A method for producing dsRNA by fermentation of Escherichia coli

By controlling dissolved oxygen, temperature, and sugar feeding rate during E. coli fermentation, the fermentation conditions were optimized, solving the problems of low dsRNA yield and high purification difficulty, and achieving increased dsRNA concentration and simplified purification.

CN115786199BActive Publication Date: 2026-03-31SILICON GENE TECH (SHANGHAI) CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202211493696.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-25
Publication Date
2026-03-31
Estimated Expiration
2042-11-25

AI Technical Summary

Technical Problem

Existing methods for producing dsRNA through E. coli fermentation result in low yields, low proportions of dsRNA in fermentation products, and significant challenges in subsequent purification.

Method used

By controlling dissolved oxygen, temperature, and sugar replenishment rate during fermentation, especially by staged cooling and reducing sugar replenishment rate after the addition of the inducer, fermentation conditions can be optimized to increase the concentration ratio of dsRNA and reduce acetic acid accumulation, which is beneficial for subsequent nucleic acid purification.

Benefits of technology

This improved the fermentation level and concentration ratio of dsRNA, simplified the subsequent nucleic acid purification process, and reduced the difficulty and cost of purification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115786199B_ABST
    Figure CN115786199B_ABST
Patent Text Reader

Abstract

This invention discloses a method for producing double-stranded RNA (dsRNA) by fermentation of *E. coli*. The method involves controlling the glucose feeding rate in the fermenter during the fermentation culture stage, adjusting the rate at different stages of cell growth. Simultaneously, after induction, the method reduces acetic acid accumulation during fermentation by gradually decreasing the temperature and glucose feeding rate, thereby improving the fermentation efficiency. The method results in a short fermentation cycle, low cell density, and high yield. Furthermore, the process is simple, easy to extract, and produces minimal environmental pollution, reducing production costs and facilitating its industrial-scale application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method for producing dsRNA by fermentation of Escherichia coli, belonging to the field of fermentation technology. Background Technology

[0002] RNA interference (RNAi) is a sequence-specific gene silencing phenomenon induced by double-stranded RNA in molecular biology. Its mechanism involves inhibiting gene expression by blocking the translation or transcription of specific genes. When double-stranded RNA homologous to the coding region of endogenous mRNA is introduced into a cell, the mRNA degrades, leading to gene silencing. RNAi is an effective tool for studying the function of genes in various organisms. As an emerging gene repression method, RNAi technology has been widely applied in functional genomics, microbiology, and the study of gene expression regulation mechanisms.

[0003] Currently, methods for in vitro preparation of siRNA each have their advantages and disadvantages. Chemical synthesis methods can produce high-quality siRNA, but they are expensive and have long lead times. In vitro transcription methods for synthesizing siRNA are relatively low-cost, but the scale and quantity of experiments are limited. Using *E. coli* fermentation to prepare double-stranded RNA samples can efficiently and rapidly produce large quantities of long double-stranded RNA in a short time, shortening the preparation cycle required for chemical synthesis, reducing high costs, and overcoming the scale limitations of in vitro transcription. However, existing methods for producing dsRNA using *E. coli* fermentation have low yields and a low proportion of dsRNA in the fermentation products, making subsequent purification difficult. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a method for producing dsRNA by fermentation of Escherichia coli.

[0005] The first objective of this invention is to provide a method for producing dsRNA by fermentation of Escherichia coli, comprising the following steps:

[0006] S1. Prepare seed culture of Escherichia coli expressing dsRNA;

[0007] S2. Inoculate the seed liquid into the fermentation medium for fermentation; during the fermentation process, control the dissolved oxygen at 30% to 40% and the fermentation temperature at 36 to 38°C. When the dissolved oxygen first rises, start to add sugar at a rate of 1 to 3 g / L / h, and gradually increase the sugar addition rate to 5 to 7 g / L / h within 2 to 4 hours.

[0008] S3, Fermentation to OD 600When the concentration reaches 18-22, induce with 0.4-1.0 mmol / L IPTG for 5-10 hours and then remove from the tank. After adding the inducer, the temperature, dissolved oxygen, and glucose supplementation rate are adjusted. The temperature is reduced to 30-35°C, the dissolved oxygen is reduced to 20%-30%, and the glucose supplementation rate is reduced by 1-2 g / L / h. After 3-5 hours, the glucose supplementation rate is adjusted to 1-3 g / L / h.

[0009] Furthermore, the cooling is a gradient cooling, with the temperature decreasing to 34-36°C after the addition of the inducing agent, and then decreasing to 30-33°C 1-3 hours after the addition of the inducing agent.

[0010] Further, the fermentation medium comprises 4-6 g / L glucose, 8-12 g / L KH2PO4, 3-5 g / L citric acid monohydrate, 1-3 g / L MgSO4·7H2O, 1-3 g / L (NH4)2SO4, and 0.5-1.5 mL / L of trace element stock solution, wherein the trace element stock solution comprises 0.10-0.15 g / L CoCl2·6H2O, 0.10-0.15 g / L CuSO4·5H2O, 5-7 g / L FeSO4·7H2O, 0.3-0.5 g / L MnSO4·H2O, and 3-5 g / L ZnSO4·7H2O.

[0011] Furthermore, the *E. coli* is an engineered strain of *E. coli* expressing the coat protein gene of tobacco mosaic virus.

[0012] Furthermore, the pH is controlled between 6.8 and 7.2 throughout the fermentation process.

[0013] Furthermore, before inoculation, the stirring was controlled at 140–160 rpm, the aeration rate at 0.4–0.6 VVM, and the pressure at 0.04–0.06 MPa.

[0014] Furthermore, the pH is adjusted using ammonia.

[0015] Furthermore, in step S2, the rate of sugar replenishment is increased every half hour.

[0016] Furthermore, the seed culture is prepared by the following method: streaking Escherichia coli strain onto LB solid medium and culturing to obtain single colonies; picking single colonies and inoculating them into LB liquid medium to obtain primary seed culture; and inoculating the primary seed culture into secondary seed medium to obtain secondary seed culture.

[0017] Further, the secondary seed culture medium comprises 8-12 g / L glucose, 12-16 g / L KH2PO4, 10-14 g / L K2HPO4·3H2O, 0.8-1.2 g / L citric acid monohydrate, 0.8-1.2 g / L MgSO4·7H2O, 4-6 g / L (NH4)2SO4, and 0.5-1.5 mL / L of trace element stock solution, wherein the trace element stock solution comprises 0.10-0.15 g / L CoCl2·6H2O, 0.10-0.15 g / L CuSO4·5H2O, 5-7 g / L FeSO4·7H2O, 0.3-0.5 g / L MnSO4·H2O, and 3-5 g / L ZnSO4·7H2O.

[0018] The beneficial effects of this invention are:

[0019] Currently, dsRNA fermentation involves high-density fermentation. Further increasing cell density can easily lead to increased acetic acid concentration, which inhibits the target dsRNA. Induction also increases the concentration of the cell's own nucleic acids, thus reducing the proportion of target dsRNA and making purification more difficult. This invention uses *E. coli* fermentation to produce dsRNA. During the fermentation stage, the glucose feeding rate in the fermenter is controlled. Different glucose feeding rates are controlled at different stages of cell growth. Simultaneously, after adding an inducer, the temperature and glucose feeding rate are gradually reduced to decrease acetic acid accumulation during fermentation, improving fermentation efficiency and increasing the proportion of target dsRNA, which is beneficial for subsequent nucleic acid purification yield. Attached Figure Description

[0020] Figure 1 The high-performance liquid chromatogram of the sample in Example 4;

[0021] Figure 2 The high-performance liquid chromatogram of the sample in Example 5;

[0022] Figure 3 This is an electrophoresis diagram showing the changes in the content of the target dsRNA during the fermentation process in Example 5. Lane M is the DL5000 Marker, and lanes 1-4 correspond to 4h, 6h, 8h and 10h after induction, respectively.

[0023] Figure 4 This is a plasmid map of the recombinant vector pT7B-TMV. Detailed Implementation

[0024] The present invention will be further described below with reference to specific embodiments, so that those skilled in the art can better understand and implement the present invention, but the embodiments are not intended to limit the present invention.

[0025] 1. Reagents: glucose, KH2PO4, K2HPO4·3H2O, citric acid monohydrate, MgSO4·7H2O, (NH4)2SO4, yeast powder, peptone, ampicillin, isopropyl-β-D-thiogalactoside (IPTG).

[0026] 2. Materials: SW-CJ-IFD type single-person single-sided clean bench, Suzhou Clean Equipment Co., Ltd.; LRH-150F biochemical culture medium box, Shanghai Yiheng Scientific Instrument Co., Ltd.; MQL-S2R shaking incubator, Shanghai Minquan Instrument Co., Ltd.; 500L, 100L, and 50L fermenters, Shanghai Baoxing Biochemical Equipment Co., Ltd.; D-30M High Pressure Homogenizer; CA-01 Industrial Chiller, Shenzhen Comsen Refrigeration Equipment Co., Ltd.; OST-550 Oil-free Air Compressor, Taizhou Aotus Industry & Trade Co., Ltd.; PE-15AZ Screw Air Compressor, Peiken (Shanghai) Compressor Co., Ltd.; LDR0.064-0.8 Fully Automatic Electric Heating Steam Generator, Shanghai Yangnuo Boiler Manufacturing Co., Ltd.; UV2000 Ultraviolet-Vis Spectrophotometer, Unico (Shanghai) Instruments Co., Ltd.; S-10 Biosensor Analyzer, Shenzhen Xierman Technology Co., Ltd.; IG0321 Small High-Speed ​​Centrifuge, Mona Biotechnology Co., Ltd.; LDZM-80L-I Vertical High-Pressure Steam Sterilizer, Shanghai Shenan Medical Instrument Factory; LC-20AD Liquid Chromatograph, Shimadzu Corporation.

[0027] 3. Main reagents and culture media

[0028] 3.1 Ampicillin (Amp, 100mg / mL): Dissolve 1g of ampicillin sodium in 10mL of sterile water, filter through a 0.22μm filter membrane for sterilization, and store at -20℃.

[0029] 3.2 LB solid medium: 10g peptone, 5g yeast extract, 10g NaCl, 20g agar, bring to a final volume of 1L. After sterilization and cooling, add Amp stock solution to achieve a final concentration of 50mg / L.

[0030] 3.3 LB liquid medium: 10g peptone, 5g yeast extract, 10g NaCl, bring the volume to 1L. Add Amp stock solution at inoculation to achieve a final concentration of 50mg / L.

[0031] 3.4. IPTG (0.6 mmol / L): Dissolve 100 g of IPTG in 1000 mL of sterile water, filter through a 0.22 μm filter membrane for sterilization, and store at 4 °C for later use.

[0032] 3.5 Secondary seed culture medium: glucose 10g / L (single preparation), KH2PO4 14g / L, K2HPO4·3H2O 12g / L, citric acid monohydrate 1g / L, MgSO4·7H2O 1g / L (single preparation), ammonium sulfate 5g / L, trace element stock solution 1mL / L, the remainder is water, pH 5-6.

[0033] 3.6 Fermentation medium: glucose 5g / L (single preparation), KH2PO4 10g / L, citric acid monohydrate 4g / L, MgSO4·7H2O 2g / L (single preparation), ammonium sulfate 2g / L, trace element stock solution 1mL / L, the remainder is water, pH 2-3.

[0034] 3.7 Trace element stock solution (single preparation): CoCl2·6H2O 0.12g / L, CuSO4·5H2O 0.12g / L, FeSO4·7H2O 6g / L, MnSO4·H2O 0.4g / L, ZnSO4·7H2O 4g / L.

[0035] 3.8. Feeding medium: 60% glucose.

[0036] 4. Fermentation control process

[0037] 4.1 pH control: Adjust the pH to 7.0 with ammonia water before inoculation, and maintain the pH at 7.0 with ammonia water after inoculation.

[0038] 4.2 Dissolved oxygen control: 30-40% before induction; 20-30% after induction.

[0039] 4.3 Temperature control: 37℃ before induction and 33℃ after induction.

[0040] 4.4 Sugar Supplementation Process Control: Sugar supplementation begins after the first rise in dissolved oxygen, at a rate of 1–3 g / L / h. Based on cell growth, the supplementation rate is increased to 5–7 g / L / h within 2–4 hours (increasing every half hour). When the fermentation OD600 reaches 20 or higher (approximately 16 hours), induction is performed using 0.4–1.0 mmol / L IPTG inducer. After adding the inducer, the sugar supplementation rate is reduced by 1–2 g / L / h per hour. After 4 hours, the rate is adjusted back to 1–3 g / L / h, and induction continues for another 6 hours before the cells are discharged. The double-stranded RNA content reached 0.8 g / L, double the level without reducing the supplementation rate, and the proportion of total nucleic acid increased from 7.5% to 23.37%. Simultaneously, the wet weight of the cells decreased by 30%.

[0041] 4.5 Induction Control: When fermentation OD 600 If the test result reaches 20 or higher, induce with 0.6 mmol / L IPTG inducer.

[0042] 5. Fermentation broth pretreatment

[0043] The fermentation broth was homogenized repeatedly using a high-pressure homogenizer 2-3 times. 1 mL of the homogenate was added to 0.1 mL (10% SDS solution) and mixed well. Then, 0.2 mL (10% potassium chloride solution) was added and mixed well. The mixture was centrifuged at 1000 rpm, and the supernatant was collected. The supernatant was precipitated with two volumes of ethanol and centrifuged at 1000 rpm. The precipitate was collected. 1 mL of pure water was added to reconstitute the precipitate, and the mixture was centrifuged at 1000 rpm. The supernatant sample was collected, and the nucleic acid content and proportion of each component were measured using NanoDrop and liquid chromatography.

[0044] 6. Detection methods

[0045] 6.1 Use NanoDrop to measure the total nucleic acid content in the sample.

[0046] 6.2. Use high performance liquid chromatography to determine the content and proportion of each nucleic acid component in the sample.

[0047] 7. Strain construction

[0048] This invention uses the coat protein (cp) gene of Tobacco mosaic virus (TMV) as an example to construct an engineered Escherichia coli strain expressing TMV(cp)-dsRNA. The specific construction process is as follows:

[0049] 1) Preparation of TMV genome (RNA): Using tobacco infected with TMV as a sample, RNA was extracted using the Viral Genome DNA / RNA Extraction Kit (catalog number DP315) from Tiangen Biotech (Beijing) Co., Ltd.

[0050] 2) cDNA synthesis: Using the RNA extracted in 1) as a template and oligo(dT)20 as a primer, cDNA was obtained by reverse transcription using Novozymes Hiscript III Reverse Transcriptase (Catalog No. R302-01).

[0051] 3) PCR amplification of the cp gene: The selected target gene is 482 bp in length. Using TMV-F and TMV-R as primers, the 5' direction contains the T7 promoter (slashed portion), and the sequence is shown in the table below:

[0052] Primer name Sequence (5'-3') TMV-F TAATACGACTCACTATAGGGTCTTACAGTATCACTACTCC TMV-R TAATACGACTCACTATAGGGCAAGTTGCRGGACCAGAGGT

[0053] PCR amplification system (50 μL): Amplification was performed using Takara DNA polymerase, as detailed in the table below:

[0054]

[0055] Amplification program: 94℃, 30s; 55℃, 10s; 72℃, 1min, for a total of 30 cycles.

[0056] The amplified TMV-cp gene was recovered by agarose gel electrophoresis and sent to BGI for sequencing. The sequence was confirmed to be correct after comparison.

[0057] 4) Construction of the recombinant vector expressing TMV(cp)-dsRNA: Using the L4440 vector as a template, primers pL4440-F and pL4440-R (sequences shown in the table below) were used to reverse amplify the L4440 vector backbone containing the dual T7 promoter. The amplification system and procedure are the same as in step 3). After amplification, DpnI enzyme was added and the mixture was digested at 37°C for 15 min to remove the L4440 vector. The obtained vector backbone was mixed with the purified TMV-cp fragment obtained in step 3) at a molar ratio of 1:3. The mixture was ligated using the Beyotime Seamless Cloning Kit (catalog number D7010S). The cells were transformed into E. coli DH5α competent cells by heat shock at 42°C, plated on ampicillin (Amp) resistant plates, and incubated overnight at 37°C. Transformants were selected and colony PCR and sequencing were performed for verification. Positive transformants were identified as the E. coli recombinant vector expressing TMV(cp)-dsRNA, named pT7B-TMV. Figure 4 As shown.

[0058] Primer name Sequence (5'-3') pL4440-F CCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGT pL4440-R CCTATAGTGAGTCGTATTAATTTCGATAAGCCAGG

[0059] 5) Construction of recombinant E. coli strain expressing TMV(cp)-dsRNA: The positive transformants obtained above were transformed into E. coli HT115(DE3) competent cells, plated on tetracycline and ampicillin double antibiotic plates, and cultured overnight to obtain the target engineered strain E. coli HT115(DE3) / pT7B-TMV.

[0060] Example 1:

[0061] Cryopreserved Escherichia coli engineered strains were streaked onto LB solid medium and cultured at 37°C to obtain single colonies. A single colony was picked and inoculated into a 50ml Erlenmeyer flask containing LB liquid medium, and cultured overnight at 37°C with stirring at 200rpm to obtain primary seed culture. The primary seed culture was inoculated at 1% (v / v) into a 50ml Erlenmeyer flask containing secondary seed medium, and cultured overnight at 37°C with stirring at 200rpm to obtain secondary seed culture. 3L of fermentation medium was added to a 5L fermenter, and 100ml of the secondary seed culture was inoculated into the fermenter for further culture.

[0062] Before inoculation and transfer, adjust the pH of the fermentation broth to 7.0 with ammonia water, and maintain the fermentation pH at 7.0 throughout the fermentation process. Dissolved oxygen control: Before inoculation or transfer (initial parameters: stirring 150 rpm, aeration rate 0.5 VVM, pressure 0.05 MPa), calibrate the dissolved oxygen electrode to 100%. After fermentation begins, control dissolved oxygen by adjusting stirring and aeration flow. Before IPTG induction, control dissolved oxygen at 30-40%, and after IPTG induction, control dissolved oxygen at 20-30%. Temperature control: 37℃ before induction, 30℃ after induction. Sugar supplementation control: Begin sugar supplementation when dissolved oxygen first rises (dissolved oxygen suddenly rises above 80%, at which point residual sugar is zero), at a rate of 2 g / L / h. Increase the sugar supplementation rate to 6 g / L / h within 2-4 hours (increasing every half hour) based on cell growth. When the fermentation OD... 600 Once the bacterial count reaches 20 (approximately 16 hours) or higher, induce with 0.6 mmol / L IPTG for 10 hours before removing from the culture vessel. After removal, collect the bacterial cells by centrifugation. The wet weight of the cells is 98 g / L, and the dsRNA content is 0.22 g / L, accounting for 8.1% of the total nucleic acid.

[0063] Example 2:

[0064] Cryopreserved Escherichia coli engineered strains were streaked onto LB solid medium and cultured at 37°C to obtain single colonies. A single colony was picked and inoculated into a 50ml Erlenmeyer flask containing LB liquid medium, and cultured overnight at 37°C with stirring at 200rpm to obtain primary seed culture. The primary seed culture was inoculated at 1% (v / v) into a 50ml Erlenmeyer flask containing secondary seed medium, and cultured overnight at 37°C with stirring at 200rpm to obtain secondary seed culture. 3L of fermentation medium was added to a 5L fermenter, and 100ml of the secondary seed culture was inoculated into the fermenter for further culture.

[0065] Before inoculation and transfer, adjust the pH of the fermentation broth to 7.0 with ammonia water, and maintain the fermentation pH at 7.0 throughout the fermentation process. Dissolved oxygen control: Before inoculation or transfer (initial parameters: stirring 150 rpm, aeration rate 0.5 VVM, pressure 0.05 MPa), calibrate the dissolved oxygen electrode to 100%. After fermentation begins, control dissolved oxygen by adjusting stirring and aeration flow. Before IPTG induction, control dissolved oxygen at 30-40%, and after IPTG induction, control dissolved oxygen at 20%-30%. Temperature control: 37℃ before induction, 33℃ after induction. Sugar supplementation control: Begin sugar supplementation when dissolved oxygen first rises (dissolved oxygen suddenly rises above 80%, at which point residual sugar is zero), at a rate of 2 g / L / h. Increase the sugar supplementation rate to 6 g / L / h within 2-4 hours (increasing every half hour) based on cell growth. When the fermentation OD... 600Once the bacterial count reaches 20 (approximately 16 hours) or higher, induce with 0.6 mmol / L IPTG for 10 hours before removing from the culture vessel. After removal, collect the bacterial cells by centrifugation. The wet weight of the cells is 110 g / L, and the dsRNA content is 0.26 g / L, accounting for 9.5% of the total nucleic acid.

[0066] Example 3:

[0067] Cryopreserved Escherichia coli engineered strains were streaked onto LB solid medium and cultured at 37°C to obtain single colonies. A single colony was picked and inoculated into a 50ml Erlenmeyer flask containing LB liquid medium, and cultured overnight at 37°C with stirring at 200rpm to obtain primary seed culture. The primary seed culture was inoculated at 1% (v / v) into a 50ml Erlenmeyer flask containing secondary seed medium, and cultured overnight at 37°C with stirring at 200rpm to obtain secondary seed culture. 3L of fermentation medium was added to a 5L fermenter, and 100ml of the secondary seed culture was inoculated into the fermenter for further culture.

[0068] Before inoculation and transfer, adjust the pH of the fermentation broth to 7.0 with ammonia water, and maintain the fermentation pH at 7.0 throughout the fermentation process. Dissolved oxygen control: Before inoculation or transfer (initial parameters: stirring 150 rpm, aeration rate 0.5 VVM, pressure 0.05 MPa), calibrate the dissolved oxygen electrode to 100%. After fermentation begins, control dissolved oxygen by adjusting stirring and aeration flow. Before IPTG induction, control dissolved oxygen at 30-40%, and after IPTG induction, control dissolved oxygen at 20%-30%. Temperature control: 37℃ before induction, 33℃ after induction. Sugar supplementation control: Begin sugar supplementation when dissolved oxygen first rises (dissolved oxygen suddenly rises above 80%, at which point residual sugar is zero), at a rate of 2 g / L / h. Increase the sugar supplementation rate to 6 g / L / h within 2-4 hours (increasing every half hour) based on cell growth. When the fermentation OD... 600 Once the bacterial count reaches 20 (approximately 16 hours) or higher, induce with 0.6 mmol / L IPTG for 16 hours before removing from the culture vessel. After removal, collect the bacterial cells by centrifugation. The wet weight of the cells is 123 g / L, and the dsRNA content is 0.23 g / L, accounting for 7.8% of the total nucleic acid.

[0069] Example 4:

[0070] Cryopreserved Escherichia coli engineered strains were streaked onto LB solid medium and cultured at 37°C to obtain single colonies. A single colony was picked and inoculated into a 50ml Erlenmeyer flask containing LB liquid medium, and cultured overnight at 37°C with stirring at 200rpm to obtain primary seed culture. The primary seed culture was inoculated at 1% (v / v) into a 50ml Erlenmeyer flask containing secondary seed medium, and cultured overnight at 37°C with stirring at 200rpm to obtain secondary seed culture. 3L of fermentation medium was added to a 5L fermenter, and 100ml of the secondary seed culture was inoculated into the fermenter for further culture.

[0071] Before inoculation and transplanting, adjust the pH of the fermentation broth to 7.0 with ammonia water, and maintain the fermentation pH at 7.0 throughout the fermentation process. Dissolved oxygen control: Before inoculation or transplanting (initial parameters: stirring 150 rpm, aeration rate 0.5 VVM, pressure 0.05 MPa), calibrate the dissolved oxygen electrode to 100%. After fermentation begins, control dissolved oxygen by adjusting stirring and aeration flow. Before IPTG induction, control dissolved oxygen at 30-40%, and after IPTG induction, control dissolved oxygen at 20%-30%. Temperature control: 37℃ before induction, lower to 35℃ after adding the inducer, and then lower to 33℃ 2 hours after adding the inducer. Sugar supplementation control: Begin sugar supplementation at the first rise in dissolved oxygen (a sudden increase to over 80%, at which point residual sugar is zero), at a rate of 2 g / L / h. Increase the sugar supplementation rate to 6 g / L / h within 2-4 hours (increasing every half hour) according to cell growth. When the fermentation OD... 600 When the cell count reached 20 (approximately 16 hours) or higher, induction was performed using 0.4 mmol / L IPTG inducer. After adding the inducer, the glucose feeding rate was reduced by 1 g / L / h per hour. After 4 hours, the glucose feeding rate was adjusted to 2 g / L / h, and induction continued for another 6 hours before being removed from the culture tank. The cell wet weight was 85 g / L, and the dsRNA content was 0.46 g / L, accounting for 18.8% of the total nucleic acid. The results are as follows. Figure 1 As shown.

[0072] Example 5:

[0073] Cryopreserved Escherichia coli engineered strains were streaked onto LB solid medium and cultured at 37°C to obtain single colonies. A single colony was picked and inoculated into a 50ml Erlenmeyer flask containing LB liquid medium, and cultured overnight at 37°C with stirring at 200rpm to obtain primary seed culture. The primary seed culture was inoculated at 1% (v / v) into a 50ml Erlenmeyer flask containing secondary seed medium, and cultured overnight at 37°C with stirring at 200rpm to obtain secondary seed culture. 3L of fermentation medium was added to a 5L fermenter, and 100ml of the secondary seed culture was inoculated into the fermenter for further culture.

[0074] Before inoculation and transplanting, adjust the pH of the fermentation broth to 7.0 with ammonia water, and maintain the fermentation pH at 7.0 throughout the fermentation process. Dissolved oxygen control: Before inoculation or transplanting (initial parameters: stirring 150 rpm, aeration rate 0.5 VVM, pressure 0.05 MPa), calibrate the dissolved oxygen electrode to 100%. After fermentation begins, control dissolved oxygen by adjusting stirring and aeration flow. Before IPTG induction, control dissolved oxygen at 30-40%, and after IPTG induction, control dissolved oxygen at 20%-30%. Temperature control: 37℃ before induction, lower to 35℃ after adding the inducer, and then lower to 33℃ 2 hours after adding the inducer. Sugar supplementation control: Begin sugar supplementation at the first rise in dissolved oxygen (a sudden increase to over 80%, at which point residual sugar is zero), at a rate of 2 g / L / h. Increase the sugar supplementation rate to 6 g / L / h within 2-4 hours (increasing every half hour) according to cell growth. When the fermentation OD... 600 When the cell count reached 20 (approximately 16 hours) or higher, induction was performed using 0.6 mmol / L IPTG inducer. After adding the inducer, the glucose feeding rate was reduced by 1 g / L / h per hour. After 4 hours, the glucose feeding rate was adjusted to 2 g / L / h, and induction continued for another 6 hours before being discharged from the container. The cell wet weight was 82 g / L, and the dsRNA content was 0.57 g / L, accounting for 23.4% of the total nucleic acid. The results are as follows. Figure 2 and Figure 3 As shown.

[0075] Example 6:

[0076] Cryopreserved Escherichia coli engineered strains were streaked onto LB solid medium and cultured at 37°C to obtain single colonies. A single colony was picked and inoculated into a 50ml Erlenmeyer flask containing LB liquid medium, and cultured overnight at 37°C with stirring at 200rpm to obtain primary seed culture. The primary seed culture was inoculated at 1% (v / v) into a 50ml Erlenmeyer flask containing secondary seed medium, and cultured overnight at 37°C with stirring at 200rpm to obtain secondary seed culture. 3L of fermentation medium was added to a 5L fermenter, and 100ml of the secondary seed culture was inoculated into the fermenter for further culture.

[0077] Before inoculation and transplanting, adjust the pH of the fermentation broth to 7.0 with ammonia water, and maintain the fermentation pH at 7.0 throughout the fermentation process. Dissolved oxygen control: Before inoculation or transplanting (initial parameters: stirring 150 rpm, aeration rate 0.5 VVM, pressure 0.05 MPa), calibrate the dissolved oxygen electrode to 100%. After fermentation begins, control dissolved oxygen by adjusting stirring and aeration flow. Before IPTG induction, control dissolved oxygen at 30-40%, and after IPTG induction, control dissolved oxygen at 20%-30%. Temperature control: 37℃ before induction, lower to 35℃ after adding the inducer, and then lower to 33℃ 2 hours after adding the inducer. Sugar supplementation control: Begin sugar supplementation at the first rise in dissolved oxygen (a sudden increase to over 80%, at which point residual sugar is zero), at a rate of 2 g / L / h. Increase the sugar supplementation rate to 6 g / L / h within 2-4 hours (increasing every half hour) according to cell growth. When the fermentation OD... 600 Once the bacterial count reaches 20 (approximately 16 hours) or higher, induction with 1.0 mmol / L IPTG is used. After adding the inducing agent, the glucose feeding rate is reduced by 1 g / L / h per hour. After 4 hours, the glucose feeding rate is adjusted to 2 g / L / h, and induction continues for another 6 hours before being removed from the container. The bacterial cell count is 79 g / L, and the dsRNA content is 0.49 g / L, accounting for 22.3% of the total nucleic acid.

[0078] Because the target dsRNA has similar or even identical properties to bacterial DNA and RNA, large-scale nucleic acid purification is challenging. A higher proportion of fermented nucleic acids results in a higher yield for subsequent purification. Conversely, a lower proportion of fermented nucleic acids leads to a lower yield and a geometrically increasing difficulty in purification.

[0079] The above-described embodiments are merely preferred embodiments provided to fully illustrate the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention. The scope of protection of the present invention is defined by the claims.

Claims

1. A method of fermentative production of dsRNA by E. coli, characterized in that, It comprises the following steps: S1, preparing a seed liquid of E. coli expressing dsRNA; S2, inoculating the seed liquid into a fermentation medium for fermentation; during the fermentation process, the dissolved oxygen is controlled at 30-40%, the fermentation temperature is 36-38℃, and when the dissolved oxygen first rises, the sugar supplementing speed is 2 g / L / h, and the sugar supplementing speed is gradually increased to 6 g / L / h within 2-4 h, and the sugar supplementing speed is increased every half hour; S3, fermentation to OD 600 After reaching 18~22, the tank is discharged after 5~10 h of induction by 0.4~1.0 mmol / L IPTG inducer; wherein, after adding the inducer, the temperature is lowered to 30~35℃, the dissolved oxygen is lowered to 20%~30%, and the sugar supplementing speed is lowered by 1 g / L / h per hour, and after 4 h, the sugar supplementing speed is adjusted to 2 g / L / h. The cooling is gradient cooling, and the temperature is reduced to 35℃ after adding the inducer, and the temperature is reduced to 33℃ after adding the inducer for 2 h; During the whole fermentation process, the pH is controlled between 6.8 and 7.

2.

2. The method of claim 1, wherein, The fermentation medium comprises glucose 4-6 g / L, KH2PO4 8-12 g / L, citric acid 3-5 g / L, MgSO4·7H2O 1-3 g / L, (NH4)2SO4 1-3 g / L, trace element mother liquor 0.5-1.5 mL / L, the trace element mother liquor comprises CoCl2·6H2O 0.10-0.15 g / L, CuSO4·5H2O 0.10-0.15 g / L, FeSO4·7H2O 5-7 g / L, MnSO4·H2O 0.3-0.5 g / L, ZnSO4·7H2O 3-5 g / L.

3. The method of claim 1, wherein, The E. coli is an E. coli engineering strain expressing the coat protein gene of tobacco mosaic virus.

4. The method of claim 1, wherein, Before inoculation, the stirring is controlled at 140-160 rpm, the aeration amount is 0.4-0.6 VVM, and the pressure is 0.04-0.06 Mpa.

5. The method of claim 1, wherein, The pH is controlled by ammonia.

6. The method of claim 1, wherein, The seed liquid is prepared by the following method: the E. coli strain is streaked and inoculated on LB solid medium to obtain single colonies; the single colonies are picked and inoculated in LB liquid medium to obtain a primary seed liquid; the primary seed liquid is inoculated in a secondary seed medium to obtain a secondary seed liquid.

7. The method of claim 6, wherein, The secondary seed medium comprises glucose 8-12 g / L, KH2PO4 12-16 g / L, K2HPO4·3H2O 10-14 g / L, citric acid 0.8-1.2 g / L, MgSO4·7H2O 0.8-1.2 g / L, (NH4)2SO4 4-6 g / L, trace element mother liquor 0.5-1.5 mL / L, the trace element mother liquor comprises CoCl2·6H2O 0.10-0.15 g / L, CuSO4·5H2O 0.10-0.15 g / L, FeSO4·7H2O 5-7 g / L, MnSO4·H2O 0.3-0.5 g / L, ZnSO4·7H2O 3-5 g / L.

Citation Information

Patent Citations

  • Process for extracellularly producing recombinant alpha-cyclodextrin glucosyltransferase

    CN101831414A

  • Escherichia coli fermentation method

    CN110777100A

  • Rapid preparation method of microbial source double-stranded RNA (Ribonucleic Acid)

    CN113151335A