Gibberella fujikuroi, a microbial agent containing the fungus, and their use and a method for producing gibberellins

By screening out gamma-ray-tolerant Fumigia fuciformis and optimizing culture conditions, the problem that existing Fumigia fuciformis cannot tolerate adverse conditions in industrial production has been solved, and efficient industrial production of gibberellin has been achieved.

CN116478832BActive Publication Date: 2026-04-14NANJING NORMAL UNIVERSITY +1
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202310419191.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-04-18
Publication Date
2026-04-14
Estimated Expiration
2043-04-18

AI Technical Summary

Technical Problem

The existing Fujikura gibberellin strain cannot tolerate adverse conditions during the industrial production of gibberellin, resulting in low production efficiency.

Method used

A strain of *Fusarium fujikuroi* is provided, which is resistant to gamma ray irradiation, has good environmental adaptability and gibberellin production potential, and produces gibberellin through liquid submerged fermentation using a specific seed and fermentation medium formulation.

Benefits of technology

It has achieved efficient production of gibberellin, with fermentation levels reaching 1250 mg/L, making it suitable for industrial production, and it maintains its activity in high-radiation environments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116478832B_ABST
    Figure CN116478832B_ABST
Patent Text Reader

Abstract

The present application relates to the field of microorganism, discloses a kind of fusarium fujikuroi, the fungicide containing the bacteria and their application and the method for producing gibberellin.The preservation number of the fusarium fujikuroi is CCTCC NO:M 20221848.The present application further provides the application of the fusarium fujikuroi in producing gibberellin.The method for producing gibberellin includes the following steps: the fusarium fujikuroi and / or the fungicide is inoculated into seed culture medium to carry out seed culture and obtain seed liquid;The seed liquid is inoculated into fermentation culture medium to carry out fermentation culture.The fusarium fujikuroi provided by the present application can resist gamma ray irradiation, has good environmental adaptability and gibberellin production potential, and is suitable for industrial production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbiology, and more specifically, to a Fusarium moniliforme, a fungal agent containing the fungus, their applications, and a method for producing gibberellins. Background Technology

[0002] Gibberellins (GA) are one of the five major plant hormones, belonging to the diterpenoid class of compounds, and are widely found in higher plants, fungi, and bacteria. Currently, there are many types of gibberellins, numbered GA1-GA136 according to their discovery dates, among which GA1, GA3, GA4, and GA7 exhibit significant biological activity. As a common plant hormone, gibberellins can break seed dormancy and promote stem and fruit growth, and are widely used in agriculture, forestry, brewing, and many other fields, possessing broad market prospects and significant economic and social benefits. GA production methods mainly include plant extraction, chemical synthesis, and microbial fermentation. However, plant extraction methods, limited by low yield and high cost, have been abandoned; chemical synthesis methods are limited by numerous steps and high pollution levels. With the rapid development of synthetic biology, microbial production of GA is gradually gaining attention due to its green process and renewable raw materials. Currently, gibberellin (GA) can be produced by many fungi, such as *Fusarium fusiforme*, *Aspergillus niger*, and *Fusarium oxysporum*. Studies have found that gibberellin synthesis requires a complex P450 enzyme system, which is an important reason why there are few reports on heterologous gibberellin synthesis. At present, the gibberellin biosynthesis pathway has only been introduced into *Yarrowia lipolytica*, but the gibberellin yield is only 10 mg / L. Therefore, the research focus is still on the production of gibberellin by naturally dominant strains.

[0003] Due to its natural ability to produce gibberellin (GA) and its controllable fermentation process, *Fusarium oxysporum* is considered a major industrial microorganism for gibberellin production, and liquid submerged fermentation with *Fusarium oxysporum* is currently the primary method for industrial gibberellin production. Existing *Fusarium oxysporum* strains are mostly isolated and screened from gramineous plants infected with *Bakanae disease*. For example, patent CN1222575A describes the isolation of gibberellin-producing strain number 46 from *Bakanae disease* plants in rural rice paddies in Zhejiang province. These *Fusarium oxysporum* strains isolated from mild environments have strict requirements for temperature, pH, and osmotic pressure, making them unsuitable for industrial gibberellin production. From an industrial perspective, analyzing and screening strains that can withstand adverse conditions during production is crucial. Summary of the Invention

[0004] The purpose of this invention is to overcome the problem that existing gibberellin-producing bacteria cannot withstand adverse conditions during the production process, and to provide a *Fujikura gibberellinum*, a bacterial agent containing the fungus, their applications, and a method for producing gibberellin. This *Fujikura gibberellinum* can withstand gamma ray irradiation, has good environmental adaptability and gibberellin production potential, and is suitable for industrial production.

[0005] To achieve the above objectives, the first aspect of the present invention provides a Fusarium fujikuroi, the preservation number of which is CCTCC NO:M 20221848.

[0006] A second aspect of the present invention provides a fungal agent containing the aforementioned Fumigranobacter fusarium.

[0007] Preferably, the inoculum contains live and / or dead cells of *Fujikura fusarium*; more preferably, it contains live cells.

[0008] Preferably, the microbial agent is a liquid microbial agent and / or a solid microbial agent.

[0009] The third aspect of the present invention provides the application of the above-mentioned Fumigranobacter fusarium and the above-mentioned inoculum in the production of gibberellin.

[0010] A fourth aspect of the present invention provides a method for producing Fusarium wilt, the method comprising the following steps:

[0011] (1) Inoculate the above-mentioned Fumigia fuciformis and / or the above-mentioned fungal agent into the seed culture medium to obtain seed liquid;

[0012] (2) The seed liquid is inoculated into a fermentation medium for fermentation culture.

[0013] Preferably, the seed culture medium in step (1) contains: glucose, soybean meal powder, peanut meal powder, dextrin, KH2PO4, (NH4)2SO4 and MgSO4·7H2O.

[0014] Preferably, the seed culture medium contains: glucose 20-50 g / L, soybean meal powder 10-30 g / L, peanut meal powder 8-15 g / L, dextrin 20-40 g / L, KH2PO4 0.8-1.6 g / L, (NH4)2SO4 0.1-0.3 g / L, and MgSO4·7H2O 0.5-1.5 g / L.

[0015] Preferably, the conditions for seed culture in step (1) include at least the following: temperature of 26-30℃, rotation speed of 250-350rpm, and time of 40-60h.

[0016] Preferably, the fermentation medium in step (2) contains: a carbon source, a nitrogen source, soybean oil, MgSO4·7H2O, (NH4)2SO4, KH2PO4, ZnSO4, and MnSO4; wherein the carbon source is selected from at least one of glucose, sucrose, maltose, and starch, and the nitrogen source is selected from at least one of yeast powder, yeast extract, peptone, corn flour, and soybean meal.

[0017] Preferably, the fermentation medium contains: 40-120 g / L carbon source, 25-40 g / L nitrogen source, 0.8-1.6 g / L soybean oil, 0.8-1.6 g / L MgSO4·7H2O, 0.2-0.5 g / L (NH4)2SO4, 1.5-4 g / L KH2PO4, 0.05-0.1 g / L ZnSO4, and 0.05-0.1 g / L MnSO4.

[0018] Preferably, the fermentation conditions in step (2) include at least the following: inoculum size of 3-8% by volume, temperature of 26-30°C, rotation speed of 250-350 rpm, and time of 8-12 days.

[0019] The beneficial effects of the present invention through the above technical solution are as follows:

[0020] The *Fujikura gibberellin* strain provided by this invention can produce gibberellin efficiently, with a fermentation level of up to 1250 mg / L. Furthermore, this *Fujikura gibberellin* strain exhibits strong environmental tolerance and can survive under 30 kGry doses of gamma rays, enabling it to cope with complex growth environments with high radiation levels. It is expected to play a role in stress resistance in industrial fermentation.

[0021] The *Fujikura gibberellin* strain provided by this invention has good adaptability to the growth environment and gibberellin production potential, making it suitable for industrial production.

[0022] Other features and advantages of the present invention will be described in detail in the following detailed description section.

[0023] Biological Preservation

[0024] The strain provided by this invention is *Fusarium fujikuroi*, with accession number NNU-01, and was deposited on November 30, 2022, at the China Center for Type Culture Collection (address: Wuhan University, Wuchang District, Wuhan, Hubei Province, postal code: 430072, abbreviated as CCTCC), with accession number CCTCC NO:M 20221848. Attached Figure Description

[0025] Figure 1 These are the morphology and microscopic images of the purified strain NNU-01 in Example 1, where a is a photo of primary hyphae, b is a photo of mycelial growth, and c is a microscopic image.

[0026] Figure 2 This is a graph showing the relationship between the radiation dose of γ rays and the lethality of strain NNU-01 in Example 2;

[0027] Figure 3 This is a production curve showing the gibberellin content in the fermentation broth of the purified strain NNU-01 in Example 3 versus time. Detailed Implementation

[0028] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0029] The first aspect of this invention provides a Fusarium fujikuroi, the preservation number of which is CCTCC NO:M 20221848.

[0030] The Fusarium moniliforme strain provided by this invention was isolated from soil in a radiation-contaminated area in Xinjiang. The Fusarium moniliforme strain can be isolated using conventional methods for isolating new strains in the art, such as a "gradual screening" strategy—liquid phase enrichment.

[0031] The liquid phase enrichment method may specifically include: collecting soil from radiation-contaminated areas in Xinjiang, crushing it in a sterilized mortar, placing it in an Erlenmeyer flask containing sterile physiological saline, shaking and suspending it for 5-15 minutes, taking a portion of the suspension from the Erlenmeyer flask and diluting it in a sterilized tube containing sterile physiological saline, and then diluting it to a 10-1 ratio. -2 10 -3 10 -4 Three concentrations were prepared, diluted, and then continued to be shaken and suspended. Finally, the diluted solutions were spread onto plates of isolation medium. After colonies grew, colonies of different shapes, sizes, and colors were picked and streaked onto the corresponding plates. The streaking continued until no contaminating colonies were obtained, and the purified strain was obtained. The purified strain was then inoculated onto beef extract peptone medium slant and stored in a refrigerator for later use.

[0032] In this invention, the separation culture medium comprises glucose, peptone, KH₂PO₄·7H₂O, agar, 1 / 3000 Bengal red aqueous solution, and streptomycin. Specifically, it can be: glucose 10 g / L, peptone 5 g / L, KH₂PO₄·7H₂O 0.5 g / L, agar 15-20 g / L, 10% 1 / 3000 Bengal red aqueous solution, and streptomycin 30 μg / L. Beef extract peptone medium is a commonly used solid culture medium in the art, and its components can be: beef extract 3 g / L, peptone 10 g / L, NaCl 5 g / L, agar 15-25 g / L, and pH 7.4-7.6.

[0033] The inventors of this invention selected a purified strain NNU-01 that could tolerate γ-rays from the screened strains, and conducted morphological observation, DNA extraction and identification. The identification results showed that the 18S rDNA sequence of this strain was 100% similar to the 18S rDNA gene sequence of Fusarium fujikuroi LS142 strain, and the strain could be identified as Fusarium fujikuroi. It was deposited at the China Center for Type Culture Collection on November 30, 2022, with accession number CCTCC NO:M 20221848.

[0034] The *Fujikura fusarium* strain provided by this invention can produce a large quantity of live *Fujikura fusarium* cells and / or fermentation products through cultivation. This invention does not impose any particular limitation on the cultivation method, as long as the cultivation method can enable the *Fujikura fusarium* strain to proliferate significantly. For example, live *Fujikura fusarium* cells can be inoculated into a culture medium at an inoculum of not less than 1% by volume, and cultured at a temperature of 26-30°C and a rotation speed of 250-350 rpm to obtain a culture solution. The culture medium can be a conventionally used culture medium in the art, or a culture medium suitable for the growth of *Fujikura fusarium*.

[0035] The present invention can further separate the Fusarium fusiforme cells from the above-mentioned culture medium. There are no particular limitations on the separation method, as long as the cells can be enriched from the culture medium. For example, it can be achieved by centrifugation and / or filtration. The conditions for centrifugation and filtration can be conventional conditions in the art, which are well known to those skilled in the art and will not be described in detail here.

[0036] A second aspect of the present invention provides a fungal agent containing the aforementioned Fumigranobacter fusarium.

[0037] In this invention, there is no particular limitation on the concentration of Fusarium oxysporum in the fungal agent, and specific selection can be made according to specific circumstances.

[0038] According to the present invention, preferably, the fungal agent contains live and / or dead cells of the *Fujikura fusarium*; more preferably, it contains live cells.

[0039] According to the present invention, there are no particular limitations on the dosage form of the fungal agent. It can be prepared into different dosage forms according to different intended uses, and corresponding excipients and other components can be added. For example, the fungal agent can be a liquid fungal agent (e.g., a liquid culture of *Fusarium oxysporum*) and / or a solid fungal agent (e.g., a powder prepared by drying *Fusarium oxysporum* or a high-purity formulation prepared through separation and purification). The choice of which excipient to add to which dosage form of the fungal agent is well known to those skilled in the art and will not be described in detail here.

[0040] The inventors have discovered that the *Fujikura gibberellin* strain provided by this invention can efficiently produce gibberellin through cultivation, and that this *Fujikura gibberellin* strain exhibits strong environmental tolerance, surviving under gamma-ray radiation conditions and capable of coping with complex growth environments with high radiation, thus showing promise for demonstrating resilience in industrial fermentation. Based on this, a third aspect of this invention provides the application of the aforementioned *Fujikura gibberellin* strain and the aforementioned inoculum in gibberellin production.

[0041] A fourth aspect of the present invention provides a method for producing Fusarium wilt, the method comprising the following steps:

[0042] (1) Inoculate the above-mentioned Fumigia fuciformis and / or the above-mentioned fungal agent into the seed culture medium to obtain seed liquid;

[0043] (2) The seed liquid is inoculated into a fermentation medium for fermentation culture.

[0044] According to the present invention, the fermentation medium can be a common culture medium in the art. Preferably, the seed culture medium in step (1) contains: glucose, soybean meal, peanut meal, dextrin, KH2PO4, (NH4)2SO4, and MgSO4·7H2O; more preferably, the seed culture medium contains: 20-50 g / L glucose, 10-30 g / L soybean meal, 8-15 g / L peanut meal, 20-40 g / L dextrin, 0.8-1.6 g / L KH2PO4, 0.1-0.3 g / L (NH4)2SO4, and 0.5-1.5 g / L MgSO4·7H2O. The inventors have found that under this preferred embodiment, the growth of *Fujikura fusarium* can be promoted, and the production efficiency of gibberellin can be improved.

[0045] According to the present invention, preferably, the conditions for seed culture in step (1) include at least the following: temperature of 26-30℃, rotation speed of 250-350rpm, and time of 40-60h.

[0046] According to the present invention, preferably, the fermentation culture medium in step (2) contains: a carbon source, a nitrogen source, soybean oil, MgSO4·7H2O, (NH4)2SO4, KH2PO4, ZnSO4, and MnSO4; wherein the carbon source is selected from at least one of glucose, sucrose, maltose, and starch, and the nitrogen source is selected from at least one of yeast powder, yeast extract, peptone, corn flour, and soybean meal. More preferably, the carbon source is starch, wherein the starch is added to the fermentation culture medium in the form of a starch liquefaction liquid. The starch liquefaction liquid is prepared by gelatinizing cassava starch, wheat starch, or corn starch and then liquefying it with α-amylase; it can be a commercially available product or prepared by methods disclosed in the prior art. For example, the preparation process of starch liquefaction liquid can be as follows: starch and water are mixed at a mass-volume ratio of 1:5, the pH is adjusted to 5.5 with hydrochloric acid, heated and stirred continuously until a paste is formed; when the temperature drops to 60℃, commercially available α-amylase (≥3700 activity units / g) is added at a mass ratio of enzyme to starch of 1:400, and the mixture is stirred at 60℃ for 60 min to obtain starch liquefaction liquid.

[0047] According to the present invention, preferably, the fermentation medium contains: 40-120 g / L carbon source, 25-40 g / L nitrogen source, 0.8-1.6 g / L soybean oil, 0.8-1.6 g / L MgSO4·7H2O, 0.2-0.5 g / L (NH4)2SO4, 1.5-4 g / L KH2PO4, 0.05-0.1 g / L ZnSO4, and 0.05-0.1 g / L MnSO4. The inventors have found that, under this preferred embodiment, the growth rate of *Fujikura scab* and its tolerance to gamma rays can be improved, thereby increasing the production efficiency of gibberellin and making it more suitable for industrial production.

[0048] According to the present invention, preferably, the fermentation conditions in step (2) include at least the following: inoculum size of 3-8% by volume, temperature of 26-30°C, rotation speed of 250-350 rpm, and time of 8-12 days. The inventors have found that under this preferred embodiment, the growth rate of *Fujikura fujiri* and its tolerance to γ-rays can be improved, thereby increasing the production efficiency of gibberellin and making it more suitable for industrial production.

[0049] In this invention, based on the method for producing gibberellin, gibberellin can be further separated from the fermentation culture broth obtained from fermentation culture by conventional separation and purification methods.

[0050] According to a particularly preferred embodiment of the present invention, a method for producing gibberellin includes the following steps:

[0051] (1) Inoculate the above-mentioned Fusarium moniliforme and / or the above-mentioned fungal agent into the seed culture medium, and carry out seed culture for 40-60 h at a temperature of 26-30℃ and a rotation speed of 250-350 rpm to obtain seed liquid. The seed culture medium contains: glucose 20-50 g / L, soybean meal powder 10-30 g / L, peanut meal powder 8-15 g / L, dextrin 20-40 g / L, KH2PO4 0.8-1.6 g / L, (NH4)2SO4 0.1-0.3 g / L, MgSO4·7H2O 0.5-1.5 g / L;

[0052] (2) The seed liquid is inoculated into the fermentation medium at an inoculation rate of 3-8% by volume, and fermented for 8-12 days at a temperature of 26-30℃ and a rotation speed of 250-350 rpm to obtain the fermentation culture medium, wherein the fermentation culture medium contains: starch liquefaction liquid 40-120 g / L, nitrogen source 25-40 g / L, soybean oil 0.8-1.6 g / L, MgSO4·7H2O 0.8-1.6 g / L, (NH4)2SO4 0.2-0.5 g / L, KH2PO4 1.5-4 g / L, ZnSO4 0.05-0.1 g / L, MnSO4 0.05-0.1 g / L.

[0053] The present invention will be described in detail below through embodiments.

[0054] Unless otherwise specified, all experimental materials and raw materials used in the following examples were purchased from conventional biochemical reagent stores.

[0055] In the following examples, the high-performance liquid chromatograph (HPLC) was a Dionex U3000, and the microscope was an Mshot ML-31 biological microscope. When detecting gibberellin using HPLC, a Venusil MPC18 column (Ageia Technologies, packing particle size 5 μm) was used. The selected mobile phase composition was methanol + water + phosphoric acid (volume ratio 68:32:0.05). The column was degassed by ultrasonication before use. The flow rate was 0.8 mL / min, the detection wavelength was 210 nm, and the injection volume was 10 μL.

[0056] In the following examples, the preparation process of starch liquefaction liquid is as follows: starch and water are mixed at a mass-to-volume ratio of 1:5, the pH is adjusted to 5.5 with hydrochloric acid, and the mixture is heated and stirred continuously until it becomes a paste; when the temperature drops to 60°C, commercially available α-amylase (≥3700 activity units / g) is added at a mass ratio of enzyme to starch of 1:400, and the mixture is stirred at 60°C for 60 min for enzymatic hydrolysis.

[0057] The components of the isolation medium were: glucose 10 g / L, peptone 5 g / L, KH2PO4·7H2O 0.5 g / L, agar 18 g / L, 10% 1 / 3000 Bengal red aqueous solution, and streptomycin 30 μg / L.

[0058] The components of the beef extract peptone medium are: beef extract 3 g / L, peptone 10 g / L, NaCl 5 g / L, agar 20 g / L, pH 7.4-7.6;

[0059] The growth medium consisted of: 35 g / L glucose, 20 g / L soybean meal, 12 g / L peanut meal, 30 g / L dextrin, 1 g / L KH2PO4, 0.2 g / L (NH4)2SO4, and 1 g / L MgSO4·7H2O.

[0060] The components of PDA medium are: 200 g / L potato, 20 g / L glucose, and 18 g / L agar.

[0061] Example 1

[0062] (1) Isolation and screening of strains

[0063] Collect 10g of soil from radiation-contaminated areas in Xinjiang, crush it in a sterilized mortar, and then place it in an Erlenmeyer flask containing 90ml of sterile physiological saline. Shake and suspend for 10 minutes. Take 1ml of the suspension from the Erlenmeyer flask and add it to a sterilized tube containing 9ml of sterile physiological saline for dilution. Then, serially dilute to 10⁻⁶. -2 10 -3 10 -4 Three concentrations were prepared, and after dilution, the suspension was continued to be shaken for 5 minutes. Finally, 0.1 ml of the diluted solution was spread on the plates of the isolation medium. After the colonies grew, colonies with different shapes, sizes, and colors were picked and streaked onto the corresponding isolation medium plates. The streaking was continued until no contaminating colonies were obtained to obtain the purified strain. The purified strain was then inoculated onto beef extract peptone slant and stored in a refrigerator at 4°C for later use.

[0064] (2) Strain identification

[0065] The purified strain NNU-01 obtained through screening was inoculated into growth medium and cultured for 10 days at 28℃, 200 rpm, and 1 VVM aeration rate. The resulting growth culture was then observed using photography and microscopy to determine the morphology of the strain. Figure 1 As shown. Figure 1 Images a and b show that the primary mycelium of strain NNU-01 is white, with a fine, downy growth, and no spores. Figure 1 The image in Figure c shows filamentous structures observed under a microscope. The species of the strain was determined based on the individual and group morphology of the fungi, as well as physiological and biochemical tests, in accordance with the *Handbook of Fungal Identification*.

[0066] DNA from strain NNU-01 was extracted and purified using a fungal genomic DNA extraction kit (manufactured by Beijing Solarbio Science & Technology Co., Ltd., product number D2300-50T). The extracted DNA was then sent to Nanjing Qingke Biotechnology Co., Ltd. for 18S rDNA gene sequencing. The nucleotide sequence is shown in SEQ ID NO.1.

[0067] CCCAACCCCTGTGACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTGA TCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCGGCCCGAAATCTAGTGGCGGTCTCGCTGCAGCTTCCATTGC GTAGTAGTAAAACCCTCGCAACTGGTACGCGGCCGGCCAAGCCGTTAAACCCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA(SEQ IDNO.1).

[0068] The 18S rDNA gene sequence of the purified strain NNU-01 was subjected to BLAST sequence alignment analysis in GenBank. The results showed that its sequence was 100% similar to the 18S rDNA gene sequence of Fusarium fujikuroi LS142 strain, and it was identified as Fusarium fujikuroi. It was deposited in the China Center for Type Culture Collection on November 30, 2022, with accession number CCTCC NO:M 20221848.

[0069] Example 2 Radiation resistance test

[0070] When gamma rays irradiate a recipient organism, they cause changes in the DNA structure, which in turn leads to mutations in the recipient organism, making it a suitable radiation source for verifying the performance of radiation-resistant bacteria.

[0071] The specific process is as follows: The purified strain NNU-01 obtained in Example 1 was inoculated into PDA medium and cultured for 3 days to activate the strain, ensuring that there was one single bacterium per culture dish. The strain was then irradiated with gamma rays at doses of 10, 20, 30, and 40 kGry, with a radiation dose rate of 50 Gy·min. -1 Five parallel groups were designed for each radiation intensity, with the purified strain NNU-01 (without radiation) serving as the control group. To prevent photoremediation, the irradiated hyphae were left to stand in the dark for approximately 36 hours before being transferred to three sites on new PDA plates. The germination time, growth status, and hyphal diameter were observed and recorded daily. To ensure uniform mycelial age, the control group was also transferred and cultured together with the mutagenesis group. The relationship between the gamma ray radiation dose and the strain lethality is as follows: Figure 2 As shown, the purified strain NNU-01 was found to be able to withstand a maximum gamma ray radiation intensity of 30 kGry. When the gamma ray intensity was higher than 30 kGry, the purified strain NNU-01 could not survive.

[0072] Example 3

[0073] The seed culture medium consisted of: 35 g / L glucose, 20 g / L soybean meal, 12 g / L peanut meal, 30 g / L dextrin, 1.2 g / L KH2PO4, 0.2 g / L (NH4)2SO4, and 1 g / L MgSO4·7H2O.

[0074] The fermentation medium consisted of: 80 g / L starch liquefaction liquid, 30 g / L yeast powder, 1.2 g / L soybean oil, 1.2 g / L MgSO4·7H2O, 0.3 g / L (NH4)2SO4, 2.5 g / L KH2PO4, 0.1 g / L ZnSO4, and 0.1 g / L MnSO4.

[0075] The purified strain NNU-01 obtained in Example 1 was inoculated into seed culture medium and cultured at 28°C and 300 rpm for 48 h to obtain seed liquid; the seed liquid was inoculated into fermentation culture medium at a volume of 5% and cultured at 28°C and 300 rpm for 10 days to obtain final fermentation broth.

[0076] Three parallel experiments were set up. Samples were taken every 24 hours to detect the gibberellin yield in the fermentation broth. The fermentation broth was centrifuged at 12000 rpm for 5 minutes to obtain the supernatant. The supernatant was filtered through a 0.22 μm aqueous membrane and then placed in a HPLC sample vial for analysis. The production curve of gibberellin (GA) content in the fermentation broth over time is shown below. Figure 3 As shown, the purified strain NNU-01 began producing gibberellin on day 3 of fermentation, and the gibberellin GA3 yield reached 1250 mg / L after 8 days. It can be seen that the gibberellin strain obtained in Example 1 has good gibberellin production potential.

[0077] Example 4

[0078] The seed culture medium consisted of: 50 g / L glucose, 30 g / L soybean meal, 8 g / L peanut meal, 20 g / L dextrin, 1.6 g / L KH2PO4, 0.1 g / L (NH4)2SO4, and 0.5 g / L MgSO4·7H2O.

[0079] The fermentation medium consisted of: starch liquefaction liquid 120 g / L, peptone 25 g / L, soybean oil 0.8 g / L, MgSO4·7H2O 0.8 g / L, (NH4)2SO4 0.2 g / L, KH2PO4 4 g / L, ZnSO4 0.05 g / L, and MnSO4 0.05 g / L.

[0080] The purified strain NNU-01 obtained in Example 1 was inoculated into seed culture medium and cultured at 26°C and 350 rpm for 60 h to obtain seed liquid. The seed liquid was inoculated into fermentation culture medium at an inoculation rate of 8% by volume and cultured at 26°C and 350 rpm for 12 days to obtain final fermentation broth.

[0081] Example 5

[0082] The seed culture medium consisted of: 20 g / L glucose, 10 g / L soybean meal, 15 g / L peanut meal, 40 g / L dextrin, 0.8 g / L KH2PO4, 0.3 g / L (NH4)2SO4, and 1.5 g / L MgSO4·7H2O.

[0083] The fermentation medium consisted of: 40 g / L starch liquefaction liquid, 20 g / L corn flour, 20 g / L soybean meal, 1.6 g / L soybean oil, 1.6 g / L MgSO4·7H2O, 0.5 g / L (NH4)2SO4, 1.5 g / L KH2PO4, 0.1 g / L ZnSO4, and 0.1 g / L MnSO4.

[0084] The purified strain NNU-01 obtained in Example 1 was inoculated into a seed culture medium and cultured for 40 h at 30°C and 250 rpm to obtain a seed liquid. The seed liquid was inoculated into a fermentation culture medium at a volume of 3% and cultured for 8 days at 30°C and 250 rpm to obtain the final fermentation broth.

[0085] Example 6

[0086] The final fermentation broth of purified strain NNU-01 was obtained according to the method in Example 5, except that the components of the seed culture medium were replaced with: corn starch 20 g / L, sucrose 20 g / L, peanut powder 20 g / L, soybean powder 20 g / L, KH2PO4 1 g / L, and MgSO4·7H2O 1 g / L.

[0087] Example 7

[0088] The final fermentation broth of purified strain NNU-01 was obtained according to the method in Example 5, except that the components of the fermentation medium were replaced with: maltose 40 g / L, corn flour 20 g / L, soybean meal 20 g / L, soybean oil 1.6 g / L, MgSO4·7H2O 1.6 g / L, (NH4)2SO4 0.5 g / L, KH2PO4 1.5 g / L, ZnSO4 0.1 g / L, and MnSO4 0.1 g / L.

[0089] Example 8

[0090] The final fermentation broth of purified strain NNU-01 was obtained according to the method in Example 5, except that the components of the fermentation medium were replaced with: corn starch 80 g / L, rice flour 80 g / L, soybean flour 20 g / L, peanut flour 20 g / L, K2SO4 1 g / L, and KH2PO4 1 g / L.

[0091] Test Example 1

[0092] The final fermentation broths from Examples 3-8 and Comparative Example 1 were taken, and the gibberellin yield in the final fermentation broths was detected according to the HPLC analysis method in Example 3. The results are shown in Table 1.

[0093] Table 1

[0094] serial number The final yield of gibberellin GA3 in the fermentation broth (mg / L) Example 3 1250mg / L Example 4 1216mg / L Example 5 1044 mg / L Example 6 975mg / L Example 7 1098mg / L Example 8 899mg / L

[0095] As can be seen from the results in Table 1, the *Fujikura gibberellin* provided by this invention can produce gibberellin efficiently, with a fermentation level of up to 1250 mg / L. Moreover, this *Fujikura gibberellin* has strong environmental tolerance and can survive under 30 kGry doses of γ-rays, thus coping with complex growth environments with high radiation. It is expected to play a role in stress resistance in industrial fermentation.

[0096] Comparative Example 1

[0097] Using *Fujikuroi NJtech 01* (CCTCC M2015614, sourced from Nanjing University of Technology, as described in patent application publication CN105441340A) as Comparative Example 1, *Fujikuroi NJtech 01* was inoculated into PDA medium and cultured for 3 days to activate the strain. One single bacterium was maintained per culture dish. The bacteria were irradiated with γ-rays at a dose of 10 kGry at a radiation dose rate of 50 Gy·min. -1 After irradiation, the hyphae need to be left to stand in the dark for about 36 hours before being transferred to three locations on a new PDA plate. The germination time, growth status and diameter of the hyphae are observed and recorded daily. It was found that Fujikuroi NJtech 01 could not survive and could not tolerate gamma ray radiation.

[0098] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. A type of Fusarium wilt fungus, characterized in that, The Fujikura Fuciformis ( Fusarium fujikuroi The accession number for this work is CCTCC NO: M 20221848.

2. A microbial agent, characterized in that, This fungicide contains *Fujikura scab* as described in claim 1.

3. The microbial agent according to claim 2, characterized in that, The inoculum contains live cells of the *Fujikura fusarium*.

4. The microbial agent according to claim 3, characterized in that, The bacterial agent can be a liquid bacterial agent or a solid bacterial agent.

5. The use of the *Fujikura gibberellin* as described in claim 1 and the fungal agent as described in any one of claims 2 to 4 in the production of gibberellin under an environment resistant to gamma radiation.

6. A method for producing gibberellin, characterized in that, The method includes the following steps: (1) The Fumigia fujikuroi described in claim 1 and / or the fungal agent described in any one of claims 2 to 4 are inoculated into a seed culture medium to obtain a seed liquid; (2) The seed liquid is inoculated into a fermentation medium for fermentation culture.

7. The method according to claim 6, characterized in that, The seed culture medium described in step (1) contains: glucose, soybean meal powder, peanut meal powder, dextrin, KH2PO4, (NH4)2SO4 and MgSO4·7H2O.

8. The method according to claim 7, characterized in that, The seed culture medium contains: glucose 20-50 g / L, soybean meal powder 10-30 g / L, peanut meal powder 8-15 g / L, dextrin 20-40 g / L, KH2PO4 0.8-1.6 g / L, (NH4)2SO4 0.1-0.3 g / L, and MgSO4·7H2O 0.5-1.5 g / L.

9. The method according to claim 8, characterized in that, The conditions for seed culture in step (1) include at least the following: temperature of 26-30℃, rotation speed of 250-350rpm, and time of 40-60h.

10. The method according to claim 6, characterized in that, The fermentation medium in step (2) contains: carbon source, nitrogen source, soybean oil, MgSO4·7H2O, (NH4)2SO4, KH2PO4, ZnSO4, and MnSO4; wherein the carbon source is selected from at least one of glucose, sucrose, maltose, and starch, and the nitrogen source is selected from at least one of yeast powder, yeast extract, peptone, corn flour, and soybean meal.

11. The method according to claim 10, characterized in that, The fermentation medium contains: 40-120 g / L carbon source, 25-40 g / L nitrogen source, 0.8-1.6 g / L soybean oil, 0.8-1.6 g / L MgSO4·7H2O, 0.2-0.5 g / L (NH4)2SO4, 1.5-4 g / L KH2PO4, 0.05-0.1 g / L ZnSO4, and 0.05-0.1 g / L MnSO4.

12. The method according to claim 6, characterized in that, The fermentation conditions described in step (2) include at least the following: inoculum size of 3-8% by volume, temperature of 26-30℃, rotation speed of 250-350 rpm, and time of 8-12 days.

Citation Information

Patent Citations

  • High-producing strain of GA (gibberellin) 4+7 and application of high-producing strain

    CN105441340A

  • Gibberela fujikuroi strain used for industrial fermentation production of gibberellin A4 and A7

    CN1222575A

  • Gibberella fujikuroia mutant strain with high yield of gibberellin GA3 and applications thereof

    CN110042061A

  • Gibberella fujikubin and fermentation method for producing GA3

    CN114231421A

  • Genetically engineered bacterium of high-yield gibberellin GA3, construction method and application

    CN114517161A