Preparation and application of phosphorescent biosensor based on phosphorescence resonance energy transfer for specific detection of messenger RNA

By constructing a phosphorescent biosensor based on phosphorescent resonance energy transfer and using PL and PDA combined with DNA probes, the selectivity and sensitivity issues of tumor marker detection in complex biological samples were solved, achieving high specificity and high sensitivity detection of TK1 mRNA.

CN117269120BActive Publication Date: 2026-04-21XIANGTAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210699281.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-06-20
Publication Date
2026-04-21
Estimated Expiration
2042-06-20

AI Technical Summary

Technical Problem

Existing optical sensors struggle to achieve high selectivity and sensitivity for tumor marker detection in complex biological samples, and are subject to interference from autofluorescence, photobleaching, or phototoxicity. Furthermore, persistently luminescent nanoparticles present challenges in constructing phosphorescent biosensors.

Method used

A phosphorescent biosensor was constructed using phosphorescent resonance energy transfer (PRET) technology, employing persistently luminescent nanoparticles (PL) as signal output and polydopamine (PDA) as a phosphorescent acceptor and DNA probe carrier. The specific detection of messenger RNA was achieved through phosphorescent resonance energy transfer (PRET).

Benefits of technology

The sensor's selectivity, sensitivity, and anti-interference capabilities have been improved, enabling highly specific recognition and analysis of the tumor marker TK1 mRNA, with a low detection limit and a wide linear range.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117269120B_ABST
    Figure CN117269120B_ABST
Patent Text Reader

Abstract

The application provides a preparation method of a phosphorescent biosensor for specifically detecting messenger RNA. In the application, a phosphorescent biosensor is constructed by using phosphorescence resonance energy transfer (PRET) between polydopamine (PDA) and persistent luminescence nanoparticles (PL). The biosensor comprises a PDA particle carrier and three nucleic acid chains, one of which is a hairpin chain (H) that is complementary to target TK1 mRNA, one is a DNA chain (PL-DNA) that is combined with the persistent luminescence nanoparticles through an amide bond, and the other is a substrate chain (S-15A) that is complementary to the PL-DNA. In the absence of the target, the phosphorescence of the PL is absorbed by the PDA, resulting in a weak signal; after the target is added, the target opens the H, and the exposed flexible end displaces the PL-DNA from the S-15A, so that the PL is away from the PDA, the PRET is closed, the phosphorescence signal is restored, and the phosphorescence signal is enhanced with the increase of the concentration of the target, and the linear relationship is 0-200 nM. The detection limit of the application is 1.74 nM.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of analytical chemistry detection technology, specifically relating to a method for preparing a phosphorescent biosensor based on phosphorescent resonance energy transfer for the specific detection of messenger RNA and its application. Background Technology

[0002] Fluorescent biosensors can image and quantify ions, small molecules, enzymes, proteins, and nucleic acids with high spatial and temporal resolution. These detections often need to be performed in complex biological samples, such as serum, cell lysates, cytoplasm, and organelles. Therefore, it is essential to effectively avoid interference from complex biological samples. In addition, traditional optical reagents, such as organic fluorescent probes [Feng Chen, Qiujun Lu, Youyu Zhang, Shouzhuo Yao. Sensors and Actuators B Chemical, 2019, 297, 126751.] and inorganic fluorescent nanoparticles [Shenghao Xu, Yongyin Nie, Liping Jiang, Jun Wang, Guiyun Xu, Wei Wang, Xiliang Luo. Analytical Chemistry, 2018, 90(6), 4039–4045.], are often affected by autofluorescence, photobleaching or phototoxicity [Shira Roth, Orr Hadass, Meir Cohen, Jasenka Verbarg, Jennifer Wilsey, Amos Danielli. Small, 2019, 15(3), 1803751.]. Therefore, there is an urgent need to develop different optical sensors to enable more sensitive and accurate detection of analytes. This invention uses PDA as an energy acceptor and DNA probe carrier to construct a phosphorescent biosensor to improve the selectivity, sensitivity and anti-interference ability of detection.

[0003] Persistently luminescent nanoparticles (PL) are a special type of luminescent material in which holes can effectively store excitation energy and slowly emit it in the form of continuous luminescence after a period of time following the excitation energy's depletion. Wang et al. developed a phosphorescent aptamer sensor for detecting kanamycin in food samples. The proposed aptamer sensor was shown to effectively eliminate interference from the food matrix and still selectively, sensitively, and non-autofluorescently detect analytes in complex samples [Bei-Bei Wang, Xu Zhao, Li-Jian Chen, Cheng Yang, Xiu-Ping Yan. Analytical Chemistry, 2021, 93(4), 2589-2595.]. The designed non-autofluorescent sensing platform can exhibit high selectivity and excellent luminescence performance for the target analyte. Although the application of persistently luminescent nanoparticles is already widespread, constructing a phosphorescent biosensor for detecting tumor markers in complex biological samples still faces significant challenges.

[0004] This invention utilizes photoluminescence (PL) as the signal output and photophosphorescence receptor (PDA) and DNA probe carrier to construct a phosphorescent sensor for the sensitive and specific detection of the tumor marker TK1 mRNA. The continuous luminescence of PL eliminates interference from the external environment, improving the sensor's detection performance. Results show that the sensor constructed in this invention possesses advantages such as high selectivity, high sensitivity, low detection limit, and wide linearity, demonstrating significant importance and practical application value for the highly specific identification and analysis of tumor markers. Summary of the Invention

[0005] The purpose of this invention is to provide a method for preparing a phosphorescent biosensor based on phosphorescent resonance energy transfer for the specific detection of messenger RNA, and to apply the sensor to the specific detection of TK1 mRNA in serum.

[0006] The objective of this invention is achieved through the following technical solution.

[0007] A method for preparing a phosphorescent biosensor based on phosphorescent resonance energy transfer for the specific detection of messenger RNA and its application, characterized by the following synthesis steps:

[0008] (1) Preparation of PDA: 0.018 g of dopamine monomer was dissolved in 9 mL of ultrapure water at 50 °C and stirred continuously. Then, 76 μL of 1.0 M NaOH was rapidly injected into the solution, and the mixture was slowly stirred in the dark for 5 hours to initiate monomer polymerization. The final solution was centrifuged at 10,000 rpm for 10 minutes, and the product was collected. The product was vacuum dried at 50 °C for later use.

[0009] (2) Preparation of PL: First, NaOH and germanium dioxide were mixed in a 2:1 molar ratio and stirred at room temperature until the mixture became transparent to obtain a sodium germanate precursor solution. 1 mL of 2M zinc nitrate and 0.005 mM manganese nitrate were dissolved in 10 mL of ultrapure water. 300 μL of HNO3 (68%, wt) was added to the mixture under vigorous stirring, and 1 mL of 1M sodium germanate precursor solution was slowly added dropwise. Subsequently, ammonia was rapidly added to the solution, and the pH was adjusted to 9.5 under vigorous stirring. The mixture was then incubated at room temperature for 60 min. The mixture was then transferred to a 50 mL polytetrafluoroethylene-lined high-pressure reactor and reacted at 220 °C for 4 h. After cooling to room temperature, the compound was collected by centrifugation at 10,000 rpm, washed three times with water, and dried to obtain pure persistent luminescent nanoparticles (PL).

[0010] (3) Preparation of PL-NH2: 25 mg of PL was weighed and stirred vigorously overnight in 10 mL of 5 mM sodium hydroxide solution. The solid was collected by centrifugation and dispersed in 10 mL of N,N-dimethylformamide (DMF). 200 μL of 3-aminopropyltriethoxysilane (APTES) was added under vigorous stirring, and the reaction was carried out at 80 °C for 24 h. The product after the reaction was completed was collected by centrifugation, washed three times with DMF, and dried for later use to obtain amino-modified persistent luminescent nanoparticles (PL-NH2).

[0011] (4) Preparation of DNA strand modified persistent luminescent nanoparticles (PL-DNA): First, the carboxyl-modified DNA strand (I-DNA) was activated by adding 50 μL of 10 μM 1-ethyl(3-dimethylaminopropyl)carbodiimide (EDC) and 50 μL of 2 μM I-DNA to 350 μL of acidic tris(hydroxymethyl)aminomethane-hydrochloric acid (Tris-HCl) buffer system at pH=5.0. The system was shaken and activated at 37 °C for 1 h. Then, 50 μL of 5 mg / mL PL-NH2 and 0.001 g of N-hydroxysuccinimide (NHS) were added and the system was shaken and activated at 37 °C for another 4 h. The particles were washed three times with buffer and resuspended in 250 μL of buffer solution and stored at 4 °C for later use, resulting in 1 mg / mL PL-DNA.

[0012] (5) Preparation of phosphorescent biosensor: 1 mg of PDA particles were dispersed in 1 mL of Tris-HCl buffer. 10 μL of the above PDA solution was mixed with 20 μL of 10 μM hairpin strand (H) and substrate strand (S-15A) (1:1). The mixture was gently shaken at room temperature for 1 h, and unreacted DNA strands were removed by centrifugation. At this point, the PDA-DNA probe was prepared. 100 μL of 1 mg / mL PL-DNA was added to the centrifuged solid, and the mixture was allowed to stand at 37 °C for 1 h. Finally, the mixture was centrifuged to remove unreacted DNA strands, and the solid was resuspended in 100 μL of buffer to successfully prepare the phosphorescent biosensor.

[0013] The phosphorescence detection conditions were set as follows: excitation wavelength: 240nm, emission wavelength: 535nm, excitation slit: 10nm, emission slit: 20nm. Attached Figure Description

[0014] [ Figure 1 Schematic diagram of the principle of phosphorescent biosensor for detecting TK1 mRNA.

[0015] [ Figure 2 Transmission electron microscope image of PDA (A), infrared spectrum of dopamine and polydopamine (B).

[0016] [ Figure 3 Zeta potential maps (A) and particle size analysis (B) of PDA and PDA-DNA.

[0017] [ Figure 4 Transmission electron microscope images of PL(A) and PL-NH2(B), and EDS spectra of PL(C) and PL-NH2(D).

[0018] [ Figure 5 Phosphorescence intensity spectra (A) and Fourier transform infrared spectra (B) of PL and PL-NH2.

[0019] [ Figure 6 Thermal analysis diagrams (A) and Fourier transform infrared XRD patterns (B) of PL and PL-NH2.

[0020] [ Figure 7 UV-Vis absorption of PL, PL-NH2 and PL-DNA (A) and Zeta potential (B).

[0021] [ Figure 8 Excitation and emission spectra of PL and PL-NH2 and UV absorption spectra of PDA (A), and changes in the normalized intensity of PL-DNA at different PDA concentrations (B).

[0022] [ Figure 9Gel image of chain displacement reaction induced by target analyte (A), phosphorescence spectrum (B) for feasibility analysis of phosphorescent biosensor detection of target analyte.

[0023] [ Figure 10 Optimization plots for PDA concentration (A), reaction time (B), reaction pH (C), and reaction temperature (D).

[0024] [ Figure 11 Phosphorescence spectrum of TK1 mRNA detected by phosphorescent biosensor (A), linear graph of TK1 mRNA detected by phosphorescent biosensor (B).

[0025] [ Figure 12 A graph examining the homology selectivity (A), mismatch selectivity (B), and competition (C) of phosphorescent biosensors in detecting TK1 mRNA.

[0026] [ Figure 13 Figures showing the stability (A) and time stability (B) of the phosphorescent biosensor for GSH, the reproducibility analysis (C) of the phosphorescent biosensor for detecting mRNA, and the infectivity experiment (D).

[0027] [ Figure 14 A comparison of the P / P0 values ​​of a phosphorescent biosensor detecting TK1 mRNA in buffer and serum.

[0028] [ Figure 15 [Image showing the recovery results of TK1 mRNA spiked in diluted human serum samples]

[0029] [ Figure 16 The probe sequence required in this experiment. Detailed Implementation Plan

[0030] Here, specific embodiments of the present invention will be described in further detail with reference to the accompanying drawings and examples. The following examples are used to illustrate the present invention, but do not limit the scope of application or extension of the present invention.

[0031] Example 1: Design of a phosphorescent biosensor based on phosphorescent resonance energy transfer for the specific detection of messenger RNA.

[0032] like Figure 1As shown, this phosphorescent biosensor consists of a PDA, a signal strand (PL-DNA), a hairpin strand (H), and a substrate strand (S-15A). Both H and S-15A contain poly-A sequences and are immobilized on the PDA surface through electrostatic interactions and π-π interactions. The PL-DNA strand forms a hybrid duplex with S-15A through base pairing and is immobilized on the PDA surface. Calculations show that the distance between the PL at the end of the PL-DNA hybrid duplex and the PDA surface is 7.48 nm, resulting in phosphorescent resonance energy transfer (PRET), at which point the phosphorescence of PL is quenched. Because the stem of H is complementary to the target material, it opens to form a flexible end in the presence of the target material. The opened end travels along the PDA track to a nearby PL-DNA hybrid duplex, where a strand displacement reaction occurs, displacing the PL-DNA from the substrate strand. The PL moves away from the PDA, causing PRET to close and phosphorescence to resume. This change in phosphorescent signal enables the quantitative detection of the target mRNA.

[0033] Example 2: Morphological and structural characterization of the intermediate product of the phosphorescent biofluorescent sensor.

[0034] The structure and morphology of all prepared materials were characterized using transmission electron microscopy, Fourier transform infrared spectroscopy, X-ray diffraction (XRD), thermogravimetric analysis, and potentiometric particle size analyzer.

[0035] Figure 2 Figure A shows a transmission electron microscope image of PDA particles. The PDA particles are uniformly spherical with a size of approximately 134 nm. Figure B shows the infrared spectra of dopamine monomers and PDA. (500 and 1700 cm⁻¹) -1 The peaks between these peaks are characteristic peaks of the dopamine monomer, and they almost all disappear after oxidative polymerization to form PDA, indicating that PDA was successfully prepared.

[0036] Figure 3 The figures show the Zeta potential and particle size distribution of PDA and PDA-DNA. Because DNA contains negatively charged phosphate residues, the total surface charge of the PDA particles changes from positive to negative after DNA adsorption. Furthermore, the most probable particle size of PDA before DNA adsorption was 151 nm, while the most probable particle size after DNA adsorption increased to 169 nm, indicating that DNA was successfully immobilized on the PDA surface.

[0037] Figure 4 The images show the transmission electron microscope (TEM) images and EDS spectra of PL and PL-NH2. PL and PL-NH2 are uniform rod-shaped structures, which are slightly larger after amino modification and have a thin layered structure on the surface. In addition, characteristic peaks of Si element appeared after grafting the silanizing agent, indicating the successful grafting of the silanizing agent APTES.

[0038] Figure 5The phosphorescence intensity and Fourier transform infrared (FTIR) spectra of PL and PL-NH2 are shown. Although the phosphorescence intensity of PL-NH2 decreased slightly after grafting APTES, the emission peak remained unchanged, indicating that functionalization of PL does not affect the emission wavelength of the particles. In the FTIR spectrum of PL-NH2, the emission peak at 3419 cm⁻¹... -1 and 3275cm -1 The section is an NH elastic band, 2932cm. -1 and 2878cm -1 The area is an asymmetric and symmetric expansion band of -CH2-, at 1125cm. -1 and 1041cm -1 The presence of strong O-Si-O stretching vibrations at these points, all characteristic peaks of the silanizing reagent APTES, indicates the successful amination of PL.

[0039] Figure 6 The thermal analysis and Fourier transform infrared (FTIR) XRD patterns of PL and PL-NH2 are shown. The thermal analysis reveals that PL and PL-NH2 possess good thermal stability, and the two particles exhibit different weight loss rates. Furthermore, the XRD patterns indicate that amino modification does not alter the crystal form of PL.

[0040] Figure 7 The UV-Vis absorption and Zeta potential plots for PL, PL-NH2, and PL-DNA are shown. The purine and pyrimidine bases in the DNA molecule have a large conjugated double bond system, absorbing UV light in the 250-280 nm range. The UV-Vis absorption spectra show that the UV curves of PL and PL-NH2 are consistent, indicating that the UV absorption of the nanoparticles does not change before and after grafting APTES. However, after grafting I-DNA, DNA absorption appears at 260 nm, indicating that I-DNA was successfully grafted onto the surface of PL-NH2, demonstrating the successful preparation of PL-DNA. The molar concentration of I-DNA loaded on the PL-NH2 surface was calculated using Lambert-Beer's law (A = Kbc). Here, A represents the UV absorbance (0.073), K is the molar absorptivity of I-DNA (251800 L / (mole·cm)), b is the thickness of the absorption layer (0.1 cm), and c is the concentration of the I-DNA being measured. Therefore, the I-DNA loading concentration on the PL-DNA surface was 0.28 μM. The potential diagram shows that the PL surface is negatively charged with a Zeta potential of -13.2 V. After amino functionalization, the surface becomes positively charged with a potential of +13.3 V. After modification with I-DNA, the potential changes from positive to negative, reaching -8.99 V, indicating the successful preparation of PL-DNA.

[0041] Example 3: Feasibility analysis of a phosphorescent biosensor based on phosphorescent resonance energy transfer for the specific detection of messenger RNA.

[0042] To verify that the conditions for phosphorescent resonance energy transfer (PRET) can be met between the PL and PDA, phosphorescence spectral analysis was performed on both. Figure 8 A shows that PDA absorbs light in the 200-800nm ​​range, while the phosphorescence of PL at 535nm can be well absorbed by PDA, indicating that PRET will occur when PDA and PL are spatially close enough. Figure 8 Study B investigated the changes in the normalized intensity of PL-DNA at different PDA concentrations. As the PDA concentration increased, the intensity of PL-DNA decreased. At a PDA concentration of 10 μg / mL, the phosphorescence intensity of PL-DNA was significantly quenched. Therefore, 10 μg / mL was selected as the optimal concentration of PDA.

[0043] The occurrence of the target-induced chain displacement reaction was verified by polyacrylamide gel electrophoresis. Figure 9 Lanes 1-8 in assay A represent DNA strands S, I, S+I (SI), H, T, H+T, H+T+I, and H+T+SI, respectively. Lane 3 produces a new band representing the SI hybridization double strand; lane 6 produces a new band representing the target compound hybridizing with the H strand; in lane 7, since the I strand is not complementary to the S strand, it becomes complementary to the H strand's end after the target compound opens the H strand, resulting in the lowest migration rate in lane 7, where the T, H, and I strands hybridize. When H, T, and the double-stranded SI are incubated together, lane 8 produces the same band as in lane 7, indicating that the H strand opened by the target compound can displace the I strand from the double-stranded SI. Therefore, the gel electrophoresis results demonstrate that a strand displacement reaction occurs in the presence of the target compound. Furthermore, we further validated the principle of the phosphorescent biosensor detecting TK1 mRNA using a phosphorescence experiment. As shown in Figure 9B, in the absence of the target substance, PL-DNA forms a hybrid double strand with the S-15A strand and is fixed on the PDA surface. The spatial distance between the donor (PL) and the acceptor (PDA) is small, resulting in phosphorescent resonance energy transfer and low phosphorescence intensity. However, after adding different concentrations of the target substance, the phosphorescence intensity rebounds to varying degrees, indicating the feasibility of using this phosphorescent biosensor to detect TK1 mRNA.

[0044] Example 4: An optimized experiment of a phosphorescent biosensor based on phosphorescent resonance energy transfer for the specific detection of messenger RNA.

[0045] like Figure 10As shown, to achieve optimal sensing performance, the amount of PDA, reaction time, pH, and temperature were optimized. The concentration of PDA directly affects the phosphorescence intensity of the system. Too high a concentration of PDA reduces the detected phosphorescence intensity, while too low a concentration results in incomplete quenching of the phosphorescence, leading to a high background signal. Therefore, selecting an appropriate PDA concentration is crucial. We selected five different concentrations of PDA (10 μg / mL, 20 μg / mL, 30 μg / mL, 40 μg / mL, and 50 μg / mL) and tested the phosphorescence intensity before and after adding the same concentration of the target analyte. The results showed that the P / P0 ratio (P0 being the initial phosphorescence intensity and P being the phosphorescence intensity obtained from detecting the target analyte) reached its maximum at a PDA concentration of 10 μg / mL. Furthermore, the P / P0 ratio reached its maximum at a reaction time of 60 min, pH = 7.4, and a temperature of 37 °C. Therefore, these conditions were selected for subsequent experiments.

[0046] Example 5: Application of the phosphorescent biosensor.

[0047] (1) Detection of different concentrations of TK1 mRNA by phosphorescent biosensor

[0048] The sensitivity of the probe was determined by adding different concentrations of TK1 mRNA to a 0.1 mg / mL solution. (Phosphorescence spectrum) Figure 11 A) shows that the measured phosphorescence signal gradually increases with increasing target concentration. Within the range of 0-200 nM, the phosphorescence intensity increases linearly with target concentration (Figure 11B), and the resulting linear equation is Y = 0.0090C + 0.9441, R... 2 =0.9951, where Y represents the P / P0 value, C is the target analyte concentration, and the detection limit is calculated based on the 3σ / k theory, which is 1.74 nM. The results indicate that this phosphorescent sensor has good detection performance, high sensitivity, wide linear range, and low detection limit.

[0049] (2) Selectivity, mismatch, and competition experiments of phosphorescent biosensor for detecting TK1 mRNA

[0050] To investigate the selectivity of the phosphorescent biosensor for TK1 mRNA, we selected a target concentration (200 nM) and performed homology selectivity analysis with other homologous mRNAs (GalNAc-T mRNA, MnSOD mRNA, and c-myc mRNA). The experimental results are as follows: Figure 12As shown in Figure A, the phosphorescent biosensor exhibits the highest P / P0 value only in the presence of TK1 mRNA, indicating that this strategy has high selectivity for the target. Simultaneously, sequences mismatched with the target analyte are also considered in the selectivity analysis. We selected sequences with single-base mismatches (SM), double-base mismatches (DM), triple-base mismatches (TM), complete mismatches (NC), and random matches (NR) for selectivity analysis. Figure 12 B demonstrates the specific ability of the phosphorescent biosensor to identify target objects. The results of the competitive experiments are as follows: Figure 12 As shown in C, the phosphorescence intensity did not change significantly after the addition of homologous mRNA, indicating that the phosphorescent biosensor has a high specific recognition ability for the target (the concentration of the target TK1 mRNA is 200 nM, while the concentration of the homologous mRNA is 5 times that of the target, i.e., 1 μM).

[0051] (3) Evaluation of the stability, reproducibility and anti-interference ability of phosphorescent biosensors

[0052] Sensor stability can help detect targets more accurately in complex biological samples. GSH stability and time stability experiments were conducted on the probe. For example... Figure 13 As shown in Figure A, the phosphorescent biosensor did not leak phosphorescent signal in the presence of 5 mM GSH, indicating that the DNA strand adsorbed on the PDA surface has good stability and does not affect the phosphorescence of PL, indicating that the probe has a certain degree of resistance to biothiols; after storing the phosphorescent biosensor probe at 4℃ for seven consecutive days, the sensor remained stable. Figure 13 B). The reproducibility of the sensor was evaluated by repeating the experiment six times in the presence of different concentrations of the target analyte (0 nM, 20 nM, 50 nM, 100 nM, 150 nM, and 200 nM). Measurements were then performed after six parallel experiments with the same concentration of the target analyte added. Figure 13 As shown in Figure C, the detected fluorescence intensities were basically consistent, with relative standard deviations of 1.0%, 1.6%, 4.5%, 2.3%, 3.7%, and 3.0%, respectively. Since nucleic acid detection is typically performed in complex biological samples, some interfering substances present in these samples, such as ions and amino acids, can affect sensor detection. Therefore, we analyzed the effects of interfering substances K... + Cl - Mg 2+ CO3 2- SO4 2- Interference experiments were conducted in the presence of glutathione (GSH), L-proline (L-pro), cysteine ​​(L-Cys), glucose, etc., with the concentration of all interfering substances being 5 mM. Figure 13D indicates that the sensor only responds in the presence of the target (200 nM). These results demonstrate that the phosphorescent biosensor described in this invention exhibits satisfactory stability, reproducibility, and interference resistance.

[0053] (5) Spike recovery of TK1 mRNA by phosphorescent biosensor

[0054] Spiked recovery experiments were conducted using normal human serum samples to evaluate the detection performance of the phosphorescent biosensor in complex biological samples. First, serum was centrifuged at 10,000 rpm for 5 min, the supernatant was collected and diluted 100-fold to prepare a 1% serum sample for subsequent experiments. Different concentrations of the target analyte (10 nM, 50 nM, 100 nM, 200 nM) were added to the serum sample, followed by the addition of the phosphorescent biosensor, and the reaction was carried out at 37°C for 60 min for phosphorescence measurement. Figure 14 As shown, the recovery rates of the phosphorescent biosensor for the target analyte ranged from 100.74% to 117.08%, with relative standard deviations of 2.2%, 3.8%, 5.0%, and 3.3%, respectively. Furthermore, by comparing the P / P0 values ​​of the phosphorescent biosensor in serum and buffer, at target analyte concentrations of 0 nM, 50 nM, 100 nM, and 200 nM, there was no significant difference between the phosphorescent biosensor in buffer and serum. Figure 15 The results showed that the phosphorescent biosensor has good detection potential in complex biological samples.

Claims

1. A method for preparing a phosphorescent biosensor for specific detection of messenger RNA based on phosphorescence resonance energy transfer, characterized by the following Synthesis steps: (1) 0.018 g dopamine was dissolved in 9 mL 50 o C ultrapure water, 76 μL 1.0 M NaOH was quickly injected into the above solution, and the solution was slowly stirred in the dark for 5 hours to obtain polydopamine nanoparticles; (2) Dissolve 1 mL of 2 M zinc nitrate and 0.005 mM manganese nitrate in 10 mL of ultrapure water. After vigorous stirring, add 300 μL of HNO3 to the above solution and slowly add 1 mL of 1 M sodium germanate precursor solution. The precursor solution is a mixture of NaOH and germanium dioxide in a 2:1 molar ratio until transparent. Adjust the pH to 9.5 using ammonia. After stirring at room temperature for 1 hour, place the mixture in a high-pressure reactor at 220 °C. o C reaction for 4 hours yielded persistent luminescent nanoparticles PL; (3) Take 25 mg of material PL from (2) and mix it with 10 mL of 5 mM NaOH. After ultrasonic dispersion, stir vigorously overnight. Centrifuge to collect the solid dispersion in N,N-dimethylformamide. Add 200 μL of 3-aminopropyltriethoxysilane under vigorous stirring. o Amino-modified persistent luminescent nanoparticles PL-NH2 were obtained by reacting at C for 24 hours. (4) Add 50 μL of 10 μM 1-ethyl(3-dimethylaminopropyl)carbodiimide and 50 μL of 2 μM carboxyl-modified DNA strand I-DNA to a 350 μL pH 5.0 acidic tris(hydroxymethyl)aminomethane-hydrochloric acid buffer system, and incubate at 37°C. o The carboxyl groups were activated by shaking at C for 1 hour; subsequently, 50 μL of 5 mg / mL N-hydroxysuccinimide was added to the above solution and the mixture was incubated at 37°C. o C continued the vortex reaction for 4 hours, and after washing, the product was resuspended in 250 μL Tris-HCl buffer to obtain 1 mg / mL DNA-modified persistent luminescent nanoparticles PL-DNA. The I-DNA sequence is: 5'-CCCCAATCCCCAATCCCCATCCCCCCAGG-3', wherein the 5' end is modified with a carboxyl group; (4) Take 10 μL of 1 mg / mL PDA from (1) and mix it with 20 μL of 10 μM hairpin strand H and substrate strand S-15A in a 1:1 ratio. After shaking at room temperature for 1 hour, centrifuge to obtain DNA-loaded polydopamine probe PDA-DNA. Then, add 100 μL of 1 mg / mL PL-DNA to the above solid and incubate at 37°C. o After incubation at C for 1 hour, centrifugation was performed, and the sample was resuspended in 100 μL Tris-HCl buffer to obtain the phosphorescent biosensor. The H sequence is: 5'-AAAAAAAAAATTCTTTCCAGGGAGAACAGAAAACAGATATCTGTTCTCCC TGGGGGGATGG-3', The S-15A sequence is: 5'-AAAAAAAAAAAAAAAAAAGGGGATGGGGTTTTTGGATTGG-3', the bolded part is the polyA sequence, used for loading onto the PDA surface.

2. The method for preparing a phosphorescent biosensor based on phosphorescence resonance energy transfer for specific detection of messenger RNA according to claim 1, characterized in that The PDA concentration for quenching PL was 10 μg / mL.

3. The method for preparing a phosphorescent biosensor for specific detection of messenger RNA based on phosphorescence resonance energy transfer according to claim 1, characterized in that The phosphorescence detection conditions are set as follows: Excitation wavelength: 240 nm, emission wavelength: 535 nm, excitation slit: 10 nm, emission slit: 20 nm.