Methemoglobin biosensor based on crisper-cas12a for pgm signal detection of myoglobin and preparation method thereof
By using a CRISPR-Cas12a-based biosensor, combined with test strips and a blood glucose meter, highly sensitive qualitative and quantitative detection of myoglobin has been achieved, solving the problems of low sensitivity and insufficient specificity in existing technologies. This technology is suitable for rapid detection and screening of acute myocardial infarction.
Patent Information
- Application Number
- CN202210449485.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-04-27
- Publication Date
- 2026-04-28
- Estimated Expiration
- 2042-04-27
AI Technical Summary
Existing methods for detecting myoglobin have low sensitivity and weak specificity, and are not suitable for rapid detection and screening of acute myocardial infarction in complex environments.
A CRISPR-Cas12a-based biosensor was designed, which, combined with a test strip and a blood glucose meter, enables qualitative and quantitative detection of myoglobin through CRISPR-Cas12a protein, crRNA, myoglobin aptamer, and biotin-DNA-convertase probe. By utilizing the binding characteristics of myoglobin to the aptamer, the cleavage activity of CRISPR-Cas12a is activated or inhibited, and colorimetric reaction occurs when combined with glucose.
It achieves highly sensitive qualitative and quantitative detection with a detection limit of 1.32 ng/mL. It is simple and easy to operate, suitable for rapid clinical testing, and balances the timeliness and accuracy of diagnosis.
Smart Images

Figure CN114924080B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of analytical detection technology, specifically relating to a biosensor for detecting myoglobin based on CRISPR-Cas12a PGM signals and its preparation method. Background Technology
[0002] Myoglobin is a small protein that can bind molecular oxygen and can be found in the heart muscle and skeletal muscle of the human body. It is one of the earliest markers that rise in patients with acute myocardial infarction. Blood concentration can rise in 2 to 4 hours, and almost all patients with acute myocardial infarction have elevated myoglobin levels in 6 to 10 hours. Therefore, the detection of myoglobin is helpful for the early diagnosis of acute myocardial infarction (AMI). However, its specificity is low and it is not suitable for rapid detection and screening of acute myocardial infarction in complex environments.
[0003] Currently, commonly used methods for detecting myoglobin include chemiluminescence and electrochemiluminescence sensor detection, but these methods have low sensitivity, poor reagent stability, and weak specificity, making them unsuitable for rapid clinical testing. Summary of the Invention
[0004] Purpose of the invention: To address the shortcomings and defects of existing technologies, the technical problem to be solved by this invention is to provide a biosensor based on the CRISPR-Cas12-PGM system for colorimetric qualitative detection of myoglobin using test strips and quantitative detection of myoglobin using a blood glucose meter. A single solution can be detected twice for repeated verification, ensuring the authenticity and validity of the experiment. For environments requiring only qualitative detection, only the test strip detection method can be used, while for environments requiring quantitative detection, both detection methods can be used in combination.
[0005] Another technical problem that this invention aims to solve is to provide a method for preparing the biosensor.
[0006] The final technical problem to be solved by this invention is to provide a method for the qualitative and quantitative detection of myoglobin in vitro.
[0007] Technical solution: In order to solve the above technical problems, the present invention provides a biosensor for detecting myoglobin based on CRISPR-Cas12a PGM signal, wherein the biosensor includes a test strip with a biotin-DNA-convertase probe.
[0008] The biosensor further includes CRISPR-Cas12a protein, crRNA, myoglobin aptamer, and PGM blood glucose meter. The DNA sequence is shown in SEQ ID NO: 3, and the invertase is sucrose invertase.
[0009] The preparation method of the biotin-DNA-convertase probe includes the following steps: using sulfo-SMCC to ligate biotin-DNA with convertase to synthesize the Biotin-DNA-INV probe.
[0010] The sensor also includes a reaction buffer solution containing Na2HPO4·12H2O and pH = 7.38.
[0011] The present invention also includes a method for preparing the aforementioned biosensor, comprising the following steps:
[0012] 1) Synthesize the Biotin-DNA-INV probe using biotin-DNA, invertase, and sulfo-SMCC;
[0013] 2) Assemble the test strips.
[0014] The present invention also includes a method for in vitro qualitative and quantitative detection of myoglobin, comprising the following steps:
[0015] 1) Add the solution to be tested onto the test strip;
[0016] 2) If the test line changes from blue to a visible green, the solution does not contain myoglobin, and the test is complete; if the test line remains the original blue of the test strip, the solution contains myoglobin, and the next step should be performed.
[0017] 3) Squeeze the reaction pad containing myoglobin from step 2), place the squeezed solution onto the PGM blood glucose meter test strip, and measure the myoglobin concentration using the relationship between the PGM signal and the myoglobin concentration.
[0018] The experimental principle of this invention: This invention utilizes the strong binding affinity between myoglobin and its aptamer to design the above system. The solution contains CRISPR-Cas12a protein, crRNA, myoglobin aptamer, and biotin-modified biotin-DNA-invertase. In the subsequent test solution, if myoglobin is absent, the aptamer binds to the CRISPR-Cas12a protein and crRNA (i.e., the CRISPR-Cas12a system), enabling it to cleave short-chain ssDNA, thus cutting the biotin-DNA-invertase and releasing invertase and biotin. If the test solution contains myoglobin, the myoglobin binds to the aptamer, failing to activate the Cas12a system, resulting in no fluorescence. The biotin-DNA-invertase remains unchanged. When the above solution is added to the test strip, if the solution contains free invertase, hydrogen peroxide will be generated during the conversion of sucrose to glucose. This hydrogen peroxide reacts with TMB (3,3′,5,5′-tetramethylbenzidine) in the test strip, causing the detection line to change from blue to a visible green. If the system contains myoglobin, the myoglobin aptamer binds to the myoglobin, and the detection line will remain the original blue color of the test strip. After squeezing out some of the glucose solution from the test strip, it can be added to the strip for glucose measurement using a blood glucose meter.
[0019] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: This invention provides a biosensor for the qualitative and quantitative detection of myoglobin, which is easy to assemble, convenient to operate, and has high detection sensitivity and good selectivity. This invention combines test strips with the PGM method for dual detection. Both methods are relatively simple and portable, reducing the difficulty of signal acquisition. Using test strips allows for visual observation of the detection effect, enabling qualitative analysis of experimental results. Combined with a blood glucose meter and a CRISPR-Cas system, it can achieve detection with low and accurate limits of detection, down to 1.32 ng / mL. The test strips and blood glucose meter are simple, easy to install, and low in cost. They can simultaneously detect the presence and concentration of myoglobin in solution, balancing timeliness and accuracy in diagnosis, and are expected to be applied in clinical practice. Attached Figure Description
[0020] Figure 1 This is a schematic diagram of the experimental principle.
[0021] Figure 2 This is a gel electrophoresis image of biotin-DNA-convertase.
[0022] Figure 3 (A) describes the color development principle of the test strips; Figure 3 (B) Colorimetric reactions of test strips for different concentrations of myoglobin; Figure 3 (C) Image J processing of color intensity of different concentrations of myoglobin;
[0023] Figure 4 The graph shows the relationship between the PGM signal and the Mb concentration in the sample.
[0024] Figure 5 (A) Selectivity diagram of different proteins; (B) Selectivity of myoglobin colorimetric detection; (C) Selectivity of myoglobin detected by PGM. Detailed Implementation
[0025] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0026] 1. The reagents used in this invention are as follows: sucrose invertase (Sigma-Aldrich, 14504), PEG-20000, tris(hydroxymethyl)aminomethane, sucrose, glucose sulfosuccinimide 4-(N-maleimidemethyl)cyclohexane-1-carboxylate (Sulfo-SMCC), myoglobin aptamer (Shanghai Sangon Biotech Co., Ltd.), CRISPR-Cas12a protein (NewEngland Biolabs), tris(2-carboxyethyl)phosphine (TCEP), 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES), 2-amino-2-(hydroxymethyl)propane-1,3-diol (Tris), SYBR Green I (DNA dye), loading buffer and streptavidin (Sigma-Aldrich), Amicon-10K / 100K centrifuge filter (Millipore), nitrocellulose membrane (NC membrane), sample pad, and PVC back pad were purchased from (Cojet Biotech Inc.). The blood glucose meter was provided by ACCU-CHEKAvi. All other solvents were analytical reagent grade and readily available in the market.
[0027] 2. The test strip (lateral flow test strip) used in this invention includes a sample pad for sample application, an NC membrane for biological DNA capture, a catalytic pad for acid catalytic conditions, and a reaction pad for glucose release and continuous sample absorption. The test strip has a detection line with molecules A and B fixed on the detection line. Molecule A is streptavidin, and molecule B is 3,3′,5,5′-tetramethylbenzidine.
[0028] 3. The analytical test strip of the present invention further includes reaction buffer A; the reaction buffer A includes Na2HPO4·12H2O, pH=7.38.
[0029] 4. The reaction reagents also include: multiple DNA sequences. The reagents used in this invention are commercially available products, and the sequences used are commercially synthesized according to Table 1.
[0030] Table 1. Experimental DNA sequences
[0031]
[0032] The DNA sequences used in this study were all synthesized by Shanghai Sangon Biotech Co., Ltd. and purified by high performance liquid chromatography.
[0033] Example 1: Preparation of Biotin-DNA-Convertase Probe
[0034] The biotin-DNA-convertase probe was synthesized via a sulfur-SMCC reaction using a bifunctional crosslinking agent. 90 μL of biotin-labeled thiol-DNA (Bio-SH-DNA in Table 1), 5 μL of 1M PBS buffer (pH 5.0), and 5 μL of 30 mM TCEP were incubated at 37 °C for 1 h. The Bio-SH-DNA was then purified eight times using a 3K ultrafiltration tube (Merck Millipore, Amicon-3K) and stored in PBS buffer to obtain the thiol-DNA solution. For the ligation of invertase, 100 μL of PBS buffer containing 20 mg / mL sucrose invertase was mixed with 1 mg sulfo-SMCC and incubated on a shaker at 37°C for 1 h. The mixture was then purified eight times using a 100K ultrafiltration tube (Merck Millipore, Amicon-100K) and PBS buffer. The purified invertase solution activated by sulfo-SMCC (BBI-lifescience, C100318-0050) was mixed with the purified thiol-DNA solution and reacted at 37°C for 48 h. Finally, the mixture was purified eight times using an Amicon-100K centrifuge filter and PBS buffer.
[0035] The obtained products were then analyzed by agarose gel electrophoresis; from Figure 2 The gel electrophoresis images demonstrate the successful synthesis of the ligation product. Lane 1: Biotin-labeled thiol DNA; Lane 2: TCEP-reduced thiol DNA; Lane 3 shows a significantly slower migration rate, indicating the synthesis of a high molecular weight Bio-DNA-INV probe.
[0036] Example 2: Combination of colorimetric detection and blood glucose detection using test strips
[0037] 1. The test strip consists of four parts: a sample pad containing the biotin-DNA-convertase probe prepared in Example 1, an NC membrane for capturing biological DNA, a catalytic pad for acid catalysis, and a reaction pad for glucose release and continuous sample absorption. The sample pad (1.8 cm × 30 cm) was treated with tris-HCl (containing 0.2% PEG20000, 0.15 mM NaCl, 0.2% Tween-20, pH 7.4). Streptavidin (2 mg / mL) was sprayed onto the NC membrane at a rate of 0.74 μL / cm (2.0 cm × 30 cm) and dried overnight at 37°C. Moisture-absorbing pad 1 (0.6 cm × 30 cm) and moisture-absorbing pad 2 (2.2 cm × 30 cm) were immersed in 0.2 M acetate buffer and 0.5 M sucrose solution, respectively, and dried at 60°C for 2 hours. The sample pad, NC membrane, catalytic pad, and absorption pad were attached to a PVC substrate, with each adjacent component overlapping each other by 1-2 cm. Cut the assembled device into 0.38mm wide pieces, dry and store for later use.
[0038] 2. For colorimetric detection using test strips, mix 1 μL of the aptamer (1 μM), 24 μL of myoglobin (Diamond, A002408), and 7 μL of reaction buffer A, and incubate at 25°C for 10 min. Then incubate the mixture with the CRISPR-Cas12a system (CRISPR-Cas12a protein and crRNA from Table 1) for 2 h. Next, add 70 μL of the mixed reaction solution to the reaction area of the test strip. After reacting for 50 min, cut the glucose test strip into 1.2 mm × 4.0 mm pieces and attach them to absorbent pads 1 and 2, respectively. Color changes can be observed after 30 min of enzymatic reaction. For quantitative detection of color intensity, the H2O2 produced by the enzyme-catalyzed glucose reaction can catalyze TMB color development in the presence of peroxidase. The chip color can be observed and analyzed on ImageJ.
[0039] Figure 3 Tables B and 3C demonstrate the addition of 11 different concentrations (0 ng / mL, 0.78 ng / mL, 1.56 ng / mL, 3.13 ng / mL, 6.25 ng / mL, 12.5 ng / mL, 25 ng / mL, 50 ng / mL, 100 ng / mL, 200 ng / mL, 400 ng / mL) of myoglobin to the CRISPR-Cas12a system, followed by observation of the color change of the test strip's detection line after a period of time, with the color intensity calculated using ImageJ software. Figure 3 As shown in Figure C, the color intensity increases with increasing myoglobin concentration. This is because myoglobin binds to the aptamer and cannot activate the cleavage activity of CRISPR-Cas12a. The results indicate that the colorimetric detection method using test strips is feasible.
[0040] 3. Combined blood glucose testing
[0041] To detect myoglobin using PGM, follow these steps: Squeeze the reaction pad from Example 2 after 50 minutes of reaction, place the solution on a blood glucose meter test strip, and quickly measure with the blood glucose meter.
[0042] In summary, this invention not only enables visual observation of the detection effect and qualitative analysis of experimental results, but also, when combined with a blood glucose meter, allows for detection with a low limit of detection. Based on the above optimization results, for the quantitative detection of Mb, such as... Figure 4 As shown, the PGM signal on the absorbent using PGM decreases with increasing Mb concentration in the sample, exhibiting a linear relationship within the detection range of 0.78–400 ng / mL. The limit of detection (LOD) is 1.32 ng / mL (0.079 nM), estimated by the equation LOD = 3σ / k, where σ is the standard deviation of the blank solution and k represents the slope of the calibration curve. This colorimetric sensitivity level is comparable to that of PGM signal detection and provides a colorimetric platform for POCT detection.
[0043] In addition, selective detection was performed, replacing myoglobin with SARS-CoV-2 N protein, CK-MB, cTnI, and BSA, and the detection was carried out in the same manner as above. Figure 5 As shown, both detection methods of this invention have good selectivity. To verify the accuracy of this experiment, spiked recovery was used to calculate the myoglobin levels of 3.13 ng / mL, 25 ng / mL, and 200 ng / mL after processing with PGM detection and colorimetric detection. Based on the linear curve relationship, the measured values of the samples were calculated, and then the recovery rate was calculated. The formula for calculating the recovery rate (Recovery%) is as follows:
[0044] Recovery rate P = (sample measured value / spiking amount) × 100%; see Table 2 for recovery rate data.
[0045] Table 2
[0046]
[0047] from Figure 5 As can be seen, the sensitivity of the blood glucose meter (PGM) of this invention is 1.32 ng / mL (0.079 nM), and the colorimetric sensitivity of the test strip is comparable to that of PGM signal detection, thus achieving dual detection of qualitative and quantitative results. sequence list <110> Nanjing University <120> A CRISPR-Cas12a-based biosensor for detecting myoglobin via PGM signal and its fabrication method <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 40 <212> DNA <213> Artificial sequence (crRNA) <400> 1 ccctcctttc cttcgacgta gatctgctgc gttgttccga 40 <210> 2 <211> 41 <212> RNA <213> Artificial sequence (Myoglobin aptamer) <400> 2 uaauuucuac uaaguguaga ugcagcagau cuacgucgaa g 41 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <400> 3 tttttttttttttttttattttttttt 30
Claims
1. A biosensor for detecting myoglobin using CRISPR-Cas12a-based PGM signals, characterized in that, The biosensor includes a test strip with a biotin-DNA-convertase probe. The sequence of the DNA is shown in SEQ ID NO:
3. The convertase is sucrose invertase. The biosensor also includes CRISPR-Cas12a protein, crRNA, myoglobin aptamer, and a PGM blood glucose meter. The preparation method of the biotin-DNA-convertase probe includes the following steps: using sulfo-SMCC to ligate biotin-DNA with the convertase to synthesize a Biotin-DNA-INV probe. The sensor also includes a reaction buffer; the reaction buffer includes Na2HPO4·12H2O, and the crRNA... The sequence is CCCTCCTTTCCTTCGACGTAGATCTGCTGCGTTGTTCCGA, and the sequence of the myoglobin aptamer is UAAUUUCUACUAAGUGUAGAUGCAGCAGAUCUACGUCGAAG. The test strip includes a sample pad containing a biotin-DNA-convertase probe, an NC membrane for biological DNA capture, a catalytic pad for acid catalysis, and a reaction pad for glucose release and continuous sample absorption. The test strip has a detection line with molecules A and B immobilized on the detection line. Molecule A is streptavidin, and molecule B is 3,3',5,5'-tetramethylbenzidine.
2. The method for preparing the biosensor according to claim 1, characterized in that, Includes the following steps: 1) Synthesize the Biotin-DNA-INV probe using biotin-DNA, invertase, and sulfo-SMCC; 2) Assemble the test strips.