Portulaca oleracea seed oil, methods of making and using same, cosmetics, pharmaceuticals, food products

By preparing high-quality purslane seed oil, the problem of insufficient research on purslane seed oil has been solved, and its anti-inflammatory and barrier repair effects in cosmetics, pharmaceuticals and food have been realized.

CN117568092BActive Publication Date: 2026-06-23上海致臻志臣科技有限公司
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
上海致臻志臣科技有限公司
Filing Date
2023-11-08
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

There is limited research on purslane seeds in the current technology, especially the pharmacological activity and application of its oil have not been fully explored.

Method used

A method for preparing purslane seed oil is provided, including drying, seed oil extraction, seed oil purification and decolorization steps. The method employs processes such as cold pressing or supercritical carbon dioxide extraction, removal of water-soluble organic acids, and treatment with a decolorizing agent to obtain high-quality purslane seed oil.

Benefits of technology

Purslane seed oil has the effects of promoting keratinocyte proliferation, reducing the production of inflammatory factors, and promoting the expression of filaggrin and tight junction protein genes. It is suitable for anti-inflammatory and barrier repair cosmetics, drugs and food.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117568092B_ABST
    Figure CN117568092B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of cosmetics, and discloses a portulaca oleracea seed oil, a preparation method and application thereof, cosmetics, medicines and food. The portulaca oleracea seed oil comprises, in percentage by mass, 33-37% of linoleic acid, 24-27% of linolenic acid, 15-18% of oleic acid, 14-16% of palmitic acid, 3.5-4.5% of stearic acid, 0.5-1% of isooleic acid and 0.3-0.4% of behenic acid. The portulaca oleracea seed oil prepared by the preparation method of the application can effectively promote the proliferation of immortalized keratinocytes, reduce the production of inflammatory factors, has strong anti-inflammatory effect, can promote the expression of filaggrin and tight junction protein genes and has barrier repair effect. The preparation method of the portulaca oleracea seed oil comprises sequentially drying, seed oil extraction, seed oil purification, decolorization, impurity removal and drying to obtain the portulaca oleracea seed oil, and has the advantages of simple operation, high yield, low cost, stable product quality, green and environment-friendly process and suitability for large-scale production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of cosmetic technology, and in particular relates to a purslane seed oil, its preparation method and uses, cosmetics, pharmaceuticals, and food. Background Technology

[0002] Purslane (Portulaca oleracea L.), also known as longevity vegetable, horse tooth vegetable, and five-element herb, is an annual herb belonging to the order Caryophyllales and family Portulacaceae. The entire plant is hairless. Purslane is sour and cold in nature, and enters the liver and large intestine meridians. The whole plant can be used medicinally.

[0003] To date, research on purslane has mainly focused on the pharmacological activities and food processing of its whole plant or above-ground parts, with relatively little research on its seeds. Summary of the Invention

[0004] This application provides a purslane seed oil that can effectively promote the proliferation of immortalized keratinocytes, reduce the production of inflammatory factors, and has a strong anti-inflammatory effect. It can also promote the expression of filaggrin and tight junction protein genes, thus having a barrier repair effect.

[0005] In a first aspect, this application provides a method for preparing purslane seed oil, the method comprising:

[0006] Provides dried purslane seeds;

[0007] Seed oil extraction includes pressing dried purslane seeds or crushing them and then extracting them with supercritical carbon dioxide to obtain crude purslane seed oil.

[0008] Seed oil purification includes removing water-soluble organic acids from crude purslane seed oil to obtain an oil phase liquid;

[0009] Decolorization, including the use of a decolorizing agent to decolorize the oil phase liquid to obtain a decolorized purslane seed crude oil solution;

[0010] Purslane crude oil decolorization solution is purified and dried to obtain purslane seed oil.

[0011] In some optional embodiments of this application, the dried purslane seeds provided include:

[0012] Remove impurities other than the purslane seeds from the purslane seeds.

[0013] Wash the purslane seeds after removing impurities until the washing solution is clear and transparent.

[0014] The washed purslane seeds are dried to obtain dried purslane seeds.

[0015] In some optional embodiments of this application, the temperature of the water used to wash the purslane seeds after impurity removal until the washing liquid is clear and transparent is controlled at 20°C to 50°C, preferably 25°C to 35°C.

[0016] In some optional embodiments of this application, the washed purslane seeds can be dried by outdoor air drying, vacuum drying, forced-air drying, or freeze drying.

[0017] In one embodiment, the purslane seeds are preferably dried using a forced-air drying method.

[0018] In some optional embodiments of this application, seed oil extraction employs cold pressing extraction, including:

[0019] The dried purslane seeds are pressed at 40℃~70℃ to obtain crude purslane seed oil.

[0020] In some optional embodiments of this application, seed oil extraction is performed by cold pressing using an oil press.

[0021] In some optional embodiments of this application, seed oil extraction employs supercritical carbon dioxide extraction, including:

[0022] The dried purslane seeds were crushed and sieved to obtain purslane powder with a particle size of 10 to 50 mesh.

[0023] Purslane powder was subjected to supercritical CO2 extraction to obtain crude purslane seed oil.

[0024] In some optional embodiments of this application, the process parameters for supercritical carbon dioxide extraction of seed oil satisfy the following:

[0025] The extraction pressure for supercritical CO2 extraction of purslane powder was 25 MPa to 50 MPa, the flow rate was 25 L / h to 45 L / h, the temperature was 30℃ to 55℃, and the extraction time was 90 min to 180 min.

[0026] In some optional embodiments of this application, seed oil purification includes:

[0027] Purslane crude seed oil and purified water were mixed at a volume ratio of 1:2 to 5, and the mixture was heated to 70℃ to 80℃ for dispersion and settling to obtain an oil-water two-phase liquid.

[0028] The aqueous phase is removed from the oil-water two-phase liquid to obtain the oil phase liquid.

[0029] In some optional embodiments of this application, seed oil purification includes:

[0030] Purslane crude seed oil and purified water were mixed at a volume ratio of 1:2 to 5, and the mixture was heated to 70℃ to 80℃ and dispersed at 100 rpm to 200 rpm for 2 to 3 hours. After standing for 10 to 12 hours, an oil-water two-phase liquid was obtained.

[0031] In some optional embodiments of this application, decolorization includes:

[0032] A decolorizing agent was added to the oil phase liquid and the mixture was heated to 70℃~80℃ for dispersion, and then cooled to room temperature to obtain a decolorized crude oil solution of purslane seeds.

[0033] In some optional embodiments of this application, decolorization includes:

[0034] Add a decolorizing agent to the oil phase liquid, heat to 70℃~80℃ and disperse at 100rpm~200rpm for 30min~60min, then cool to room temperature to obtain purslane seed crude oil decolorized liquid.

[0035] In some optional embodiments of this application, the decolorizing agent is selected from kaolin, attapulgite, zeolite, diatomaceous earth, alumina, food-grade coconut shell activated carbon, or a combination thereof.

[0036] In an optional embodiment of this application, the decolorizing agent is food-grade coconut shell activated carbon, which accounts for 0.1 wt.% to 0.2 wt.% of the oil phase liquid mass.

[0037] In an optional embodiment of this application, the purification and drying of the purslane crude oil decolorizing solution includes:

[0038] The crude oil decolorized purslane seed solution was filtered once, and then 0.1 wt.% to 0.5 wt.% of a desiccant was added to the filtrate for dispersion, followed by a second filtration to obtain purslane seed oil.

[0039] In an optional embodiment of this application, the purification and drying of the purslane crude oil decolorizing solution includes:

[0040] The decolorized crude oil solution of purslane seeds was filtered once using a filter membrane with a diameter of 0.1 μm to 0.8 μm. Then, 0.1 wt.% to 0.5 wt.% of a chemical drying agent was added to the filtrate. The solution was then dispersed at 100 rpm to 200 rpm for 30 min to 60 min. Finally, the dried product was filtered a second time using a filter membrane with a diameter of 0.1 μm to 0.8 μm to obtain purslane seed oil with a yield of 14% to 16%.

[0041] In some optional embodiments of this application, the chemical desiccant is selected from anhydrous magnesium sulfate, anhydrous calcium chloride, anhydrous magnesium sulfate, quicklime, or a combination thereof.

[0042] In some optional embodiments of this application, filtration can be performed using any of the following methods: plate and frame filtration, pressure filtration, and vacuum filtration.

[0043] Secondly, this application provides a purslane seed oil, comprising, by weight percentage:

[0044] Linoleic acid 33%–37%, linolenic acid 24%–27%, oleic acid 15%–18%, palmitic acid 14%–16%, stearic acid 3.5%–4.5%, isoleic acid 0.5%–1%, behenic acid 0.3%–0.4%.

[0045] Thirdly, this application provides the use of purslane seed oil in the preparation of anti-inflammatory, cell barrier-repairing foods, drugs, or cosmetics.

[0046] Fourthly, this application provides a cosmetic product, comprising: the above-mentioned purslane seed oil or purslane seed oil prepared according to the method for preparing purslane seed oil.

[0047] In some optional embodiments of this application, the cosmetic also includes at least one of the following additives: wetting agent, moisturizer, thickener, emulsifier, emollient, surfactant, antioxidant, stabilizer, and preservative, with purslane seed oil accounting for 1 wt.% to 5 wt.% of the total mass of the cosmetic.

[0048] Fifthly, this application provides a medicine comprising: the above-mentioned purslane seed oil or purslane seed oil prepared according to the method for preparing purslane seed oil.

[0049] In some optional embodiments of this application, the drug further includes at least one of adjuvant, carrier, excipient, retention aid, sweetener, diluent, preservative, dye / coloring agent, flavor enhancer, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent or emulsifier, and the mass fraction of purslane seed oil in the total mass of the drug is 1 wt.% to 5 wt.%.

[0050] Sixthly, this application provides a food product comprising: the above-mentioned purslane seed oil or purslane seed oil prepared according to the method for preparing purslane seed oil, wherein the purslane seed oil accounts for 10 wt.% to 20 wt.% of the total mass of the food product.

[0051] The method for preparing purslane seed oil according to this application involves drying, seed oil extraction, seed oil purification, decolorization, and filtration to obtain purslane seed oil. The preparation method is simple to operate, has a high yield and low cost, stable product quality, and is environmentally friendly, making it suitable for large-scale production.

[0052] The purslane seed oil of this application embodiment can effectively promote the proliferation of keratinocytes and reduce the production of inflammatory factors, thus having a strong anti-inflammatory effect. At the same time, it can also promote the expression of filaggrin and tight junction protein genes, thus having a barrier repair effect. Attached Figure Description

[0053] To more clearly illustrate the technical solutions of the embodiments of this application, the accompanying drawings used in the embodiments of this application will be briefly introduced below. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0054] Figure 1 This is a schematic flowchart of a method for preparing purslane seed oil according to an embodiment of this application;

[0055] Figure 2 This is a comparison chart of the effects of purslane seed oil and other control groups on the toxicity test results of immortalized keratinocytes;

[0056] Figure 3 This is a comparison chart of the effects of purslane seed oil and other control groups on the repair of scratches on immortalized keratinocytes;

[0057] Figure 4 This is a comparison diagram of the effects of purslane seed oil and other control groups on the morphology of mouse macrophages;

[0058] Figure 5 This is a comparison chart of the effects of purslane seed oil and other control groups on NO release from mouse macrophages;

[0059] Figure 6 This is a comparison chart of the effects of purslane seed oil and other control groups on the release of TNF-α from mouse macrophages;

[0060] Figure 7 This is a comparison diagram of the effects of purslane seed oil and other control groups on the expression level of FLG protein in immortalized keratinocytes;

[0061] Figure 8 This is a comparison diagram of the effects of purslane seed oil and other control groups on the expression level of ZO-1 protein in immortalized keratinocytes. Detailed Implementation

[0062] The features and exemplary embodiments of various aspects of this application will be described in detail below. To make the objectives, technical solutions, and advantages of this application clearer, the application will be further described in detail below with reference to the accompanying drawings and specific embodiments. It should be understood that the specific embodiments described herein are only intended to explain this application and not to limit it. For those skilled in the art, this application can be implemented without some of these specific details. The following description of the embodiments is merely to provide a better understanding of this application by illustrating examples.

[0063] It should be noted that, in this document, relational terms such as "first" and "second" are used merely to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitations, an element defined by the phrase "comprising..." does not exclude the presence of additional identical elements in the process, method, article, or apparatus that includes said element.

[0064] According to the Chinese Pharmacopoeia, purslane has the effects of clearing heat and detoxifying, stopping bleeding and cooling blood, and stopping dysentery. Clinically, it is used to treat dysentery caused by heat toxins, carbuncles, boils, eczema, erysipelas, snake and insect bites, hematochezia, hemorrhoidal bleeding, and metrorrhagia. Chemical composition studies have shown that purslane contains a variety of components such as alkaloids, organic acids, flavonoids, lignin, terpenes, polysaccharides, vitamins, and sterols, possessing unique nutritional value. It is a dual-use medicinal and edible plant approved by the Ministry of Health of China and is hailed as one of the most promising and worthwhile green foods to be developed in the 21st century. Modern pharmacological studies have shown that purslane has various effects such as antibacterial, anti-inflammatory, analgesic, antioxidant, anti-aging, anti-asthmatic, lipid-lowering, and immune-enhancing properties. Purslane is listed by the World Health Organization as one of the most commonly used medicinal plants.

[0065] To fully utilize abundant natural resources and further explore new bioactive natural products, the applicant conducted in-depth and systematic research on purslane seed oil and its bioactivity. The research revealed that purslane seed oil is rich in linolenic acid and β-carotene, and that linoleic acid and linolenic acid in purslane seed oil are excellent sources of polyunsaturated fatty acids. Through numerous experiments, the applicant successfully developed a method for preparing purslane seed oil and its novel applications.

[0066] To address the problems in the prior art, this application provides a method for preparing purslane seed oil. The method for preparing purslane seed oil provided in this application will be described below.

[0067] Figure 1 A schematic flowchart illustrating a method for preparing purslane seed oil according to an embodiment of this application is shown. Figure 1 As shown, the method for preparing purslane seed oil includes:

[0068] S1. Provides dried purslane seeds;

[0069] S2. Seed oil extraction, including pressing dried purslane seeds or crushing them and then extracting them with supercritical carbon dioxide to obtain crude purslane seed oil.

[0070] S3. Seed oil purification, including removing water-soluble organic acids from crude purslane seed oil to obtain an oil phase liquid;

[0071] S4. Decolorization, including using a decolorizing agent to decolorize the oil phase liquid to obtain a decolorized purslane seed crude oil solution;

[0072] S5. The crude purslane oil decolorization solution is purified and dried to obtain purslane seed oil.

[0073] The method for preparing purslane seed oil according to this application involves drying, seed oil extraction, seed oil purification, decolorization, impurity removal, and drying in sequence to obtain purslane seed oil. The preparation method has the advantages of simple operation, high yield and low cost, stable product quality, and the process is green and environmentally friendly, making it suitable for large-scale production.

[0074] In some optional embodiments of this application, the dried purslane seeds provided include:

[0075] Remove impurities other than the purslane seeds from the purslane seeds.

[0076] Wash the purslane seeds after removing impurities until the washing solution is clear and transparent.

[0077] The washed purslane seeds are dried to obtain dried purslane seeds.

[0078] In the embodiments of this application, purslane seeds can be either existing purslane seeds containing fatty acids or fresh purslane seeds. During the impurity removal process, small stones, sand, plant roots, leaves, and other impurities are removed. The purslane seeds after impurity removal are washed until the washing liquid is clear and transparent, indicating that the surface of the purslane seeds no longer contains sand or other external impurities that would affect the preparation of purslane seed oil.

[0079] In some optional embodiments of this application, the temperature of the water used to wash the purslane seeds after impurity removal until the washing liquid is clear and transparent is controlled at 20°C to 50°C, and optionally at 25°C to 35°C.

[0080] In some optional embodiments of this application, the washed purslane seeds can be dried by outdoor air drying, vacuum drying, forced-air drying, or freeze drying.

[0081] In one embodiment, the purslane seeds are preferably dried using a forced-air drying method.

[0082] In some optional embodiments of this application, seed oil extraction employs cold pressing extraction, including:

[0083] The dried purslane seeds are pressed at 40℃~70℃ to obtain crude purslane seed oil.

[0084] In some optional embodiments of this application, seed oil extraction is performed by cold pressing using an oil press.

[0085] The method for preparing purslane seed oil in this application embodiment involves cold pressing extraction, which yields crude purslane seed oil with sediment after pressing.

[0086] In some optional embodiments of this application, seed oil extraction employs supercritical carbon dioxide extraction, including:

[0087] The dried purslane seeds were crushed and sieved to obtain purslane powder with a particle size of 10 to 50 mesh.

[0088] Purslane powder was subjected to supercritical CO2 extraction to obtain crude purslane seed oil.

[0089] The method for preparing purslane seed oil in this application embodiment obtains slightly turbid crude purslane seed oil through supercritical CO2 extraction.

[0090] In some optional embodiments of this application, the process parameters for supercritical carbon dioxide extraction of seed oil satisfy the following:

[0091] The extraction pressure for supercritical CO2 extraction of purslane powder was 25 MPa to 50 MPa, the flow rate was 25 L / h to 45 L / h, the temperature was 30℃ to 55℃, and the extraction time was 90 min to 180 min.

[0092] In some optional embodiments of this application, seed oil purification includes:

[0093] Purslane crude seed oil and purified water were mixed at a volume ratio of 1:2 to 5, and the mixture was heated to 70℃ to 80℃ for dispersion and settling to obtain an oil-water two-phase liquid.

[0094] The aqueous phase is removed from the oil-water two-phase liquid to obtain the oil phase liquid.

[0095] In some optional embodiments of this application, seed oil purification includes:

[0096] Purslane crude seed oil and purified water were mixed at a volume ratio of 1:2 to 5, and the mixture was heated to 70℃ to 80℃ and dispersed at 100 rpm to 200 rpm for 2 to 3 hours. After standing for 10 to 12 hours, an oil-water two-phase liquid was obtained.

[0097] The aqueous phase is removed from the oil-water two-phase liquid to obtain the oil phase liquid.

[0098] In this application, mixing purslane crude oil with purified water can remove water-soluble organic acids from purslane seed crude oil, reduce the acid value of purslane seed oil, and extend the shelf life of purslane seed oil.

[0099] In some optional embodiments of this application, decolorization includes:

[0100] A decolorizing agent was added to the oil phase liquid and the mixture was heated to 70℃~80℃ for dispersion, and then cooled to room temperature to obtain a decolorized crude oil solution of purslane seeds.

[0101] In some optional embodiments of this application, decolorization includes:

[0102] Add a decolorizing agent to the oil phase liquid, heat to 70℃~80℃ and disperse at 100rpm~200rpm for 30min~60min, then cool to room temperature to obtain purslane seed crude oil decolorized liquid.

[0103] In some optional embodiments of this application, the decolorizing agent is selected from kaolin, attapulgite, zeolite, diatomaceous earth, alumina, food-grade coconut shell activated carbon, or a combination thereof. The amount of decolorizing agent can be adjusted according to the amount of purslane seed crude oil used, to the extent that it can completely adsorb pigments such as β-carotene in the purslane seed crude oil.

[0104] In an optional embodiment of this application, the decolorizing agent is food-grade coconut shell activated carbon, which accounts for 0.1 wt.% to 0.2 wt.% of the oil phase liquid mass. Based on the concept of green environmental protection, health and safety, biodegradable food-grade coconut shell activated carbon is preferred.

[0105] In an optional embodiment of this application, the purification and drying of the purslane crude oil decolorizing solution includes:

[0106] The crude oil decolorized purslane seed solution was filtered once, and then 0.1 wt.% to 0.5 wt.% of a desiccant was added to the filtrate for dispersion, followed by a second filtration to obtain purslane seed oil.

[0107] In some optional embodiments of this application, filtration includes first filtering the decolorized purslane seed oil solution using a 0.1 μm to 0.8 μm filter membrane, then adding 0.1 wt.% to 0.5 wt.% of a drying agent to the filtrate, followed by dispersion at 100 rpm to 200 rpm for 30 min to 60 min, and then second filtering the dried product using a 0.1 μm to 0.8 μm filter membrane to obtain yellow purslane seed oil with a yield of 14% to 16%.

[0108] In some optional embodiments of this application, the desiccant is selected from anhydrous magnesium sulfate, anhydrous calcium chloride, anhydrous magnesium sulfate, quicklime, or a combination thereof.

[0109] In some optional embodiments of this application, filtration can be performed using any of the following methods: plate and frame filtration, pressure filtration, and vacuum filtration.

[0110] On the other hand, this application provides a purslane seed oil prepared according to the above-described method for preparing purslane seed oil, comprising fatty acids, wherein the fatty acids, by mass percentage, include:

[0111] The fatty acid composition of purslane seed oil is 33%–37%, linolenic acid 24%–27%, oleic acid 15%–18%, palmitic acid 14%–16%, stearic acid 3.5%–4.5%, isoleic acid 0.5%–1%, and behenic acid 0.3%–0.4%. The determination method for fatty acid composition in purslane seed oil is in accordance with GB5009.168-2016.

[0112] The purslane seed oil of this application can effectively promote the proliferation of keratinocytes and reduce the production of inflammatory factors, thus having a strong anti-inflammatory effect. At the same time, it can also promote the expression of filaggrin and tight junction protein genes, thus having a barrier repair effect.

[0113] The purslane seed oil of this application can be used in food, medicine or cosmetics.

[0114] Thirdly, this application provides the use of purslane seed oil in the preparation of anti-inflammatory, cell barrier-repairing food, pharmaceutical or cosmetic products.

[0115] Fourthly, this application provides a cosmetic product comprising the aforementioned purslane seed oil or purslane seed oil prepared according to the method for preparing purslane seed oil.

[0116] In some optional embodiments of this application, the cosmetic also includes a carrier, and at least one adjuvant selected from wetting agents, moisturizers, thickeners, emulsifiers, emollients, surfactants, antioxidants, stabilizers, and preservatives, wherein the purslane seed oil accounts for 1 wt.% to 5 wt.% of the total mass of the cosmetic.

[0117] The carrier may be water or an organic solvent that is harmless to humans or the environment. For example, the organic solvent may be ethanol or a homologue of ethanol. The auxiliary agents in the cosmetic are selected from propylene glycol, butylene glycol, 1,2-pentanediol, glycerin, carbomer, xanthan gum, coconut oil-caprylate / caprylate, squalane, polydimethylsiloxane 350CS, Olivem 1000, glyceryl stearate, p-hydroxyacetophenone, and 1,2-hexanediol.

[0118] The purslane seed oil of this application has a mass fraction of 1wt.% to 5wt.% in cosmetics. Within this range, it is beneficial for purslane seed oil to promote the proliferation of keratinocytes and reduce the production of inflammatory factors, thus having a strong anti-inflammatory effect. At the same time, it can also promote the expression of filaggrin and tight junction protein genes, thus having a barrier repair effect, and can also avoid the adverse effects of excessive concentration.

[0119] Cosmetics can be formulated into various forms, including but not limited to creams, lotions, lotions, toners, sprays, patches, and masks.

[0120] Fifthly, this application provides a medicine comprising the above-mentioned purslane seed oil or purslane seed oil prepared according to the method for preparing purslane seed oil.

[0121] In some optional embodiments of this application, the pharmaceutical composition may further include acceptable adjuvants, including but not limited to any adjuvants, carriers, excipients, retention aids, sweeteners, diluents, preservatives, dyes / colorants, flavor enhancers, surfactants, wetting agents, dispersants, suspending agents, stabilizers, isotonic agents, solvents, or emulsifiers approved for use in humans or animals, and other carriers in various forms that do not have side effects on the pharmaceutical composition. Purslane seed oil constitutes 1 wt.% to 5 wt.% of the total mass of the pharmaceutical composition.

[0122] For example, the excipients in the pharmaceutical product are selected from propylene glycol, mannitol, sorbitol, cellulose, ethyl cellulose, cellulose propionate, cellulose acetate propionate, cellulose acetate butyrate, methyl or ethyl acrylate, methyl methacrylate, xylitol, dextran, cyclodextrin, gelatin, gum arabic, corn starch, potato starch, hydroxymethyl cellulose, hydroxypropyl cellulose, carboxymethyl cellulose, polyvinylpyrrolidone, acetone, ethanol, methanol, isopropanol, magnesium stearate, stearic acid, calcium stearate, glyceryl monostearate, glyceryl tristearate, polyethylene glycol, palmitic acid, neotame, sodium saccharin, steviol glycoside, erythrose, glucose, sodium sucrose chloride, methylparaben, ethylparaben, propylparaben, α-carotene, β-carotene, propylene glycol monolaurate, lauroyl polyoxyglyceride, linoleyl polyoxyglyceride, oleyl polyoxyglyceride or stearoyl polyoxyglyceride, microcrystalline cellulose, colloidal silica or combinations thereof.

[0123] In some optional embodiments of this application, the drug is used directly as a drug with anti-inflammatory and cell-repairing properties.

[0124] In some optional embodiments of this application, the drug is prepared by using purslane seed oil as an additive to assist in anti-inflammatory and cell-repairing effects.

[0125] In some optional embodiments of this application, the drug may be prepared as a topical pharmaceutical dosage form including but not limited to ointments, creams, lotions, and patches.

[0126] Those skilled in the art can mix the purslane seed oil of the present invention with the above-mentioned adjuvants according to any method known in the prior art, and any dosage form prepared is also known in the prior art.

[0127] For example, drugs with anti-inflammatory and cell-repairing properties can be formulated into a lip balm dosage form for use in cases of dry and inflamed lips caused by dryness or inflammation.

[0128] Sixthly, this application provides a food product comprising the above-mentioned purslane seed oil or purslane seed oil prepared according to the method for preparing purslane seed oil, wherein the purslane seed oil accounts for 10 wt.% to 20 wt.% of the total mass of the food product.

[0129] In some optional embodiments of this application, the food product may be a health-promoting oil, a gel candy, or a milkshake.

[0130] For example, the food can be a powder containing purslane seed oil, a ready-to-eat cake, or a nutritional supplement.

[0131] Example

[0132] The present application will be further illustrated by the following examples. Any simple modifications to the preparation method based on the concept of this application are within the scope of protection claimed in this application. Unless otherwise specified, all raw materials and solvents used in the examples are commercially available products.

[0133] Example 1

[0134] A method for preparing purslane seed oil, the method comprising:

[0135] S1. Provide dried purslane seeds, including removing impurities other than the seeds from fresh purslane seeds, washing the purslane seeds after removing impurities until the washing liquid is clear and transparent, and then placing the purslane seeds outdoors to dry, to obtain dried purslane seeds with a moisture content of 3.2 wt.%.

[0136] S2. Seed oil extraction: 500 kg of dried purslane seeds were weighed and added to a screw oil press for cold pressing. The pressing temperature was controlled at 43℃. After pressing, 92.1 kg of black purslane seed crude oil with sediment was obtained.

[0137] S3. Seed oil purification: Crude purslane seed oil was mixed with 280L of purified water and heated to 80℃. The mixture was dispersed at 200rpm for 3 hours and allowed to stand for 10 hours to obtain an oil-water two-phase liquid. The aqueous phase was removed from the oil-water two-phase liquid to obtain 84.4kg of oil phase liquid.

[0138] S4. Decolorization: Add 150g of 100-200 mesh food-grade coconut shell activated carbon to the oil phase liquid, heat to 80℃ and disperse at 200rpm for 30min, then cool to room temperature to obtain purslane seed crude oil decolorized solution.

[0139] S5. The decolorized purslane seed oil solution was filtered once using a filter membrane with a pore size of 0.8 μm. Then, 150 g of anhydrous sodium sulfate was added to the filtrate and dispersed at 200 rpm for 30 min. After a second filtration using a filter membrane with a pore size of 0.8 μm, 77.2 kg of light yellow purslane seed oil (M-1) was obtained, with a yield of 15.44%.

[0140] Example 2

[0141] A method for preparing purslane seed oil, the method comprising:

[0142] S1. Provide dried purslane seeds, including removing impurities other than the seeds from fresh purslane seeds, washing the purslane seeds after removing impurities until the washing liquid is clear and transparent, and then putting the purslane seeds into a blower dryer for drying at a temperature of 50°C for 8 hours to obtain dried purslane seeds with a moisture content of 3.9 wt.%.

[0143] S2. Seed oil extraction: 500 kg of dried purslane seeds were weighed and added to a pulverizer for pulverization. The pulverized seeds were then sieved through a 50-mesh sieve to obtain purslane seed powder. Subsequently, the purslane seed powder was subjected to supercritical CO2 extraction at an extraction pressure of 25 MPa, a flow rate of 30 L / h, an extraction temperature of 45℃, and an extraction time of 180 min to obtain 83 kg of slightly turbid, dark yellow crude purslane seed oil.

[0144] S3. Seed oil purification: Crude purslane seed oil was mixed with 170L of purified water and heated to 70℃. The mixture was dispersed at 150rpm for 2 hours and allowed to stand for 12 hours to obtain an oil-water two-phase liquid. The aqueous phase was removed from the oil-water two-phase liquid to obtain 81.5kg of oil phase liquid.

[0145] S4. Decolorization: Add 100g of food-grade coconut shell activated carbon with a particle size of 100 mesh to the oil phase liquid, heat to 70℃ and disperse at a speed of 100rpm for 30min, then cool to room temperature to obtain 79.0kg of purslane seed crude oil decolorized liquid.

[0146] S5. Filtration: The decolorized purslane seed oil solution was filtered once using a filter membrane with a pore size of 0.1μm to 0.8μm. Then, 120g of anhydrous magnesium sulfate was added to the filtrate and dispersed at 100rpm for 60min. Finally, it was filtered a second time using a filter membrane with a pore size of 0.22μm to obtain 79.0kg of light yellow purslane seed oil (M-2), with a yield of 15.8%.

[0147] Comparative Example 1

[0148] This comparative example provides a method for preparing purslane seed oil. Compared with Example 1, the difference between this comparative example and Example 1 is that:

[0149] Remove impurities from fresh purslane seeds, wash them with clean water until the washing liquid is clear and transparent, then place the purslane seeds outdoors to dry, and obtain dried purslane seeds with a moisture content of 3.6%.

[0150] Weigh 500 kg of dried purslane seeds and add them to a screw oil press for pressing. The pressing temperature is controlled at 40℃. After pressing, 91.5 kg of black purslane seed crude oil with sediment is obtained.

[0151] Add 150g of food-grade coconut shell activated carbon with a particle size of 100-200 mesh to the crude oil of purslane seeds, heat to 80℃, stir at 200rpm for 30min, cool to room temperature, and then filter through a 0.8μm filter membrane to obtain the crude oil decolorized solution.

[0152] Then, 150g of anhydrous sodium sulfate was added to the crude oil decolorization solution, and the mixture was stirred at 200rpm for 30min. After that, it was filtered through a 0.8μm filter membrane to obtain 73.5kg of light yellow purslane seed oil with a yield of 14.7wt%.

[0153] Test section

[0154] The acid value and fatty acid content of the purslane seed oil prepared in Examples 1-2 and Comparative Example 1 were determined using the first method of the national food safety standard GB5009.229-2016 "Determination of Acid Value in Food" and the first method of GB5009.168-2016 "Determination of Fatty Acids in Food", respectively. The results are shown in Table 1.

[0155] Table 1 Comparison of Acid Value and Fatty Acid Content of Purslane Seed Oil

[0156] index Example 1 Example 2 Comparative Example Acid value (mg / g) 0.5 0.6 1.4 Linoleic acid (%) 35.21% 36.14 35.03 Linolenic acid (%) 25.42% 26.02 24.97 Oleic acid (%) 16.64 17.22 16.72 Palmitic acid (%) 15.90 14.55 15.83 Stearic acid (%) 4.52 4.35 4.66 Isooleic acid (%) 0.82 0.53 0.77 Arachidic acid (%) 0.80 0.64 0.79 Behenic acid (%) 0.31 0.33 0.39

[0157] From the preparation methods of purslane seed oil in Examples 1-2 and Comparative Example 1, and the test data in Table 1, it can be seen that adding water helps to reduce the acid value of purslane seed oil and increase the oil content level.

[0158] Examples 3-4

[0159] Examples 3-4 each provide a cream, and the material ratios of each are shown in Table 2 below:

[0160] Table 2. Material proportions of the creams in Examples 3-4

[0161]

[0162]

[0163] Preparation Examples 3-4 contain purslane seed oil formulations, including:

[0164] Add component A to a water pot and heat to 75℃~85℃ to obtain solution A;

[0165] Add component B to the oil pan and heat to 75℃~85℃ to obtain solution B;

[0166] The solutions from group A and group B were mixed in an emulsifying pot and homogenized for 20 minutes to obtain an emulsion.

[0167] The emulsion was cooled to 45°C, component C was added, and the mixture was stirred for 30 minutes before being discharged and allowed to stand for 48 hours. It was then filled and packaged. The final product was a white to egg-yolk yellow cream, fine and uniform in texture. This cream can be used as a topical medication or skincare product.

[0168] Example 5

[0169] A health-promoting oil food is prepared by mixing 50kg of purslane seed oil and 250kg of soybean oil in a 500L mixing tank and stirring at 50rpm for 8 hours, then dispensing into 250ml bottles and sealing the finished product.

[0170] Bioactivity test

[0171] 1. Cytotoxicity test

[0172] The purslane seed oil (M-1) prepared in Example 1 was diluted with PBS to a volume percentage 10 times the concentration to be tested; immortalized keratinocytes were cultured in a solution containing 10% (v / v) fetal bovine serum and 1% penicillin-antibody (1×10⁻⁶) 5Immortalized keratinocytes were cultured in DMEM medium containing 100 mg / L penicillin and 100 mg / L streptomycin at 37°C in a 5% CO2 incubator until the cell confluence reached 85%-95%. PBS, a phosphate buffer for cell culture, was prepared as follows: potassium dihydrogen phosphate (KH2PO4): 0.27 g; disodium hydrogen phosphate (Na2HPO4): 1.42 g; sodium chloride (NaCl): 8 g; potassium chloride (KCl): 0.2 g; add approximately 800 mL of deionized water and stir thoroughly to dissolve. Then, add concentrated hydrochloric acid to adjust the pH to 7.4, and finally bring the volume to 1 L.

[0173] Immortalized keratinocytes in the logarithmic growth phase were digested with trypsin at a concentration of 0.05% (v / v), and the digestion reaction was terminated with DMEM medium containing 10% (v / v) fetal bovine serum.

[0174] Use a cell counting chamber to adjust the number of cells per unit volume of the cell suspension to 2 × 10⁻⁶. 5 / ml, seeded into 96-well plates at a ratio of 200μL per well, and incubated at 37℃ and 5% CO2 for a certain period of time until the cell confluence reached 45%-60%; then remove the old culture medium, and add 200μL of serum-free culture medium containing the test sample at a volume concentration (v / v) of 0.25%, 0.50%, 1.00%, and 2.50% of purslane seed oil to the corresponding test wells as the sample group, and perform 4 replicates for each volume concentration of the test solution.

[0175] The control group was cell-free, and 200 μL of PBS was added.

[0176] The control group (BC) contained cells and was incubated with 200 μL of serum-free culture medium at 37°C and 5% CO2 for 24 h.

[0177] Then, 20 μL of CCK8 solution was added to each well of the sample group, blank group, and control group, and incubated for 3 hours. The absorbance value was measured at 450 nm, and the cell viability of each group was calculated.

[0178] (1) Cell viability (%) = (sample group - blank group) / (control group - blank group) * 100%;

[0179] (2) Description of the concentration of purslane seed oil raw material test: The concentration of purslane seed oil (M-1) sample provided in Example 1 in the culture medium.

[0180] In cytotoxicity tests, higher cell viability indicates lower cytotoxicity of purslane seed oil. The results of the cytotoxicity test of purslane seed oil (M-1) against immortalized keratinocytes are as follows: Figure 2As shown, when the volume concentration of purslane seed oil is 2.5% (v / v), the immortalized keratinocytes have normal morphology and a relative cell viability of 76%. Therefore, according to the CCK8 test results, purslane seed oil has no cytotoxicity to immortalized keratinocytes in the volume concentration range of 2.5% (v / v).

[0181] 2. Cell scratch test

[0182] Cell migration assay: Immortalized keratinocytes (HaCAT) in the logarithmic growth phase were collected and migrated at a rate of 2 × 10⁻⁶ cells / year. 5 Cells were seeded at a density of 1 / ml into 24-well culture plates. The seeded plates were incubated at 37°C and 5% CO2 for 24 hours. Then, a 200μL pipette tip was used to create "damage" marks in the 24-well plates. Cells were washed three times with PBS to remove the marked cells. Samples were loaded according to Table 3, with FBS-free medium as the negative control, medium containing 10% FBS as the positive control, and medium containing FBS and 2.5% (v / v) purslane seed oil as the sample groups. The samples were then incubated at 37°C and 5% CO2 for 24 hours, with three replicates per group. Cells were photographed using an inverted microscope during migration. Comparison images of the migration at the start of the migration test and after 48 hours are shown below. Figure 3 As shown. FBS stands for Fetal Bovine Serum.

[0183] Table 3. Experimental Design for Cell Migration

[0184]

[0185] Combined with Table 3 and Figure 3 The comparison results show that in the cell migration experiment, the vertical spacing of the scratches in the negative control group was only 20% shorter after 48 hours compared to 0 hours; while in the positive control group, the vertical spacing of the scratches was 40% shorter after 48 hours compared to 0 hours. Compared with the negative and positive control groups, after treatment with purslane seed oil at a volume concentration of 2.5% (v / v), the vertical spacing of the scratches was shortened by 50% after 48 hours, indicating that the healing rate of immortalized keratinocytes was increased. This proves that purslane seed oil has a certain effect on promoting cell migration and repairing cell scratch damage.

[0186] 3. Anti-inflammatory and soothing efficacy experiment

[0187] Cell seeding: Mouse macrophages (i.e., RAW264.7 cells) were seeded at a rate of 1.5 × 10⁻⁶ cells / year. 5 Inoculate 100 cells / well into a 24-well plate and incubate overnight in an incubator at 37°C and 5% CO2.

[0188] Experimental groups: A control group, negative control group, positive control group, sample group, and solvent control group were set up. The sample group had three concentration gradients, with three replicates for each gradient.

[0189] Solution preparation: Prepare a 2.5% (v / v) working solution of purslane seed oil according to the test concentration setting table. For NO content detection, prepare working solutions of purslane seed oil with volume concentrations of 0.625% (v / v), 1.250% (v / v) and 2.5% (v / v).

[0190] Sample feeding: Feed the cells when the cell deposition rate in the 24-well plate reaches 50%-60%; among which,

[0191] The control group consists of culture medium containing no chemicals.

[0192] The negative control group (LPS group) was given culture medium containing LPS.

[0193] The positive control group (LPS+DEX group) was supplemented with a culture medium containing LPS and the positive control drug dexamethasone (DEX);

[0194] For the sample group (LPS + corresponding concentration of purslane seed oil), each well was filled with culture medium containing LPS and the corresponding volume concentration of purslane seed oil working solution.

[0195] The solvent control group was prepared by adding LPS-free culture medium without adding cells.

[0196] LPS refers to lipopolysaccharide. The concentration of LPS added to each group was the same, with a mass concentration of 1 μg / mL.

[0197] After drug administration, the 24-well plates were placed in an incubator (37°C, 5% CO2) and cultured for 24 hours. Cell morphology was observed and photographed under a microscope. If the cells were not contaminated, they were immediately tested.

[0198] Detection: After 24 hours of cell incubation, 500 μL of cell supernatant was collected for the determination of the levels of inflammatory factors NO and TNF-α.

[0199] Then, add DMEM-diluted CCK8 solution to each well, incubate at 37°C, and read the OD value at 450 nm; relative cell viability (%) = (sample group OD - control group OD) / (solvent control group OD - control group OD) * 100%.

[0200] 1) Effects of purslane seed oil (M-1) on the morphology of mouse macrophages (RAW264.7 cells) Figure 4 As shown, the experimental results indicate that:

[0201] (1) In the solvent control group, normal RAW264.7 cells were oval-shaped with a round, plump and smooth appearance; in the positive control group, the cell morphology was close to that of the normal group.

[0202] In the negative control group, i.e. the model group, which was added with LPS, RAW264.7 cells underwent pulverization under the induction of LPS. Compared with the normal group, the number of pseudopodia increased, most of which were dendritic. There were more gas bubbles and granular substances in the cells, which were more dispersed in the system. The cells changed from transparent round shapes to spindle or polygonal shapes.

[0203] (2) When the volume concentration of purslane seed oil reached 2.5% (v / v), most cells were close to the normal group in morphology. Therefore, purslane seed oil can effectively prevent LPS-induced pulverization of macrophages in this experiment.

[0204] 2) Effect of purslane seed oil (M-1) on NO release from mouse macrophages (i.e., RAW264.7 cells)

[0205] like Figure 5 As shown, the experimental results indicate that:

[0206] (1) RAW264.7 cells overexpressed NO after LPS stimulation, reaching 5.68 μM;

[0207] (2) After treatment with purslane seed oil at volume concentrations (v / v) of 2.5%, 1.25%, and 0.625%, the expression level of NO in mouse macrophages decreased to 1.7 μM, 2.9 μM, and 4.3 μM, respectively. This indicates that purslane seed oil can effectively act on LPS-stimulated RAW264.7 cells and alleviate cellular inflammation.

[0208] 3) Effect of purslane seed oil (M-1) on TNF-α release in mouse macrophages (RAW264.7 cells)

[0209] like Figure 6 As shown, the experimental results indicate that:

[0210] (1) After LPS stimulation, the expression level of pro-inflammatory factor TNF-α in RAW264.7 cells was significantly increased to 615 pg / ml;

[0211] (2) After treatment with purslane seed oil at a volume concentration of 2.5% (v / v), the expression level of pro-inflammatory factor TNF-α decreased to 559 pg / ml, indicating that this concentration of purslane seed oil can act on LPS-stimulated RAW264.7 cells and can effectively alleviate cellular inflammatory response; its effect in alleviating cellular inflammatory response is comparable to that of DEX.

[0212] 4. Barrier repair efficacy experiment

[0213] 1. UVB treatment of immortalized human keratinocytes (HaCaT cells)

[0214] (1) Immortalized human keratinocytes were cultured in a solution containing 10% fetal bovine serum and 1% penicillin-antibody (1×10⁻⁶). 5 Cells were cultured in DMEM medium containing 100 mg / L penicillin and 100 mg / L streptomycin. Cells were grown at 37°C in a 5% CO2 incubator until cell confluence reached 85%-95%.

[0215] (2) Digest logarithmic growth phase cells with 0.05% trypsin and terminate the digestion reaction with DMEM medium containing 10% serum.

[0216] (3) Count the cells using a cell counting chamber, dividing the cells into groups of 2 × 10⁻⁶. 5 Cells were seeded at a density of 1 / ml into 6-well plates and incubated at 37°C and 5% CO2 for a certain period of time until the cell confluence reached 60%-70%.

[0217] (4) Experimental groups: CTR control group (only DMEM added, no UVB irradiation), model control group (UVB+DMEM), and sample group (sample+UVB+DMEM, the sample refers to the purslane seed oil final concentration of 1% (v / v) in Example 1) were set up respectively.

[0218] (5) Replace the original culture medium in the 6-well plate with serum-free medium, starve the plate for two hours, then add the samples from each group in (4) and treat for 4 hours. Then replace the medium with PBS and use 30 mJ / cm 2 Immortalized keratinocytes were irradiated with UVB and cultured for another 24 hours.

[0219] 2. RNA extraction

[0220] (1) Cell sampling (operation on ice): The cells cultured in 6-well plates were washed twice with pre-cooled sterile PBS, TRIzol was added, 500 μL was added to each well, and the cells were gently pipetted to collect the cell lysate in 1.5 ml EP tubes.

[0221] (2) Pre-cool the high-speed centrifuge at 4℃, centrifuge at 12000g for 10min, take the supernatant into a new RNase-FREE 1.5ml EP tube, and discard the tissue precipitate;

[0222] (3) Add 200 μL of chloroform to the clear liquid, shake it up and down 15 times to mix the liquid thoroughly, keep the cap closed and let it stand at room temperature for 5 minutes to allow it to separate into layers naturally.

[0223] (4) Centrifuge at 12000g for 15 min at 4℃, and carefully aspirate the upper aqueous phase into a new RNase-FREE 1.5ml EP tube. Pay special attention to avoid touching the central precipitate to prevent protein contamination.

[0224] (5) Add 500 μL of isopropanol to the supernatant, gently invert to mix, keep the tube cap closed and let stand at room temperature for 5 min to allow mRNA to be fully extracted.

[0225] (6) Centrifuge at 12000g for 10 min at 4℃, discard the supernatant and add 75% ethanol solution prepared with DEPC water, and gently invert to wash the mRNA precipitate.

[0226] (7) Centrifuge at 7500g for 5 min at 4℃, discard the supernatant and wash the mRNA precipitate again with 75% ethanol solution;

[0227] (8) Centrifuge at 7500g for 5 min at 4℃, discard the supernatant and absorb as much residual liquid as possible, and let stand at room temperature for 30 min-60 min to evaporate the residual ethanol.

[0228] (9) Add an appropriate amount of DEPC water to dissolve the mRNA, determine the concentration, and perform reverse transcription according to the instructions of the reverse transcription kit.

[0229] 3. Reverse transcription PCR

[0230] System (20 μl): 10×buffer 2 μl, 2.5 mM dNTP 2 μl, DNA polymerase (Taq) 0.5 μl, primer 2 μl, template (cDNA obtained from reverse transcription diluted 10 times as template) 2 μl - 10 μl of ultrapure water to make up the system to 20 μl;

[0231] Reaction conditions: Pre-denaturation 94℃ for 5 min; 30 cycles; denaturation 94℃ for 30 s, annealing 60℃ for 30 s, extension 72℃ for 30 s; post-extension 72℃ for 10 min;

[0232] 5. Quantitative Real-Time PCR (QPCR)

[0233] System (20μl): 10μl of 2×SYBR, 2μl-5μl of template (cDNA obtained by reverse transcription diluted 10 times as template), 1μl-2μl of primer, and ultrapure water to make up the system to 20μl;

[0234] Reaction conditions: Pre-denaturation 94℃ for 5 min; 40 cycles: denaturation 94℃ for 30 s, annealing 60℃ for 30 s, extension 72℃ for 30 s (real-time fluorescence imaging); melting curve 94℃ for 30 s, 60℃ for 30 s, 72℃ for 1 s (real-time fluorescence imaging during the heating process).

[0235] The following are the primers used for reverse transcription PCR and quantitative real-time PCR (QPCR) experiments:

[0236] hZO-1F ACCAGTAAGTCGTCCTGATCC hZO-1R TCGGCCAAATCTTCTCACTCC

[0237] Experimental conclusions: such as Figure 7 and 8 As shown, purslane seed oil at a volume concentration of 1% (v / v) can significantly promote the expression level of FLG and ZO-1 proteins in mRNA within UVB-damaged keratinocytes, and has a certain repair effect on UVB-damaged keratinocytes.

[0238] The above description is merely a specific implementation of this application. Those skilled in the art will clearly understand that, for the sake of convenience and brevity, the specific working process described above can be referred to the corresponding process in the foregoing method embodiments, and will not be repeated here. It should be understood that the protection scope of this application is not limited thereto. Any person skilled in the art can easily conceive of various equivalent modifications or substitutions within the technical scope disclosed in this application, and these modifications or substitutions should all be covered within the protection scope of this application.

Claims

1. The application of purslane seed oil in the preparation of cosmetics for repairing scratch damage or UVB damage to human keratinocytes, wherein the purslane seed oil is prepared by a method comprising the following steps: Dried purslane seeds are provided, including: Remove impurities other than the purslane seeds from the purslane seeds. Wash the purslane seeds after removing the impurities until the washing liquid is clear and transparent. Dry the washed purslane seeds to obtain dried purslane seeds. Seed oil extraction includes pressing dried purslane seeds at 40℃~70℃, or pulverizing them into purslane powder of 10 mesh~50 mesh and then extracting them with supercritical carbon dioxide to obtain crude purslane seed oil. Purification of seed oil includes mixing the crude purslane seed oil with purified water at a volume ratio of 1:2 to 5, dispersing the mixture at 70°C to 80°C, allowing it to stand, and obtaining an oil-water two-phase liquid; removing the aqueous phase from the oil-water two-phase liquid, thereby removing the water-soluble organic acids from the crude purslane seed oil, and obtaining an oil phase liquid. Decolorization, including the use of a decolorizing agent to decolorize the oil phase liquid to obtain a decolorized purslane seed crude oil solution; Purslane crude oil decolorization solution is purified and dried to obtain purslane seed oil. The purslane seed oil, by mass percentage, comprises: 33%–37% linoleic acid, 24%–27% linolenic acid, 15%–18% oleic acid, 14%–16% palmitic acid, 3.5%–4.5% stearic acid, 0.5%–1% isoleic acid, and 0.3%–0.4% behenic acid.

2. The application of purslane seed oil according to claim 1 in the preparation of cosmetics for repairing scratch damage or UVB damage to human keratinocytes, characterized in that, The decolorization includes: A decolorizing agent is added to the oil phase liquid, and the temperature is raised to 70℃~80℃ for dispersion. After dispersion, the mixture is cooled to room temperature to obtain a decolorized purslane seed crude oil solution.

3. The application of purslane seed oil according to claim 2 in the preparation of cosmetics for repairing scratch damage or UVB damage to human keratinocytes, characterized in that, The decolorizing agent is selected from kaolin, attapulgite, zeolite, diatomaceous earth, alumina, food-grade coconut shell activated carbon, or a combination thereof.

4. The application of purslane seed oil according to claim 1 in the preparation of cosmetics for repairing scratch damage or UVB damage to human keratinocytes, characterized in that, The process of removing impurities and drying the purslane crude oil decolorizing solution includes: filtering the purslane seed crude oil decolorizing solution once, then adding a desiccant of 0.1 wt.% to 0.5 wt.% of the filtrate for dispersion, and filtering a second time to obtain purslane seed oil.

5. The application of purslane seed oil according to claim 4 in the preparation of cosmetics for repairing scratch damage or UVB damage to human keratinocytes, characterized in that, The filtration can be any of the following methods: plate and frame filtration, pressure filtration, or vacuum filtration.

6. The application of purslane seed oil according to claim 4 in the preparation of cosmetics for repairing scratch damage or UVB damage to human keratinocytes, characterized in that, The desiccant is selected from anhydrous magnesium sulfate, anhydrous calcium chloride, quicklime, or a combination thereof.

7. The application of purslane seed oil according to claim 1 in the preparation of cosmetics for repairing scratch damage or UVB damage to human keratinocytes, characterized in that, The purslane seed oil accounts for 1 wt.% to 5 wt.% of the total mass of the cosmetic composition.

Citation Information

Patent Citations

  • CN116831958A