A kit for detecting tumor driver gene TP53 R248W

By combining the CRISPR/Cas13a nucleic acid detection system with the RAA method, we designed crRNA with mismatched bases for TP53 R248W mutation detection, which solves the problems of false positives and high detection costs in existing technologies. This achieves high-sensitivity and low-cost TP53 R248W mutation detection, which is suitable for home-based tumor driver gene detection.

CN115261470BActive Publication Date: 2026-05-05GENERAL HOSPITAL OF SOUTHERN THEATRE COMMAND OF PLA
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210830476.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-06-24
Publication Date
2026-05-05
Estimated Expiration
2042-06-24

AI Technical Summary

Technical Problem

Existing technologies exhibit false positives when detecting the TP53 R248W mutation. Furthermore, digital PCR is costly and complex to operate, while high-throughput sequencing offers high sensitivity but involves complex experimental procedures and suffers from poor stability of mutation amplification systems. There is a lack of a detection method that is highly sensitive, stable, and cost-effective.

Method used

The CRISPR/Cas13a nucleic acid detection system was used to design mismatched bases using crRNA, combined with the RAA method for isothermal amplification, and the results were visualized by fluorescence readings to detect the TP53 R248W mutation.

Benefits of technology

It achieves highly sensitive and specific detection of TP53 R248W mutation, is easy to operate, low in cost, and suitable for home-based tumor driver gene detection, providing a basis for clinical diagnosis and treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115261470B_ABST
    Figure CN115261470B_ABST
Patent Text Reader

Abstract

This invention provides a kit for detecting the tumor driver gene TP53R248W. Using crRNA with the nucleotide sequence shown in SEQ ID NO: 5, the R248W mutant base is designed at the 5' end of the crRNA spacer sequence, and a new mismatched base C is introduced. When there are two base mismatches between the crRNA spacer sequence and the wild-type RNA, a complex will not form, and the Cas13a protein will not be activated. This kit can detect mixed plasmids with a mutation frequency as low as 0.01%, and can detect plasma concentrations as low as 10... 4 The kit contains copies / μL of the TP53R248W variant. This kit exhibits good sensitivity, high specificity, and is simple, rapid, and efficient to use.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, and more specifically, to a kit for detecting the tumor driver gene TP53R248W. Background Technology

[0002] TP53 is a crucial tumor suppressor gene, expressed at low levels in normal cells and at high levels in malignant tumors. Inactivation mutations resulting from missense mutations, insertions, or deletions are very common. Clinical studies have confirmed that 95.1% of TP53 point mutations in tumors occur primarily at highly conserved sites 175, 245, 248, 249, 273, and 282. Loss-of-function events in TP53 are common in cancer; the R248W variant not only leads to loss of tumor suppression but also, as a gain-of-function mutation, promotes tumorigenesis in mouse models. Compared to wild-type mutants, this mutant is more responsive to doxorubicin treatment. The R248W mutation has been shown to result in poorer survival. Detection of the tumor-driving gene TP53 R248W is helpful for clinical medication guidance and prognostic assessment, and is of great significance for improving overall patient survival.

[0003] Currently, the main methods for detecting TP53 R248W in tissues and plasma include digital PCR, high-throughput sequencing, and mutation amplification systems. The TP53 gene R248W mutation involves a C-to-T mutation at position 742. Because it involves only a single base mutation, false positives can occur when using qPCR. This is because qPCR probes have an inherent limitation—they easily bind non-specifically to non-target genes, forming mismatches, especially when the non-target and target genes differ by only one base. Digital PCR is costly and requires highly skilled instruments and operators; high-throughput sequencing offers high sensitivity but has a complex experimental procedure; mutation amplification systems are simple to operate but lack stability. Therefore, there is an urgent need to find a new method for detecting tumor driver genes that is highly sensitive, stable, and cost-effective.

[0004] With the continuous development of gene testing technology, numerous gene testing projects have emerged in the market, and a large number of emerging companies are vying for dominance in this field, such as Ancestry, Illumina, Helix, and 23andMe abroad, and BGI Genomics, Sansure Biotech, and Anwo Gene in China. Currently, the quality of life for the Chinese people is improving, and consumers' health awareness is gradually increasing. More and more people are beginning to pay attention to their deeper needs, such as their physical health and nutritional status. This is especially true for young people, who are the main consumers and are more receptive to new things, have a better understanding of genetics and other medical knowledge, and are willing to use gene testing to understand their genetic and health information, leading to a continuous expansion of the consumer-grade gene testing market. In future business development, as the gene testing industry matures, downstream service businesses will see significant expansion, and gene testing companies will face even fiercer competition and greater challenges. Summary of the Invention

[0005] The purpose of this invention is to overcome the above-mentioned shortcomings of the prior art and provide a kit for detecting the tumor driver gene TP53R248W.

[0006] The first object of the present invention is to provide a composition.

[0007] A second object of the present invention is to provide the use of the composition in the preparation of a product for detecting the tumor driver gene TP53R248W.

[0008] A third objective of this invention is to provide a kit for detecting the tumor driver gene TP53 R248W.

[0009] To achieve the above objectives, the present invention is implemented through the following solution:

[0010] A composition comprising crRNA, primers, and a probe, wherein the nucleotide sequence of the crRNA is shown in SEQ ID NO: 5.

[0011] Preferably, the nucleotide sequences of the primers are shown in SEQ ID NO: 2 and SEQ ID NO: 4.

[0012] Preferably, the nucleotide sequence of the probe is shown in SEQ ID NO: 6.

[0013] More preferably, the 5' end of the probe is labeled with a FAM group and the 3' end is labeled with a BHQ1 group.

[0014] The composition is used in the preparation of a product for detecting the tumor driver gene TP53 R248W.

[0015] A kit for detecting the tumor driver gene TP53 R248W, the kit containing the composition.

[0016] Preferably, the kit contains RAA or PCR amplification reagents and CRIPSR / Cas13a detection reagents, wherein the RAA or PCR amplification reagents contain the primers and the CRIPSR / Cas13a detection reagents contain the crRNA and the probe.

[0017] Preferably, the RAA amplification reagent in the kit further includes RAA reaction solution, MgCl2, water and RAA dry powder, wherein the RAA dry powder tube contains recombinase, single-stranded binding protein and DNA polymerase.

[0018] More preferably, the RAA amplification reagent in the kit further includes 1-4 μL of each primer with nucleotide sequences as shown in SEQ ID NO: 2 and SEQ ID NO: 4, each primer concentration of 10 μM, 15-60 μL of RAA reaction solution, 1-5 μL of 28 mM MgCl2, 6.5-26 μL of water, and 50 mg of RAA dry powder. The RAA dry powder tube contains 25-100 U of recombinase, 1-4 mg of single-stranded binding protein, and 50-200 U of DNA polymerase.

[0019] More preferably, the RAA amplification reagent in the kit includes 2 μL of each primer with nucleotide sequences as shown in SEQ ID NO: 2 and SEQ ID NO: 4, each primer concentration of 10 μM, 29.5 μL of RAA reaction solution, 2.5 μL of 28 mM MgCl2, 13 μL of water, and 50 mg of RAA dry powder. The RAA dry powder tube contains 100 U of recombinase, 2 mg of single-stranded binding protein, and 100 U of DNA polymerase.

[0020] Preferably, the PCR amplification reagents in the kit further include DNA polymerase and water.

[0021] More preferably, the PCR amplification reagents in the kit further include 1-4 μL each of primers with nucleotide sequences as shown in SEQ ID NO: 2 and SEQ ID NO: 4, 12.5-50 μL of DNA polymerase, and 10.5-42 μL of water.

[0022] More preferably, the PCR amplification reagents in the kit further include 25 μL of DNA polymerase and 20 μL of water.

[0023] Preferably, the CRIPSR / Cas13a detection reagent in the kit further includes the amplification product, the crRNA, the Cas13a protein, the probe, T7 transcriptase, RNase inhibitor, 5× T7 buffer, NTP and water.

[0024] More preferably, the CRIPSR / Cas13a detection reagent in the kit includes 1-2 μL of amplification product, 0.5-1 μL of 1 μM crRNA, 0.5-1 μL of 10 μM Cas13a protein, 0.5-1 μL of 10 μM probe, 0.5-1 μL of 50 U / μL T7 transcriptase, 0.5-1 μL of RNase inhibitor, 2-8 μL of 5× T7 buffer, and 1-2 μL of NTP, with RNase-free pure water added to bring the reaction reagent to 20 μL.

[0025] More preferably, the CRIPSR / Cas13a detection reagent in the kit includes 2 μL of amplification product, 1 μL of 1 μM crRNA, 1 μL of 10 μM Cas13a protein, 1 μL of 10 μM ssRNA fluorescent reporter gene, 1 μL of 50 U / μL T7 transcriptase, 1 μL of RNase inhibitor, 4 μL of 5× T7 buffer, and 2 μL of NTP, with RNase-free pure water added to bring the reaction reagent to 20 μL.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] This invention provides a kit for detecting the tumor driver gene TP53 R248W. Using crRNA with the nucleotide sequence shown in SEQ ID NO: 5, the R248W mutant base is designed at the 5' end of the crRNA spacer sequence, and a new mismatched base C is introduced. When there are two base mismatches between the crRNA spacer sequence and the wild-type RNA, a complex will not form, and the Cas13a protein will not be activated. This kit can detect mixed plasmids with a mutation frequency as low as 0.01%, and can detect plasma concentrations as low as 10... 4 The kit of this invention contains copies / μL of the TP53 R248W variant. It exhibits good sensitivity, high specificity, ease of use, and rapid, efficient operation; it is used to detect TP53 R248W mutations in the plasma of cancer patients, providing molecular evidence for clinical diagnosis and treatment.

[0028] The CRISPR / Cas13a nucleic acid detection system uses the RAA method as the nucleic acid amplification technology. RAA technology is an in vitro isothermal amplification detection technology for nucleic acids, which can detect both DNA and RNA. Compared with PCR technology, it has advantages such as low cost, short processing time, simple operation, and no limitation on testing site. Compared with other nucleic acid detection methods, the CRISPR / Cas13a detection method provides a faster alternative and provides a visual reading result through fluorescence reading, similar to a home pregnancy test. Researchers only need a portable heater, readily available reagents, and a small fluorescence detector to detect the lung cancer driver gene TP53 R248W and read the result on a visual readout strip. Attached Figure Description

[0029] Figure 1 Electrophoresis results and CRISPR / Cas13a detection results of Primer1 and Primer2 amplification products are shown. In the figures, A is an agarose gel electrophoresis image of Primer1 and Primer2 amplification products (RAA and PCR); B is the CRISPR / Cas13a detection result of Primer1 and Primer2 amplification products; C is the statistical analysis of the CRISPR / Cas13a detection result. In the figures, ns means no statistical significance, * represents P < 0.05, ** represents P < 0.01, and *** represents P < 0.001.

[0030] Figure 2 The effect of different concentrations of crRNA on the detection intensity of CRISPR / Cas13a is shown in Figure 1. * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001.

[0031] Figure 3 The effect of T7 buffer on CRIPSR / Cas13a detection performance is shown in Figure A, where T7 buffer is added and T7 buffer is not added.

[0032] Figure 4 The image shows the detection of TP53 R248W at different mutation frequencies using CRISPR / LwaCas13a. A is the electrophoresis image of the amplification products; B is the detection result of the CRISPR / Cas13a method for different TP53 R248W mutation frequencies. * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001.

[0033] Figure 5The image shows the detection of ctDNA in simulated plasma using CRISPR / Cas13a. A represents the electrophoresis image of the amplified ctDNA products from plasma; B represents the detection results of ctDNA in simulated plasma using the CRISPR / Cas13a method. * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001. Detailed Implementation

[0034] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0035] Example 1: The effect of the method for amplifying the TP53 R248W variant on the detection efficiency of CRIPSR / Cas13a.

[0036] I. Experimental Methods

[0037] 1. Amplification of the TP53 R248W variant

[0038] Two pairs of amplification primers, Primer 1 and Primer 2, were designed based on the TP53 R248W variant sequence. Primer 1 contains primers (front primer) and (back primer) with nucleotide sequences as shown in SEQ ID NO: 2 (front primer) and SEQ ID NO: 3 (back primer), and Primer 2 contains primers (front primer) and (back primer) with nucleotide sequences as shown in SEQ ID NO: 2 (front primer) and SEQ ID NO: 4 (back primer). Primer 1 is used to amplify the amplification product with the nucleotide sequence shown in SEQ ID NO: 7, and Primer 2 is used to amplify the amplification product with the nucleotide sequence shown in SEQ ID NO: 8.

[0039] The RAA amplification system was as follows: 1 μL TP53 R248W plasmid, 2 μL each of pre- and post-primer, 10 μM, 29.5 μL RAA reaction solution, 2.5 μL MgCl2 (28 mM), and 13 μL pure water. After thoroughly mixing the above reagents, add 50 mg of RAA dry powder (containing 100 U recombinase, 2 mg single-stranded binding protein, and 100 U DNA polymerase), and then incubate at 39 °C for 20 min. The nucleotide sequence of the TP53 R248W plasmid is shown in SEQ ID NO: 1.

[0040] The PCR detection system is as follows:

[0041] 1 μL of TP53 R248W plasmid, 2 μL each of pre- and post-primer, 10 μM, 25 μL of DNA polymerase (R045A, Takara) and 20 μL of purified water. After thoroughly mixing the above reagents, proceed with the amplification program. The nucleotide sequence of the TP53 R248W plasmid is shown in SEQ ID NO: 1.

[0042] The PCR amplification program is as follows: preheat at 98℃ for 5 min, then at 98℃ for 10 s, 58℃ for 15 s, 72℃ for 30 s, for 40 cycles, and finally incubate at 72℃ for 10 min.

[0043] Primer and crRNA / RNA probe sequences are shown in Table 1:

[0044] Table 1. Primer, crRNA, and probe nucleotide sequences

[0045]

[0046] 2. The CRIPSR / Cas13a method was used to detect the amplification products with nucleotide sequences as shown in SEQ ID NO: 7 and SEQ ID NO: 8 from step 1, respectively. The detection system is as follows:

[0047] Step 1: 2 μL of the amplified product with the nucleotide sequence shown in SEQ ID NO: 7 or the amplified product with the nucleotide sequence shown in SEQ ID NO: 8, 1 μL of 1 μM R248W-crRNA, 1 μL of 10 μM Cas13a protein, 1 μL of 10 μM probe, 1 μL of T7 transcriptase (50 U / μL), 1 μL of RNase inhibitor, 4 μL of 5× T7 buffer, 2 μL of NTP, and RNase-free pure water to make up to 20 μL.

[0048] After the detection system was mixed, it was detected at 37°C for 1 hour using a Bio Rad CFX fluorescence detector, and the relative fluorescence unit (RFU) was recorded for each time period.

[0049] II. Experimental Results

[0050] Both PCR and RAA techniques successfully amplified a fragment of approximately 110 bp (SEQ NO ID: 7) and a fragment of 360 bp (SEQ NO ID: 8). Figure 1A). Using CRISPR / Cas13a to detect the amplification products, the results showed that the RFU values ​​of all groups reached a plateau within 10 minutes. However, the RFU value of the R248W variant amplified based on Primer 1 was not significantly different from that of the wild type (P>0.05); while the RFU value of the R248W variant amplified based on Primer 2 was significantly higher than that of the wild type (P<0.001). Figure 1 B, C).

[0051] The TP53 gene R248W mutation is a mutation at position 742 where a C nucleotide is changed to a T nucleotide. Specifically, in the TP53 gene R248W, the nucleotide sequence complementary to the crRNA spacer has the following wild-type sequence: The nucleotide sequence of the mutant sequence is The mutant strain is formed by a C-to-T mutation in the wild-type strain, as can be seen in the bolded and underlined bases. Because there is only a single base mutation, false positives can occur when using qPCR technology. This is because the probes used in qPCR have an inherent limitation – they easily bind non-specifically to non-target genes, forming mismatches, especially when the non-target gene differs from the target gene by only one base.

[0052] In CRISPR / Cas13a detection technology, the Cas13a protein is the effector protein. It is activated to produce "linked cleavage" RNase properties only when the crRNA matches the target gene. If the crRNA mismatches with another gene, the Cas13a protein will not function. CRISPR / Cas13a detection technology reduces the occurrence of false positive results. The amplification product must contain a mutation site; therefore, the primers must be at both ends of the mutation site. If the amplified fragment is too short, such as 110 bp, the complex of R248W-crRNA and the target gene (i.e., the amplified fragment) cannot enable Cas13a to produce "linked cleavage" function. Around 360 bp, the complex of R248W-crRNA and the target gene (i.e., the amplified fragment) can activate Cas13a.

[0053] By designing the R248W mutant base at the 5' end of the spacer sequence of crRNA and introducing a new mismatched base C, when there are two base mismatches between the spacer sequence of crRNA and wild-type RNA, a complex will not be formed and the Cas13a protein cannot be activated.

[0054] Example 2: Effect of R248W-crRNA concentration on CRIPSR / Cas13a detection efficiency

[0055] I. Experimental Methods

[0056] R248W-crRNA was serially diluted to five concentrations, resulting in final crRNA concentrations of 0.05 μM, 0.1 μM, 0.15 μM, 0.20 μM, and 0.25 μM in the CRIPSR / Cas13a detection reaction system. The CRIPSR / Cas13a detection reaction system was the same as in Example 1.

[0057] II. Experimental Results

[0058] The results showed that within the range of 0.05–0.25 μM, the RFU value increased with increasing R248W-crRNA concentration. The difference was statistically significant when the R248W-crRNA concentration reached 0.20 μM or higher (P < 0.001), indicating that increasing the R248W-crRNA concentration enhances the fluorescence signal intensity of CRISPR / Cas13a. Figure 2 The concentration of R248W-crRNA was selected as 0.25 μM.

[0059] Example 3: The effect of T7 buffer on the detection performance of CRIPSR / Cas13a

[0060] I. Experimental Methods

[0061] The CRIPSR / Cas13a detection method is the same as in Example 1. The nucleotide sequences of the amplification primers are shown in SEQ NO ID: 2 and SEQ NO ID: 4. The effects of adding or not adding T7 buffer (Beijing TransGen Biotech Co., Ltd. (JT101-01)) on the CRIPSR / Cas13a detection effect are compared.

[0062] II. Experimental Results

[0063] Because T7 transcriptase is highly sensitive to sodium and magnesium ions, it only functions under appropriate sodium and magnesium ion concentrations. However, due to the amplification products, the sodium and magnesium ion concentrations in the Cas13a protein preservation solution are difficult to stabilize, sometimes causing T7 transcriptase to fail to function properly in the detection system. The results are as follows... Figure 3 As shown, T7 buffer needs to be added to the detection reaction system to stimulate the transcription of T7 transcriptase, and the addition of T7 buffer does not affect the detection efficiency of the CRISPR / Cas13a system for mutant strains.

[0064] Example 4: A kit for detecting the tumor driver gene TP53 R248W

[0065] I. Composition

[0066] 1. RAA amplification system: 2 μL each of pre- and post-primer, 10 μM, 29.5 μL RAA reaction solution, 2.5 μL MgCl2 (28 mM), 13 μL pure water. 50 mg RAA powder (containing 100 U recombinase, 2 mg single-stranded binding protein, and 100 U DNA polymerase). The nucleotide sequence of the pre-primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the post-primer is shown in SEQ ID NO: 4.

[0067] 2. PCR detection system: 2 μL each of front and back primers, 10 μM, 25 μL of DNA polymerase (R045A, Takara) and 20 μL of pure water. The nucleotide sequence of the front primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the back primer is shown in SEQ ID NO: 4.

[0068] 3. CRIPSR / Cas13a detection system:

[0069] The amplification system for RAA or PCR consists of 2 μL of the amplified product, 1 μL of 1 μM R248W-crRNA, 1 μL of 10 μM Cas13a protein, 1 μL of 10 μM probe, 1 μL of T7 transcriptase (50 U / μL), 1 μL of RNase inhibitor, 4 μL of 5× T7 buffer, 2 μL of NTP, and RNase-free pure water to a final volume of 20 μL. The nucleotide sequence of R248W-crRNA is shown in SEQ ID NO: 5, and the nucleotide sequence of the probe is shown in SEQ ID NO: 6. The probe is labeled with a FAM group at its 5' end and a BHQ1 group at its 3' end.

[0070] II. Instructions for Use

[0071] 1. Thoroughly mix the RAA amplification system, add 1-2 μL of the DNA fragment to be tested, and incubate at 39°C for 20 min.

[0072] 2. Thoroughly mix the PCR amplification system, add 1-2 μL of the DNA fragment to be tested, and start the amplification program. The PCR amplification program is as follows: preheat at 98℃ for 5 min, then at 98℃ for 10 s, 58℃ for 15 s, 72℃ for 30 s, for 40 cycles, and finally incubate at 72℃ for 10 min.

[0073] 3. After mixing the CRIPSR / Cas13a detection system, use a Bio Rad CFX fluorescence detector at 37℃ for 1 hour and record the relative fluorescence unit (RFU) at each time point. A positive result is defined as an RFU value that is more than twice that of the control group.

[0074] Example 5 shows the detection effect of TP53 R248W with different mutation rates.

[0075] I. Experimental Methods

[0076] With a concentration of 10 3 10 4 10 5 and 10 6 The TP53 R248W plasmid with copies / μL was compared with 10 7 TP53 wild-type strains were mixed at a volume ratio of 1:1 to form mixed plasmids with mutation frequencies of 0.01%, 0.1%, 1%, and 10%. 2 μL of each mixed plasmid with different mutation rates was taken for PCR amplification, and then detected using the kit in Example 4.

[0077] II. Experimental Results

[0078] Using a mixed plasmid as a template, a sequence fragment containing the mutation site was successfully amplified by PCR technology. Figure 4 A). The amplification products were detected using the CRISPR / Cas13a method. Results showed that the detection results of the TP53 gene with different mutation frequencies were statistically significant compared to the wild type (P<0.05). The lowest detectable mutation frequency was a mixed plasmid with a mutation frequency of 0.01% (containing 10...). 3 The presence of wild-type TP53 does not affect the detection of the TP53 R248W variant. Figure 4 B).

[0079] Example 6: Detection of cell-free DNA in plasma

[0080] I. Experimental Methods

[0081] Magen's nucleic acid extraction kit (catalog number D3182-03) was used to extract cell-free DNA from plasma according to the instructions. The specific steps are as follows:

[0082] 1. Transfer 100 μL of proteinase K to a 10-50 mL centrifuge tube.

[0083] 2. Transfer 1 mL of serum to the centrifuge tube containing proteinase K from step 1, mix for 5 seconds to obtain a mixed sample of serum and proteinase K.

[0084] 3. Pre-mix the carrier RNA with the digestion solution ACL. Add 0.8 mL of digestion solution ACL / carrier RNA (1 μg) to the serum and proteinase K mixed sample from step 2. The amount of carrier RNA used in each sample is 1 μg (5 μL). Vortex mix for 10 seconds. Incubate at 60°C for 30 minutes, occasionally inverting the container several times to mix.

[0085] 4. Add 1.8 mL of binding solution ACB2 to the sample, invert and mix 10-15 times, place on ice for 5 minutes to obtain the mixture.

[0086] 5. Connect the free nucleic acid adsorption column and vacuum connector to the vacuum filtration box, and insert the extension tube into the free nucleic acid adsorption column.

[0087] 6. Transfer the mixture obtained in step 4 (no more than 15 mL at a time) to the column from step 5 and turn on the vacuum pump for filtration. Continue transferring the mixture to the column for filtration. After filtration is complete, turn off the vacuum pump and allow the pressure to drop to zero. Discard the extension tube.

[0088] 7. Add 850 μL of washing buffer DCW1 to the column. After filtration, turn off the vacuum pump and allow the pressure to drop to zero.

[0089] 8. After the filtration in step 7 is completed, add 850 μL of washing buffer DCW2 to the column. After the filtration is completed, turn off the vacuum pump and let the pressure drop to zero, then collect the eluent.

[0090] 9. Collect the eluent from step 8, add 850 μL of anhydrous ethanol to the column, and after filtration, turn off the vacuum pump and let the pressure drop to zero.

[0091] 10. Remove the column and place it in a collection tube. Centrifuge at 13000×g for 3 min, remove the column, place it in a new 1.5 mL collection tube, and dry in a 56℃ oven for 10 min.

[0092] 11. Add 40-60 μL of elution buffer AE to the center of the membrane in the column, let stand for 3 min, centrifuge at 13000×g for 1 min, and collect the elution buffer.

[0093] 12. Transfer the eluent collected in step 11 to the center of the membrane in the column, let stand for 1 min, and centrifuge at 13000×g for 1 min.

[0094] 13. Discard the DNA binding column and store the eluent containing DNA at -20°C or -80°C.

[0095] Then, the cell-free DNA in plasma was detected using the kit from Example 4.

[0096] II. Experimental Results

[0097] Using simulated plasma ctDNA as a template, a sequence fragment containing the mutation site was successfully amplified. Figure 5 A). The amplification products were detected using the CRISPR / Cas13a method described in Example 1. The results showed that when the concentration of the TP53R248W variant in plasma reached 10... 4 The RFU value of the simulated plasma was significantly higher than that of wild-type plasma (P<0.01), indicating that the method in this study can detect a minimum concentration of 10 copies / μL in simulated plasma. 4 copies / μL of the TP53 R248W variant ( Figure 5 B).

[0098] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention. sequence list <110> Southern Theater Command General Hospital of the Chinese People's Liberation Army <120> A kit for detecting the tumor driver gene TP53 R248W <160> 10 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1756 <212> DNA <213> Artificial Sequence <400> 1 gattcctcac tgattgctct taggtctggc ccctcctcag catctttatcc gagtggaagg 60 aaatttgcgt gtggagtatt tggatgacag aaacactttt cgacatagtg tggtggtgcc 120 ctatgagccg cctgaggtct ggtttgcaac tggggtctct gggaggaggg gttaagggtg 180 gttgtcagtg gccctccagg tgagcagtag gggggctttc tcctgctgct tatttgacct 240 ccctataacc ccatgagatg tgcaaagtaa atgggtttaa ctattgcaca gttgaaaaaa 300 ctgaagctta cagaggctaa gggcctcccc tgcttggctg ggcgcagtgg ctcatgcctg 360 taatcccagc actttgggag gccaaggcag gcggatcacg aggttgggag atcgagacca 420 tcctggctaa cggtgaaacc ccgtctctac tgaaaaatac aaaaaaaaat tagccgggcg 480 tggtgctggg cacctgtagt cccagctact cgggaggctg aggaaggaga atggcgtgaa 540 cctgggcggt ggagcttgca gtgagctgag atcacgccac tgcactccag cctgggcgac 600 agagcgagat tccatctcaa aaaaaaaaaa aaaaggcctc ccctgcttgc cacaggtctc 660 cccaaggcgc actggcctca tcttgggcct gtgttatctc ctaggttggc tctgactgta 720 ccaccatcca ctacaactac atgtgtaaca gttcctgcat gggcggcatg aactggaggc 780 ccatcctcac catcatcaca ctggaagact ccaggtcagg agccacttgc caccctgcac 840 actggcctgc tgtgccccag cctctgcttg cctctgaccc ctgggcccac ctcttaccga 900 tttcttccat actactaccc atccacctct catcacatcc ccggcgggga atctccttac 960 tgctcccact cagttttctt ttctctggct ttgggacctc ttaacctgtg gcttctcctc 1020 cacctacctg gagctggagc ttaggctcca gaaaggacaa gggtggttgg gagtagatgg 1080 agcctggttt tttaaatggg acaggtagga cctgatttcc ttactgcctc ttgcttctct 1140 tttcctatcc tgagtagtgg taatctactg ggacggaaca gctttgaggt gcgtgtttgt 1200 gcctgtcctg ggagagaccg gcgcacagag gaagagaatc tccgcaagaa aggggagcct 1260 caccacgagc tgcccccagg gagcactaag cgaggtaagc aagcaggaca agaagcggtg 1320 gaggagacca agggtgcagt tatgcctcag attcactttt atcacctttc cttgcctctt 1380 tcctagcact gcccaacaac accagctcct ctccccagcc aaagaagaaa ccactggatg 1440 gagaatattt cacccttcag gtactaagtc ttgggacctc ttatcaagtg gaaagtttcc 1500 agtctaacac tcaaaatgcc gttttcttct tgactgtttt acctgcaatt ggggcatttg 1560 ccatcagggg gcagtgatgc ctcaaagaca atggctcctg gttgtagcta actaacttca 1620 gaacaccaac ttataccata atatatattt taaaggacca gaccagcttt caaaaagaaa 1680 attgttaaag agagcatgaa aatggttcta tgactttgcc tgatacagat gctacttgac 1740 ttacgatggt gttact 1756 <210> 2 <211> 55 <212> DNA <213> Artificial Sequence <400> 2 atatttaata cgactcacta taggggttgg ctctgactgt accaccatcc actac 55 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <400> 3 ctggagtcttccagtgtgatgatggtgagg 30 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <400> 4 atctactccc aaccaccctt gtcctttc 28 <210> 5 <211> 64 <212> DNA <213> Artificial Sequence <400> 5 gatttagact accccaaaaa cgaaggggac taaaacccac ttcatgccgc ccatgcagga 60 actg 64 <210> 6 <211> 6 <212> RNA <213> Artificial Sequence <400> 6 uuuuuu 6 <210> 7 <211> 110 <212> DNA <213> Artificial Sequence <400> 7 gttggctctg actgtaccac catccactac aactacatgt gtaacagttc ctgcatgggc 60 ggcatgaact ggaggcccat cctcaccatc atcacactgg aagactccag 110 <210> 8 <211> 368 <212> DNA <213> Artificial Sequence <400> 8 tctgactgta ccaccatcca ctacaactac atgtgtaaca gttcctgcat gggcggcatg 60 aactggaggc ccatcctcac catcatcaca ctggaagact ccaggtcagg agccacttgc 120 caccctgcac actggcctgc tgtgccccag cctctgcttg cctctgaccc ctgggcccac 180 ctcttaccga tttcttccat actactaccc atccacctct catcacatcc ccggcgggga 240 atctccttac tgctcccact cagttttctt ttctctggct ttgggacctc ttaacctgtg 300 gcttctcctc cacctacctg gagctggagc ttaggctcca gaaaggacaa gggtggttgg 360 gagtagat 368 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <400> 9 ccggaggccc atcctcacca tcatcacact 30 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <400> 10 ctggaggccc atcctcacca tcatcacact 30

Claims

1. A composition of crRNA, primers, and probes for detecting the tumor driver gene TP53 R248W based on a CRISPR / Cas13a nucleic acid detection system, characterized in that, The nucleotide sequence of the crRNA is shown in SEQ ID NO: 5; the nucleotide sequences of the primers are shown in SEQ ID NO: 2 and SEQ ID NO: 4; and the nucleotide sequence of the probe is shown in SEQ ID NO:

6.

2. The composition according to claim 1, characterized in that, The probe is labeled with the FAM group at its 5' end and the BHQ1 group at its 3' end.

3. The use of the composition according to any one of claims 1 to 2 in the preparation of a product for detecting the tumor driver gene TP53 R248W.

4. A kit for detecting the tumor driver gene TP53 R248W, characterized in that, The kit contains the composition according to any one of claims 1 to 2.

5. The reagent kit according to claim 4, characterized in that, The kit contains RAA amplification reagents, which include RAA reaction solution, MgCl2, water, and RAA dry powder. The RAA dry powder contains recombinase, single-stranded binding protein, and DNA polymerase.

6. The reagent kit according to claim 4, characterized in that, The kit contains PCR amplification reagents, which include DNA polymerase and water.

7. The reagent kit according to claim 4, characterized in that, The kit contains a CRIPSR / Cas13a detection reagent, which includes Cas13a protein, T7 transcriptase, RNase inhibitor, 5× T7 buffer, NTP and water.

Citation Information

Patent Citations

  • Probes, primers and reagent kits for detecting five mutations of human gene TP53

    CN105463114A

  • Detection method of specific nucleic acid fragment based on CRISPR-Cas13a

    CN107557455A