A method for producing deoxythymidine triphosphate by a recombinant strain

By modifying Escherichia coli using CRISPR/Cas9 gene editing technology to construct recombinant strains, the problem of low synthesis efficiency of deoxynucleoside triphosphates was solved, achieving high yield and high purity of deoxythymidine triphosphate production.

CN116287066BActive Publication Date: 2026-04-14NANJING YOUWEI BIOPHARMA CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211727940.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-30
Publication Date
2026-04-14
Estimated Expiration
2042-12-30

AI Technical Summary

Technical Problem

In the existing technology, the chemical synthesis methods of deoxynucleoside triphosphates (dNTPs) have problems such as long reaction time, low yield, and insufficient precision in microbial cell modification, which leads to unsatisfactory product yield.

Method used

CRISPR/Cas9-mediated gene editing was used to directionally modify Escherichia coli by knocking out nucleoside triphosphate pyrophosphatase, nucleotidase, and nucleotidase genes, and integrating endogenous thymidine kinase and dTMP kinase genes to construct a recombinant strain for producing deoxythymidine triphosphate.

Benefits of technology

It has achieved efficient production of deoxythymidine triphosphate with a conversion rate of 80% to 90% and a purity of up to 99%, providing an economical and environmentally friendly solution for industry and research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116287066B_ABST
    Figure CN116287066B_ABST
Patent Text Reader

Abstract

The application discloses a method for producing deoxythymidine triphosphate by using a recombinant strain, and comprises the following steps: step 1: using a CRISPR / Cas9-mediated gene editing method to perform targeted modification on an E. coli genome, and the targeted modification comprises the following contents: a. knocking out a nucleoside triphosphate pyrophosphatase gene (mazG / yhdE) to block a path of degrading dTTP into dTMP; b. knocking out a nucleotide nucleosidase gene (ppnN) to block a path of degrading dTMP into thymine; and c. knocking out a nucleotidase gene (yfbR / yfdR / ushA / umpH / umpG / yjjG) to block a path of degrading dTMP into dT. The application provides a method for producing deoxythymidine triphosphate by using a recombinant strain, and the conversion rate of the method reaches 80% to 90%, and after ion exchange chromatography purification, the purity can reach more than 99%.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a method for producing deoxythymidine triphosphate by a recombinant strain. Background Technology

[0002] Nucleosides and their derivatives play important roles in cellular metabolism and are widely used in medicine, food, and scientific research. Among them, deoxynucleoside-5′-triphosphates (dNTPs) are crucial precursors in DNA synthesis and indispensable reagents in molecular biology research. Polymerase chain reaction (PCR) and other PCR applications for DNA synthesis require deoxynucleoside triphosphates (dNTPs) as essential precursors and substrates. There are four types of dNTPs: deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), and deoxythymidine triphosphate (dTTP). Due to the increasing use of PCR in DNA biosynthesis by the biotechnology research and industry, the demand for dNTPs is steadily increasing.

[0003] Traditionally, dNTPs are chemically synthesized. For example, in a solvent, deoxynucleosides are directly phosphorylated by phosphorus oxychloride (POCl3) to generate the corresponding deoxynucleotides. Many deoxynucleotide derivatives have been synthesized by this method. However, chemical synthesis presents several challenges, such as long reaction times and low yields. Furthermore, a major drawback is the lack of a universal method applicable to all nucleosides and the cumbersome purification protocols.

[0004] Patent CN1269422A discloses a method for preparing deoxyribonucleoside triphosphates (dNTPs) using natural DNA as a raw material through enzymatic hydrolysis-enzymatic catalysis-chemical synthesis, achieving an overall yield of 45-80%. However, the availability and cost of natural DNA, the purification cost of byproducts from the chemical reaction, and yield stability are limiting factors. Using whole microbial cells (such as yeast or E. coli) as direct biocatalysts can avoid expensive protein purification processes. However, due to the presence of various enzymes in the cell, such reactions are uncontrollable, and product yields are not ideal. However, by directionally modifying the genes of microbial cells to overexpress key enzymes for synthesizing specific products, the reaction can be effectively controlled, resulting in stable yields.

[0005] For the reasons mentioned above, the inventors have provided a method for producing deoxythymidine triphosphate using recombinant strains. Summary of the Invention

[0006] 1. The technical problem to be solved:

[0007] To address the aforementioned technical problems, this invention provides a method for producing deoxythymidine triphosphate using recombinant strains.

[0008] 2. Technical Solution:

[0009] A method for producing deoxythymidine triphosphate by a recombinant strain includes the following steps:

[0010] Step 1: The *E. coli* genome was targeted using CRISPR / Cas9-mediated gene editing. This targeted modification included: a. Knocking out the nucleoside triphosphate pyrophosphatase gene (mazG / yhdE) to block the degradation of dTTP to dTMP; b. Knocking out the nucleotidase gene (ppnN) to block the degradation of dTMP to thymine; c. Knocking out the nucleotidase genes (yfbR / yfdR / ushA / umpH / umpG / yjjG) to block the degradation of dTMP to dT; d. Integrating the endogenous *E. coli* thymidine kinase gene tdk at the pseudogene site mbhA to enhance the phosphorylation pathway of dT; e. Integrating the endogenous *E. coli* dTMP kinase gene tmk at the pseudogene site yeeP to enhance the phosphorylation pathway of dTMP.

[0011] Step 2: Using deoxythymidine as the starting substrate, deoxythymidine triphosphate is produced by fermentation with genetically modified Escherichia coli.

[0012] Furthermore, the gene sequence of the thymidine kinase gene tdk is as follows:

[0013] 1ATGGCACAGCTATATTTCTACTATTCCGCAATGAATGCGGGTAAGTCTACAGCATTGTTG

[0014] 61CAATCTTCATACAATTACCAGGAACGCGGCATGCGCACTGTCGTATATACGGCAGAAATT

[0015] 121GATGATCGCTTTGGTGCCGGGAAAGTCAGTTCGCGTATAGGTTTGTCATCGCCTGCAAAA

[0016] 181TTATTTAACCAAAATTCATCATTATTTGATGAGATTCGTGCGGAACATGAACAGCAGGCA

[0017] 241ATTCATTGCGTACTGGTTGATGAATGCCAGTTTTTAACCAGACAACAAGTATATGAATTA

[0018] 301TCGGAGGTTGTCGATCAACTCGATATACCCGTACTTTGTTATGGGTACCGATTTT

[0019] 361CGAGGTGAATTATTTATTGGCAGCCAATACTTACTGGCATGGTCCGACAAACTGGTTGAA

[0020] 421TTAAAAACCATCTGTTTTTGTGGCCGTAAAGCAAGCATGGTGCTGCGTCTTGATCAAGCA

[0021] 481GGCAGACCTTATAACGAAGGTGAGCAGGTGGTAATTGGTGGTAATGAACGATACGTTTCT

[0022] 541GTATGCCGTAAACACTATAAAGAGGCGTTACAAGTCGACTCATTAACGGCTATTCAGGAA

[0023] 601AGGCATCGCCACGATTAA。

[0024] Furthermore, the gene sequence of the dTMP kinase gene tmk is as follows:

[0025] 1ATGCGCAGTAAGTATATCGTCATTGAGGGGCTGGAAGGCGCAGGCAAAACTACCGCGCGT

[0026] 61AATGTGGTGGTTGAGACGCTCGAGCAACTGGGTATCCGCGACATGGTTTTCACTCGGGAA

[0027] 121CCTGGCGGTACGCAACTTGCCGAAAAGTTAAGAAGCCTGGTGCTGGATATCAAATCGGTA

[0028] 181GGCGATGAAGTCATTACCGATAAAGCCGAAGTTCTGATGTTTTATGCCGCGCGCGTTCAA

[0029] 241CTGGTAGAAACGGTCATCAAACCAGCTCTGGCTAACGGCACCTGGGTGATTGGCGATCGC

[0030] 301CACGATCTCTCCACTCAGGCGTATCAGGGCGGCGGACGTGGTATTGACCAACATATGCTG

[0031] 361GCAACACTGCGTGATGCTGTTCTCGGGGATTTTCGCCCCGACTTAACGCTCTATCTCGAT

[0032] 421GTTACCCCGGAAGTTGGCTTAAAACGCGCGCGTGCGCGCGGCGAGCTGGATCGTATTGAG

[0033] 481CAAGAATCTTTCGATTTCTTTAATCGCACCCGCGCCCGCTATCTGGAACTGGCAGCACAA

[0034] 541GATAAAAGCATTCATACCATTGATGCCACCCAGCCGCTGGAGGCCGTGATGGATGCAATC

[0035] 601CGCACTACCGTGACCCACTGGGTGAAGGAGTTGGACGCATGA.

[0036] Furthermore, the plasmids used in the CRISPR / Cas9-mediated gene editing method are pTarget and pCas9, respectively. pCas carries the pTarget elimination system, the λ phage Red recombination system, and the Cas9 protein expression system. pTarget contains an sgRNA sequence, an N20 sequence, and a donor DNA fragment.

[0037] Furthermore, in step 1, the nucleoside triphosphate pyrophosphatase gene (mazG / yhdE), nucleotide nuclease gene (ppnN), and nuclease gene (yfbR / yfdR / ushA / umpH / umpG / yjjG) are knocked out through the following steps:

[0038] S1: Based on the corresponding gene sequence to be knocked out, use the tool CRISPRRGENTools to select the target sequence (PAM:5'-NGG-3') and design the N20 sequence;

[0039] S2: Construct the plasmid vector according to the instructions of the kit, and use gene synthesis methods to synthesize the sgRNA expression cassette and recombinant fragment containing the N20 sequence;

[0040] S3: After gene synthesis, the PCR product - sgRNA fragment is amplified using primers provided by the plasmid vector kit. The sgRNA fragment is ligated into the pTarget plasmid to obtain the gene editing plasmid pTarget-X, where X is the gene to be knocked out. pTarget-X is electroporated into competent cells from the previous modification stage, and single colonies are obtained by revival culture. Positive recombinants are obtained by PCR colony verification.

[0041] S4: Cultivate positive strains expressing sgRNA, prepare electrotransformation competent cells, electrotransform the pCas9 plasmid into the electrotransformation competent cells, revive and culture to obtain single colonies, and verify the positive recombinants by PCR colony verification; then sequentially remove the gene editing plasmids pTarget-X and pCas9.

[0042] Furthermore, the steps for integrating the endogenous thymidine kinase gene tdk from E. coli at the pseudogene site mbhA are as follows:

[0043] S1: Based on the mbhA gene sequence, the target sequence (PAM:5'-NGG-3') was selected using the CRISPRRGENTools tool, and the N20 sequence was designed;

[0044] S2: Construct according to the instructions of the plasmid vector kit. First, use gene synthesis methods to synthesize the sgRNA expression cassette containing the N20 sequence and the recombinant endogenous tdk sequence.

[0045] S3: After gene synthesis, the PCR product -sgRNA-tdk fragment was amplified using the primers provided in the kit. Then, the sgRNA-tdk fragment was ligated into the pTarget plasmid. The pTarget-mbhA-tdk was electroporated into competent cells from the previous modification stage. Single colonies were obtained by revival culture and positive recombinants were obtained by PCR colony verification.

[0046] S4: Cultivate positive strains expressing sgRNA, prepare electrotransformation competent cells, electrotransform the pCas9 plasmid into the electrotransformation competent cells, revive and culture to obtain single colonies, and verify the positive recombinants by PCR colony verification; then sequentially remove the gene editing plasmids pTarget-mbhA-tdk and pCas9.

[0047] Furthermore, the steps involved in integrating the endogenous dTMP kinase gene tmk from the pseudogene site yeeP are as follows:

[0048] S1: Based on the yeeP gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the CRISPRRGENTools tool, and the N20 sequence was designed;

[0049] S2: Construct according to the instructions of the plasmid vector kit. First, use gene synthesis methods to synthesize the sgRNA expression cassette containing the N20 sequence and the recombinant endogenous tmk sequence.

[0050] S3: After gene synthesis, the PCR product -sgRNA-tmk fragment was amplified using the primers provided in the kit. Then, the sgRNA-tmk fragment was ligated into the pTarget plasmid. The pTarget-yeeP-tmk was electroporated into competent cells after the previous modification stage. Single colonies were obtained by revival culture and positive recombinants were obtained by PCR colony verification.

[0051] S4: Cultivate positive strains expressing sgRNA, prepare electrotransformation competent cells, electrotransform the pCas9 plasmid into the electrotransformation competent cells, revive and culture to obtain single colonies, and verify the positive recombinants by PCR colony verification; then sequentially remove the gene editing plasmids pTarget-yeeP-tmk and pCas9.

[0052] Further, the operation method of step 2 is as follows: the genetically modified Escherichia coli strain is inoculated into a seed culture medium and cultured to a secondary seed culture using the seed expansion culture method; the seed culture is inoculated into a fermentation culture medium containing nutrients and the starting substrate deoxythymidine at an inoculation rate of 10-15% to start fermentation culture; the initial pH of fermentation is controlled at 7.0±0.2, and after 8-10 hours of fermentation, the pH is maintained at 6.55±0.1 by adding ammonia water; after 12 hours of fermentation, feedback control is started to add nutrients and the starting substrate deoxythymidine; the dissolved oxygen is controlled at 30-40% and the temperature is controlled at 37℃ throughout the process, and the fermentation cycle is 36 hours.

[0053] 3. Beneficial effects:

[0054] This invention provides a method for producing deoxythymidine triphosphate (DTPP) using a recombinant strain. This method utilizes CRISPR / Cas9-mediated genome editing to perform a series of metabolic engineering modifications on *E. coli*. By knocking out the genes for nucleoside triphosphate pyrophosphatase, nucleotidase, and nucleotidase, the enzymes related to the degradation pathway of DTPP and its precursors are blocked. By integrating endogenous *E. coli* thymidine kinase and dTMP kinase genes and overexpressing key enzymes in the synthesis pathway, the synthesis of DTPP is promoted, thus constructing a high-yield DTPP strain. By knocking out enzymes related to the degradation pathway and overexpressing key enzymes in the synthesis pathway (tdk / tmk), a recombinant strain is constructed to obtain the metabolic pathway. The first step uses deoxythymidine as the starting substrate and converts it to dTMP through tdk catalysis. The second step uses tmk catalysis to convert dTMP to dTDP. Finally, the recombinant strain produces deoxythymidine triphosphate through its own phosphokinase, achieving a conversion rate of 80% to 90%. After purification by ion exchange chromatography, the purity can reach over 99%, providing an economically competitive and environmentally friendly feasible technology for industry and research. Attached Figure Description

[0055] Figure 1 The metabolic pathway of the strain after gene-directed modification in Example 1 is shown. Detailed Implementation

[0056] The present invention will now be described in detail with reference to the accompanying drawings.

[0057] Example 1

[0058] Construction of strains producing high levels of deoxythymidine triphosphate

[0059] The genome of *E. coli* was targetedly modified using CRISPR / Cas9-mediated gene editing methods. The targeted modification included the following:

[0060] a. Knock out the nucleoside triphosphate pyrophosphatase gene (mazG / yhdE) to block the pathway of dTTP degradation to dTMP;

[0061] b. Knock out the nucleoside nuclease gene (ppnN) to block the pathway of dTMP degradation into thymine;

[0062] c. Knock out nuclease genes (yfbR / yfdR / ushA / umpH / umpG / yjjG) to block the pathway of dTMP degradation to dT;

[0063] d. The endogenous thymidine kinase gene tdk in E. coli is integrated at the pseudogene site mbhA, enhancing the phosphorylation pathway of dT;

[0064] e. At the pseudogene site yeeP, the endogenous dTMP kinase gene tmk in E. coli is integrated, thereby enhancing the phosphorylation pathway of dTMP.

[0065] The metabolic pathways of the genetically engineered strains are as follows: Figure 1 As shown.

[0066] The gene sequence of the thymidine kinase gene tdk is as follows:

[0067] 1ATGGCACAGCTATATTTCTACTATTCCGCAATGAATGCGGGTAAGTCTACAGCATTGTTG

[0068] 61CAATCTTCATACAATTACCAGGAACGCGGCATGCGCACTGTCGTATATACGGCAGAAATT

[0069] 121GATGATCGCTTTGGTGCCGGGAAAGTCAGTTCGCGTATAGGTTTGTCATCGCCTGCAAAA

[0070] 181TTATTTAACCAAAATTCATCATTATTTGATGAGATTCGTGCGGAACATGAACAGCAGGCA

[0071] 241ATTCATTGCGTACTGGTTGATGAATGCCAGTTTTTAACCAGACAACAAGTATATGAATTA

[0072] 301TCGGAGGTTGTCGATCAACTCGATATACCCGTACTTTGTTATGGTTTACGTACCGATTTT

[0073] 361CGAGGTGAATTATTTATTGGCAGCCAATACTTACTGGCATGGTCCGACAAACTGGTTGAA

[0074] 421TTAAAAACCCATCTGTTTTTGTGGCCGTAAAGCAAGCATGGTGCTGCGTCTTGATCAAGCA

[0075] 481GGCAGACCTTATAACGAAGGTGAGCAGGTGGTAATTGGTGGTAATGAACGATACGTTTTCT

[0076] 541GTATGCCGTAAACACTATAAAGAGGCGTTACAAGTCGACTCATTAACGGCTATTCAGGAA

[0077] 601AGGCATCGCCACGATTAA。

[0078] The gene sequence of the dTMP kinase gene tmk is as follows:

[0079] 1ATGCGCAGTAAGTATATCGTCATTGAGGGGCTGGAAGGCGCAGGCAAAACTACCGCGCGT

[0080] 61AATGTGGTGGTTGAGACGCTCGAGCAACTGGGTATCCGCGACATGGTTTTCACTCGGGAA

[0081] 121CCTGGCGGTACGCAACTTGCCGAAAAGTTAAGAAGCCTGGTGCTGGATATCAAATCGGTA

[0082] 181GGCGATGAAGTCATTACCGATAAAGCCGAAGTTCTGATGTTTTATGCCGCGCGCGTTCAA

[0083] 241CTGGTAGAAACGGTCATCAAACCAGCTCTGGCTAACGGCACCTGGGTGATTGGCGATCGC

[0084] 301CACGATCTCTCCACTCAGGCGTATCAGGGCGGCGGACGTGGTATTGACCAACATATGCTG

[0085] 361GCAACACTGCGTGATGCTGTTCTCGGGGATTTTCGCCCCGACTTAACGCTCTATCTCGAT

[0086] 421GTTACCCCGGAAGTTGGCTTAAAACGCGCGCGTGCGCGCGGCGAGCTGGATCGTATTGAG

[0087] 481CAAGAATCTTTCGATTTCTTTAATCGCACCCGCGCCCGCTATCTGGAACTGGCAGCACAA

[0088] 541GATAAAAGCATTCATACCATTGATGCCACCCAGCCGCTGGAGGCCGTGATGGATGCAATC

[0089] 601CGCACTACCGTGACCCACTGGGTGAAGGAGTTGGACGCATGA.

[0090] This invention employs a CRISPR / Cas9-mediated genome editing method to construct engineered strains. The plasmids used in this method are pTarget and pCas9, where pCas carries the pTarget elimination system, the λ phage Red recombination system, and the Cas9 protein expression system; pTarget contains an sgRNA sequence, an N20 sequence, and a donor DNA fragment.

[0091] The specific modification process is as follows:

[0092] a1) mazG gene knockout

[0093] Based on the mazG gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the CRISPRRGEN Tools tool, and the N20 sequence was designed. Following the plasmid vector kit instructions, the sgRNA expression cassette and recombinant fragment containing the N20 sequence were first synthesized using gene synthesis methods. After gene synthesis, the PCR product—the sgRNA fragment—was amplified using primers provided in the kit. The sgRNA fragment was then ligated into the pTarget plasmid. pTarget-mazG was electroporated into competent *E. coli* cells, and single colonies were obtained through resuscitation culture. Positive recombinants were confirmed by PCR colony verification. The positive strain expressing sgRNA was cultured, and electroporation competent cells were prepared. The pCas9 plasmid was electroporated into the competent cells, and single colonies were obtained through resuscitation culture. Positive recombinants were confirmed by PCR colony verification. Finally, the gene editing plasmids pTarget-mazG and pCas9 were sequentially removed, resulting in strain TT1.

[0094] a2) yhdE gene knockout

[0095] Based on the yhdE gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the CRISPRRGEN Tools tool, and the N20 sequence was designed. Following the plasmid vector kit instructions, the sgRNA expression cassette and recombinant fragment containing the N20 sequence were first synthesized using gene synthesis methods. After gene synthesis, the PCR product—the sgRNA fragment—was amplified using primers provided in the kit. The sgRNA fragment was then ligated into the pTarget plasmid. pTarget-yhdE was electroporated into TT1 competent cells, and single colonies were obtained through resuscitation culture. Positive recombinants were confirmed by PCR colony verification. The positive strain expressing sgRNA was cultured, and electroporation competent cells were prepared. The pCas9 plasmid was electroporated into the competent cells, and single colonies were obtained through resuscitation culture. Positive recombinants were confirmed by PCR colony verification. Finally, the gene editing plasmids pTarget-yhdE and pCas9 were sequentially removed, resulting in strain TT2.

[0096] b) ppnN gene knockout

[0097] Based on the ppnN gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the CRISPRRGEN Tools tool, and the N20 sequence was designed. Following the plasmid vector kit instructions, the sgRNA expression cassette and recombinant fragment containing the N20 sequence were first synthesized using gene synthesis methods. After gene synthesis, the PCR product—the sgRNA fragment—was amplified using primers provided in the kit. The sgRNA fragment was then ligated into the pTarget plasmid. pTarget-ppnN was electroporated into TT2 competent cells, and single colonies were obtained through resuscitation culture. Positive recombinants were confirmed by PCR colony verification. The positive strain expressing sgRNA was cultured, and electroporation competent cells were prepared. The pCas9 plasmid was electroporated into the competent cells, and single colonies were obtained through resuscitation culture. Positive recombinants were confirmed by PCR colony verification. Finally, the gene editing plasmids pTarget-ppnN and pCas9 were sequentially removed, resulting in strain TT3.

[0098] c1) yfbR gene knockout

[0099] Based on the yfbR gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the CRISPRRGEN Tools tool, and the N20 sequence was designed. Following the plasmid vector kit instructions, the sgRNA expression cassette and recombinant fragment containing the N20 sequence were first synthesized using gene synthesis methods. After gene synthesis, the PCR product—the sgRNA fragment—was amplified using primers provided in the kit. The sgRNA fragment was then ligated into the pTarget plasmid. pTarget-yfbR was electroporated into TT3 competent cells, and after resuscitation and culture, single colonies were obtained. Positive recombinants were confirmed by PCR colony verification. The positive strain expressing sgRNA was cultured, and electroporation competent cells were prepared. The pCas9 plasmid was electroporated into the competent cells, and after resuscitation and culture, single colonies were obtained. Positive recombinants were confirmed by PCR colony verification. Finally, the gene editing plasmids pTarget-yfbR and pCas9 were sequentially removed, resulting in strain TT4.

[0100] c2) yfdR gene knockout

[0101] Based on the yfdR gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the CRISPRRGEN Tools tool, and the N20 sequence was designed. Following the plasmid vector kit instructions, the sgRNA expression cassette and recombinant fragment containing the N20 sequence were first synthesized using gene synthesis methods. After gene synthesis, the PCR product—the sgRNA fragment—was amplified using primers provided in the kit. The sgRNA fragment was then ligated into the pTarget plasmid. pTarget-yfdR was electroporated into TT4 competent cells, and after resuscitation and culture, single colonies were obtained. Positive recombinants were confirmed by PCR colony verification. The positive strain expressing sgRNA was cultured, and electroporation competent cells were prepared. The pCas9 plasmid was electroporated into the competent cells, and after resuscitation and culture, single colonies were obtained. Positive recombinants were confirmed by PCR colony verification. Finally, the gene editing plasmids pTarget-yfdR and pCas9 were sequentially removed, resulting in strain TT5.

[0102] c3) ushA gene knockout

[0103] Based on the ushA gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the CRISPRRGEN Tools tool, and the N20 sequence was designed. Following the plasmid vector kit instructions, the sgRNA expression cassette and recombinant fragment containing the N20 sequence were first synthesized using gene synthesis methods. After gene synthesis, the PCR product—the sgRNA fragment—was amplified using primers provided in the kit. The sgRNA fragment was then ligated into the pTarget plasmid. pTarget-ushA was electroporated into TT5 competent cells, and single colonies were obtained through resuscitation culture. Positive recombinants were confirmed by PCR colony verification. The positive strain expressing sgRNA was cultured, and electroporation competent cells were prepared. The pCas9 plasmid was electroporated into the competent cells, and single colonies were obtained through resuscitation culture. Positive recombinants were confirmed by PCR colony verification. Finally, the gene editing plasmids pTarget-ushA and pCas9 were sequentially removed, resulting in strain TT6.

[0104] c4) umpH gene knockout

[0105] Based on the umpH gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the CRISPRRGEN Tools tool, and the N20 sequence was designed. Following the plasmid vector kit instructions, the sgRNA expression cassette and recombinant fragment containing the N20 sequence were first synthesized using gene synthesis methods. After gene synthesis, the PCR product—the sgRNA fragment—was amplified using primers provided in the kit. The sgRNA fragment was then ligated into the pTarget plasmid. pTarget-umpH was electroporated into TT6 competent cells, and after resuscitation and culture, single colonies were obtained. Positive recombinants were confirmed by PCR colony verification. The positive strain expressing sgRNA was cultured, and electroporation competent cells were prepared. The pCas9 plasmid was electroporated into the competent cells, and after resuscitation and culture, single colonies were obtained. Positive recombinants were confirmed by PCR colony verification. Finally, the gene editing plasmids pTarget-umpH and pCas9 were sequentially removed, resulting in strain TT7.

[0106] c5) umpG gene knockout

[0107] Based on the umpG gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the CRISPRRGEN Tools tool, and the N20 sequence was designed. Following the plasmid vector kit instructions, the sgRNA expression cassette and recombinant fragment containing the N20 sequence were first synthesized using gene synthesis methods. After gene synthesis, the PCR product—the sgRNA fragment—was amplified using primers provided in the kit. The sgRNA fragment was then ligated into the pTarget plasmid. pTarget-umpG was electroporated into TT7 competent cells, and single colonies were obtained through resuscitation culture. Positive recombinants were confirmed by PCR colony verification. The positive strain expressing sgRNA was cultured, and electroporation competent cells were prepared. The pCas9 plasmid was electroporated into the competent cells, and single colonies were obtained through resuscitation culture. Positive recombinants were confirmed by PCR colony verification. Finally, the gene editing plasmids pTarget-umpG and pCas9 were sequentially removed, resulting in strain TT8.

[0108] c6) yjjG gene knockout

[0109] Based on the yjjG gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the CRISPRRGEN Tools tool, and the N20 sequence was designed. Following the plasmid vector kit instructions, the sgRNA expression cassette and recombinant fragment containing the N20 sequence were first synthesized using gene synthesis methods. After gene synthesis, the PCR product—the sgRNA fragment—was amplified using primers provided in the kit. The sgRNA fragment was then ligated into the pTarget plasmid. pTarget-yjjG was electroporated into TT8 competent cells, and after resuscitation and culture, single colonies were obtained. Positive recombinants were confirmed by PCR colony verification. The positive strain expressing sgRNA was cultured, and electroporation competent cells were prepared. The pCas9 plasmid was electroporated into the competent cells, and after resuscitation and culture, single colonies were obtained. Positive recombinants were confirmed by PCR colony verification. Finally, the gene editing plasmids pTarget-yjjG and pCas9 were sequentially removed, resulting in strain TT9.

[0110] d) Integration of the tdk gene at the mbhA site

[0111] Based on the mbhA gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the CRISPRRGEN Tools tool, and the N20 sequence was designed. Following the plasmid vector kit instructions, the sgRNA expression cassette containing the N20 sequence and the recombinant endogenous tdk sequence were first synthesized using gene synthesis methods. After gene synthesis, the PCR product -sgRNA-tdk fragment was amplified using primers provided in the kit. Then, the sgRNA-tdk fragment was ligated into the pTarget plasmid. pTarget-mbhA-tdk was electroporated into TT9 competent cells, and after resuscitation and culture, single colonies were obtained. Positive recombinants were confirmed by PCR colony verification. The positive strain expressing sgRNA was cultured, and electroporation competent cells were prepared. The pCas9 plasmid was electroporated into the competent cells, and after resuscitation and culture, single colonies were obtained. Positive recombinants were confirmed by PCR colony verification. Finally, the gene editing plasmids pTarget-mbhA-tdk and pCas9 were sequentially removed, resulting in strain TT10.

[0112] e) Integration of the tmk gene at the yeeP site

[0113] Based on the yeeP gene sequence, the target sequence (PAM: 5'-NGG-3') was selected using the CRISPRRGEN Tools tool, and the N20 sequence was designed. Following the plasmid vector kit instructions, the sgRNA expression cassette containing the N20 sequence and the recombinant endogenous tmk sequence were first synthesized using gene synthesis methods. After gene synthesis, the PCR product - sgRNA-tmk fragment was amplified using primers provided in the kit. Then, the sgRNA-tmk fragment was ligated into the pTarget plasmid. pTarget-yeeP-tmk was electroporated into TT10 competent cells, and after resuscitation and culture, single colonies were obtained. Positive recombinants were confirmed by PCR colony verification. The positive strain expressing sgRNA was cultured, and electroporation competent cells were prepared. The pCas9 plasmid was electroporated into the competent cells, and after resuscitation and culture, single colonies were obtained. Positive recombinants were confirmed by PCR colony verification. Finally, the gene editing plasmids pTarget-yeeP-tmk and pCas9 were sequentially removed, resulting in strain TT11.

[0114] Example 2

[0115] Deoxythymidine triphosphate (dTTP) was produced by fermentation using strain TT11.

[0116] Take the seed from the glycerol preservation tube (strain TT11) and inoculate it into the seed culture medium. Incubate overnight at 37℃ and 200 rpm for primary seed culture. Take the primary seed liquid and inoculate it into the seed culture medium. Incubate at 37℃ and 200 rpm for 8-10 hours for secondary seed expansion culture. Seed culture was inoculated at a rate of 10-15% into a fermentation medium containing nutrients and the starting substrate deoxythymidine. Fermentation was initiated, with the initial pH controlled at 7.0±0.2. After 8-10 hours of fermentation, ammonia was added to maintain the pH at 6.55±0.1. After 12 hours of fermentation, feedback control was initiated to add nutrients and the starting substrate deoxythymidine. Dissolved oxygen was maintained at 30-40% throughout the process, and the feeding was started and stopped based on dissolved oxygen feedback. The starting substrate deoxythymidine was added in two batches at 12 and 24 hours. The temperature was maintained at 37℃ throughout the process, and the fermentation cycle was 36 hours. Under these conditions, the product yield reached 61.45 g / L, with a conversion rate of 81.1%. After purification by ion exchange chromatography, the purity reached over 99%.

[0117] Example 3

[0118] Deoxythymidine triphosphate (dTTP) was produced by fermentation using strain TT11.

[0119] Take the seed from the glycerol preservation tube (strain TT11) and inoculate it into the seed culture medium. Incubate overnight at 37℃ and 200 rpm for primary seed culture. Take the primary seed liquid and inoculate it into the seed culture medium. Incubate at 37℃ and 200 rpm for 8-10 hours for secondary seed expansion culture. Seed culture was inoculated at a rate of 10-15% into a fermentation medium containing nutrients and the starting substrate deoxythymidine. Fermentation was initiated, with the initial pH controlled at 7.0±0.2. After 8-10 hours of fermentation, ammonia was added to maintain the pH at 6.55±0.1. After 12 hours of fermentation, feedback control was initiated to add nutrients and the starting substrate deoxythymidine. Dissolved oxygen was maintained at 30-40% throughout the process, and the feeding was controlled based on dissolved oxygen feedback. The starting substrate deoxythymidine was added in four batches at 12, 18, 24, and 30 hours. The temperature was maintained at 37℃ throughout the process, and the fermentation cycle was 36 hours. Under these conditions, the product yield reached 67.13 g / L, with a conversion rate of 88.6%. After purification by ion exchange chromatography, the purity reached over 99%.

[0120] Although the present invention has been disclosed above with reference to preferred embodiments, these are not intended to limit the invention. Any person skilled in the art can make various changes or modifications without departing from the spirit and scope of the invention. Therefore, the scope of protection of the present invention should be defined by the scope of the claims of this application.

Claims

1. A method for producing deoxythymidine triphosphate by a recombinant strain, characterized by, Includes the following steps: Step 1: The *E. coli* genome was targeted and modified using CRISPR / Cas9-mediated gene editing. The targeted modification included the following: a. Knocking out two nucleoside triphosphate pyrophosphatase genes, mazG and yhdE, blocking the pathway of dTTP degradation to dTMP; b. Knocking out the nucleonucleotide nuclease gene ppnN, blocking the pathway of dTMP degradation to thymine; c. Knocking out six nucleonucleotide nuclease genes, yfbR, yfdR, ushA, umpH, umpG, and yjjG, blocking the pathway of dTMP degradation to dT; d. Integrating the endogenous *E. coli* thymidine kinase gene tdk at the pseudogene site mbhA, enhancing the phosphorylation pathway of dT; e. Integrating the endogenous *E. coli* dTMP kinase gene tmk at the pseudogene site yeeP, enhancing the phosphorylation pathway of dTMP. The gene sequence of the thymidine kinase gene tdk is SEQ ID NO.1, and the gene sequence of the dTMP kinase gene tmk is SEQ ID NO.

2. Step 2: Using deoxythymidine as the starting substrate, deoxythymidine triphosphate is produced by fermentation with genetically modified Escherichia coli.

2. The method for producing deoxythymidine triphosphate by a recombinant strain according to claim 1, characterized in that, The CRISPR / Cas9-mediated gene editing method uses plasmids pTarget and pCas9, respectively. pCas9 carries the pTarget elimination system, the λ phage Red recombination system, and the Cas9 protein expression system. pTarget contains an sgRNA sequence, an N20 sequence, and a donor DNA fragment.

3. The method for producing deoxythymidine triphosphate by a recombinant strain according to claim 2, characterized in that, In step 1, the two nucleoside triphosphate pyrophosphatase genes mazG and yhdE, the nucleotide nucleoside enzyme gene ppnN, and the six nucleoside enzyme genes yfbR, yfdR, ushA, umpH, umpG, and yjjG are knocked out through the following steps: S1: Based on the corresponding gene sequence to be knocked out, use the tool CRISPRRGENTools to select the target sequence, whose PAM sequence is 5'-NGG-3', and design the N20 sequence; S2: Construct the plasmid vector according to the instructions of the kit, and use gene synthesis methods to synthesize the sgRNA expression cassette and recombinant fragment containing the N20 sequence; S3: After gene synthesis, the PCR product - sgRNA fragment is amplified using primers provided by the plasmid vector kit. The sgRNA fragment is ligated into the pTarget plasmid to obtain the gene editing plasmid pTarget-X, where X is the gene to be knocked out. pTarget-X is electroporated into competent cells from the previous modification stage, and single colonies are obtained by revival culture. Positive recombinants are obtained by PCR colony verification. S4: Cultivate positive strains expressing sgRNA, prepare electrotransformation competent cells, electrotransform the pCas9 plasmid into the electrotransformation competent cells, revive and culture to obtain single colonies, and verify the positive recombinants by PCR colony verification; then sequentially remove the gene editing plasmids pTarget-X and pCas9.

4. The method for producing deoxythymidine triphosphate by a recombinant strain according to claim 3, characterized in that, The steps involved in the integration of the endogenous thymidine kinase gene tdk into the pseudogene site mbhA in E. coli are as follows: S1: Based on the mbhA gene sequence, the target sequence was selected using the tool CRISPRRGENTools. Its PAM sequence is 5'-NGG-3', and the N20 sequence was designed. S2: Construct according to the instructions of the plasmid vector kit. First, use gene synthesis methods to synthesize the sgRNA expression cassette containing the N20 sequence and the recombinant endogenous tdk sequence. S3: After gene synthesis, the PCR product -sgRNA-tdk fragment was amplified using the primers provided in the kit. Then, the sgRNA-tdk fragment was ligated into the pTarget plasmid. The pTarget-mbhA-tdk was electroporated into competent cells from the previous modification stage. Single colonies were obtained by revival culture and positive recombinants were obtained by PCR colony verification. S4: Cultivate positive strains expressing sgRNA, prepare electrotransformation competent cells, electrotransform the pCas9 plasmid into the electrotransformation competent cells, revive and culture to obtain single colonies, and verify the positive recombinants by PCR colony verification; then sequentially remove the gene editing plasmids pTarget-mbhA-tdk and pCas9.

5. The method for producing deoxythymidine triphosphate by a recombinant strain according to claim 3, characterized in that, The steps involved in the integration of the endogenous dTMP kinase gene tmk into the pseudogene site yeeP are as follows: S1: Based on the yeeP gene sequence, the target sequence was selected using the tool CRISPRRGENTools. Its PAM sequence is 5'-NGG-3', and the N20 sequence was designed. S2: Construct according to the instructions of the plasmid vector kit. First, use gene synthesis methods to synthesize the sgRNA expression cassette containing the N20 sequence and the recombinant endogenous tmk sequence. S3: After gene synthesis, the PCR product -sgRNA-tmk fragment was amplified using the primers provided in the kit. Then, the sgRNA-tmk fragment was ligated into the pTarget plasmid. The pTarget-yeeP-tmk was electroporated into competent cells after the previous modification stage. Single colonies were obtained by revival culture and positive recombinants were obtained by PCR colony verification. S4: Cultivate positive strains expressing sgRNA, prepare electrotransformation competent cells, electrotransform the pCas9 plasmid into the electrotransformation competent cells, revive and culture to obtain single colonies, and verify the positive recombinants by PCR colony verification; then sequentially remove the gene editing plasmids pTarget-yeeP-tmk and pCas9.

6. A method for producing deoxythymidine triphosphate by a recombinant strain according to claim 4 or 5, characterized in that, The operation method of step 2 is as follows: the genetically modified Escherichia coli strain is inoculated into seed culture medium and cultured to secondary seed using the seed expansion culture method; The seed culture was inoculated into a fermentation medium containing nutrients and the starting substrate deoxythymidine at an inoculation rate of 10-15% to start fermentation. The initial pH of fermentation was controlled at 7.0±0.

2. After 8-10 hours of fermentation, ammonia was added to maintain the pH at 6.55±0.

1. After 12 hours of fermentation, feedback control was started to add nutrients and the starting substrate deoxythymidine. The dissolved oxygen was controlled at 30-40% and the temperature was controlled at 37℃ throughout the process. The fermentation cycle was 36 hours.

Citation Information

Patent Citations

  • Method for synthesizing deoxythymidine triphosphate through biotechnology

    CN101705269A

  • Method for producing deoxyribonucleotide triphosphate from deoxyribonucleotide monophosphate

    JP2007068532A