promoters in the signal molecule biosynthesis gene expression cassette and the allosteric transcription factor expression cassette are selected from P Tet , P shown in SEQ ID NO: 24 New , J23100, J23111, J23119, PA1 or PN25.

12. The system of any one of claims 1 to 9, wherein: The promoters in the signal molecule biosynthesis gene expression cassette and the allosteric transcription factor expression cassette are selected from P gal , P adh or P tet .

13. The system of any one of claims 1 to 9, wherein: The promoters in the signal molecule biosynthesis gene expression cassette and the allosteric transcription factor expression cassette are selected from CMV1 or CMV3G promoters.

14. The system of claim 13, wherein: The allosteric transcription factor is a fusion protein fused with VTR3.

15. A multicellular gene circuit, the gene circuit comprising signal sending elements and signal receiving elements present in different cells, thereby coupling the cells with the help of signal molecules; wherein, The signal molecules include 2,4-diacetylphloroglucinol (DAPG); The signal sending element is a signal molecule biosynthesis gene expression cassette; The signal receiving element comprises an allosteric transcription factor expression cassette and an inducible promoter; wherein the allosteric transcription factor interacts with the signal molecule, and the inducible promoter comprises an operator sequence that interacts with the allosteric transcription factor; Wherein, the DAPG biosynthesis gene is the coding sequence of PhlD, PhlA, PhlB and PhlC; the allosteric transcription factor interacting with DAPG is PhlF; the operator sequence of PhlF is SEQ ID NO: 34; Wherein, the signal molecule further comprises one or more of p-coumaroyl-homoserine lactone (pC), isovaleryl-homoserine lactone (IV), salicylate (Sal), methicillin furan (MMF), naringenin (NG), 3-oxo-hexanoyl-L-homoserine lactone (3OC6) and 3-oxo-dodecanoyl-L-homoserine lactone (3OC12); Wherein, the pC biosynthesis gene is the coding sequence of TAL, 4CL and RpaI; the allosteric transcription factor interacting with pC is RpaR; the operator sequence of RpaR is SEQ ID NO: 35; Wherein, the IV biosynthesis gene is the coding sequence of the branched-chain α-ketoacid dehydrogenase complex BCDH and BjaI; the allosteric transcription factor interacting with IV is BjaR; the operator sequence of BjaR is SEQ ID NO: 36; Wherein, the Sal biosynthesis gene is selected from the coding sequence of isochorismate-pyruvate lyase and isochorismate synthase, the coding sequence of salicylate synthase or a combination thereof; the allosteric transcription factor interacting with Sal is NahR; the operator sequence of NahR is SEQ ID NO: 37; Wherein, the MMF biosynthesis gene is the coding sequence of MmfL, MmfH and MmfP; the allosteric transcription factor interacting with MMF is MmfR; the operator sequence of MmfR is SEQ ID NO: 38; Wherein, the NG biosynthesis gene is the coding sequence of TAL, 4CL, chalcone synthase A and chalcone isomerase 1; the allosteric transcription factor interacting with NG is FdeR; the operator sequence of FdeR is SEQ ID NO: 39; Wherein, the 3OC6 biosynthesis gene is the coding sequence of LuxI; the allosteric transcription factor interacting with 3OC6 is LuxR; the operator sequence of LuxR is SEQ ID NO: 41; Wherein, the 3OC12 biosynthesis gene is the coding sequence of LasI; the allosteric transcription factor interacting with 3OC12 is LasR; and the operator sequence of LasR is SEQ ID NO:

43.

16. The gene circuit according to claim 15, wherein: The coding sequences of PhlD and PhlF are the phlD gene and the phlF gene of Pseudomonas fluorescens, respectively; the coding sequences of PhlA, PhlB and PhlC are the phlACB operon of Pseudomonas fluorescens.

17. The gene circuit according to claim 16, wherein: The Ph1F has a D128G mutation.

18. The gene circuit according to claim 15, wherein: For the signal molecule pC, the coding sequence of TAL is the tal gene of Rhodobacter sphaeroides; the coding sequences of 4CL, RpaI and RpaR are the 4cl, rpaI and rpaR genes of Rhodopseudomonas palustris, respectively.

19. The gene circuit according to claim 15, wherein: The coding sequence of the branched-chain α-ketoacid dehydrogenase complex BCDH is the IpdA1-bdkFGH operon of Streptomyces avermitilis; the coding sequences of BjaI and BjaR are the bjaI and bjaR genes of Bradyrhizobium japonicum, respectively.

20. The gene circuit according to claim 15, wherein: The coding sequences of isochorismate-pyruvate lyase and isochorismate synthase are the pchBA double gene operon of Pseudomonas aeruginosa; the coding sequence of salicylic acid synthase is the irp9 gene of Yersinia enterocolitica; and the coding sequence of NahR is the nahR gene of Pseudomonas putida.

21. The gene circuit according to claim 20, wherein: The NahR has a Q168R mutation.

22. The gene circuit according to claim 15, wherein: The coding sequences of MmfL, MmfH and MmfP are the mmfLHP operon of Streptomyces coelicolor; and the coding sequence of MmfR is the mmfR gene of Streptomyces coelicolor.

23. The gene circuit according to claim 15, wherein: For the signal molecule NG, the coding sequence of TAL is the tal gene of Rhodobacter sphaeroides; the coding sequence of 4CL is the 4cl gene of Rhodobacter palustris; the coding sequence of chalcone synthase A is the chs gene of petunia; the coding sequence of chalcone isomerase 1 is the chi gene of alfalfa; and the coding sequence of FdeR is the fdeR gene of Herbaspirillum seropedicae.

24. The gene circuit according to any one of claims 15 to 23, wherein: The gene circuit has 2, 3, 4, 5, 6, 7 or 8 channels.

25. The gene circuit according to any one of claims 15 to 23, wherein: The gene circuit comprises one or more of the following logic gates: AND gate, NOT gate, OR gate, NOR gate, NAND gate, XOR gate, XAND gate, INCLUSIVE gate, INCLUSIVE NOT gate, isochronous gate, or a combination thereof.

26. The gene circuit according to any one of claims 15 to 23, wherein: The gene circuit performs one or more functions selected from the following: sensor, switch, counter, timer, converter or trigger.

27. Use of the intercellular communication system according to any one of claims 1 to 14 or the gene circuit according to any one of claims 15 to 26 in implementing bacteria-bacteria and bacteria-yeast signal transduction.

28. Use of the intercellular communication system according to any one of claims 1 to 14 or the gene circuit according to any one of claims 15 to 26 in preparing a reagent for implementing bacterial-mammalian cell, yeast-mammalian and mammalian cell-to-cell signal transduction.

29. Use of the intercellular communication system according to any one of claims 1 to 14 or the gene circuit according to any one of claims 15 to 26 in constructing artificial tissues, artificial organs or disease models.

30. Use of the intercellular communication system according to any one of claims 1 to 14 or the gene circuit according to any one of claims 15 to 26 in preparing a reagent for smart treatment.

Images