A non-pigment-producing strain of Pantoea algina and its application in the preparation of exopolysaccharides

Abstract

The present invention discloses a mutant strain of Pantoea algina without pigment production, wherein the mutant strain is Pantoea algina. Pantoea alhagi XK‑11 was used as the starting strain, and the phytoene synthase gene was knocked out in the XK‑11 genome. crt The present invention also discloses the application of the engineered bacteria for fermentation and preparation of Pantoea acuminata exopolysaccharide. Compared with the starting strain XK-11, the engineered bacteria XK-11Δ crt B. The purification process of preparing extracellular polysaccharides uses less ethanol, and the color of the polysaccharide after drying is pure white, which significantly reduces the production cost and improves the quality of extracellular polysaccharides. It can be used in the development of daily chemical moisturizing, food thickening, medical gel and other products.

Description

Technical Field

[0001] The invention belongs to the technical field of biochemical engineering, and particularly relates to a pigment-free Pantoea camelliae strain and application thereof in preparing extracellular polysaccharides. Background Art

[0002] Microbial exopolysaccharides are biomacromolecules secreted by microorganisms. Due to their diverse monosaccharide composition and glycosidic bond diversity, exopolysaccharides exhibit diverse functions such as thickening, emulsification, antioxidant, and anti-tumor properties, demonstrating promising application potential in a wide range of fields, including medicine, food, agriculture, and industry.

[0003] Pantoea exopolysaccharide is a newly discovered and characterized acidic heteropolysaccharide secreted by Pantoea quinquefolia. Composed of glucose, galactose, glucosamine, glucuronic acid, and mannose, pantoea exopolysaccharide has been shown to significantly promote plant growth and enhance plant resistance in agriculture. However, during fermentation, Pantoea quinquefolia also secretes a large amount of pigment, which readily forms complexes with the product polysaccharide through electrostatic chelation and ionic bonding, significantly increasing the difficulty of downstream separation. Currently, the mainstream methods for removing the pigment are activated carbon decolorization or ethanol decolorization. Activated carbon decolorization often generates solid activated carbon waste during industrial production, increasing environmental and safety assessment costs for manufacturers. Ethanol decolorization requires the use and recovery of large amounts of ethanol, significantly increasing the end-product cost. Consequently, these limitations have significantly hindered the application and promotion of Pantoea exopolysaccharides in high-quality applications such as food, daily chemicals, and medical applications. Therefore, if it is possible to construct a pigment-free Pantoea polysaccharide-synthesizing strain through genetic engineering and reduce downstream separation costs, it will be crucial for its industrial application in multiple fields. Summary of the Invention

[0004] Purpose of the invention: To solve the problem of difficult decolorization and purification of Pantoea camelthorn exopolysaccharide, the present invention provides a pigment-free Pantoea polysaccharide synthesis strain, a construction method thereof, and its application in high-yield colorless Pantoea polysaccharide.

[0005] To address the above technical problems, the present invention discloses a pigment-free strain of Pantoea alhagi, which is derived from Pantoea alhagi XK-11 as a starting strain and is constructed by knocking out the phytoene synthase gene crtB in the XK-11 genome. The strain is named Pantoea alhagi XK-11ΔcrtB, wherein the nucleotide sequence of the phytoene synthase gene crtB is shown in SEQ ID No. 1. The engineered strain XK-11ΔcrtB phenotypically no longer possesses the yellow pigment of the starting strain XK-11.

[0006] The crtB gene was knocked out using the Crispr / Cas9 tool.

[0007] The present invention further proposes a method for constructing the above-mentioned Pantoea algina, comprising the following steps:

[0008] (1) Using the genome of Pantoea alhagi XK-11 as a template, PCR amplified the upstream and downstream homologous fragments of crtB, namely crtB-UP and crtB-DN; using the pTarget plasmid as a template, cloned the crtB-sgRNA fragment with the crtB sgRNA sequence, and after gel recovery, obtained the gene fragment crtB-sgRNA-UP-DN by overlapping PCR; reverse PCR was performed on the plasmid pTarget to obtain the pTarget backbone fragment, and the obtained pTarget backbone fragment and the overlapping fragment crtB-sgRNA-UP-DN were cloned by in-fusion with the recombinase ExnaseⅡ at 37℃, and then transformed into E.coli DH5α, spread on LB solid medium containing streptomycin resistance and cultured overnight, and picked positive clones to obtain the recombinant plasmid pTarget-crtB;

[0009] (2) The pCas plasmid was transformed into Pantoea acuminata XK-11 competent cells by electroporation to obtain Pantoea acuminata XK-11 (pCas) competent cells;

[0010] (3) The recombinant plasmid pTarget-crtB was transformed into Pantoea acuminata XK-11 (pCas) competent cells by electroporation and plated onto a plate containing Km r and Str r Double-antibody LB solid medium, 30℃, culture for 24h;

[0011] (4) Pick the positive clones and inoculate them into the Km r and IPTG in LB medium, culture at 30°C, 200 rpm overnight and subculture continuously until the strain can no longer be grown in Str r The strain that lost the pTarget-crtB recombinant plasmid was grown on the resistance plate, indicating that the pTarget-crtB recombinant plasmid had been lost. Subsequently, the strain that lost the pTarget-crtB recombinant plasmid was inoculated into LB medium, cultured at 37°C, 200 rpm overnight, and continuously passaged until the strain could no longer grow on the Km plate. r The mutant strain was named Pantoea acuminata XK-11ΔcrtB.

[0012] Among them, in step (2), the electroporation conditions are: electric field intensity 25 kV / cm, electric shock time 4 msec.

[0013] In step (3), the electroporation conditions are: electric field intensity 25 kV / cm, electric shock time 4 msec.

[0014] The present invention also proposes the application function of the Pantoea alginate in fermenting and preparing Pantoea alginate exopolysaccharide.

[0015] Specifically, the steps for preparing Pantoea acuminata exopolysaccharide are as follows:

[0016] (1) Seed liquid expansion: The preserved strains are inoculated into LB medium for expansion culture to obtain fermentation seed liquid;

[0017] (2) Fermentation: The seed solution is transferred to a fermentation medium at an inoculum size of 1% to 10% for exopolysaccharide fermentation. The fermentation medium comprises a carbon source, a nitrogen source, an inorganic salt, and an oxygen carrier. The fermentation conditions are: a temperature of 25 to 32° C., an aeration intensity of 0.1 to 0.8 vvm, a fermentation period of 16 to 24 h, and a pH of 6.5 to 7.5.

[0018] (3) Purification: The fermentation broth prepared in step (2) is first subjected to high-temperature viscosity reduction, and is sterilized by filtration through a plate and frame filter using perlite as a filter medium while hot. After the filtrate is cooled to room temperature, 2 to 3 times the volume of ethanol is added, and the flocculent precipitate is collected and dried to obtain purified exopolysaccharide.

[0019] The carbon source is one or a combination of sucrose, glucose, glycerol, starch, and molasses; the nitrogen source is any one or a combination of ammonium sulfate, corn steep liquor, soybean meal powder, and peptone; the inorganic salt is any one or a combination of NaCl, K2HPO4, KH2PO4, MgSO4, MnSO4, and CaCl2; and the oxygen carrier is any one or a combination of n-hexane, n-heptane, and n-hexadecane.

[0020] Specifically, the carbon source concentration is 30-50 g / L, the nitrogen source concentration is 2-8 g / L, the total inorganic salt concentration is 0.5-2.5 g / L, and the total oxygen carrier concentration is 0.5-10 g / L.

[0021] The high temperature viscosity reduction condition is heating at 115°C for 30 minutes to reduce the viscosity.

[0022] Beneficial effects: Compared with the prior art, this application has the following advantages:

[0023] (1) During the preparation of pantoea polysaccharide from the starting strain XK-11, pigment-free pantoea polysaccharide was obtained, requiring repeated alcohol precipitation to remove the pigment. The present invention constructs a pigment-free pantoea polysaccharide fermentation strain that can obtain pigment-free pantoea polysaccharide through a single alcohol precipitation. After drying, the polysaccharide is pure white, and the amount of ethanol used is greatly reduced.

[0024] (2) Compared with the starting strain, the engineered strain XK-11ΔcrtB reduced the loss of cellular nutrients and energy to byproducts due to the blocking of pigment synthesis, resulting in a significant increase in the fermentation exopolysaccharide yield exceeding 30 g / L.

[0025] (3) The prepared Pantoea bursa-haystackia polysaccharide is white after drying, which makes it more acceptable when used in the development of daily chemical moisturizing, food thickening, medical gel and other products. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Differences in colony morphology between strains XK-11 and ΔcrtB on plates;

[0027] Figure 2 Phenotypic differences in Pantoea polysaccharides obtained from fermentation broths of strains XK-11 and ΔcrtB. DETAILED DESCRIPTION

[0028] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more apparent. Unless otherwise specified, the reagents and strains used in the following examples are all commercially available reagents.

[0029] Example 1 Construction of a genetically engineered strain of Pantoea alhagi that secretes no pigment.

[0030] 1. Construction of recombinant plasmid pTarget-crtB

[0031] The starting strain is Pantoea alhagi XK-11, which has been deposited in the General Microbiology Center of the China Culture Collection Administration on March 29, 2018, with the deposit number CGMCCNO.15526. The detailed information of the strain is disclosed in patent CN202010736899.9.

[0032] The CrtB gene is a well-known gene for synthesizing pigments. The present invention uses the previously reported crtB gene as the target sequence and the genome of Pantoea alginate as the template sequence to identify the crtB gene in Pantoea alginate by BLAST.

[0033] The crtB gene sequence in Pantoea algina is as follows:

[0034] ATGAACAGTACGCTGATGGATCACGCCACTGAAACCATGGCGGTCGGCTCAAAGAGTTTTGCCACCGCCTCAAAGCTGTTCGATGCCCGCACGCGTCGTAGCGCGCTGATGCTTTATGCCTGGTGCCGCTATTGCGATGACGTGATTGATGGTCAGGTGCTGGGTTTTCATCATCCGGCAGCGAGCGGCGGCAGCGCAACGCAGCGGCTGGAGATGCTGAAAACCGAGACGCAGCGCGCCTTTGCCGGTGCAGAGATGCAGGAGCCGGCCTTTGCCGCCTTTCAGGAGGTTGCGACCCGTCACACCATCCCGCCGCAGCTGGCCTTTGATCATCTTGAAGGCTTTGCGATGGATGTGCGCGAGACGCACTATGAGACCTTCACAGATACGCTGCGTTATTGTTATCACGTGGCGGGCGTGGTGGGGCTGATGATGGCGCGGGTGATGGGCGTACGTGACGAATCGGTGCTGGATCGCGCCTGTGACTTAGGGCTGGCGTTTCAGCTAACCAATATTGCCCGCGATATCGTTGAGGATGTGCAGGCGGGGCGCTGTTATCTGCCGCAGGCGTGGCTGGATGAGAAAGGGATGCGTTCTGCCGATATTCTCGATCCGGCCCGGCGCGAGGATCTGGCGCACCTGGCGCAGCGGCTGGTCGCGCAGGCAGAGCCTTATTACGACTCGGCGCGGGCAGGACTGAGCGGCTTGCCGCTGCGATCCGCCTGGGCGATCGCCTCGGCGCATGGGGTTTACCGTGAGATTGGCGTTAAGGTCAGCGCGGCGGGCGCTCGCGCCTGGGAGACGCGGCAGGGAACCAGCCGCACAGAGAAGATCGGTTTGCTGATTAAGGGCGCGGCGCTGGCGCTCAGCTCTCGCGTTGCGAATCCGCCGCCGCGTTCTTCTGAGCTGTGGCAGCGCCCGCGTCGGAAGAGCGGACACGCGAAGCTGTAG。

[0035] Using the genome of the starting bacteria XK-11 as a template, PCR was performed with primers crtB-UP-F / crtB-UP-R and crtB-DN-F / crtB-DN-R to amplify the upstream and downstream homologous fragments of crtB, namely crtB-UP and crtB-DN, respectively. At the same time, using the pTarget plasmid as a template, primers crtB-sgRNA-F / crtB-sgRNA-R were used to clone the fragment crtB-sgRNA with the crtB sgRNA sequence. The sgRNA sequence was gagacgcagcgcgcctttgc. The PCR system was: Kodaq 2×PCR MasterMix withdye 25μL, Primer F 2μL, Primer R 2μL, genome 2μL, and ddH2O 19μL. The PCR conditions were: 95°C for 10 min; 95°C for 30 s, 55°C for 30 s, 72°C for 30 s, 30 cycles; and 72°C for 10 min. After gel recovery, the gene fragment crtB-sgRNA-UP-DN was obtained by overlapping PCR. Its sequence is:

[0036] CAGTCCTAGGTATAATACTAGTGAGACGCAGCGCGCCTTTGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTCGCTGGCACCGCCCGGCTGCGGCAGCTACTACGTGCTGGCGCCGGTGCCGCATCTGGGCACGGCAAATCTCGACTGGACGGTAGAGGGGCCGCGTCTGCGCGATCGTATTTTTGCTTATCTGGAGCAACATTATATGCCGGGCCTGCGCGATCAGCTAGTGACGCACCGGATGTTTACGCCGTTTGATTTCCGTGACCAGTTGGGGGCGCATCAGGGGTCGGCGTTCTCCATTGAACCCATTCTGCGCCAAAGTGCCTGGTTCCGTCCGCATAACCGCGACAGCCGCATCCCCAATCTCTATCTGGTGGGCGCGGGCACGCATCCGGGCGCCGGGATCCCGGGCGTGATCGGCTCGGCGAAAGCCACCGCAGGTCTGATGCTGGAGGCGCTGAGCTGATGAACAGTACGCTGATGTGCCGCTGCGATCCGCCTGGGCGATCGCCTCGGCGCATGGGGTTTACCGTGAGATTGGCGTTAAGGTCAGCGCGGCGGGCGCTCGCGCCTGGGAGACGCGGCAGGGAACCAGCCGCACAGAGAAGATCGGTTTGCTGATTAAGGGCGCGGCGCTGGCGCTCAGCTCTCGCGTTGCGAATCCGCCGCCGCGTTCTTCTGAGCTGTGGCAGCGCCCGCGTCGGAAGAGCGGACACGCGAAGCTGTAGTTTTCTGCGCCCGTGGTTTTTTAACGTTTCGCTCGCGCAGGATGGCCTGTAATTTTTCCACCGGCGGCGCATAGAGGAAGCCGAAAGAGACGCAATCCTCTTTGCCGCGTACCGCATGGTGCAGGCGGTGCGCCATATAGAGACGTTTCAGATAGCCACGGCGT

[0037] The pTarget plasmid was subjected to reverse PCR using primers pTarget-F / pTarget-R to obtain the backbone structure of the pTarget plasmid. The obtained pTarget backbone fragment and the overlapping fragment crtB-sgRNA-UP-DN were cloned by in-fusion cloning (30 min) at 37°C using recombinase Exnase II (Nanjing Novozymes Biotech Co., Ltd., Nanjing, China) and transformed into E. coli DH5α (Universal Biosystems (Anhui) Co., Ltd., Chuzhou, China) and plated onto a plate containing streptomycin (Streptomycin). r ) were cultured overnight (37°C) in LB solid medium with resistance to Target, and positive clones were picked to obtain the recombinant plasmid pTarget-crtB. The primers used are shown in Table 1.

[0038] Table 1 Primers

[0039]

[0040]

[0041] 2. Preparation of Pantoea alginosus XK-11 Competent Cells and Electroporation

[0042] (1) Preparation of Pantoea algina XK-11 competent cells:

[0043] a. Pick XK-11 into liquid LB medium and culture overnight at 37°C, 200 rpm;

[0044] b. Transfer the 1% volume ratio of the transfer volume to 50 mL of liquid LB medium and culture at 37 ° C, 200 rpm until the OD 600 = around 0.7 (slightly turbid, foggy);

[0045] c. Immediately place the cultured cells on ice for 10 minutes, divide into two tubes, and centrifuge at 4°C, 4,000 rpm, for 15 minutes.

[0046] d. After collecting the cells, resuspend each tube with 25 mL of ice-cold deionized water;

[0047] e. Repeat steps c and d, and wash the collected cells three times with deionized water;

[0048] f. Wash the cells collected in step d once with 5 mL of 10% (w / v) glycerol on ice, then resuspend in 300 μL of 10% (w / v) glycerol on ice and aliquot into three 1.5 mL centrifuge tubes, 100 μL per tube, to obtain three tubes of XK-11 competent cells;

[0049] (2) Electric shock conversion:

[0050] a. Place the cleaned electroporation cup (electrode spacing 0.1 cm) soaked in 75% ethanol upside down in a clean bench. Turn on ventilation and sterilize under UV light for 15 minutes to ensure the cup is dry.

[0051] b. Add 200 ng of pCas plasmid to the prepared XK-11 competent cells, mix gently, and place on ice;

[0052] c. Adjust the parameters of the Bio-Rad MicroPulser 1652100 electroporator to: voltage 2.5 kV, shock time 4 msec;

[0053] d. Transfer the cell and DNA mixture to a pre-chilled electroporation cuvette, wipe away any condensation and mist from the electroporation chamber, and place the cuvette into the electroporator.

[0054] e. Immediately after electroporation, add 1 mL of SOC medium (Qingdao Haibo Biotechnology Co., Ltd., China) and mix thoroughly. Transfer the mixture into a 1.5 mL EP tube and incubate at 30°C and 200 rpm for 3 h.

[0055] f. After incubation, the culture medium in e was applied to a plate containing kanamycin (Km r )-resistant plates and cultured at 30°C overnight to grow transformants, namely XK-11 (pCas) competent cells.

[0056] 3. crtB gene knockout.

[0057] Prepare XK-11 (pCas) competent cells using the method in step 2. After preparation, electroporate the pTarget-crtB recombinant plasmid into XK-11 (pCas) competent cells (the method is the same as step 2, adjust the parameters of the Bio-Rad MicroPulser 1652100 electroporator to: voltage 2.5kV, shock time 4msec;), and apply it to the Km r and Str r The cells were cultured in LB solid medium containing double antibodies at 30°C for 24 h.

[0058] The transformants were verified by colony PCR using primers crtB-OUT-F / crtB-OUT-R (Table 1). NX-11 was used as a control to screen for positive clones with successful knockout. Positive clones were inoculated into LB medium (Km r , IPTG), 30 ° C, 200 rpm overnight culture, and continuous passage until the strain can no longer be grown in Str rThe strain that lost the pTarget-crtB recombinant plasmid was then inoculated into LB medium, cultured overnight at 37°C and 200 rpm, and subcultured continuously until the strain could no longer grow in the Km r The mutant strain grew on the resistant plate, indicating that the pCas plasmid had been lost. The mutant strain was named ΔcrtB.

[0059] Example 2 Phenotypic analysis of the starting strain XK-11 and the mutant strain ΔcrtB.

[0060] Single colonies of XK-11 and ΔcrtB were picked and placed in LB solid medium and fermentation solid medium (mass volume ratio: sucrose 4%, peptone 1%, yeast powder 0.5%, sodium chloride 1%, agar 1.5%), respectively, and cultured at 30°C for 24 h to observe their colony morphology.

[0061] The results are as follows Figure 1 As shown, single colonies of XK-11 and ΔcrtB both appeared as moist, round colonies with a large amount of mucus in solid fermentation medium; the difference was that XK-11 appeared bright yellow, while ΔcrtB was milky white, indicating that the mutant strain ΔcrtB lacked the ability to synthesize yellow pigments.

[0062] Example 3 Comparison of exopolysaccharide fermentation by the starting strain XK-11 and the mutant strain ΔcrtB.

[0063] Using the starting strain XK-11 and the mutant strain ΔcrtB as the strains, exopolysaccharide was fermented and prepared according to the following procedures:

[0064] (1) Pick a single colony of the preserved strain and place it in LB liquid medium. Culture it at 37°C and 200 rpm for 12 h to obtain seed solution.

[0065] (2) The seed solution was transferred to a fermentation medium (sucrose 4% w / v, peptone 1% 4 w / v%, yeast extract 0.5% 4 w / v%, sodium chloride 1% 4 w / v%, and n-hexane 2.3 g / L) at a 4% (v / v) inoculum. The culture was maintained at 30°C, pH 7, for 24 h with an aeration rate of 0.5 v / m and an agitation speed of 600 ppm. After fermentation, the polysaccharide content in the fermentation broth was determined by the phenol-sulfuric acid method.

[0066] (3) The fermentation broth prepared in step (2) was heated at 115° C. for 30 min to reduce viscosity, and sterilized by filtering through a plate and frame filter using perlite as a filter medium while hot. After the filtrate was cooled to room temperature, 2 volumes of ethanol were added, and the flocculent precipitate was collected and dried to obtain purified exopolysaccharide.

[0067] Table 2 Comparison of exopolysaccharide yields between the starting strain XK-11 and the mutant strain ΔcrtB

[0068]

[0069] The fermentation results are shown in Table 2. After knocking out the phytoene synthase gene crtB, under the same fermentation conditions, the extracellular polysaccharide production of the mutant strain ΔcrtB was significantly increased, which may be due to the reduction of nutrients and energy flow to the by-product yellow pigment. Figure 2 As shown, after sterilization by filtration, the fermentation broth was subjected to a one-step alcohol precipitation to produce exopolysaccharides. The exopolysaccharide obtained from the fermentation broth of the starting strain XK-11 was yellowish, indicating that a single alcohol precipitation was insufficient to remove the pigment from the fermentation broth, necessitating further treatment such as activated carbon decolorization or multiple alcohol precipitations. In contrast, after sterilization, the fermentation broth of the mutant strain ΔcrtB yielded a pure white polysaccharide product via a single alcohol precipitation. Therefore, the genetically engineered bacteria provided by this invention can significantly improve the product quality of Pantoea acuminata polysaccharides, simplify the preparation process, reduce ethanol usage, and lower production costs.

Claims

1. An engineered strain of Pantoea acuminata that does not produce pigment, characterized in that: The engineered bacteria of Pantoea algina is Pantoea algina Pantoea alhagi XK-11 was used as the starting strain and the phytoene synthase gene in the XK-11 genome was knocked out. crt B was constructed and named Pantoea alhagi XK-11Δ crt B, wherein the Pantoea acuminata Pantoea alhagi The accession number of XK-11 is CGMCC NO.15526; the phytoene synthase gene crt The nucleotide sequence of B is shown in SEQ ID No.

1.

2. The engineered strain of Pantoea acuminata according to claim 1, characterized in that described crt The B gene was knocked out using the Crispr / Cas9 tool.

3. The method for constructing the engineered strain of Pantoea acuminata according to claim 1, characterized in that: The steps include: (1) Pantotrichum camelthorn Pantoea alhagi XK-11 genome was used as a template for PCR amplification crtB The upstream and downstream homologous fragments are crtB-UP , crtB-DN ; Using the pTarget plasmid as a template, clone the crtB Fragment of sgRNA sequence crtB-sgRNA After gel recovery, the gene fragments were obtained by overlapping PCR crtB-sgRNA-UP-DN, Its sequence is shown in SEQ ID No. 2; Perform reverse PCR on the plasmid pTarget to obtain the pTarget backbone fragment, and then combine the obtained pTarget backbone fragment and the overlapping fragment crtB-sgRNA-UP-DN In-fusion cloning was performed at 37°C using the recombinase Exnase II and then transferred into E. coli DH5α, spread onto LB solid medium containing streptomycin resistance and culture overnight, pick positive clones, and obtain recombinant plasmid pTarget- crtB ; (2) The pCas plasmid was transformed into Pantoea acuminata XK-11 competent cells by electroporation to obtain Pantoea acuminata XK-11 competent cells carrying pCas. The electroporation conditions were: electric field intensity 25 kV / cm, electroporation time 4 msec; (3) Recombinant plasmid pTarget- crtB Transformed into the pCas-carrying Pantoea australis XK-11 competent cells by electroporation, and plated onto the Km r and Str r The cells were cultured in LB solid medium containing double antibodies at 30°C for 24 h. The electroporation conditions were as follows: electric field strength 25 kV / cm, shock time 4 msec; (4) Pick the positive clones and inoculate them into the Km r and IPTG in LB medium, culture at 30°C, 200 rpm overnight and subculture continuously until the strain can no longer be grown in Str r Growth on resistant plates resulted in pTarget- crtB Strains that have lost the recombinant plasmid will subsequently lose pTarget- crtB The recombinant plasmid strain was inoculated into LB medium, cultured at 37°C, 200 rpm overnight, and continuously passaged until the strain could no longer grow at Km r The mutant strain was named Pantoea acuminata XK-11Δ crt B.

4. Use of the engineered Pantoea alginate bacteria according to claim 1 in the fermentation preparation of Pantoea alginate exopolysaccharides.

5. The use according to claim 4, characterized in that The steps for preparing Pantoea acuminata exopolysaccharide are as follows: (1) Seed liquid expansion culture: inoculating the engineered bacteria of Pantoea acuminata described in claim 1 into LB culture medium for expansion culture to obtain fermentation seed liquid; (2) Fermentation: The seed liquid is transferred to a fermentation medium at an inoculum size of 1% to 10% for extracellular polysaccharide fermentation. The fermentation medium contains a carbon source, a nitrogen source, an inorganic salt, and an oxygen carrier. The fermentation conditions are: a temperature of 25 to 32°C, an aeration intensity of 0.1 to 0.8 vvm, a fermentation cycle of 16 to 24 h, and a pH of 6.5 to 7.

5. (3) Purification: The fermentation broth prepared in step (2) is first subjected to high-temperature viscosity reduction, and is sterilized by filtration through a plate and frame filter using perlite as a filter medium while hot. After the filtrate is cooled to room temperature, 2 to 3 times the volume of ethanol is added, and the flocculent precipitate is collected and dried to obtain purified exopolysaccharide.

6. The use according to claim 5, characterized in that The carbon source is one or a combination of sucrose, glucose, glycerol, starch, and molasses; the nitrogen source is any one or a combination of ammonium sulfate, corn steep liquor, soybean meal powder, and peptone; the inorganic salt is any one or a combination of NaCl, K2HPO4, KH2PO4, MgSO4, MnSO4, and CaCl2; the oxygen carrier is any one or a combination of n-hexane, n-heptane, and n-hexadecane; wherein the carbon source concentration is 30-50 g / L, the nitrogen source concentration is 2-8 g / L, the total inorganic salt concentration is 0.5-2.5 g / L, and the total oxygen carrier concentration is 0.5-10 g / L.

7. The use according to claim 5, characterized in that The conditions for high temperature viscosity reduction are heating at 115°C for 30 min to reduce viscosity.

Images