A high-efficiency chromatin DNA-binding map sequencing method

By using BAMEA-Tn5 and MEB-Tn5 transposases to bind nucleic acid aptamers, the high cost and complex operation problems caused by antibody dependence in existing technologies have been solved, enabling rapid and efficient chromatin DNA binding mapping sequencing with high signal-to-noise ratio, reduced sequencing costs and improved stability.

CN116218971BActive Publication Date: 2026-04-28TSINGHUA UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310031360.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-10
Publication Date
2026-04-28
Estimated Expiration
2043-01-10

AI Technical Summary

Technical Problem

Existing chromatin DNA binding mapping sequencing technologies rely on high-purity, high-specificity antibodies, resulting in high costs, poor stability, complex operation, and long processing times.

Method used

Using BAMEA-Tn5 and MEB-Tn5 transposases to bind nucleic acid aptamers, specific transcription factor sites were identified and adapter sequences and tags were added. Subsequently, specific DNA fragments were enriched with streptavidin magnetic beads to construct sequencing libraries, avoiding the use of antibodies.

Benefits of technology

It achieves rapid, efficient, and low-cost chromatin DNA binding mapping sequencing with high signal-to-noise ratio, simple operation, stable nucleic acid aptamer performance, strong reproducibility, and significantly shortens library preparation time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116218971B_ABST
    Figure CN116218971B_ABST
Patent Text Reader

Abstract

The application discloses a high-efficiency chromatin DNA binding map sequencing method. The method adopts BAMEA-Tn5 transposase. The BAMEA-Tn5 transposase is obtained by adding a specific nucleic acid aptamer sequence of a transcription factor to a 5' end of a linker sequence of Tn5 transposase, and the 5' end is provided with a modified group. The method is targeted to a transcription factor site in cells by the BAMEA-Tn5 transposase based on the recognition ability of the nucleic acid aptamer, and the BAMEA linker sequence and the tag are added at the site where chromatin DNA is combined with the transcription factor by the cleavage activity of the Tn5 enzyme. The sequencing method adopts the nucleic acid aptamer to target and recognize the transcription factor, greatly reduces the sequencing cost, and the nucleic acid aptamer has stable performance and strong reproducibility.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a chromatin DNA binding mapping sequencing method. More specifically, this invention relates to a rapid and efficient chromatin DNA binding mapping sequencing method that does not rely on any antibodies. Background Technology

[0002] Regulatory regions of nuclear chromatin are enriched with diverse gene regulatory elements such as transcription factors and histone modifications, forming a cell-specific chromatin-DNA binding landscape. These regulatory elements play crucial roles in many disease processes and important biological processes such as embryonic development and cell differentiation. High-throughput detection of these regulatory elements' enrichment sites in chromatin-DNA is of great significance for elucidating the molecular mechanisms of gene expression regulation. Classical chromatin immunoprecipitation sequencing (ChIP-seq), as well as the increasingly advanced methods such as CUT&Tag, CUT&RUN, itChIP-seq, CoBATCH, and ChIL-seq in recent years, have greatly promoted the development of this field.

[0003] However, the publicly available chromatin DNA binding mapping sequencing technology relies on high-purity, high-specificity antibodies. These antibodies are expensive, have poor stability, and are complex and time-consuming to operate. Summary of the Invention

[0004] The embodiments of the present invention aim to at least partially solve one of the technical problems in related technologies. To this end, the embodiments of the present invention propose a chromatin DNA binding map sequencing method, comprising the following steps:

[0005] (1) Collect cells and add formaldehyde solution to crosslink transcription factors with DNA; (2) Add activated magnetic beads to cells for incubation, then separate and collect the magnetic beads; (3) Add permeation blocking solution for incubation, then separate and collect the magnetic beads; (4) Add a solution containing BAMEA-Tn5 transposase but without transposase activator for incubation, then separate and collect the magnetic beads; (5) Wash the cells and then add a buffer containing transposase activator for incubation; (6) Add MEB-Tn5 transposase to the solution in step (5) and continue to incubate the cells; (7) Use streptavidin magnetic beads to recover the enzyme-digested fragments; (8) PCR library construction and next-generation sequencing;

[0006] The BAMEA-Tn5 transposase is constructed by adding a nucleic acid aptamer sequence that specifically recognizes the transcription factor to the 5' end of the linker sequence of the Tn5 transposase, and the 5' end has a modifying group; the MEB-Tn5 transposase is a Tn5 transposase containing a conventional linker sequence at the 5' end.

[0007] In this embodiment of the invention, the BAMEA-Tn5 transposase functions by targeting the Tn5 enzyme to transcription factor sites within the cell based on the recognition ability of nucleic acid aptamers. The Tn5 enzyme then adds BAMEA adapter sequences and tags (e.g., biotin tags) to the chromatin DNA binding sites of transcription factors through its cleavage activity. After this step, the MEB-Tn5 transposase is used to interact with the cells, randomly cleaving open sites on the chromatin DNA to obtain small DNA fragments. Subsequently, through enrichment with streptavidin magnetic beads, only those small fragments specifically tagged during the BAMEA-Tn5 transposase step are enriched, thereby specifically capturing the DNA sites where transcription factors bind. In this process, the separate treatment with BAMEA-Tn5 and MEB-Tn5 transposases also adds primer binding sites for PCR amplification of the target DNA fragments. Therefore, PCR of the streptavidin-enriched products is sufficient to construct a chromatin DNA binding map sequencing library. The sequencing method of this invention does not require the use of antibodies or other proteins / peptides for specific binding, thus avoiding the problems of high cost and poor stability associated with the use of antibodies. Furthermore, the sequencing method of this invention uses nucleic acid aptamers, which greatly reduces sequencing costs, and the nucleic acid aptamers are stable and highly reproducible.

[0008] In some embodiments, the nucleic acid aptamer sequence is a DNA sequence that can specifically bind to the transcription factor in the cell in situ, with a binding force Kd value of less than 100 nM.

[0009] In some embodiments, the 5' end modification group of the BAMEA-Tn5 transposase is biotin, a chloroalkane molecule (Halo Tag ligand), or a benzylguanine molecule (SNAP Tag ligand). Biotin is preferred.

[0010] In some embodiments, the BAMEA-Tn5 transposase is obtained by incubating an equimolar mixture of the BAMEA-Tn5 adapter sequence and the Tn5 transposase; wherein the BAMEA-Tn5 adapter sequence is formed by annealing and hybridizing an equimolar mixture of the BAMEA sequence and the ME sequence, the ME sequence being shown in SEQ ID No. 2; the structure of the BAMEA sequence is 5'-BAL-MEA-3', where B is biotin, A is a nucleic acid aptamer sequence, and L is a linker arm, and the MEA sequence is shown in SEQ ID No. 1.

[0011] 5'-TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG-3' (SEQ ID No. 1);

[0012] 5'-P-CTG TCT CTT ATA CAC ATC TGA CGC TGC CGA CGA-3'(5' phosphorylation) (SEQ ID No. 2).

[0013] Furthermore, the BAMEA-Tn5 transposase is obtained by mixing the BAMEA-Tn5 adapter sequence with the Tn5 transposase in equimolar amounts and incubating at room temperature for 1 hour.

[0014] In some embodiments, the connecting arm in the BAMEA sequence is T. 10 Nucleic acid (TTTTTTTTTT), one of the following: C6 adapter, C12 adapter, S9 adapter, or S18 adapter. The structures of the C6 adapter, C12 adapter, S9 adapter, and S18 adapter are as follows: Figure 4 As shown.

[0015] In some embodiments, the MEB-Tn5 transposase is obtained by incubating an equimolar mixture of the MEB-Tn5 adapter sequence and the Tn5 transposase; wherein the MEB-Tn5 adapter sequence is formed by annealing and hybridizing an equimolar amount of MEB sequence and ME sequence, the ME sequence being shown in SEQ ID No. 2; and the MEB sequence being shown in SEQ ID No. 3.

[0016] 5'-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA G-3' (SEQ ID No. 3).

[0017] In some embodiments, the MEB-Tn5 transposase is obtained by mixing the MEB-Tn5 adapter sequence with the Tn5 transposase in equimolar amounts and incubating at room temperature for 1 hour.

[0018] In some embodiments, the magnetic beads are concanavalin A magnetic beads.

[0019] In some embodiments, the permeable sealing solution is a solution containing digitalis saponins, bovine serum albumin, and random single-stranded nucleic acids.

[0020] In some embodiments, the transposase activator is a divalent metal ion, such as Mg. 2+ Zn 2+ Mn 2+ Ca 2+ Fe 2+ One or more of the following. Preferably, the transposase activator is Mg. 2+ .

[0021] In some embodiments, step (1) is as follows: collect cells, crosslink them with 0.1-0.5% formaldehyde for 5 min, neutralize them with 0.125M glycine for 5 min to crosslink the transcription factors with DNA, and then wash them three times with PBS buffer to remove residual formaldehyde and glycine.

[0022] In some embodiments, the cell incubation temperature in step (3) is 4-25°C (preferably 10-20°C) and the time is 30 min.

[0023] In some embodiments, the cell incubation temperature in step (4) is 4-25°C (preferably 10-20°C) and the time is 30 min.

[0024] In some embodiments, the cell incubation temperature in step (5) is 37°C and the incubation time is 30 min.

[0025] In some embodiments, the cell incubation temperature in step (6) is 37°C and the time is 30 min.

[0026] In some embodiments, the Tn5 transposase may be replaced by a Tn1 transposase, Tn2 transposase, Tn3 transposase, Tn4 transposase, Tn6 transposase, Tn7 transposase, Tn8 transposase, Tn9 transposase, or Tn10 transposase.

[0027] This invention also provides a kit comprising: BAMEA-Tn5 transposase; wherein the BAMEA-Tn5 transposase is constructed by adding a nucleic acid aptamer sequence that specifically recognizes the transcription factor to the 5' end of the linker sequence of the Tn5 transposase, and the 5' end has a modifying group.

[0028] In some embodiments, the kit further includes: MEB-Tn5 transposase; the MEB-Tn5 transposase is a Tn5 transposase containing a conventional linker sequence at its 5' end.

[0029] In some embodiments, the nucleic acid aptamer sequence is a DNA sequence that can specifically bind to the transcription factor in the cell in situ, with a binding force Kd value of less than 100 nM.

[0030] In some embodiments, the 5' end modification group of the BAMEA-Tn5 transposase is biotin, a chloroalkane molecule (Halo Tag ligand), or a benzylguanine molecule (SNAP Tag ligand). Biotin is preferred.

[0031] In some embodiments, the BAMEA-Tn5 transposase is obtained by incubating an equimolar mixture of the BAMEA-Tn5 adapter sequence and the Tn5 transposase; wherein the BAMEA-Tn5 adapter sequence is formed by annealing and hybridizing an equimolar mixture of the BAMEA sequence and the ME sequence, the ME sequence being shown in SEQ ID No. 2; the structure of the BAMEA sequence is 5'-BAL-MEA-3', where B is biotin, A is a nucleic acid aptamer sequence, and L is a linker arm, and the MEA sequence is shown in SEQ ID No. 1.

[0032] 5'-TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG-3' (SEQ ID No. 1);

[0033] 5'-P-CTG TCT CTT ATA CAC ATC TGA CGC TGC CGA CGA-3'(5' phosphorylation) (SEQ ID No. 2).

[0034] In some embodiments, the BAMEA-Tn5 transposase is obtained by mixing the BAMEA-Tn5 adapter sequence with the Tn5 transposase in equimolar amounts and incubating at room temperature for 1 hour.

[0035] In some embodiments, the connecting arm in the BAMEA sequence is T. 10 Nucleic acid (TTTTTTTTTT), one of the following: C6 adapter, C12 adapter, S9 adapter, or S18 adapter. The structures of the C6 adapter, C12 adapter, S9 adapter, and S18 adapter are as follows: Figure 4 As shown.

[0036] In some embodiments, the MEB-Tn5 transposase is obtained by incubating an equimolar mixture of the MEB-Tn5 adapter sequence and the Tn5 transposase; wherein the MEB-Tn5 adapter sequence is formed by annealing and hybridizing an equimolar amount of MEB sequence and ME sequence, the ME sequence being shown in SEQ ID No. 2; and the MEB sequence being shown in SEQ ID No. 3.

[0037] 5'-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA G-3' (SEQ ID No. 3).

[0038] In some embodiments, the kit further includes a blocking sequence as shown in SEQ ID No. 4.

[0039] ATAGGCTGCGAAGGCGATAG(SEQ ID No.4)

[0040] In some embodiments, the kit further includes one or more of the following: washing buffer, binding buffer, reaction buffer, blocking buffer, and annealing buffer.

[0041] In some embodiments, the 10X washing buffer comprises: 200 mM HEPES-KOH pH=7.5, 1.5 M NaCl, and 5 mM spermidine.

[0042] In some embodiments, the 10X binding buffer comprises: 200 mM HEPES-KOH pH=7.9, 100 mM KCl, 10 mM CaCl2, and 10 mM MnCl2.

[0043] In some embodiments, the 10X reaction buffer comprises: 200 mM HEPES-KOH pH=7.5, 3 M NaCl, and 5 mM spermidine.

[0044] In some embodiments, the 25X blocking buffer comprises: 50 mM EDTA pH 8.0, 2.5% BSA.

[0045] In some embodiments, the annealing buffer comprises: 10 mM Tris-HCl pH 7.5, 1 mM EDTA, and 100 mM NaCl.

[0046] In some embodiments, the kit further includes sequencing primers.

[0047] In some embodiments, the Tn5 transposase may be replaced by a Tn1 transposase, Tn2 transposase, Tn3 transposase, Tn4 transposase, Tn6 transposase, Tn7 transposase, Tn8 transposase, Tn9 transposase, or Tn10 transposase.

[0048] This invention also provides the application of the above-described kit in chromatin DNA binding mapping sequencing.

[0049] In some embodiments, the kit is used for tissue samples obtained through clinical pathological biopsy or surgical resection. It is of great significance for clinical research in studying the epigenetic regulatory mechanisms of disease-related cells.

[0050] The advantages and beneficial effects of the embodiments of the present invention are as follows:

[0051] (1) The present invention is simple to operate and only takes 4.5-5 hours to complete the library construction process, which significantly shortens the library construction time in related technologies.

[0052] (2) This invention does not require the use of antibodies or other proteins / peptides for achieving specific binding; thus avoiding the problems of high cost and poor stability caused by the use of antibodies.

[0053] (3) The present invention uses nucleic acid aptamers, which greatly reduces the sequencing cost, and the nucleic acid aptamers have stable performance and strong reproducibility.

[0054] (4) The sequencing method of this invention has a high signal-to-noise ratio, which is superior to the classic chromatin immunoprecipitation sequencing. Attached Figure Description

[0055] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the following description of the embodiments taken in conjunction with the accompanying drawings.

[0056] Figure 1 This is a flowchart illustrating the classic ChIP-seq method.

[0057] Figure 2 This is a schematic diagram illustrating the construction of the BAMEA-Tn5 transposase.

[0058] Figure 3 This is a schematic diagram of the MEB-Tn5 structure.

[0059] Figure 4 Structural diagrams of C6 connector, C12 connector, S9 connector, and S18 connector;

[0060] Figure 5 This is a schematic flowchart of the chromatin DNA binding pattern sequencing method according to an embodiment of the present invention;

[0061] Figure 6 A visualization map of chromatin enrichment sites for the FOXM1 transcription factor;

[0062] Figure 7 Statistical analysis of the number of FOXM1 chromatin enrichment sites obtained by different methods;

[0063] Figure 8 Venn diagrams of FOXM1 chromatin enrichment sites obtained by different methods;

[0064] Figure 9 Venn diagram of FOXM1 chromatin enrichment sites and chromatin open sites;

[0065] Figure 10 For the reproducibility of the FOXM1 AptaChC-seq method;

[0066] Figure 11 Distribution of FOXM1 transcription factor in different chromatin regions obtained by AptaChC-seq;

[0067] Figure 12 To assess the stability of AptaChC-seq performance based on nucleic acid aptamers. Detailed Implementation

[0068] Regulatory regions of nuclear chromatin are enriched with diverse gene regulatory elements such as transcription factors and histone modifications, forming a cell-specific chromatin-DNA binding landscape. These regulatory elements play crucial roles in many disease processes and important biological processes such as embryonic development and cell differentiation. High-throughput detection of these regulatory elements' enrichment sites in chromatin-DNA is of great significance for elucidating the molecular mechanisms of gene expression regulation. Classical chromatin immunoprecipitation sequencing (ChIP-seq), as well as the increasingly advanced methods in recent years such as CUT&Tag (Cleavage Under Targets and Tagmentation), CUT&RUN (Cleavage Under Targets and Release Using Nuclease), itChIP-seq (indexing and tagmentation-based ChIP-seq), CoBATCH (combinatorial barcoding and targeted chromatin release), and ChIL-seq (Chromatin Integration Labeling sequencing), have greatly promoted the development of this field.

[0069] Figure 1 The flowchart of the classic ChIP-seq method is shown. First, live cells are cross-linked with 1% formaldehyde, covalently linking various chromatin regulatory elements to their bound DNA fragments. Second, chromatin is broken down by sonication, releasing the complexes of regulatory proteins and small DNA fragments into solution. Then, magnetic beads with surface-modified antibodies specific to the target protein are added to the solution for incubation, capturing the target protein and its bound DNA fragments. Next, the captured DNA fragments are purified. Finally, a DNA library is prepared and next-generation sequencing is performed. The entire process takes approximately 3 days.

[0070] Other methods, such as CUT&Tag, CUT&RUN, itChIP-seq, CoBATCH, and ChIL-seq, differ from ChIP-seq in their specific operational steps. However, the core steps are all to capture the target protein and the DNA fragment it binds to with antibodies. These methods are complex and time-consuming. For example, CUT&Tag takes about 12 hours, CUT&RUN takes about 9-12 hours, itChIP-seq takes about 12 hours, and ChIL-seq takes about 3 days.

[0071] Nucleic acid aptamers are functional nucleic acid molecules composed of DNA or RNA. They recognize targets, including small molecules, proteins, peptides, and metal ions, by forming specific nucleic acid secondary structures. Nucleic acid aptamers can be synthesized using commercially available solid-phase nucleic acid synthesis principles, which are low-cost, stable, reproducible, and easily modified and functionalized. Aptamers synthesized from different companies and batches exhibit consistent binding capabilities. Therefore, aptamers are high-performance molecular recognition tools and have already replaced antibodies in bioanalytical methods such as enzyme-linked immunosorbent assays (ELISA) and immunochromatography to recognize target molecules. If nucleic acid aptamers could be used to replace antibodies in chromatin DNA binding mapping sequencing, enabling antibody-independent chromatin DNA binding mapping, it would have significant application potential.

[0072] However, simply replacing antibodies with nucleic acid aptamers is insufficient in chromatin DNA binding mapping sequencing methods. For example, in classic chromatin immunoprecipitation sequencing, antibody-modified magnetic beads can be directly replaced with aptamer-modified magnetic beads, but this does not overcome the inherent drawbacks of ChIP-seq (complex procedures, low signal-to-noise ratio, and large cell requirements). In immunochromatographic methods such as CUT&Tag and CUT&RUN, the cascade amplification generated by the sequential binding of primary antibody, secondary antibody, and Protein A / G to the target site enriches multiple nuclease molecules near the target site, resulting in small fragmented cleavage products. Using only nucleic acid aptamers, without any antibodies or functional peptides such as Protein A / G, makes it difficult to enrich nuclease molecules at chromatin target sites, resulting only in DNA double-strand breaks and failing to obtain fragmented cleavage products. Therefore, improvements and innovations in chromatin DNA binding mapping sequencing methods are necessary to achieve antibody-independent chromatin DNA binding mapping sequencing.

[0073] It should be noted that the disclosure of the above information is only intended to enhance the understanding of the overall background of the present invention, and should not be construed as an admission or implication in any way that the information constitutes prior art known to those skilled in the art.

[0074] The following are descriptions of terms or words, and unless otherwise defined, all technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains.

[0075] In this article, the words “contain” and “include” and their various variations mean that other elements or wholes may be included but not specifically described.

[0076] The term "transcription factor" refers to a polypeptide capable of sequence-specific interactions with a portion of the transcriptional regulatory region of a gene. This interaction can be direct sequence-specific binding, where the transcription factor directly contacts the nucleic acid; or indirect sequence-specific binding mediated or facilitated by other accessory proteins, where the transcription factor is bound to the nucleic acid by a direct nucleic acid-binding protein. Additionally, some transcription factors exhibit induced or co-inducible binding. Transcription factors influence the level of gene transcription.

[0077] The term "nucleic acid aptamer" refers to a nucleic acid molecule that has been engineered to bind to a target molecule through repeated cycles of in vitro selection or SELEX (systematic evolution via exponentially enriched ligands). Nucleic acid aptamers can be DNA or RNA molecules. Aptamers may contain modifications, such as modified nucleotides, like 2′-fluorosubstituted pyrimidines, and / or may contain one or more nucleotides having an L-ribose unit (or L-deoxyribose) instead of a standard D-ribose unit (or D-deoxyribose).

[0078] The term "specific binding" refers to the stronger binding of a nucleic acid aptamer to its specific target, such as an epitope, compared to binding to another target. If a nucleic acid aptamer binds to a first target with a dissociation constant (Kd) lower than that relative to a second target, then the binding of the nucleic acid aptamer to the first target is stronger than that to the second target. Preferably, the dissociation constant (Kd) of the compound to which it specifically binds is more than 10 times, more preferably more than 20 times, more preferably more than 50 times, and even more preferably more than 100 times, 200 times, 500 times, or 1000 times lower than that of the compound to which it does not specifically bind.

[0079] In this paper, the term “Kd” (usually measured in “mol / L”, sometimes abbreviated as “M”) is intended to represent the dissociation equilibrium constant of a specific interaction between a nucleic acid aptamer and a transcription factor.

[0080] The term "next-generation sequencing," also known as high-throughput sequencing, refers to the so-called "synthetic parallel sequencing" or "ligation sequencing" platforms currently used by companies such as Illumina, Life Technologies, and Roche. Next-generation sequencing methods can also include nanopore sequencing methods (e.g., those commercialized by Oxford Nanopore Technologies), electron detection methods (e.g., the Ion Torrent technology commercialized by Life Technologies), and single-molecule fluorescence-based methods (e.g., those commercialized by Pacific Biosciences).

[0081] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0082] This invention is the first to propose a rapid and efficient chromatin DNA binding mapping sequencing method that does not rely on any antibodies, namely Aptamer-guided chromatin cleavage with sequencing (AptaChC-seq). Without using any protein-based interaction factors, it achieves simple, efficient, low-cost, and highly reproducible chromatin DNA binding mapping sequencing.

[0083] The chromatin DNA binding map sequencing method of this invention includes the following steps:

[0084] (1) Collect cells and add formaldehyde solution to crosslink transcription factors with DNA; (2) Add activated magnetic beads to cells for incubation, then separate and collect the magnetic beads; (3) Add permeation blocking solution for incubation, then separate and collect the magnetic beads; (4) Add a solution containing BAMEA-Tn5 transposase but without transposase activator for incubation, then separate and collect the magnetic beads; (5) Wash the cells and then add a buffer containing transposase activator for incubation; (6) Add MEB-Tn5 transposase to the solution in step (5) and continue to incubate the cells; (7) Use streptavidin magnetic beads to recover the enzyme-digested fragments; (8) PCR library construction and next-generation sequencing;

[0085] Among them, BAMEA-Tn5 transposase is constructed by adding a nucleic acid aptamer sequence that specifically recognizes transcription factors to the 5' end of the linker sequence of Tn5 transposase, and the 5' end has a modification group; MEB-Tn5 transposase is a Tn5 transposase with a conventional linker sequence at the 5' end.

[0086] In this embodiment of the invention, the BAMEA-Tn5 transposase functions by targeting the Tn5 enzyme to transcription factor sites within the cell based on the recognition ability of nucleic acid aptamers. The Tn5 enzyme then adds BAMEA adapter sequences and tags (e.g., biotin tags) to the chromatin DNA binding sites of transcription factors through its cleavage activity. After this step, the MEB-Tn5 transposase is used to interact with the cells, randomly cleaving open sites on the chromatin DNA to obtain small DNA fragments. Subsequently, through enrichment with streptavidin magnetic beads, only those small fragments specifically tagged during the BAMEA-Tn5 transposase step are enriched, thereby specifically capturing the DNA sites where transcription factors bind. In this process, the separate treatment with BAMEA-Tn5 and MEB-Tn5 transposases also adds primer binding sites for PCR amplification of the target DNA fragments. Therefore, PCR of the streptavidin-enriched products is sufficient to construct a chromatin DNA binding map sequencing library. The sequencing method of this invention does not require the use of antibodies or other proteins / peptides for specific binding, thus avoiding the problems of high cost and poor stability associated with the use of antibodies. Furthermore, the sequencing method of this invention uses nucleic acid aptamers, which greatly reduces sequencing costs, and the nucleic acid aptamers are stable and highly reproducible.

[0087] In some embodiments, the nucleic acid aptamer sequence is a DNA sequence that can specifically bind to intracellular transcription factors in situ, with a binding affinity (Kd) of less than 100 nM. It is understood that the nucleic acid aptamer sequence in this invention can be flexibly changed according to the type of transcription factor to be measured, and the effect of this method can still be achieved. For example, the human transcription factor FOXM1 aptamer TCA CTT CAC ACC GCA TCT CTA CGT CCG GTT GCG CTT TCCTTT (SEQ ID No. 5) reported by Tan et al. can be used in this method to achieve human cell chromatin FOXM1 transcription factor mapping sequencing.

[0088] The 5' end modification group of the BAMEA sequence is a small molecule functional group used for affinity purification and needs to be directly linked to the nucleic acid chain via a solid-phase nucleic acid synthesis step. In some embodiments, the 5' end modification group of the BAMEA-Tn5 transposase is biotin, a Halo Tag ligand molecule (chloroalkane), or a SNAP Tag ligand molecule (benzylguanine). Biotin is preferred.

[0089] In some embodiments, the BAMEA-Tn5 transposase is obtained by incubating an equimolar mixture of the BAMEA-Tn5 adapter sequence and the Tn5 transposase; wherein the BAMEA-Tn5 adapter sequence is formed by annealing and hybridizing equimolar amounts of the BAMEA sequence and the ME sequence, the ME sequence being shown in SEQ ID No. 2; the structure of the BAMEA sequence is 5'-BAL-MEA-3', where B is biotin, A is the nucleic acid aptamer sequence, L is the linker arm, and the MEA sequence is shown in SEQ ID No. 1. 5'-TCG TCG GCA GCG TCA GATGTG TAT AAG AGA CAG-3' (SEQ ID No. 1);

[0090] 5'-P-CTG TCT CTT ATA CAC ATC TGA CGC TGC CGA CGA-3'(5' phosphorylation) (SEQ ID No. 2).

[0091] Furthermore, the BAMEA-Tn5 transposase was obtained by mixing the BAMEA-Tn5 adapter sequence with the Tn5 transposase in equimolar amounts and incubating at room temperature for 1 hour.

[0092] In some embodiments, the connecting arm in the BAMEA sequence is T. 10 Nucleic acid (TTTTTTTTTT), one of the following: C6 adapter, C12 adapter, S9 adapter, or S18 adapter. The structures of the C6 adapter, C12 adapter, S9 adapter, and S18 adapter are as follows: Figure 4 As shown. Understandably, the connecting arm is used to ensure the appropriate distance between the nucleic acid aptamer and the Tn5 transposase.

[0093] In some embodiments, the MEB-Tn5 transposase is obtained by incubating an equimolar mixture of the MEB-Tn5 adapter sequence and the Tn5 transposase; wherein the MEB-Tn5 adapter sequence is formed by annealing and hybridizing an equimolar amount of MEB sequence and ME sequence, and the ME sequence is SEQ ID No. 2 with a phosphate group modified at the 5' end; the MEB sequence is shown in SEQ ID No. 3.

[0094] 5'-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA G-3' (SEQ ID No. 3).

[0095] In some embodiments, the MEB-Tn5 transposase is obtained by mixing the MEB-Tn5 adapter sequence with the Tn5 transposase in equimolar amounts and incubating at room temperature for 1 hour.

[0096] In some embodiments, the magnetic beads are concanavalin A magnetic beads.

[0097] In some embodiments, the permeation-blocking solution is a solution containing digitalis saponins, bovine serum albumin, and random single-stranded nucleic acids.

[0098] In some embodiments, the transposase activator is a divalent metal ion, such as Mg. 2+ Zn 2+ Mn 2+ Ca 2+ Fe 2+ One or more of the following. Preferably, the transposase activator is Mg. 2+ .

[0099] In some embodiments, step (1) is as follows: collect cells, crosslink them with 0.1-0.5% formaldehyde for 5 min, neutralize them with 0.125M glycine for 5 min to crosslink the transcription factors with DNA, and then wash them three times with PBS buffer to remove residual formaldehyde and glycine.

[0100] In some embodiments, the cell incubation temperature in step (3) is 4-25°C (preferably 10-20°C) and the time is 30 min.

[0101] In some embodiments, the cell incubation temperature in step (4) is 4-25°C (preferably 10-20°C) and the time is 30 min.

[0102] In some embodiments, the cell incubation temperature in step (5) is 37°C and the incubation time is 30 min.

[0103] In some embodiments, the cell incubation temperature in step (6) is 37°C and the time is 30 min.

[0104] In some embodiments, the concentration of BAMEA-Tn5 transposase in the reaction system in step (4) is 50-100 nM.

[0105] In some embodiments, the concentration of MEB-Tn5 transposase in step (6) in the reaction system is 50-100 nM.

[0106] In some embodiments, the chromatin DNA binding mapping sequencing method includes the following steps:

[0107] S1: Collect cells, cross-link them with 0.1-0.5% formaldehyde for 5 min, neutralize them with 0.125M glycine for 5 min to cross-link transcription factors with DNA, and then wash them 3 times with PBS buffer to remove residual formaldehyde and glycine.

[0108] S2: Cells are captured using activated concanavalin A magnetic beads, allowing the cells to attach to the beads; this step facilitates the separation of cells from the solution using a magnetic rack in subsequent steps.

[0109] S3: Add a solution containing digitalis saponins, bovine serum albumin, and random single-stranded nucleic acids, and incubate the cells at room temperature for half an hour; this step is to permeate the cells and block non-specific DNA binding sites.

[0110] S4: Add a solution containing BAMEA-Tn5 transposase and free of magnesium ions, and incubate the cells at room temperature for half an hour;

[0111] This step is to enable the BAMEA-Tn5 transposase to specifically bind to the transcription factor to be tested;

[0112] S5: Wash cells twice; remove non-specifically bound BAMEA-Tn5 transposase; add a buffer containing magnesium ions to activate the activity of Tn5 transposase, incubate cells at 37°C for half an hour to allow transcription factor sites to be cleaved by BAMEA-Tn5 transposase, and at the same time allow biotin-modified adapter sequences to be linked to specific sites on genomic DNA.

[0113] S6: Add MEB-Tn5 transposase to the solution from step S5, and incubate the cells at 37°C for half an hour to cut the DNA in open regions of chromatin into small fragments.

[0114] S7: Recover the digested fragments using streptavidin magnetic beads; Since the Tn5 transposase coupled with a biotin-modified aptamer was used during digestion in step S6, only DNA fragments containing biotin were ligated near the transcription factor. Therefore, the recovered fragments were all located at the transcription factor site, thus achieving the goal of this method to specifically detect chromatin DNA binding sites.

[0115] S8: PCR library construction, next-generation sequencing, and data analysis.

[0116] In some embodiments, the Tn5 transposase is replaced by the Tn1, Tn2, Tn3, Tn4, Tn6, Tn7, Tn8, Tn9, or Tn10 transposase.

[0117] This invention also provides a kit comprising: BAMEA-Tn5 transposase;

[0118] BAMEA-Tn5 transposase is constructed by adding a nucleic acid aptamer sequence that specifically recognizes transcription factors to the 5' end of the linker sequence of Tn5 transposase, with a modifying group at the 5' end.

[0119] In some embodiments, the kit further includes: MEB-Tn5 transposase;

[0120] MEB-Tn5 transposase is a Tn5 transposase containing a conventional linker sequence at its 5' end.

[0121] In some embodiments, the nucleic acid aptamer sequence is a DNA sequence that can specifically bind to intracellular transcription factors in situ, with a binding force Kd value of less than 100 nM.

[0122] In some embodiments, the 5' end modification group of the BAMEA-Tn5 transposase is biotin, a chloroalkane ligand of HaloTag, or benzylguanine ligand of SNAP Tag. Biotin is preferred.

[0123] In some embodiments, the BAMEA-Tn5 transposase is obtained by incubating an equimolar mixture of the BAMEA-Tn5 adapter sequence and the Tn5 transposase; wherein the BAMEA-Tn5 adapter sequence is formed by annealing and hybridizing equimolar amounts of the BAMEA sequence and the ME sequence, the ME sequence being shown in SEQ ID No. 2; the structure of the BAMEA sequence is 5'-BAL-MEA-3', where B is biotin, A is the nucleic acid aptamer sequence, L is the linker arm, and the MEA sequence is shown in SEQ ID No. 1. 5'-TCG TCG GCA GCG TCA GATGTG TAT AAG AGA CAG-3' (SEQ ID No. 1);

[0124] 5'-P-CTG TCT CTT ATA CAC ATC TGA CGC TGC CGA CGA-3'(5' phosphorylation) (SEQ ID No. 2).

[0125] In some embodiments, BAMEA-Tn5 transposase is obtained by mixing BAMEA-Tn5 adapter sequence and Tn5 transposase in equimolar amounts and incubating at room temperature for 1 hour.

[0126] In some embodiments, the connecting arm in the BAMEA sequence is T. 10 Nucleic acid (TTTTTTTTTT), one of the following: C6 adapter, C12 adapter, S9 adapter, or S18 adapter. The structures of the C6 adapter, C12 adapter, S9 adapter, and S18 adapter are as follows: Figure 4 As shown.

[0127] In some embodiments, the MEB-Tn5 transposase is obtained by incubating an equimolar mixture of the MEB-Tn5 adapter sequence and the Tn5 transposase; wherein the MEB-Tn5 adapter sequence is formed by annealing and hybridizing an equimolar amount of MEB sequence and ME sequence, and the ME sequence is SEQ ID No. 2 with a phosphate group modified at the 5' end; the MEB sequence is shown in SEQ ID No. 3.

[0128] 5'-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA G-3' (SEQ ID No. 3).

[0129] In some embodiments, the kit further includes a blocking sequence as shown in SEQ ID No. 4.

[0130] ATAGGCTGCGAAGGCGATAG(SEQ ID No.4)

[0131] In some embodiments, the kit further includes one or more of the following: washing buffer, binding buffer, reaction buffer, blocking buffer, and annealing buffer.

[0132] In some embodiments, the 10X washing buffer comprises: 200 mM HEPES-KOH pH=7.5, 1.5 M NaCl, and 5 mM spermidine.

[0133] In some embodiments, the 10X binding buffer comprises: 200 mM HEPES-KOH pH=7.9, 100 mM KCl, 10 mM CaCl2, and 10 mM MnCl2.

[0134] In some embodiments, the 10X reaction buffer comprises: 200 mM HEPES-KOH pH=7.5, 3 M NaCl, and 5 mM spermidine.

[0135] In some embodiments, the 25X blocking buffer comprises: 50 mM EDTA pH 8.0, 2.5% BSA.

[0136] In some embodiments, the annealing buffer comprises: 10 mM Tris-HCl pH 7.5, 1 mM EDTA, and 100 mM NaCl.

[0137] As a specific example, the components of a chromatin DNA binding mapping sequencing kit include:

[0138] (1) 10X washing buffer (200mM HEPES-KOH pH=7.5, 1.5M NaCl, 5mM spermidine)

[0139] (2) 10X binding buffer (200mM HEPES-KOH pH=7.9, 100mM KCl, 10mM CaCl2, 10mM MnCl2)

[0140] (3) 10X reaction buffer (200mM HEPES-KOH pH=7.5, 3M NaCl, 5mM spermidine)

[0141] (4) Blocked sequence (ATAGGCTGCGAAGGCGATAG, 10 μM aqueous solution)

[0142] (5) 25X blocking buffer (50mM EDTA pH=8.0, 2.5% BSA)

[0143] (6) BAMEA-Tn5 transposase (1:100)

[0144] (7) MEB-Tn5 transposase (1:100)

[0145] (8) Annealing buffer (10mM Tris-HCl pH=7.5, 1mM EDTA, 100mM NaCl)

[0146] In some embodiments, the kit also includes sequencing primers.

[0147] In some embodiments, the Tn5 transposase is replaced by the Tn1, Tn2, Tn3, Tn4, Tn6, Tn7, Tn8, Tn9, or Tn10 transposase.

[0148] This invention also provides the application of the above-described kit in chromatin DNA binding mapping sequencing.

[0149] In some embodiments, the kit is used for tissue samples obtained through clinical pathological biopsy or surgical resection. It is of great significance for clinical research in studying the epigenetic regulatory mechanisms of disease-related cells.

[0150] The reagents used in the embodiments and comparative examples of this invention are sourced from:

[0151] Nucleic acid sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd., Beijing Ruiboxing Biotechnology Co., Ltd., or General Biotech (Anhui) Co., Ltd. Protease inhibitors were purchased from Roche (04693132001), rabbit anti-FOXM1 antibody from CST Biotech (#20459), rabbit isotype control antibody from Abcam (ab172730), and concanavalin A beads, pA / G beads, and Tn5 transposase (naked enzyme) from Suzhou Nearshore Protein Technology Co., Ltd. Example 1: Sequencing of the DNA binding map of human HEK293FT cell transcription factor FOXM1 (FOXM1AptaChC-seq)

[0152] 1. Preparation of FOXM1 BAMEA-Tn5 transposase and MEB-Tn5 transposase

[0153] The following three nucleic acid chains were synthesized using conventional methods and dissolved in annealing buffer (10mM Tris-HCl pH=7.5, 1mM EDTA, 100mM NaCl) to a final concentration of 100μM.

[0154] FOXM1 BAMEA: 5'-Biotin-TCA CTT CAC ACC GCA TCT CTA CGT CCG GTT GCG CTTTCC TTT-TTT TTT TTT T-TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG-3' (5' biotinylated) (SEQ ID No. 6);

[0155] MEB: 5'-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA G-3' (SEQ ID No. 3);

[0156] ME:5'-P-CTG TCT CTT ATA CAC ATC TGA CGC TGC CGA CGA-3'(5' phosphorylation) (SEQ ID No. 2);

[0157] Mix 10 μL of 100 μM FOXM1 BAMEA with 10 μL of 100 μM ME to obtain 20 μL of 50 μM FOXM1BAMEA-Tn5 connector. Mix 10 μL of 100 μM MEB with 10 μL of 100 μM ME to obtain 20 μL of 50 μM MEB-Tn5 connector. Heat both connectors at 95 °C for 5 min, then slowly cool and anneal.

[0158] 20 μL of 50 μM FOXM1 BAMEA-Tn5 adapter was mixed with 100 μL of 10 μM Tn5 transposase, thoroughly mixed, and incubated at room temperature for 1 h to obtain FOXM1 BAMEA-Tn5 transposase. 20 μL of 50 μM MEB-Tn5 adapter was mixed with 100 μL of 10 μM Tn5 transposase, thoroughly mixed, and incubated at room temperature for 1 h to obtain MEB-Tn5 transposase. Both transposases were stored at -20℃ for later use.

[0159] 2. Prepare sword bean protein A magnetic beads.

[0160] The reagent quantities described in the following steps are for 6 samples and can be adjusted proportionally according to the actual number of samples to be tested.

[0161] Dilute 10X binding buffer (200mM HEPES-KOH pH=7.9, 100mM KCl, 10mM CaCl2, 10mM MnCl2) with water to obtain 2mL of 1X binding buffer. Take 60μL of concanavalin A magnetic beads, wash twice with 500μL of 1X binding buffer, and resuspend in 60μL of 1X binding buffer for later use.

[0162] 3. Prepare buffer solution

[0163] Prepare the washing buffer: 750 μL of 10X washing buffer (200 mM HEPES-KOH pH=7.5, 1.5 M NaCl, 5 mM spermidine), 150 μL of 50X protease inhibitor, and 6600 μL of water. Mix well.

[0164] Preparation of permeability blocking buffer: 300 μL washing buffer, 3 μL 5% digitalis saponin, 12 μL 25X blocking buffer (50 mM EDTA pH=8.0, 2.5% BSA), 3 μL 10 μM blocking sequence (ATAGGCTGCGAAGGCGATAG, (SEQ ID No.4) 10 μM aqueous solution).

[0165] Prepare Tn5 reaction solution: 750 μL 10X reaction buffer, 150 μL 50X protease inhibitor, 6600 μL water, 15 μL 5% digitalis saponin, mix well.

[0166] Prepare BAMEA-Tn5 incubation solution: 300 μL Tn5 reaction solution, 6 μL BAMEA-Tn5 transposase, mix well.

[0167] Prepare Tn5 cleavage buffer: 300 μL Tn5 reaction solution, 3 μL 1M MgCl2, mix well.

[0168] 4. Prepare HEK293FT cells

[0169] HEK293FT cells were cultured to a density of 90%, digested with 0.05% trypsin, and resuspended in 500 μL PBS. 72 μL of 4% paraformaldehyde was added, and the cells were crosslinked at room temperature for 5 min. Then, 64 μL of 1.25 M glycine was added, and the cells were incubated at room temperature for 5 min.

[0170] Centrifuge at 1500 rpm for 2 min and remove the supernatant. Add 500 μL of pre-chilled PBS (on ice), centrifuge at 1500 rpm for 2 min, and remove the supernatant. Repeat the washing process twice. Resuspend the cells in 100 μL of washing buffer. Count the cells to determine the cell concentration.

[0171] 5. Sequencing of the DNA binding map of transcription factor FOXM1

[0172] Prepare six 1.5 mL centrifuge tubes, add 5,000 to 100,000 cells to each tube, and then add washing buffer to a total volume of 90 μL. Next, add 10 μL of the prepared concanavalin A magnetic beads to each tube. Gently mix and incubate at room temperature for 10 min.

[0173] Let stand on a magnetic rack for 1 min, remove the supernatant, add 50 μL of the prepared permeation blocking solution to each tube, and incubate at room temperature for 30 min.

[0174] Let stand on a magnetic rack for 1 min, remove the supernatant, add 50 μL of the prepared BAMEA-Tn5 incubation solution to each tube, and incubate at room temperature for 30 min.

[0175] Let the mixture stand on a magnetic rack for 1 minute, then remove the supernatant. Add 500 μL of the prepared Tn5 reaction solution to each tube, let it stand on a magnetic rack for 1 minute, then remove the supernatant. Repeat the washing process once.

[0176] Add 50 μL of Tn5 cleavage buffer to each tube and incubate at 37°C for 30 min. Then add 1 μL of prepared MEB-Tn5 transposase (1:100) and incubate at 37°C for 30 min.

[0177] Add 1 μL of 10% SDS and 5 μL of 20 mg / mL proteinase K to each tube. Incubate at 55°C for 15 min.

[0178] Add 100 μL of water to each tube, then transfer to a Phase Lock tube. Add 150 μL of DNA extraction buffer (phenol:chloroform:isoamyl alcohol = 25:24:1, pH > 7.8), and mix by inverting 20 times. Centrifuge at 15000 rpm for 5 min. Add another 150 μL of chloroform, and mix by inverting 20 times. Centrifuge at 15000 rpm for 5 min.

[0179] Remove the supernatant and transfer it to a new 0.2 mL PCR tube. Add 2 μL of streptavidin magnetic beads to each tube and incubate at room temperature for 20 min.

[0180] Incubate on a magnetic rack for 1 minute, then remove the supernatant. Add 100 μL of the prepared washing solution to each tube, incubate on a magnetic rack for 1 minute, then remove the supernatant. Repeat the washing once. Resuspend in 35 μL of pure water.

[0181] Add 2.5 μL of i5 PCR primer, 2.5 μL of i7 PCR primer, and 10 μL of 5X PCR premix to each tube. Perform PCR according to the following steps: 72℃ for 3 min, 98℃ for 30 s, (98℃ for 15 s, 60℃ for 20 s, 72℃ for 10 s), 16-22 cycles, 72℃ for 2 min, and hold at 12℃.

[0182] i5 PCR primer: 5'-AAT GAT ACG GCG ACC ACC GAG ATC TAC AC NNNNNNNN TCG TCGGCA GCG TC-3' (SEQ ID No.7)

[0183] i7 PCR primer: 5'-CAA GCA GAA GAC GGC ATA CGA GAT NNNNNNNN GTC TCG TGGGCT CGG-3' (SEQ ID No.8)

[0184] Where NNNNNNNN is an 8bp index sequence, and N is any base among A, T, G, and C.

[0185] The constructed library was subjected to next-generation sequencing.

[0186] Comparative Example 1: (Control AptaChC-seq)

[0187] In the Control AptaChC-seq experiment, the Control BAMEA sequence used was:

[0188] 5'-Biotin-TCA TTT TTT TTT TTT TTT TTT TTT TTT TTT GCG CTT TCC TTT-TTTTTT TTT T-TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG-3'(5' biotinylated) (SEQ ID No. 9), used as a control group for FOXM1 BAMEA, contains a nucleic acid aptamer portion that is a nucleic acid sequence with no specific binding ability.

[0189] The other experimental materials and procedures are exactly the same as in Example 1.

[0190] Comparative Example 2: FOXM1 ChIP-seq

[0191] The FOXM1 ChIP-seq experiment was performed according to the procedure reported in the literature (Science, 316(2007) 1497-1502). Briefly, firstly, live cells were cross-linked with 1% formaldehyde to covalently link the protein to its bound DNA fragments; secondly, chromatin was broken up by sonication to release the protein-DNA complex into the solution; then, pA / G magnetic beads conjugated with rabbit anti-FOXM1 antibody were added to the solution for incubation to capture the FOXM1 protein and its bound DNA fragments; next, the captured DNA fragments were purified; finally, a DNA library was prepared and next-generation sequencing was performed.

[0192] Comparative Example 3: Control ChIP-seq

[0193] In the Control ChIP-seq experiment, the antibody used was a rabbit isotype control antibody. Other experimental materials and procedures were exactly the same as in Comparative Example 2.

[0194] Comparative Example 4: ATAC-seq

[0195] The ATAC-seq experiment on the human HEK293FT cell line was performed according to the procedure reported in the literature (Nat Methods, 14(2017) 959-962.). Briefly, the cell nuclei were first extracted; then, Tn5 transposase with adapters was added for incubation, followed by shearing and adapter ligation; then, the obtained DNA fragments were purified and recovered; finally, a DNA library was prepared and next-generation sequencing was performed.

[0196] Figure 6 A visualization map of chromatin enrichment sites for FOXM1 transcription factors, through Figure 6 As can be seen, the signal enrichment sites of AptaChC-seq are all chromatin open sites, and they overlap with the sites obtained by the ChIP-seq method. No enrichment signal was observed in the control groups using Negative IgG or Negative Aptamer. The background signal of AptaChC-seq was lower than that of ChIP-seq.

[0197] Figure 7 To statistically analyze the number of FOXM1 chromatin enrichment sites obtained by different methods, the following methods were used: Figure 7 It can be seen that the number of AptaChC-seq signals is comparable to that of ChIP-seq, but much lower than the number of chromosomal open sites, indicating that the obtained signals are specific.

[0198] Figure 8 Venn diagrams of FOXM1 chromatin enrichment sites obtained by different methods were constructed. Figure 8 As can be seen, AptaChC-seq captured most of the ChIP-seq sites and detected more specific signals.

[0199] Figure 9 Venn diagram of FOXM1 chromatin-rich sites and chromatin-opening sites, through... Figure 9 As can be seen, in the principle of chromatin mapping sequencing based on targeted shearing, chromatin open sites are a potential source of non-specific enrichment signals. AptaChC-seq enrichment signals are located at chromatin open sites, but not all chromatin open sites can generate enrichment signals. This result further illustrates the specificity of the method in the embodiments of the present invention.

[0200] Figure 10 To improve the reproducibility of the FOXM1 AptaChC-seq method, through Figure 10 As can be seen, the Pearson correlation coefficients of the sequencing signals obtained from the three parallel AptaChC-seq experiments are above 0.8, indicating that the reproducibility of the method in this embodiment is good.

[0201] Figure 11 The distribution of FOXM1 transcription factor in different chromatin regions obtained by AptaChC-seq was analyzed by... Figure 11 It can be seen that the FOXM1 transcription factor sequencing signal is mainly concentrated in the promoter region and highly enriched near the transcription start site, which is consistent with expectations and further confirms the correctness of the sequencing results obtained by the method in the embodiments of the present invention.

[0202] Figure 12 To ensure the stability of AptaChC-seq performance based on nucleic acid aptamers, by... Figure 12 As can be seen, there was no significant difference in the sequencing results obtained after BAMEA-Tn5 was placed at room temperature for 3 days. Sequencing results from BAMEA sequences purchased from three different companies also showed no significant differences. This data demonstrates the high reliability of molecular recognition methods based on nucleic acid aptamers.

[0203] In this invention, the terms "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., refer to a specific feature, structure, material, or characteristic described in connection with that embodiment or example, which is included in at least one embodiment or example of the invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0204] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A chromatin-DNA binding mapping sequencing method, characterized in that, The steps include: (1) collecting cells and adding formaldehyde solution to cross-link transcription factors with DNA; (2) Add the activated magnetic beads to the cells for incubation, and then separate and collect the magnetic beads; (3) Add the permeation blocking solution for incubation, and then separate and collect the magnetic beads; (4) Add the solution containing BAMEA-Tn5 transposase but without transposase activator for incubation, and then separate and collect the magnetic beads; (5) After washing the cells, add the buffer containing transposase activator for incubation; (6) Add MEB-Tn5 transposase to the solution in step (5) and continue to incubate the cells; (7) Use streptavidin magnetic beads to recover the enzyme-digested fragments; (8) PCR library construction and next-generation sequencing; among which, The BAMEA-Tn5 transposase is constructed by adding a nucleic acid aptamer sequence that specifically recognizes the transcription factor to the 5' end of the linker sequence of the Tn5 transposase, with a modifying group at the 5' end; the MEB-Tn5 transposase is a Tn5 transposase containing a conventional linker sequence at the 5' end. The BAMEA-Tn5 transposase is obtained by incubating an equimolar mixture of the BAMEA-Tn5 adapter sequence and the Tn5 transposase. The BAMEA-Tn5 adapter sequence is formed by annealing and hybridizing equimolar amounts of the BAMEA and ME sequences. The ME sequence is shown in SEQ ID No. 2, and the BAMEA sequence has the structure 5'-BAL-MEA-3', where B is biotin, A is a nucleic acid aptamer sequence, and L is a linker arm. The MEA sequence is shown in SEQ ID No.

1. The MEB-Tn5 transposase is obtained by incubating an equimolar mixture of the MEB-Tn5 adapter sequence and the Tn5 transposase; wherein the MEB-Tn5 adapter sequence is formed by annealing and hybridizing an equimolar mixture of the MEB sequence and the ME sequence, wherein the ME sequence is shown in SEQ ID No. 2 and the MEB sequence is shown in SEQ ID No.

3.

2. The chromatin DNA binding mapping sequencing method according to claim 1, characterized in that, The nucleic acid aptamer sequence is a DNA sequence that can specifically bind to the transcription factor in the cell in situ, with a binding force Kd value of less than 100 nM.

3. The chromatin-DNA binding mapping sequencing method according to claim 1, characterized in that, The connecting arm is T. 10 One of the following: nucleic acid, C6 adapter, C12 adapter, S9 adapter, and S18 adapter.

4. The chromatin DNA binding map sequencing method according to claim 1, characterized in that, The magnetic beads are concanavalin A magnetic beads; And / or, the permeable sealing solution is a solution containing digitalis saponins, bovine serum albumin, and random single-stranded nucleic acids; And / or, the transposase activator is a divalent metal ion.

5. The chromatin-DNA binding mapping sequencing method according to claim 4, characterized in that, The transposase activator is Mg 2+ .

6. The chromatin DNA binding map sequencing method according to claim 1, characterized in that, Step (1) is as follows: Collect cells, crosslink them with 0.1%-0.5% formaldehyde for 5 min, neutralize them with 0.125M glycine for 5 min to crosslink the transcription factors with DNA, and then wash them 3 times with PBS buffer to remove the residual formaldehyde and glycine. And / or, the cell incubation temperature in step (3) is 4-25℃ and the time is 30min; And / or, the cell incubation temperature in step (4) is 4-25℃ and the time is 30min; And / or, the cell incubation temperature in step (5) is 37°C and the time is 30 min; And / or, the cell incubation temperature in step (6) is 37°C and the time is 30 min.

7. A reagent kit, characterized in that, include: BAMEA-Tn5 transposase; and MEB-Tn5 transposase, among which The BAMEA-Tn5 transposase is constructed by adding a nucleic acid aptamer sequence that specifically recognizes the transcription factor to the 5' end of the linker sequence of the Tn5 transposase, with a modifying group at the 5' end; and... The MEB-Tn5 transposase is a Tn5 transposase containing a conventional linker sequence at its 5' end. in: The BAMEA-Tn5 transposase is obtained by incubating an equimolar mixture of the BAMEA-Tn5 adapter sequence and the Tn5 transposase. The BAMEA-Tn5 adapter sequence is formed by annealing and hybridizing equimolar amounts of the BAMEA and ME sequences. The ME sequence is shown in SEQ ID No. 2, and the BAMEA sequence has the structure 5'-BAL-MEA-3', where B is biotin, A is a nucleic acid aptamer sequence, and L is a linker arm. The MEA sequence is shown in SEQ ID No.

1. The MEB-Tn5 transposase is obtained by incubating an equimolar mixture of the MEB-Tn5 adapter sequence and the Tn5 transposase; wherein the MEB-Tn5 adapter sequence is formed by annealing and hybridizing an equimolar mixture of the MEB sequence and the ME sequence, wherein the ME sequence is shown in SEQ ID No. 2 and the MEB sequence is shown in SEQ ID No.

3.

8. The reagent kit according to claim 7, characterized in that, The nucleic acid aptamer sequence is a DNA sequence that can specifically bind to the transcription factor in the cell in situ, with a binding force Kd value of less than 100 nM.

9. A reagent kit according to claim 7, characterized in that, The connecting arm is T. 10 One of the following: nucleic acid, C6 adapter, C12 adapter, S9 adapter, and S18 adapter.

10. A reagent kit according to claim 7, characterized in that, The kit also includes a blocking sequence, as shown in SEQ ID No.

4.

11. A reagent kit according to any one of claims 7-10, characterized in that, The kit also includes one or more of the following: washing buffer, binding buffer, reaction buffer, blocking buffer, and annealing buffer.

12. A reagent kit according to claim 11, characterized in that, The 10X wash buffer consists of: 200 mM MEPES-KOH pH=7.5, 1.5 M NaCl, and 5 mM spermidine; And / or, the 10X binding buffer comprises: 200 mM HEPES-KOH pH 7.9, 100 mM KCl, 10 mM CaCl2, and 10 mM MnCl2; And / or, the 10X reaction buffer comprises: 200 mM HEPES-KOH pH=7.5, 3 M NaCl, and 5 mM spermidine; And / or, the 25X blocking buffer comprises: 50 mM EDTA pH 8.0, 2.5% BSA; And / or, the annealing buffer comprises: 10 mM Tris-HCl pH 7.5, 1 mM EDTA, and 100 mM NaCl.

13. A reagent kit according to claim 12, characterized in that, The kit also includes sequencing primers.

14. The application of the kit according to any one of claims 7-13 in chromatin DNA binding mapping sequencing.

Citation Information

Patent Citations

  • Composition and method for genome editing

    WO2022269037A1

  • Method of preparing DNA from formalin-fixed-paraffin-embedded (FFPE) tissue samples

    WO2023277763A1