Lactobacillus delbrueckii subspecies and its cultivation method and application

Abstract

The present invention relates to a Lactobacillus delbrueckii subspecies and a culture method and application thereof. The Lactobacillus delbrueckii subspecies of the present invention is preserved in the China Center for Type Culture Collection, and its preservation number is CCTCCNO.M20221248. The Lactobacillus delbrueckii subspecies of the present invention is negative in a hydrogen peroxide test, can decompose sucrose and D-glucose, etc.; can produce a-hemolytic rings and antibacterial rings, can inhibit the growth of Staphylococcus aureus and Escherichia coli visible to the naked eye after being cultured on a blood plate for 48 hours, and can produce regular concentric circular hemolytic rings with Staphylococcus aureus; can inhibit the growth of Streptococcus agalactiae by producing acid on a culture medium; can decompose glycogen in vaginal epithelial cells to produce lactic acid, reduce pH value, inhibit the growth of pathogenic bacteria and excessive reproduction of conditional pathogens; is sensitive to 19 common antibacterial drugs, and is only resistant to sulfonamides; is suitable for the prevention or treatment of bacterial vaginal diseases, especially the prevention or treatment of bacterial vaginal diseases in pregnant women.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a Lactobacillus delbrueckii subspecies and a culture method and application thereof. Background Art

[0002] Lactobacillus delbrueckii is an important species of the genus Lactobacillus. It was discovered and isolated by Beijierinck in 1901 and named after the German bacteriologist M. Delbrück. Lactobacillus delbrueckii belongs to the class Schizobacteriales, the order Eubacteriales, the family Lactobacillaceae and the genus Lactobacillus. According to the rRNA sequence, Lactobacillus delbrueckii can be divided into six subspecies: subspecies delbrueckii, subspecies lactic acid, subspecies bulgaricus, and the subsequently discovered subspecies Indian, subspecies sunkii and subspecies Jacobsen; subspecies sunkii mainly comes from the external environment such as river water and kimchi.

[0003] At present, there are many studies on Lactobacillus delbrueckii, but they are all concentrated on Lactobacillus delbrueckii subspecies bulgaricus, and there are few reports on the research of subspecies sunkii; and currently, the most research on Lactobacillus delbrueckii is in the food industry and animal husbandry, while there is very little research in medical care and disease prevention and treatment. Summary of the invention

[0004] The object of the present invention is to provide a Lactobacillus delbrueckii subsp. sunkii to solve the problems existing in the prior art.

[0005] The embodiment of the present invention is implemented as follows: a Lactobacillus delbrueckii subsp. sunkii, named WuYi2021-1, was deposited in the China Center for Type Culture Collection (CCTCC) on August 5, 2022, and the preservation address is Wuhan University, Wuhan City, Hubei Province, China, and its preservation number is CCTCC NO.M 20221248.

[0006] Furthermore, the Lactobacillus delbrueckii subspecies can decompose α-glucosidase, α-galactosidase, D-maltose, D-glycosidose, D-glycosidase, D-sorbitol, sucrose, salicin, arginine dihydrolase 1, arginine dihydrolase 2, alanine arylaminease, and alanine-phenylalanine-proline arylaminease, and the optoxin tolerance test is positive.

[0007] Furthermore, the hydrogen peroxide test was negative and the pH of the culture medium was reduced.

[0008] The embodiment of the present invention also provides a culture method for the above-mentioned Lactobacillus delbrueckii subspecies, wherein the separation and culture adopts MRS blood culture medium, and the ingredients include (g / L): peptone 10g, glucose 20g, agar powder 15g, sodium acetate 5g, beef extract powder 5g, yeast extract powder 4g, magnesium sulfate 0.2g, manganese sulfate 0.05g, dipotassium hydrogen phosphate 2g, ammonium citrate trihydrate 2g, Tween 80 1ml, 5% sterile defibrinated sheep red blood cells 50ml, deionized double distilled water 950ml, citric acid-sodium citrate buffer with pH=4.0.

[0009] Furthermore, pure culture uses a modified acidic blood culture medium, the ingredients of which include (g / L): 10 g of peptone, 20 g of glucose, 15 g of agar powder, 5 g of sodium chloride, 5 g of beef extract powder, 5 g of yeast extract powder, 5 g of beef heart extract powder, 50 ml of 5% sterile defibrinated sheep red blood cells, 50 ml of fetal bovine serum, 900 ml of deionized double distilled water, and citric acid-sodium citrate buffer with a pH of 4.0.

[0010] The embodiment of the present invention also provides the use of the above-mentioned Lactobacillus delbrueckii subspecies for preparing a drug for preventing or treating bacterial vaginal disease.

[0011] Further, the invention is used for preparing the application of the drug for preventing or treating bacterial vaginal disease in pregnant women. Lactobacillus delbrueckii subspecies was first isolated and cultured in the vaginal secretions of pregnant women. The present invention has found that the structure of lactobacillus flora in pregnant women is different from that of women of general childbearing age and women with no sexual life history, and the lactobacillus species in their vagina are significantly reduced, which may be related to the hormone level in pregnant women, inhibiting the growth and reproduction of other lactobacilli, so the value of Lactobacillus delbrueckii in the vagina of pregnant women is very important, which may be related to the vaginal self-cleaning effect and regulating the microecological balance of vaginal flora, and plays an important role in inhibiting the excessive growth and reproduction of pathogenic bacteria and miscellaneous bacteria. The drug sensitivity test of Lactobacillus delbrueckii subspecies found that it was sensitive to most antibacterial drugs and was only resistant to sulfonamide drugs, which suggested that multiple antibiotics would affect the growth and reproduction of Lactobacillus delbrueckii flora in clinical practice, promote the reduction of Lactobacillus delbrueckii content, indirectly affect the microecological balance of vagina, and then promote the occurrence and development of related diseases. This reflects that pregnant women should not use antibiotics during pregnancy, so as not to inhibit the growth and reproduction of lactobacilli, disrupt the balance of vaginal microecology, cause flora disorders and induce vaginitis, resulting in the impact of fetal development. Therefore, the microecological preparation of Lactobacillus delbrueckii subspecies may have a very good effect on the treatment of bacterial vaginitis in pregnant women during pregnancy.

[0012] Compared with the prior art, the Lactobacillus delbrueckii subspecies optoxin tolerance test of the present invention is positive, the hydrogen peroxide test is negative, it can decompose sucrose and D-glucose to produce acid, it can produce α-hemolysis ring and antibacterial ring, and it can inhibit the growth of Staphylococcus aureus and Escherichia coli visible to the naked eye after being cultured on a blood plate for 48 hours. At the same time, Streptococcus agalactiae can inhibit the growth of the Lactobacillus delbrueckii subspecies of the present invention in the external culture medium for a short period of time, and can inhibit its growth after the Lactobacillus delbrueckii subspecies of the present invention produces a large amount of lactic acid. It can decompose glycogen in vaginal epithelial cells to produce lactic acid, reduce the pH value, inhibit the growth of its pathogenic bacteria and the excessive reproduction of conditional pathogens; although it does not produce hydrogen peroxide, it can still significantly reduce the pH value of the culture medium, indicating that it has a strong acid production ability; it is suitable for the prevention or treatment of bacterial vaginal diseases, especially the prevention or treatment of bacterial vaginal diseases in pregnant women. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 is a phylogenetic tree of Lactobacillus delbrueckii subspecies sunkii of the present invention;

[0014] Figure 2 It is a partial sequencing peak diagram of Lactobacillus delbrueckii subspecies of the present invention;

[0015] Figure 3 is the Lactobacillus delbrueckii subspecies of the present invention;

[0016] Figure 4 is a Gram-positive diagram of Lactobacillus delbrueckii subspecies sunkii of the present invention;

[0017] Figure 5 The Lactobacillus delbrueckii subspecies of the present invention inhibits the growth of Staphylococcus aureus;

[0018] Figure 6 The inhibition of the growth of Escherichia coli by the Lactobacillus delbrueckii subspecies of the present invention;

[0019] Figure 7 The Lactobacillus delbrueckii subspecies of the invention and Staphylococcus aureus can produce regular concentric circular hemolytic rings. DETAILED DESCRIPTION

[0020] In order to make the objectives, technical solutions and advantages of the present invention more clear, the present invention will be further described in detail below with reference to the accompanying drawings.

[0021] At present, some Lactobacillus delbrueckii subspecies found in the world are isolated from the external environment, and no one has successfully isolated and cultured them in the human body. The present invention is the first to truly separate and culture Lactobacillus delbrueckii subspecies from the vaginal secretions of pregnant women. It is isolated from the human body and then applied to the prevention and treatment of human diseases, and the safety factor is relatively high.

[0022] Example 1

[0023] The invention discloses an isolation, culture and identification of Lactobacillus delbrueckii subsp. sunkii WuYi2021-1, comprising the following steps:

[0024] (1) Specimen collection and isolation and pure culture. Use sterile sampling cotton swabs to strictly aseptically collect vaginal secretions from pregnant women. All collected samples are sent for examination in a timely manner, and are inoculated in MRS blood culture medium in a zone and placed in a 5% CO2 incubator for isolation and culture for 48 hours. Suspicious colonies are selected for further pure culture in modified acidic blood culture medium.

[0025] (2) Identify the bacterial species using a mass spectrometer and observe the growth of the colonies and the staining effect. After isolating the pure culture, pick a single colony and place it on a mass spectrometer for bacterial species identification. Specific operations are performed according to the instrument operating instructions. At the same time, observe the growth of the colonies and perform Gram staining on them.

[0026] (3) Biochemical reaction, acid production test and antibacterial test. The Lactobacillus delbrueckii initially identified by the mass spectrometer was subjected to biochemical reaction and inoculated on the GP Gram-positive bacteria identification card and the GN Gram-negative bacteria identification card, respectively. The Lactobacillus delbrueckii was prepared into a 0.5 McFarland unit bacterial solution, and 1 ml of 5% medical glucose injection and 0.1 ml of the bacterial solution were added to 5 ml of nutrient broth medium for acid production test; at the same time, the bacterial solution was densely streaked and inoculated on one side of a 9 cm blood plate, and a Staphylococcus aureus colony (standard strain ATCC 25923) or a standard strain of Escherichia coli colony (standard strain ATCC25922) was picked up with an inoculation needle and inoculated in the center of the dense streak. A Staphylococcus aureus colony (standard strain ATCC 25923) or a standard strain of Escherichia coli colony (standard strain ATCC 25922) was also inoculated on the other side of the blood plate for control test. After 48 hours of culture, the acid production and antibacterial effect were observed.

[0027] (4) Sample DNA extraction. First, take a 1.5ml centrifuge tube, add 200ul pretreatment solution and 3 glass beads, then add an appropriate amount of bacterial sample, and put it in a grinder to grind it thoroughly. Then add 20ul Proteinase K solution, mix well, and place it at 37℃ for 30-60min. Then add 200ul lysis solution, mix thoroughly by inverting, and place it at 70℃ for 10min. Then add 200ul anhydrous ethanol, mix thoroughly by inverting, and centrifuge for a short time to remove the liquid on the inner wall of the tube cap, pass it through the adsorption column, wash it once with the washing solution, and wash it twice with the rinsing solution. Place the adsorption column at room temperature for 5-10min to completely dry the residual rinsing solution in the adsorption material. Finally, transfer the adsorption column to a new centrifuge tube, add 50-100ul ddH2O to the center of the adsorption membrane in mid-air, place it at room temperature for 5-10min, centrifuge it at 12000rpm for 2min, and store the extracted sample DNA template solution in the centrifuge tube in a -20℃ refrigerator for later use.

[0028] (5) 16s rRNA gene amplification The 27F primer sequence for 16s rRNA gene amplification is AGAGTTTGATCCTGGCTCAG, and the 1492R primer sequence is TACGGCTACCTTGTTACGACTT. The final product fragment size is about 1500 bp. Add 15 μL of Super Mix enzyme mixture, 1 μL of F primer, R primer and DNA template to a 0.5 mL PCR reaction tube, and then add ddH2O to 30 μL. Centrifuge at high speed for 5 seconds and then amplify on the machine. The PCR amplification program is: first 96℃ for 5 minutes; then 96℃ for 20 seconds, 62℃ for 20 seconds, and 72℃ for 30 seconds for a total of 35 cycles; finally 72℃ for 10 minutes, and end the amplification program at 16℃.

[0029] (6) PCR product detection, purification and sequencing. Add 3ul of PCR product to 1.0% agarose gel for electrophoresis to observe the presence and brightness of product bands. Purify the PCR product with magnetic beads according to the instructions of the kit, and then sequence the purified PCR product on the machine.

[0030] (7) Data analysis. The sequencing results were compared with the database on the NCBI website by BLAST analysis to identify the bacterial species. The sequencing results of the 16s RNA gene amplification product were compared with the database on the NCBI website by BLAST analysis. The results showed that it was most closely related to Lactobacillus delbrueckii subsp. sunkii. The evolutionary tree is shown in Figure 1 , named WuYi2021-1, the variable region sequence of its 16s rRNA is shown in the sequence listing SEQ ID NO: 1, and the sequencing results are shown in Figure 2 .

[0031] Example 2

[0032] Isolation and culture of Lactobacillus delbrueckii subspecies WuYi2021-1

[0033] 1. Preparation of Lactobacillus delbrueckii Isolation Medium

[0034] Prepare MRS blood culture medium according to the formula, sterilize at 121℃ for 15 minutes, cool to about 50℃, add 5% sterile defibrinated sheep red blood cells, mix well and quickly pour 15-20ml into a 90cm sterile plate, cool to room temperature and solidify, and then use it after passing the quality inspection. The prepared culture medium has a pH of about 6.0. Before use, add 3ml of citric acid-sodium citrate buffer (pH=4.0, room temperature 25℃) on the surface of the MRS blood culture medium and put it in the incubator for 15-20 minutes to allow the citric acid-sodium citrate buffer to be automatically absorbed into the culture medium.

[0035] The components of MRS blood culture medium (g / L) include: 10 g of peptone, 20 g of glucose, 15 g of agar powder, 5 g of sodium acetate, 5 g of beef extract powder, 4 g of yeast extract powder, 0.2 g of magnesium sulfate, 0.05 g of manganese sulfate, 2 g of dipotassium hydrogen phosphate, 2 g of triammonium citrate, 801 ml of Tween, 50 ml of 5% sterile defibrinated sheep red blood cells, 950 ml of deionized double distilled water, and citric acid-sodium citrate buffer (pH = 4.0, room temperature 25°C).

[0036] 2. Preparation of pure culture medium of Lactobacillus delbrueckii

[0037] Prepare the modified acidic blood culture medium according to the formula, sterilize at 121℃ for 15 minutes, cool to about 50℃, add 5% sterile defibrinated sheep red blood cells and sterile fetal bovine serum, mix well and quickly pour 15-20ml into a 90cm sterile plate, cool to room temperature and solidify, and then use it after passing the quality inspection. The prepared culture medium has a pH of about 7.0. Before use, add 3ml of citric acid-sodium citrate buffer (pH=4.0, room temperature 25℃) on the surface of the blood culture medium and put it in the incubator for 15-20 minutes to allow the citric acid-sodium citrate buffer to be automatically absorbed into the culture medium.

[0038] The components of the modified acidic blood culture medium (g / L) include: 10 g of peptone, 20 g of glucose, 15 g of agar powder, 5 g of sodium chloride, 5 g of beef extract powder, 5 g of yeast extract powder, 5 g of beef heart extract powder, 50 ml of 5% sterile defibrinated sheep red blood cells, 50 ml of fetal bovine serum, 900 ml of deionized double distilled water, and citric acid-sodium citrate buffer (pH = 4.0, room temperature 25°C).

[0039] Example 3

[0040] The physiological and biochemical characteristics of Lactobacillus delbrueckii subspecies WuYi2021-1 isolated and cultured in Example 1 were tested.

[0041] 1. Colony morphology and staining.

[0042] The colony edge of Lactobacillus delbrueckii subspecies WuYi2021-1 on the blood agar plate is neatly slightly convex and concave in the middle, the colony is moist, and it can produce a-hemolytic rings; it is Gram-positive and long rod-shaped, such as Figure 3 and Figure 4 .

[0043] 2. Biochemical reaction results of GP and GN identification cards

[0044] The Lactobacillus delbrueckii subspecies WuYi2021-1 of the present invention can decompose α-glucosidase, α-galactosidase, D-maltose, D-glycosidose, D-glycosidol, D-sorbitol, sucrose, salicin, arginine dihydrolase 1, arginine dihydrolase 2, alanine arylamine enzyme, and alanine-phenylalanine-proline arylamine enzyme, and the optoxine tolerance test is positive, and the hydrogen peroxide test is negative, as shown in Tables 1 and 2.

[0045] Table 1 Positive results of Lactobacillus delbrueckii subspecies WuYi2021-1 on GP Gram-positive bacteria identification card

[0046]

[0047] Table 2 Positive results of Lactobacillus delbrueckii subspecies WuYi2021-1 against GN Gram-negative bacteria identification card

[0048]

[0049] 3. Acid production and antibacterial effect

[0050] Lactobacillus delbrueckii subspecies WuYi2021-1 can decompose 5% medical glucose injection to produce acid, reducing the pH of the nutrient broth medium containing 5% medical glucose injection from 7.8 to about pH 4.2, and the glucose concentration from 277mmol / L to about 138mmol / L; after 48 hours of culture on the blood agar plate, the growth of Staphylococcus aureus and Escherichia coli can be inhibited by the naked eye. Figure 5 and Figure 6 ; Can produce antibacterial ring and hemolytic ring, Figure 7 It is a very regular round translucent hemolytic ring produced when Staphylococcus aureus and Lactobacillus delbrueckii subspecies are cultured simultaneously. A strain of Staphylococcus aureus is inoculated in the center, and densely growing Lactobacillus delbrueckii subspecies are next to it.

[0051] 4. Drug sensitivity test

[0052] (1) Strain culture Based on the previous research, the isolated S. sunkii subspecies WuYi2021-1 was inoculated on a blood plate and placed in an incubator at 35°C with 5% CO2 for 24 h. At the same time, the standard control strains Escherichia coli (ATCC25922) and Staphylococcus aureus (ATCC25923) were also inoculated on a blood plate and placed in an incubator at 35°C with 5% CO2 for 24 h.

[0053] (2) Identification: According to the colony morphology, staining, culture characteristics and biochemical reaction results, it was confirmed again whether the experimental strain Lactobacillus delbrueckii subspecies WuYi2021-1 and the standard control strains Escherichia coli and Staphylococcus aureus met the requirements of the drug sensitivity test.

[0054] (3) Drug sensitivity test The experimental strain Lactobacillus delbrueckii subspecies WuYi2021-1 and the standard control strains Escherichia coli and Staphylococcus aureus were inoculated into blood plates according to the KB method. Five drug sensitivity papers were pasted on each blood plate, and each strain was tested for drug sensitivity three times in parallel. The 20 antimicrobial drugs included linezolid paper, ciprofloxacin, levofloxacin, gatifloxacin, tetracycline, rifampicin, chloramphenicol, ampicillin, penicillin, vancomycin, gentamicin, amikacin, clindamycin, ceftriaxone, cefepime, cefotaxime, erythromycin, trimethoprim / sulfamethoxazole, imipenem, and meropenem. The above drug sensitivity papers were purchased from Wenzhou Kangtai Biotechnology Co., Ltd.

[0055] (4) Result determination The average and standard deviation of the inhibition zone diameters of the three parallel drug sensitivity tests were calculated, and the drug sensitivity results of Lactobacillus delbrueckii subspecies sunkii were determined by referring to the drug sensitivity results of the standard control strains Escherichia coli (ATCC25922) and Staphylococcus aureus (ATCC25923).

[0056] (5) Statistical Methods The data of this example were analyzed using SPSS 22.0 software. The measurement data were expressed as (x±s). Before analysis, normality and homogeneity of variance tests were performed. If the data were normally distributed, a t-test was performed. The count data were expressed as [n, (%)] and a χ2 test was performed. P<0.05 indicated that the difference was statistically significant.

[0057] (6) Results: The drug sensitivity results of Lactobacillus delbrueckii subspecies WuYi2021-1 to 20 antimicrobial drugs are as follows: linezolid disk (40±1) mm, ciprofloxacin (18±1) mm, levofloxacin (20±2) mm, gatifloxacin (26±1) mm, tetracycline (28±2) mm, rifampicin (25±2) mm, chloramphenicol (37±2) mm, ampicillin (41±1) mm, penicillin (4 7±1) mm, vancomycin (29±1) mm, gentamicin (21±1) mm, amikacin (23±1) mm, clindamycin (26±2) mm, ceftriaxone (36±2) mm, cefepime (41±1) mm, cefotaxime (41±1) mm, erythromycin (41±1) mm, trimethoprim / sulfamethoxazole (0±0) mm, imipenem (49±1) mm, meropenem (41±1) mm. It can be seen that Lactobacillus delbrueckii subspecies WuYi2021-1 is sensitive to all drugs except sulfonamides.

[0058] 5. Application prospects

[0059] The Lactobacillus delbrueckii subspecies WuYi2021-1 of the present invention does not produce hydrogen peroxide; at the same time, it is found that Streptococcus agalactiae can inhibit the growth of Lactobacillus delbrueckii subspecies in the external culture medium for a short period of time, and after the Lactobacillus delbrueckii subspecies produces a large amount of lactic acid, it can inhibit its growth (that is, acid production can inhibit the growth of Streptococcus agalactiae); at the same time, it is also observed that Lactobacillus delbrueckii can produce antibacterial rings and hemolytic rings with Staphylococcus aureus; it can also inhibit the growth of Escherichia coli.

[0060] For pregnant women, various infectious diseases may often occur during pregnancy. If antibiotics are used at this moment, the level of Lactobacillus delbrueckii may be affected, further increasing the risk of vaginal-related diseases, and ultimately affecting the life, health and safety of the fetus. The results of the present invention found that Lactobacillus delbrueckii subspecies WuYi2021-1 is resistant to sulfonamides, but sensitive to other antibacterial drugs. This suggests that a variety of antibiotics will affect the activity of Lactobacillus delbrueckii clinically, promote the reduction of Lactobacillus delbrueckii content, indirectly affect the balance of vaginal microecology, and then promote the occurrence and development of related diseases. It reflects that pregnant women should not use antibiotics during pregnancy, so as not to inhibit the growth and reproduction of lactobacillus, break the balance of vaginal microecology, cause flora disorder and induce vaginitis, and cause the fetus to be affected. Lactobacillus delbrueckii subspecies WuYi2021-1 has obvious resistance to sulfonamides, and is sensitive to the rest of the drugs to varying degrees, which provides guidance for clinical pregnant women's medication, and fully illustrates that pregnant women should try to avoid the use of antibiotics to ensure the life, health and safety of themselves and the fetus.

Claims

1. A strain of Lactobacillus delbrueckii subsp. sunkii, named WuYi2021-1, characterized in that: The deposit number is CCTCC NO.M 20221248.

Images