Real-time fluorescent primer probe set and detection kit for Tritrichomonas fetus from cats and their application

Abstract

The embodiment of the present invention discloses a real-time fluorescent primer probe group and a detection kit and application of fetal Tritrichomonas fetus from cats. The primer probe group for detecting fetal Tritrichomonas fetus from cats is characterized in that it comprises a primer pair and a probe, wherein the primer pair is composed of a single-stranded DNA shown in SEQ ID No.1 and a single-stranded DNA shown in SEQ ID No.2; and the probe is a single-stranded DNA shown in SEQ ID No.3. The real-time fluorescent quantitative PCR detection kit for fetal Tritrichomonas fetus prepared by the primer probe group of the present invention has a simple and fast detection method, good repeatability, high sensitivity, strong specificity, and can realize the detection of large-throughput samples, and can perform rapid and highly sensitive real-time fluorescent quantitative PCR detection of fetal Tritrichomonas fetus from cats.

Description

Technical Field

[0001] The embodiments of the present invention relate to the field of gene detection technology, and specifically to a cat-derived Tritrichomonas fetus real-time fluorescent primer probe set and a detection kit and application thereof. Background Art

[0002] Tritrichonas foetus (T.foetus) is an intestinal parasitic protozoan of the genus Trichomonas in the order Trichomonas. The parasite is spindle-shaped or pear-shaped and can parasitize in a variety of hosts such as cattle, pigs, dogs and cats. When parasitizing the reproductive system of cattle, it can cause uterine pyometra and early pregnancy abortion, seriously affecting the fertility of cattle. It can also parasitize the nasal cavity, stomach, cecum and reproductive tract of pigs, causing diarrhea in piglets, vaginitis in sows, repeated infertility, and in severe cases, abortion in sows. In recent years, research reports have found that T.foetus can infect the ileum, cecum and colon of cats, causing enteritis. The typical clinical symptoms of infection are chronic or intermittent diarrhea, with an average duration of up to 135 days. Other clinical symptoms include anorexia, depression, weight loss or no weight gain, vomiting, etc. In addition, T.foetus has also been found in rats, dogs and the lungs of human patients. At present, the diseases caused by T.foetus have been listed as notifiable diseases by the World Organization for Animal Health.

[0003] At present, there are relatively few detection methods for cat-source T.foetus, and the accuracy, specificity and sensitivity of the detection are insufficient. For T.foetus, which is stubborn, prone and contagious, it is not possible to prevent T.foetus infection and symptomatic treatment in a timely and effective manner. At present, the main methods for experimental diagnosis and detection of T.foetus are: direct wet mount microscopy, culture, staining and ordinary PCR detection. Direct wet mount microscopy detects the worm body based on the shape and movement characteristics of the trophozoite, but it is difficult to be found if the worm body is dead or does not move. In addition, it is easy to misjudge with protozoa with similar morphology such as Giardia. This method is simple to operate and low in cost, but the detection sensitivity is low. The culture method has higher sensitivity than the microscopy method, but the detection cycle is very long, and it takes 4 to 5 days to complete the detection, but the specificity is poor and different Trichomonas species cannot be distinguished. The staining method is simple to operate, but has poor detection accuracy and cannot distinguish different Trichomonas species and detect multiple samples simultaneously. Currently, the main method for detecting Trichomonas fetus is the PCR method. For example, Xu Lixin et al. used 5.8rRNA, ITS1 and ITS2 regions as target genes, designed two pairs of upstream and downstream primers, and performed nested PCR amplification and gel electrophoresis detection. This method has good specificity and high accuracy and is widely used. Liu Jia et al. used 18S rRNA gene sequence as the target sequence to design primers for ordinary PCR detection. However, its sensitivity is about 100 times lower than that of the second-generation PCR technology fluorescent quantitative PCR detection, and the detection time is relatively long. In addition, the process of opening the lid to handle the samples is very likely to lead to contamination and false positives.

[0004] Existing technologies limit the practical application of Tritrichomonas foetus in actual clinical detection. Therefore, there is an urgent need to develop a method that can provide new primer pairs and probes to enable real-time fluorescence quantitative PCR to achieve rapid, accurate and specific detection of T. foetus. Summary of the invention

[0005] To this end, the embodiments of the present invention provide a real-time fluorescent primer probe set and a detection kit and application of feline Tritrichomonas fetus.

[0006] In order to achieve the above purpose, the embodiment of the present invention provides the following technical solutions:

[0007] The embodiment of the present invention provides a primer probe set for detecting feline fetal Tritrichomonas foetus, which comprises a primer pair and a probe, wherein the primer pair is any one of the following:

[0008] a1) consists of the single-stranded DNA shown in SEQ ID No.1 and the single-stranded DNA shown in SEQ ID No.2;

[0009] a2) a single-stranded DNA represented by a sequence obtained by substituting and / or deleting and / or adding one or more nucleotides of the single-stranded DNA represented by SEQ ID No.1 and the single-stranded DNA represented by SEQ ID No.2, and having the same function as the primer pair described in a1);

[0010] The nucleotide probe is a single-stranded DNA shown in SEQ ID No.3.

[0011] In one embodiment of the present invention, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0012] The embodiment of the present invention also provides a primer pair for cat-derived Tritrichomonas foetus, which is the primer pair described above.

[0013] The present invention also provides a detection kit for detecting cat-derived Tritrichomonas fetus, which comprises the primer probe set or the primer pair.

[0014] The kit of the present invention also contains a real-time fluorescence PCR amplification buffer.

[0015] The above-mentioned kit of the present invention also contains a positive pLB-ITS1 plasmid vector.

[0016] The present invention also provides the use of the above-mentioned primer probe set, the above-mentioned primer pair, and the above-mentioned kit in the following:

[0017] Detection or auxiliary detection of Tritrichomonas fetus from cats;

[0018] Detect or assist in detecting whether the sample to be tested contains Tritrichomonas fetus from cats;

[0019] Preparation of products for detecting or assisting in the detection of Tritrichomonas fetus in cats;

[0020] Prepare products for detecting or assisting in detecting whether a sample to be tested contains Tritrichomonas fetus of cat origin.

[0021] The embodiment of the present invention also provides a method for detecting whether a sample contains feline Tritrichomonas fetus, which comprises: diluting a positive plasmid pLB-ITS1 into sample solutions with different concentration gradients, and performing real-time fluorescent PCR amplification on the positive plasmid pLB-ITS1 sample solutions with different concentrations using the primer probe set;

[0022] The Ct value of the sample solution with different concentration gradients amplified was used as the ordinate y, and the logarithm of the concentration value x of the sample solution before amplification was used as the abscissa to construct the standard curve formula;

[0023] The sample to be tested is subjected to real-time fluorescence PCR, and the x value can be calculated using the standard curve formula according to the Ct value after real-time fluorescence PCR amplification, and the presence of fetal Tritrichomonas fetus from cats in the sample to be tested is determined according to the x value.

[0024] In one embodiment of the present invention, the standard curve formula is y=-3.3337x+40.05, R 2 =0.9961, amplification efficiency E=0.954; where y is the Ct value of the sample solution with different concentration gradients, and x is the sample concentration value before PCR amplification;

[0025] When the x value is not less than 1.45×10 0 When the x value is less than 1.45×10 0 When the number of copies / μL is less than 1%, it can be determined that the sample to be tested does not contain feline Tritrichomonas fetus.

[0026] In one embodiment of the present invention, in the real-time fluorescence PCR: the concentration of the two single-stranded DNAs constituting the primer pair is 10 μmol / L, and the amount used in the 20 μL system is 0.8 μL; the concentration of the probe is 10 μmol / L, and the amount used in the 20 μL system is 0.4 μL;

[0027] The real-time fluorescence PCR reaction program was 95°C for 3 min; 95°C for 10 s, 60°C for 15 s to collect FAM channel fluorescence signals, and 40 cycles.

[0028] The embodiments of the present invention have the following advantages:

[0029] The invention uses the ITS1 region in the 5.8rRNA of fetal Tritrichomonas foetus from cats as the target gene at the level of common PCR technology, provides a pair of primer probe sequences through real-time fluorescence quantitative PCR technology, establishes a PCR amplification system, and achieves a sensitivity of 1.45 copies / μl; the detection sensitivity of fetal Tritrichomonas foetus is greatly improved and the detection time is shortened, and the optimization of faster detection speed, stronger specificity, higher accuracy and higher sensitivity of fetal Tritrichomonas foetus is achieved, which is of great significance for controlling the infection, transmission and timely prevention and treatment of fetal Tritrichomonas foetus.

[0030] The invention establishes a simple, sensitive, specific and rapid qualitative detection method for feline Tritrichomonas fetus, realizes detection and prevention of cats infected with feline Tritrichomonas fetus, and provides a theoretical basis for clinical treatment and prevention and control. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the implementation methods of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the implementation methods or the description of the prior art. Obviously, the drawings in the following description are only exemplary, and for ordinary technicians in this field, other implementation drawings can be derived from the provided drawings without creative work.

[0032] The structures, proportions, sizes, etc. illustrated in this specification are only used to match the contents disclosed in the specification so as to facilitate understanding and reading by persons familiar with the technology. They are not used to limit the conditions under which the present invention can be implemented, and therefore have no substantial technical significance. Any structural modification, change in proportion or adjustment of size shall still fall within the scope of the technical contents disclosed in the present invention without affecting the effects and purposes that can be achieved by the present invention.

[0033] Figure 1 The conventional PCR amplification electrophoresis diagram of the ITS1 gene of the fetal Tritrichomonas foetus genome from cats provided in the embodiment of the present invention;

[0034] Figure 2 A diagram showing the results of a screening test of different primer and probe sets provided in an embodiment of the present invention;

[0035] Figure 3 A standard curve diagram of real-time fluorescence quantitative PCR provided by an embodiment of the present invention;

[0036] Figure 4 A specific test diagram of real-time fluorescence quantitative PCR provided in an embodiment of the present invention;

[0037] Figure 5 A real-time fluorescence quantitative PCR sensitivity test diagram provided in an embodiment of the present invention;

[0038] Figure 6 A diagram showing the stability verification results provided by an embodiment of the present invention;

[0039] Figure 7 A sample detection result diagram provided by an embodiment of the present invention. DETAILED DESCRIPTION

[0040] The following is a description of the implementation of the present invention by specific embodiments. People familiar with the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0041] This embodiment provides a process for PCR amplification of the ITS1 gene of Tritrichomonas fetus from cats, which comprises the following steps:

[0042] Step 1. DNA extraction: Use materials to separate fecal samples infected with feline Tritrichomonas foetus from clinical diseased samples, verify the positive samples of feline Tritrichomonas foetus by ordinary PCR and sequencing, and extract total DNA from feline Tritrichomonas foetus clinical samples using TIANamp Virus DNA / RNA Kit and store at -80℃ for later use.

[0043] Step 2, ITS1 gene amplification: The total DNA extracted in step 1 was used as an amplification template, and the ITS1 gene in the gene with GenBank accession number MK770856 was used as the target sequence through Primer 5.0 primer software. The ITS1 gene sequence is as follows (SEQ ID No. 4):

[0044] TGCCGTTGGATCAGTTTCGTTAATAATTACAAACATATTTTTTTAATGTCTATAACTATTTATACAAAATTAAACACATAATCTAAAAAATTTAGACCTTAGGCAATGGATGTCTTGGCTTCTTACACGATGAAGAACGTTGCATAATGCGATAAGCGGCTGGATTAGCTTTCTTTGCGACAAGTTCGATCTTTGAATGCACATTGCGCGCCGTTTTAGCTTGCTAGAACACGCATATATGTTACAGTAACCCATATTAATTTAATACCAAATTCTCTTTTTAAGCAAAAGAGCGAAAAATAAATATGTATTAACAAAAGGGTTCTGTCTCATATAGGAAGACCCG, ordinary PCR amplification primers were designed, the PCR product length was 346 bp, the upstream and downstream primers were: ITSF1: 5'-TGCCGTTGGATCAGTTTCGT -3', ITSR1: 5'-CGGGTCTTCCTATATGAGACAGAAC -3, and the upper and lower primers were synthesized by Qingke Biotechnology.

[0045] The PCR amplification reaction system was: 25 μL of Yisheng Mix, 2 μL of upstream and downstream primers (10 μmol / L), 2 μL of template, and ddH2O to 50 μL. The reaction procedure was as follows: 95°C for 3 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s; 72°C for 5 min, for 30 cycles, and finally 5 μL of the reaction product was subjected to 1% agarose gel electrophoresis. Figure 1Shown is the electrophoresis diagram of conventional PCR amplification of the ITS1 gene of the fetal Tritrichomonas foetus genome from cats.

[0046] The construction and plasmid extraction process of the standard positive plasmid pLB-ITS1 in this example are as follows:

[0047] 1. Recovery of ITS1 target gene

[0048] The PCR product of the ITS1 gene amplified in Example 1 was recovered by gel recovery according to the instruction manual of TIANgel Midi Purification Kit. The implementation method is as follows:

[0049] 1) Column equilibration step: Add 500 μl of equilibration solution BL to the adsorption column CA2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0050] 2) Gel cutting: Cut the single target DNA band from the agarose gel, put it into a sterile 1.5mL centrifuge tube, and weigh it.

[0051] 3) Sol: Add an equal volume of PN solution to the gel block (if the gel weighs 0.1 g, its volume can be regarded as 100 µl, then add 100 µl of PN solution), place in a 50°C water bath, and gently turn the centrifuge tube upside down until the gel block is completely dissolved. Then add 1 / 2 the volume of isopropanol to mix evenly by inversion;

[0052] 4) Add the solution obtained in the previous step to an adsorption column CA2 (the adsorption column is placed in a collection tube), leave it at room temperature for 2 minutes, centrifuge it at 12,000 rpm for 30 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CA2 in the collection tube.

[0053] 5) Add 600 μl of rinse solution PW to the adsorption column CA2, centrifuge at 12,000 rpm for 30 seconds, pour out the waste liquid in the collection tube, place the adsorption column CA2 in the collection tube, and repeat once;

[0054] 6) Place the adsorption column CA2 back into the collection tube and centrifuge at 12,000 rpm for 2 min to remove as much of the rinse solution as possible. Place the adsorption column CA2 at room temperature for several minutes to dry thoroughly.

[0055] 7) Transfer the adsorption column CA2 to a 1.5 ml sterile centrifuge tube, add an appropriate amount of elution buffer EB (50 μl) to the middle of the adsorption membrane, let it stand at room temperature for 2 min, and centrifuge at 12,000 rpm (~13,400×g) for 2 min to collect the DNA solution.

[0056] 8) The nucleic acid concentration of the PCR product obtained by gel recovery was measured using a UV spectrophotometer and stored at -20°C for later use.

[0057] 2. Construction and transformation of pLB-ITS1 positive plasmid vector

[0058] The ITS1-PCR product obtained above was used to construct the pLB-ITS1 plasmid vector according to the instructions of the Tiangen pLB Zero Background Rapid Cloning Kit. The implementation method is as follows:

[0059] 1) Prepare the vector cloning reaction solution in a sterile centrifuge tube: pLB Vector 1µl, 2×ReactionSolution 5µl, T4 DNA Ligase 1µl, PCR product 2µl, and add ddH2O to 10µl. Gently flick the centrifuge tube to mix the reaction solution and centrifuge briefly for 5 seconds.

[0060] 2) Place the reaction solution in a water bath and react at 22°C for 5 min. After the reaction is completed, place the centrifuge tube on ice for subsequent transformation experiments.

[0061] 3) Take the competent cells DH5α (100 µl / tube) out of the -70℃ freezer and place them in an ice bath. When they are just thawed, add more than 10 µl of the ligation product and place them in an ice bath for 30 min. Then place the centrifuge tube at a constant temperature of 42℃ for 90 sec. After taking out the tube, immediately place it in an ice bath for 3 min.

[0062] 4) Add 500 µl of LB medium (without antibiotics) preheated at 37℃ to the centrifuge tube and shake at 200 rpm and 37℃ for 45 min. After recovery, mix the bacterial solution in the centrifuge tube, pipette 100 μl of the bacterial solution onto the LB solid agar medium containing ampicillin, and spread the cells evenly with a sterile elbow glass rod. After the surface of the plate is dry, invert the plate and culture at 37℃ for 12-16 h.

[0063] 5) Aseptically pick a single clone of the strain from the LB solid agar medium containing ampicillin and culture it in 3 mL of LB liquid medium containing ampicillin for 6 hours. Then send the bacterial solution to Qingke Biotechnology for sequencing. Compare the sequencing results with the target sequence and store it at -20℃ with a final glycerol concentration of 30% for future use.

[0064] 3. Extraction of pLB-ITS1 recombinant plasmid

[0065] 1) Add 100 µl of the above-mentioned preserved bacterial solution to 900 µl of LB liquid culture medium containing ampicillin and culture at 37℃ for 6 h. Mix the bacterial solution and spread 100 µl of the bacterial solution evenly on LB solid agar medium containing ampicillin and culture at 37℃ for 12 h. Aseptically pick a single clone strain and culture it in 10 mL of LB liquid culture medium containing ampicillin for 8 hours for later use.

[0066] 2) The bacterial liquid obtained above was used to extract and purify the positive plasmid of Tritrichomonas fetus ITS1 from cats according to the instructions of Tiangen Plasmid Extraction Kit to obtain the recombinant plasmid pLB-ITS1. The concentration and purity of the plasmid nucleic acid were determined by UV spectrophotometer and stored at -20°C for future use.

[0067] The method for screening the real-time fluorescent quantitative PCR primer probe set for Tritrichomonas fetus from cats in this embodiment comprises the following steps:

[0068] According to the sequences of Ankara-Turkey2F strain (GenBank No. MH490937.1), FLI-Wusterhausen 64 strain (JX187005.1), TF3-R3.ab1 strain (GenBank No. KJ439572.1), and Berne 360 ​​(GenBank No. JN006996.1) of Tritrichomonas fetus published on GenBank, sequence alignment was performed using MEGA7, and three sets of primers and probes were designed by selecting the conserved sequence segments. As shown in Table 1, the first set of primers and probes are TF-F1 / TF-R1, TF-P1; the second set of primers and probes are TF-F2 / TF-R2, TF-P2; and the third set of primers and probes are TF-F3 / TF-R3, TF-P3. The above-mentioned pLB-ITS1 plasmid was used as a template, and fluorescence PCR was performed for 40 cycles at 95°C for 3 min, 95°C for 10 s, and 60°C for 15 s to collect fluorescence signals. Figure 2 As shown, it is a diagram of the screening test results of different primer and probe sets, among which TF-F1 / R1 / P1 is preferably the best primer and probe combination.

[0069] Table 1

[0070] name Gene sequence TF-F1 (SEQ ID No. 1) 5'-TGTCTTGGCTTCTTACACGATGA-3' TF-R1 (SEQ ID No. 2) 5'-GATCGAACTTGTCGCAAAGAAA-3' TF-P1 (SEQ ID No. 3) 5'-FAM-CATAATGCGATAAGCGGCTGGAT-BHQ1-3' TF-F2 5'-GCGGCTGGATTAGCTTTCTTT-3' TF-R2 5'- ACATATATGCGTGTTCTAGCAAGCT -3' TF-P2 5'-FAM-ACAAGTTCGATTCTTTG-MGB-3' TF-F3 5'-ACCTTAGGCAATGGATGTCTT-3' TF-R3 5'-GCGTGTTCTAGCAAGCTAAAA-3' TF-P3 5'-FAM-CTTCTTACACGATGAAGAACGT-MGB-3'

[0071] The above-mentioned pLB-ITS1 plasmid was used as a template for PCR amplification, and the PCR system and reaction conditions were optimized, and the PCR reaction conditions with the smallest Ct value and the highest fluorescence value were selected.

[0072] Reaction system: 10 μL of 2×Probe qPCR Master Mix1, 0.8 μL of each of the TF-F1 / R1 / P1 primer probe set (10 μmol / L) screened in the upstream and downstream primer examples, 0.4 μL of the probe (10 μmol / L), and finally ddH20 was added to make up to 20 μL. Reaction procedure: 95℃ 3 min; 95℃ 10 s, 60℃ 15 s to collect FAM channel fluorescence signals, 40 cycles.

[0073] The nucleic acid concentration of the above-mentioned fetal Tritrichomonas fetus positive plasmid pLB-ITS1 was measured by ultraviolet spectrophotometer (purity requirement: (1.6<OD 260nm / OD 280nm <2.0), and converted to plasmid copy number according to the formula: copy number = plasmid concentration × 10 -9 ×6.02×10 23 / (660 × total plasmid length). The above plasmid concentration is 53 ng / μL, the total length is 3320 bp, and the resulting copy number is 1.45×10 10 copies / μL, stored at -20℃ for future use.

[0074] The plasmid with known copy number was diluted 10-fold to obtain a concentration of 1.45×10 5 copies / μL~1.45×10 0 The standard template of 1000 copies / μL was used, and the reaction program used optimized experimental conditions for PCR amplification. The amplification results were detected and analyzed using the Applied Biosystems QuantStudio Q3 fluorescent PCR instrument, and the result points were on a straight line. A standard curve was drawn with the Ct value as the ordinate and the logarithm of the starting sample template concentration as the abscissa, and the linear relationship expression between the logarithm of the copy number and the Ct value was obtained, y=-3.3337x+40.05, R 2 =0.9961, amplification efficiency E=0.954, there is a good linear relationship between standards of different concentrations, y is the Ct value after amplification of the sample, and x is the logarithmic value of the initial sample template concentration, such as Figure 3 shown.

[0075] The primer probe set screened in Example 3 and the real-time fluorescence quantitative PCR reaction system constructed in Example 4 were used to perform PCR detection using Giardia, feline parvovirus, feline coronavirus, Rickettsia, and ddH2O as templates. The detection results were all negative, while for feline fetal Tritrichomonas foetus, it had a good amplification effect, such as Figure 4As shown, the results show that the primer pair designed in this example can only specifically amplify Tritrichomonas fetus from cats, and other samples and negative controls have no specific amplification. This result shows that the established real-time fluorescence quantitative PCR method has good specificity.

[0076] The positive plasmid of fetal Tritrichomonas fetus from cats was diluted 10 times, and each gradient positive plasmid was tested 20 times. The lowest detection concentration with a detection rate of more than 95% was determined as the minimum detection limit of the fetal Tritrichomonas fetus reaction solution system. Figure 5 As shown, the primer probe set selected in Example 3 was used for detection, and the minimum template copy number that could be detected by the real-time fluorescence quantitative PCR method was 1.45×10 0 copies / μL.

[0077] Table 2

[0078] Positive plasmid concentration (copies / μL) <![CDATA[1.45×10 5 ]]> <![CDATA[1.45×10 4 ]]> <![CDATA[1.45×10 3 ]]> <![CDATA[1.45×10 2 ]]> <![CDATA[1.45×10 1 ]]> <![CDATA[1.45×10 0 ]]> Negative Ct value 20.35 22.96 26.35 29.65 33.51 36.71 none

[0079] The selected plasmid concentration was 1.45×10 5 copies / μL~1.45×10 1 The standard sample with 100 copies / μL was subjected to 3 intra-batch and inter-batch repeats, and the primer probe set screened in Example 3 and the real-time fluorescence quantitative PCR reaction system constructed in Example 4 were used for amplification. The intra-batch repeat coefficients of variation were all less than 5%, and the inter-batch repeat coefficients of variation were all less than 1.5%. As shown in Table 3, the intra-batch repeatability test of 3 batches of real-time fluorescence quantitative PCR products, and Table 4 is the inter-batch repeatability test of 3 batches of real-time fluorescence quantitative PCR products. The results show that the real-time fluorescence quantitative PCR detection method has good repeatability and stability.

[0080] Table 3

[0081]

[0082] Table 4

[0083]

[0084] According to the determined feline fetal Tritrichomonas PCR reaction system, three different batches of reaction solutions were prepared and placed in a 37°C incubator for treatment. They were placed for 3 days and 7 days for accelerated destruction treatment to verify the stability of the PCR reaction solution. At the same time, the three different batches of PCR reaction solutions were subjected to repeated freeze-thaw experiments. The specific implementation method was to place the reaction solution at -20°C until it was completely frozen, then take it out to room temperature for thawing. After it was completely thawed, it was recorded as one freeze-thaw experiment. This method was repeated for 10 and 20 times of repeated freeze-thaw treatment to verify the repeated freeze-thaw stability of the reaction solution. After the above treatment, the concentration was 1.45×10 5copies / μL, 1.45×10 3 copies / μL and 1.45×10 1 The results were verified by positive results of cat-derived Tritrichomonas fetus. Figure 6 As shown, A is the result of 5 repeated freeze-thaw tests, B is the result of 10 repeated freeze-thaw tests, C is the result of maintaining at 37°C for 3 days, and D is the result of maintaining at 37°C for 7 days. Therefore, the PCR reaction solution of Tritrichomonas fetus can remain stable for 7 days at 37°C and can withstand 20 repeated freeze-thaw cycles.

[0085] In this example, 52 fecal samples of cats with chronic diarrhea or diarrhea were collected from a pet hospital in Beijing. After the samples were collected, the fecal genomic DNA extraction kit purchased from Tiangen Biochemical Technology Co., Ltd. was used to extract the sample nucleic acid. The extracted nucleic acid was used as a template. At the same time, the primer probe set selected in Example 3 and the real-time fluorescence quantitative PCR reaction system constructed in Example 4 were used to detect the PCR reaction solution of Tritrichomonas fetus. Figure 7 As shown in the results, the detection rate was 26.41% (14 samples).

[0086] Although the present invention has been described in detail above by general description and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made to the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

[0087] Xu Lixin, Yan Ruofeng, Bo Xinwen, et al. PCR detection of Tritrichomonas fetus in cattle [C] / / . Abstracts of the 9th Academic Seminar of the Livestock Parasitology Branch of the Chinese Society of Animal Husbandry and Veterinary Medicine. [Publisher unknown], 2006:98.

[0088] Liu Jia, Li Yongxiu, Mei Rufan, Wang Xuemin, Chen Lifeng, Wang Qiuyue. Morphological observation and molecular identification of Tritrichomonas fetus in cats[J]. Acta Animal Husbandry and Veterinary Medicine, 2020, 51(09): 2324-2328.

Claims

1. A primer probe set for detecting Tritrichomonas fetus from cats, characterized in that: It comprises a primer pair and a probe, wherein the primer pair is composed of the single-stranded DNA shown in SEQ ID No.1 and the single-stranded DNA shown in SEQ ID No.2; and the probe is the single-stranded DNA shown in SEQ ID No.

3.

2. The primer probe set according to claim 1, characterized in that: The 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

3. A detection kit for detecting Tritrichomonas fetus from cats, characterized in that: Comprising the primer probe set according to claim 1 or 2.

4. The kit according to claim 3, characterized in that Also contains real-time fluorescence PCR amplification buffer.

5. The kit according to claim 3, characterized in that Also included is the positive pLB-ITS1 plasmid vector.

Images