A LAMP primer set and kit for detecting BCR-ABL fusion gene

Abstract

The present invention relates to a LAMP primer set for detecting BCR-ABL fusion gene, including a LAMP primer set for detecting BCR-ABL1 gene, a LAMP primer set for detecting BCR-ABL2 gene, and a LAMP primer set for detecting BCR-ABL3 gene, with a total of 17 LAMP primers, and the sequence is shown in SEQ ID NO: 1-17. Detection method: Using the sample DNA to be tested as a template, the above-mentioned LAMP primer set for detecting BCR-ABL1 gene, the LAMP primer set for detecting BCR-ABL2 gene, and the LAMP primer set for detecting BCR-ABL3 gene are used for loop-mediated isothermal amplification, and then the amplified product is detected, and judged according to the test result. The detection method of the present invention can quickly, sensitively and specifically detect three types of BCR-ABL fusion genes, and is simple to operate, does not require complex instruments, and has low detection cost.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a LAMP primer set and a kit for detecting a BCR-ABL fusion gene. Background Art

[0002] Chronic myeloid leukemia (CML) is a type of myeloproliferative tumor, and its pathogenesis is related to the BCR-ABL fusion gene. The BCR-ABL fusion gene is formed by the translocation of chromosomes 9 and 22, and can express BCR-ABL fusion protein with high tyrosine kinase activity. The disorder of BCR-ABL fusion protein activity leads to the occurrence of CML. Ph chromosomes and BCR-ABL fusion genes can be detected in more than 90% of CML patients. The breakpoints of the BCR gene in the BCR-ABL fusion gene are mainly divided into three types: Major-BCR (M-BCR), minor (m-BCR) and u-BCR. The breakpoint of the BCR gene in the M-BCR region is usually limited to a 5.8kb DNA fragment region, and the breakpoint occurs between exons e13 and e14 or e14 and e15. The upstream of the broken BCR gene exon remains on chromosome 22 and fuses with exon a2 after the ABL gene break, transcribed into e13a2 or e14a2 mRNA, encoding P210 fusion protein, which is seen in more than 90% of CML cases; the breakpoint of the BCR gene in the m-BCR region usually occurs between exons e1 and e2, transcribed into e1a2 mRNA, encoding P190 fusion protein, which is seen in 3% of atypical CML and 2 / 3 of Ph-positive B-cell acute lymphoblastic leukemia (Ph-positive B-cell acute lymphoblastic leukemia). The BCR gene breakpoint in the u-BCR region usually occurs between exons e19 and e20, transcribed into e19a2 mRNA, encoding P230 fusion protein, which is common in chronic neutrophilic leukemia (CNL) cases. Targeted drugs such as the small molecule tyrosine kinase inhibitor (TKI) imatinib can bind to the ATP binding site of the BCR-ABL fusion protein, inhibit the phosphorylation of the BCR-ABL target, and then block the conduction of the downstream signaling pathway, thereby inhibiting the proliferation of CML cells and inducing cell apoptosis, which can significantly prolong the survival of patients. As a molecular marker of CML, the detection of the BCR-ABL fusion gene has become the "gold standard" for the diagnosis of CML.

[0003] At present, the main methods for detecting BCR-ABL fusion gene include fluorescence in situ hybridization, fluorescence quantitative PCR, gene chip, PCR sequencing, etc. However, these methods have the disadvantages of equipment dependence, high cost, cumbersome experimental methods, and long time.

[0004] The loop mediated isothermal amplification (LAMP) method is a new type of nucleic acid amplification method. Due to its rapidity (30-60 minutes), simplicity, sensitivity, and specificity, it has been widely used in the identification of biological species such as viruses and bacteria in recent years. It can achieve trace amplification at 60-65°C, making a great contribution to large-scale rapid detection of species. In the prior art, there is no report on the detection of BCR-ABL fusion gene using loop mediated isothermal amplification technology. Summary of the invention

[0005] The purpose of the present invention is to solve the shortcomings of the methods for detecting BCR-ABL fusion gene in the prior art, and to provide a LAMP primer set, a kit and a detection method for detecting BCR-ABL fusion gene.

[0006] Technical Solution

[0007] A LAMP primer set for detecting a BCR-ABL fusion gene, comprising a LAMP primer set for detecting a BCR-ABL1 gene, a LAMP primer set for detecting a BCR-ABL2 gene, and a LAMP primer set for detecting a BCR-ABL3 gene;

[0008] The LAMP primer set for detecting the BCR-ABL1 gene includes a BCR-ABL1-F3 primer, a BCR-ABL1-B3 primer, a BCR-ABL1-FIP primer, a BCR-ABL1-BIP primer and a BCR-ABL1-LB primer, the nucleotide sequence of the BCR-ABL1-F3 primer is shown in SEQ ID NO: 1, the nucleotide sequence of the BCR-ABL1-B3 primer is shown in SEQ ID NO: 2, the nucleotide sequence of the BCR-ABL1-FIP primer is shown in SEQ ID NO: 3, the nucleotide sequence of the BCR-ABL1-BIP primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the BCR-ABL1-LB primer is shown in SEQ ID NO: 5;

[0009] The LAMP primer set for detecting the BCR-ABL2 gene includes a BCR-ABL2-F3 primer, a BCR-ABL2-B3 primer, a BCR-ABL2-FIP primer, a BCR-ABL2-BIP primer, a BCR-ABL2-LF primer and a BCR-ABL2-LB, the nucleotide sequence of the BCR-ABL2-F3 primer is shown in SEQ ID NO:6, the nucleotide sequence of the BCR-ABL2-B3 primer is shown in SEQ ID NO:7, the nucleotide sequence of the BCR-ABL2-FIP primer is shown in SEQ ID NO:8, the nucleotide sequence of the BCR-ABL2-BIP primer is shown in SEQ ID NO:9, the nucleotide sequence of the BCR-ABL2-LF primer is shown in SEQ ID NO:10, and the nucleotide sequence of the BCR-ABL2-LB primer is shown in SEQ ID NO:11;

[0010] The LAMP primer set for detecting the BCR-ABL3 gene includes a BCR-ABL3-F3 primer, a BCR-ABL3-B3 primer, a BCR-ABL3-FIP primer, a BCR-ABL3-BIP primer, a BCR-ABL3-LF primer and a BCR-ABL3-LB primer. The nucleotide sequence of the BCR-ABL3-F3 primer is shown in SEQ ID NO: 12, the nucleotide sequence of the BCR-ABL3-B3 primer is shown in SEQ ID NO: 13, the nucleotide sequence of the BCR-ABL3-FIP primer is shown in SEQ ID NO: 14, the nucleotide sequence of the BCR-ABL3-BIP primer is shown in SEQ ID NO: 15, the nucleotide sequence of the BCR-ABL3-LF primer is shown in SEQ ID NO: 16, and the nucleotide sequence of the BCR-ABL3-LB primer is shown in SEQ ID NO: 17.

[0011] A kit for detecting BCR-ABL fusion gene comprises the above-mentioned LAMP primer set for detecting BCR-ABL fusion gene.

[0012] Furthermore, the kit also includes 2×Bst LAMP MasterMix (SYBR Green).

[0013] A method for detecting BCR-ABL fusion gene: using a sample DNA to be tested as a template, performing loop-mediated isothermal amplification using a LAMP primer set for detecting BCR-ABL1 gene, a LAMP primer set for detecting BCR-ABL2 gene, and a LAMP primer set for detecting BCR-ABL3 gene to obtain an amplified product, detecting the amplified product, and making a judgment based on the detection result.

[0014] The reaction system for detecting the BCR-ABL1 gene is:

[0015]

[0016] The reaction system for detecting the BCR-ABL2 gene is:

[0017]

[0018] The reaction system for detecting the BCR-ABL3 gene is:

[0019]

[0020] The reaction conditions of the loop-mediated isothermal amplification are: constant temperature reaction at 65° C. for 30 minutes.

[0021] Beneficial effects of the present invention: The present invention provides a LAMP primer set and a kit for detecting BCR-ABL fusion gene, which can quickly (30-60 minutes), sensitively and specifically detect three types of BCR-ABL fusion genes, have high detection coverage, are simple to operate, do not require complex instruments, and have low detection costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The sensitivity and specificity test results for BCR-ABL1 type BCR-ABL fusion gene;

[0023] Figure 2 The sensitivity and specificity test results for BCR-ABL2 type BCR-ABL fusion gene;

[0024] Figure 3 These are the sensitivity and specificity detection results for the BCR-ABL3 type BCR-ABL fusion gene. DETAILED DESCRIPTION

[0025] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and specific embodiments.

[0026] In the following examples, 2×Bst LAMP MasterMix (SYBR Green) is a product of XinDa Biotechnology Co., Ltd.

[0027] Example 1

[0028] 1. Primer design and synthesis:

[0029] Using the specific sequences near the fusion sites of BCR-ABL1 (nucleotide sequence as shown in SEQ ID NO: 18), BCR-ABL2 (nucleotide sequence as shown in SEQ ID NO: 19), and BCR-ABL3 (nucleotide sequence as shown in SEQ ID NO: 20), a LAMP primer set for detecting BCR-ABL fusion gene was designed, including a LAMP primer set for detecting BCR-ABL1 gene, a LAMP primer set for detecting BCR-ABL2 gene, and a LAMP primer set for detecting BCR-ABL3 gene. A total of 17 LAMP primers were designed, and the primer sequences are shown in Table 1. The primer sequences were sent to GenScript Co., Ltd. for synthesis, and diluted to 10uM or 20uM for standby use after synthesis.

[0030] Table 1 Primer sequences

[0031]

[0032]

[0033] 2. Establishment of reaction system

[0034] The reaction system for detecting BCR-ABL-1 gene subtypes is shown in Table 2:

[0035] Table 2

[0036]

[0037] The reaction system for detecting BCR-ABL2 gene subtypes is shown in Table 3:

[0038] Table 3

[0039]

[0040] The reaction system for detecting BCR-ABL3 gene subtypes is shown in Table 4:

[0041] Table 4

[0042]

[0043]

[0044] 3. Method for detecting BCR-ABL fusion gene: Using the sample DNA to be tested as a template, a LAMP primer set for detecting BCR-ABL1 gene, a LAMP primer set for detecting BCR-ABL2 gene, and a LAMP primer set for detecting BCR-ABL3 gene are used for loop-mediated isothermal amplification. The reaction system is shown in Table 2-4. The reaction is carried out at 65°C for 30 minutes to obtain an amplified product. The amplified product is detected to obtain the test result. Since the kit contains the fluorescent dye SYBR Green that binds to DNA, during the amplification of the target fusion gene DNA, the dye binds to the double-stranded DNA of the fusion gene to enhance the fluorescence. The fluorescence signal on the fusion gene is collected by the fluorescence quantitative PCR instrument. The amount of fluorescence released by the binding of the fusion gene to the dye is proportional to the amount of the fusion gene amplification product. Therefore, the product amplification amount can be judged according to the strength of the fluorescence signal.

[0045] Example 2

[0046] The BCR-ABL fusion gene BCR-ABL1, BCR-ABL2, and BCR-ABL3 sequence plasmids constructed in the PUC57 vector were used as experimental materials to verify the sensitivity and specificity of the LAMP primer set. The experimental method includes the following steps:

[0047] (1) Add samples to sterilized PCR tubes in the order from top to bottom in the reaction system of Table 2-4. Experimental groups: sensitivity experiment includes negative control group (template replaced by ddH2O) and BCR-ABL sensitivity experiment group (template 10 copies, 10 2 copies, 10 3 copies, 10 4 copies and 10 5 The specificity included a negative control group (the template was replaced by ddH2O) and a BCR-ABL specific experimental group (the template was 10 4 copies of the BCR-ABL fusion gene plasmid).

[0048] (2) Gently tap the bottom of the test tube 20 times with your finger to mix it thoroughly. Centrifuge for a few seconds to allow the reaction solution to sink to the bottom.

[0049] (3) Place the prepared reaction tube in a fluorescence quantitative PCR instrument, react at 65°C for 30 min, and collect the fluorescence signal once every 1 min.

[0050] The sensitivity and specificity of BCR-ABL1 BCR-ABL fusion gene detection results are shown in Figure 1 ,in, Figure 1 A is the sensitivity test result, Figure 1 B is the specific test result; the sensitivity and specificity test results for BCR-ABL2 type BCR-ABL fusion gene are shown in Figure 2 ,in Figure 2 A is the sensitivity test result, Figure 2 B is the specificity test result; the sensitivity and specificity test results for BCR-ABL3 type BCR-ABL fusion gene are shown in Figure 3 ,in, Figure 3 A is the sensitivity test result, Figure 3 B is the specificity test result. Figure 1 A. Figure 2 A and Figure 3 As can be seen from A, the present invention can detect a minimum of 10-10 2 copies / reaction of BCR-ABL fusion gene, and as the number of BCR-ABL fusion gene copies in each reaction increases, the higher the fluorescence value in the test result, indicating good sensitivity; Figure 1 B. Figure 2 B and Figure 3 As can be seen from B, after amplification with the specific primers of the present invention, only the BCR-ABL fusion genotype corresponding to the specific primers can be amplified, and no non-specific amplification occurs, indicating that the amplification reaction has good specificity.

[0051] According to statistics, the primer set and detection method of the present invention are used to detect the BCR-ABL1 fusion gene encoding the P210 protein, and its mutation frequency is 52.64%; the BCR-ABL2 fusion gene is detected to encode the P210 fusion protein, and its mutation frequency is 32.68%; the BCR-ABL3 fusion gene is detected to encode the P230 fusion protein, and its mutation frequency is 1.53%, indicating that the detection coverage is relatively high.

[0052] Sequence Listing:

[0053] SEQ ID NO:1

[0054] BCR-ABL1-F3 primers

[0055] GGGGCTCTATGGGTTTCTGA

[0056] SEQ ID NO:2

[0057] BCR-ABL1-B3 Primers

[0058] AGGTTGGGGTCATTTTCACTG

[0059] SEQ ID NO:3

[0060] BCR-ABL1-FIP primers

[0061] TGCTACTGGCCGCTGAAGGATCGTCCACTCAGCCACT

[0062] SEQ ID NO:4

[0063] BCR-ABL1-BIP Primers

[0064] TGACTTTGAGCCTCAGGGTCTGAGTCCAGCGAGAAGGTTTTCC

[0065] SEQ ID NO:5

[0066] BCR-ABL1-LB Primer

[0067] TGAAGCCGCTCGTTGGAAC

[0068] SEQ ID NO:6

[0069] BCR-ABL2-F3 Primers

[0070] CCTGACATCCGTGGAGCT

[0071] SEQ ID NO:7

[0072] BCR-ABL2-B3 Primers

[0073] AGGTTGGGGTCATTTTCACTG

[0074] SEQ ID NO:8

[0075] BCR-ABL2-FIP primers

[0076] GGCCGCTGAAGGGCTTCTTCGACCAACTCGTGTGTGAAACT

[0077] SEQ ID NO:9

[0078] BCR-ABL2-BIP Primers

[0079] TGACTTTGAGCCTCAGGGTCTGAGTCCAGCGAGAAGGTTTTCC

[0080] SEQ ID NO:10

[0081] BCR-ABL2-LF Primers

[0082] GCGGAATGCTGTGGACAG

[0083] SEQ ID NO:11

[0084] BCR-ABL2-LB Primer

[0085] CCGCTCGTTGGAACTCC

[0086] SEQ ID NO:12

[0087] BCR-ABL3-F3 Primers

[0088] GCTGTGGTCACCAAGAGAG

[0089] SEQ ID NO:13

[0090] BCR-ABL3-B3 Primers

[0091] GAGCGGCTTCACTCAGAC

[0092] SEQ ID NO:14

[0093] BCR-ABL3-FIP primers

[0094] TAGATGCCCACCTCCTCCATGCGAGGTCCAAGGTGCCCTA

[0095] SEQ ID NO:15

[0096] BCR-ABL3-BIP Primers

[0097] CCACGGACATCCAGGCACTGGAGGCTCAAAGTCAGATGCT

[0098] SEQ ID NO:16

[0099] BCR-ABL3-LF Primers

[0100] ATCTCCTCCACGCACTGGC

[0101] SEQ ID NO:17

[0102] BCR-ABL3-LB Primer

[0103] CCTTCGACGTCAAAGCCCTTC

[0104] SEQ ID NO:18

[0105] BCR-ABL1 gene

[0106] ATGGAGTCTGAGGAGGGGAAGGAGGCAAGGTTGGCTCGGAGCTCCCCGGAGCAGCCCAGGCCCAGCACCTCCAAGGCAGTCTCACCACCCCACCTGGATGGACCGCCTAGCCCCAGGAGCCCCGTCATAGGAAGTGAGGTCTTCCTGCCCAACAGCAACCACGTGGCCAGTGGCGCCGGGGAGGCAGCCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCCCTCTACCCCGCATCTACAAGCCTTGCTTTGTCTGTCAGGACAAGTCCTCAGGCTACCACTATGGGGTCAGCGCCTGTGAGGGCTGCAAGGGCTTC

[0107] SEQ ID NO:19

[0108] BCR-ABL2 gene

[0109] TATGGCTGTGGTACAGTCAGTGCCCGGGGCACACCCCGTGCCAGTGTACGCCTTCTCCATCAAAGGCCCTTCCTATGGAGAGGATGTCTCCAATACAACGACAGCCCAGAAGAGGAAGTGCAGCCAGACCCAGTGCCCCAGGAAGGTCATCAAGATGGAGTCTGAGGAGGGGAAGGAGGCAAGCCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCCCTCTACCCCGCATCTACAAGCCTTGCTTTGTCTGTCAGGACAAGTCCTCAGGCTACCACTATGGGGTCAGCGCCTGTGAGGGCTGCAAGGGCT

[0110] SEQ ID NO:20

[0111] BCR-ABL3 gene

[0112] AGCCTGCAAGCTGCCGTGCGCACCGATGGCTTCGACGAGTTCAAGGTGCGCCTGCAGGACCTCAGCTCTTGCATCACCCAGGGGAAAGCCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCC CAGCCCTCCCTCGCCACCCCCTCTACCCCGCATCTACAAGCCTTGCTTTGTCTGTCAGGACAAGTCCTCAGGCTACCACTATGGGGTCAGGCCTGTGAGGGCTGCAAGGGCTTCTTCCGCCGCAGCA Sequence Listing <110> Suzhou Health Vocational and Technical College <120> A LAMP primer set and kit for detecting BCR-ABL fusion gene <140> 202210347336X <141> 2022-04-01 <160> 20 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Chronic myeloid leukemia <400> 1 ggggctctat gggtttctga 20 <210> 2 <211> twenty one <212> DNA <213> Chronic myeloid leukemia <400> 2 aggttggggt cattttcact g 21 <210> 3 <211> 37 <212> DNA <213> Chronic myeloid leukemia <400> 3 tgctactggc cgctgaagga tcgtccactc agccact 37 <210> 4 <211> 43 <212> DNA <213> Chronic myeloid leukemia <400> 4 tgactttgag cctcagggtc tgagtccagc gagaaggttt tcc 43 <210> 5 <211> 19 <212> DNA <213> Chronic myeloid leukemia <400> 5 tgaagccgct cgttggaac 19 <210> 6 <211> 18 <212> DNA <213> Chronic myeloid leukemia <400> 6 cctgacatcc gtggagct 18 <210> 7 <211> twenty one <212> DNA <213> Chronic myeloid leukemia <400> 7 aggttggggt cattttcact g 21 <210> 8 <211> 41 <212> DNA <213> Chronic myeloid leukemia <400> 8 ggccgctgaa gggcttcttc gaccaactcg tgtgtgaaac t 41 <210> 9 <211> 43 <212> DNA <213> Chronic myeloid leukemia <400> 9 tgactttgag cctcagggtc tgagtccagc gagaaggttt tcc 43 <210> 10 <211> 18 <212> DNA <213> Chronic myeloid leukemia <400> 10 gcggaatgct gtggacag 18 <210> 11 <211> 17 <212> DNA <213> Chronic myeloid leukemia <400> 11 ccgctcgttg gaactcc 17 <210> 12 <211> 19 <212> DNA <213> Chronic myeloid leukemia <400> 12 gctgtggtca ccaagagag 19 <210> 13 <211> 18 <212> DNA <213> Chronic myeloid leukemia <400> 13 gagcggcttc actcagac 18 <210> 14 <211> 40 <212> DNA <213> Chronic myeloid leukemia <400> 14 tagatgccca cctcctccat gcgaggtcca aggtgcccta 40 <210> 15 <211> 40 <212> DNA <213> Chronic myeloid leukemia <400> 15 ccacggacat ccaggcactg gaggctcaaa gtcagatgct 40 <210> 16 <211> 19 <212> DNA <213> Chronic myeloid leukemia <400> 16 atctcctcca cgcactggc 19 <210> 17 <211> twenty one <212> DNA <213> Chronic myeloid leukemia <400> 17 ccttcgacgt caaagccctt c 21 <210> 18 <211> 342 <212> DNA <213> Chronic myeloid leukemia <400> 18 atggagtctg aggaggggaa ggaggcaagg ttggctcgga gctccccgga gcagcccagg 60 cccagcacct ccaaggcagt ctcaccaccc cacctggatg gaccgcctag ccccaggagc 120 cccgtcatag gaagtgaggt cttcctgccc aacagcaacc acgtggccag tggcgccggg 180 gaggcagcca ttgagaccca gagcagcagt tctgaagaga tagtgcccag ccctccctcg 240 ccaccccctc taccccgcat ctacaagcct tgctttgtct gtcaggacaa gtcctcaggc 300 taccactatg gggtcagcgc ctgtgagggc tgcaagggct tc 342 <210> 19 <211> 336 <212> DNA <213> Chronic myeloid leukemia <400> 19 tatggctgtg gtacagtcag tgcccggggc acaccccgtg ccagtgtacg ccttctccat 60 caaaggccct tcctatggag aggagtctc caatacaacg acagcccaga agaggaagtg 120 cagccagacc cagtgcccca ggaaggtcat caagatggag tctgaggagg ggaaggaggc 180 aagccattga gacccagagc agcagttctg aagagatagt gcccagccct ccctcgccac 240 cccctctacc ccgcatctac aagccttgct ttgtctgtca ggacaagtcc tcaggctacc 300 actatggggt cagcgcctgt gagggctgca agggct 336 <210> 20 <211> 256 <212> DNA <213> Chronic myeloid leukemia <400> 20 agcctgcaag ctgccgtgcg caccgatggc ttcgacgagt tcaaggtgcg cctgcaggac 60 ctcagctctt gcatcaccca ggggaaagcc attgagaccc agagcagcag ttctgaagag 120 atagtgccca gccctccctc gccaccccct ctaccccgca tctacaagcc ttgctttgtc 180 tgtcaggaca agtcctcagg ctaccactat ggggtcagcg cctgtgaggg ctgcaagggc 240 ttcttccgcc gcagca 256

Claims

1. A LAMP primer set for detecting BCR-ABL fusion gene, characterized in that: It consists of a LAMP primer set for detecting the BCR-ABL1 gene, a LAMP primer set for detecting the BCR-ABL2 gene, and a LAMP primer set for detecting the BCR-ABL3 gene; The LAMP primer set for detecting the BCR-ABL1 gene consists of a BCR-ABL1-F3 primer, a BCR-ABL1-B3 primer, a BCR-ABL1-FIP primer, a BCR-ABL1-BIP primer and a BCR-ABL1-LB primer, the nucleotide sequence of the BCR-ABL1-F3 primer is shown in SEQ ID NO: 1, the nucleotide sequence of the BCR-ABL1-B3 primer is shown in SEQ ID NO: 2, the nucleotide sequence of the BCR-ABL1-FIP primer is shown in SEQ ID NO: 3, the nucleotide sequence of the BCR-ABL1-BIP primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the BCR-ABL1-LB primer is shown in SEQ ID NO: 5; The LAMP primer set for detecting the BCR-ABL2 gene consists of a BCR-ABL2-F3 primer, a BCR-ABL2-B3 primer, a BCR-ABL2-FIP primer, a BCR-ABL2-BIP primer, a BCR-ABL2-LF primer and a BCR-ABL2-LB primer, the nucleotide sequence of the BCR-ABL2-F3 primer is shown in SEQ ID NO:6, the nucleotide sequence of the BCR-ABL2-B3 primer is shown in SEQ ID NO:7, the nucleotide sequence of the BCR-ABL2-FIP primer is shown in SEQ ID NO:8, the nucleotide sequence of the BCR-ABL2-BIP primer is shown in SEQ ID NO:9, the nucleotide sequence of the BCR-ABL2-LF primer is shown in SEQ ID NO:10, and the nucleotide sequence of the BCR-ABL2-LB primer is shown in SEQ ID NO:11; The LAMP primer set for detecting the BCR-ABL3 gene consists of a BCR-ABL3-F3 primer, a BCR-ABL3-B3 primer, a BCR-ABL3-FIP primer, a BCR-ABL3-BIP primer, a BCR-ABL3-LF primer and a BCR-ABL3-LB primer. The nucleotide sequence of the BCR-ABL3-F3 primer is shown in SEQ ID NO: 12, the nucleotide sequence of the BCR-ABL3-B3 primer is shown in SEQ ID NO: 13, the nucleotide sequence of the BCR-ABL3-FIP primer is shown in SEQ ID NO: 14, the nucleotide sequence of the BCR-ABL3-BIP primer is shown in SEQ ID NO: 15, the nucleotide sequence of the BCR-ABL3-LF primer is shown in SEQ ID NO: 16, and the nucleotide sequence of the BCR-ABL3-LB primer is shown in SEQ ID NO:

17.

2. A kit for detecting BCR-ABL fusion gene, characterized in that: The method comprises the LAMP primer set for detecting the BCR-ABL1 gene, the LAMP primer set for detecting the BCR-ABL2 gene and the LAMP primer set for detecting the BCR-ABL3 gene according to claim 1.

3. The kit for detecting the BCR-ABL fusion gene according to claim 2, characterized in that: The kit includes 2×Bst LAMP MasterMix (SYBR Green).

Images