PacircCNGC, a circular RNA from the golden-inlaid bamboo, and its applications
By overexpressing the circular RNA PacircCNGC in Phyllostachys edulis, the growth limitation of Phyllostachys edulis under drought conditions was solved, and the drought and salt tolerance were significantly improved, providing genetic resources and molecular breeding tools for Phyllostachys edulis breeding.
Patent Information
- Application Number
- CN202311480079.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-08
- Publication Date
- 2026-04-21
- Estimated Expiration
- 2043-11-08
AI Technical Summary
The growth of golden bamboo is limited under the high temperature and drought conditions caused by global warming, and existing breeding techniques are difficult to effectively improve its drought resistance and salt tolerance.
By using genetic engineering techniques, the expression level of the circular RNA PacircCNGC in Phoebe zhennan was overexpressed, thereby regulating the plant's drought and salt tolerance. Specific methods included introducing a vector containing the circular RNA PacircCNGC, increasing its copy number on chromosomes, altering the promoter sequence, or using enhancers.
It significantly enhanced the drought and salt resistance of plants, promoted the breeding process of Phyllostachys edulis, provided a theoretical basis and gene resources for stress-resistant molecular breeding, and broke through the limitations of conventional breeding.
Smart Images

Figure HDA0004537868730000011 
Figure HDA0004537868730000012 
Figure HDA0004537868730000013
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the circular RNA PacircCNGC of Phyllostachys edulis and its applications. Background Technology
[0002] Golden-striped bamboo (Phyllostachys aureosulcata f. spectabilis CDChu et C.S.Chao) is a species of bamboo in the genus Phyllostachys of the Poaceae family. Unlike most other landscaping bamboos, Golden-striped bamboo has pale yellow culms in its youth, gradually turning golden yellow as it matures, while naturally developing vertical, irregular bluish-green stripes on its culms. In most parts of southern my country, North China, and southern Henan, Golden-striped bamboo can remain evergreen year-round under natural growing conditions and can overwinter outdoors, thus it is widely used as a common ornamental bamboo species.
[0003] Under natural conditions, the growth of *Phyllostachys edulis* is influenced by many factors, among which water is the most crucial for its normal growth and development. In particular, global warming leading to rising temperatures and reduced precipitation, with high summer temperatures often causing drought, severely impacts the growth of *Phyllostachys edulis* under natural conditions. Therefore, under these circumstances, it is necessary to promote the improvement of *Phyllostachys edulis* species, explore new genes, and cultivate more new varieties of *Phyllostachys edulis* with strong drought and salt tolerance. Summary of the Invention
[0004] In a first aspect, the present invention provides a circular RNA PacircCNGC, the cDNA nucleotide sequence of which is shown in SEQ ID NO.1.
[0005] Preferably, the cDNA nucleotide sequence of the circular RNA PacircCNGC is shown in SEQ ID NO.2.
[0006] The structure of the circular RNA of *Phyllostachys edulis* is a circular structure formed by transcription and splicing of the nucleotide sequence shown in SEQ ID NO.1, with the ends connected. The Circ Based ID of the circular RNA PacircCNGC is hic_scaffold_8:14927508|14929885. The circular RNA PacircCNGC is composed of the 7th and 8th exons of the gene PH02Gene31681 on chromosome 8 of *Phyllostachys edulis*, and the nucleotide sequence after intron removal is shown in SEQ ID NO.2.
[0007] Secondly, the present invention provides biological materials containing the aforementioned circular RNA PacircCNGC.
[0008] Preferably, the biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria, or non-renewable plant parts.
[0009] In some embodiments, the non-renewable plant part is a plant cell or tissue; the plant cell or tissue cannot develop into a complete plant individual.
[0010] Thirdly, the present invention provides the application of the circular RNA PacircCNGC or the biological material described herein in regulating plant drought resistance and / or salt tolerance.
[0011] Fourthly, the present invention provides the application of the circular RNA PacircCNGC or the biological materials described herein in plant breeding and germplasm resource improvement.
[0012] Preferably, the plant breeding methods include transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.
[0013] In this invention, the plants include, but are not limited to, plants of the genus Arabidopsis in the family Brassicaceae or the genus Phyllostachys in the family Poaceae; preferably, the plants are Arabidopsis or Phyllostachys edulis; more preferably, the plants are Arabidopsis or Phyllostachys edulis.
[0014] Fifthly, the present invention provides a method for regulating the drought resistance and / or salt tolerance of plants, comprising: regulating the expression level of the circular RNA PacircCNGC in plants through genetic engineering methods.
[0015] Preferably, the present invention provides a method for improving the drought resistance and / or salt resistance of plants, comprising: overexpressing the circular RNA PacircCNGC in plants by means of genetic engineering.
[0016] Preferably, the overexpression mode is selected from at least one of the following 1) to 5):
[0017] 1) Introduce a vector containing cDNA of the circular RNA PacircCNGC;
[0018] 2) Increase the copy number of cDNA of the circular RNA PacircCNGC on plant chromosomes;
[0019] 3) Alter the promoter sequence of the cDNA of the circular RNA PacircCNGC on plant chromosomes;
[0020] 4) The strong promoter is operatively ligated to the cDNA of the circular RNA PacircCNGC;
[0021] 5) Import enhancers.
[0022] Preferably, the method for improving the drought resistance and / or salt resistance of plants includes: transferring the cDNA of the circular RNA PacircCNGC into Arabidopsis thaliana plants using Agrobacterium-mediated transformation to obtain transgenic Arabidopsis thaliana plants overexpressing the circular RNA PacircCNGC.
[0023] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0024] This invention, through the design of forward and backward primers combined with RNase R, verified the objective existence and confirmed that the circular RNA PacircCNGC of *Phyllostachys edulis* is indeed a closed ring. It also discovered the role of PacircCNGC in drought and salt tolerance in *Phyllostachys edulis*, providing a theoretical basis and gene resources for resistance breeding, a powerful tool for transgenic research, and valuable circular RNA for stress-resistant molecular breeding. This is of great significance for revealing the molecular mechanisms of bamboo stress resistance, overcoming the limitations of conventional breeding, and accelerating the bamboo breeding process. Attached Figure Description
[0025] Figure 1 This is an electrophoresis diagram of the PCR products of circular RNA PacircCNGC cDNA, its flanking structures, and introns; lane 1 contains the PCR products of circular RNA PacircCNGC cDNA and its flanking structures, lane 2 contains the PCR products of introns, and lane M contains the DNA marker.
[0026] Figure 2 This is a diagram for verifying the expression vector by enzyme digestion; lane M is the DL 15000 DNA Marker, lane 1 is the plasmid pCAMBIAsuper1300-GFP, lane 2 is the linearized plasmid after double digestion with Hind III-Spe I, lane 3 is the plasmid after successful insertion of PacircCNGC and other elements, and lane 4 is the linearized plasmid after double digestion with Xba I-Spe I in lane 3.
[0027] Figure 3 This is a PCR verification diagram of transgenic Arabidopsis thaliana using back primers; lane M is the DL 500 DNA Marker, lanes 1-3 are the amplified bands of PacircCNGC transgenic Arabidopsis thaliana OE1-3 using back primers, and lane 4 is the wild-type Arabidopsis thaliana PacircCNGC back primer control.
[0028] Figure 4 This is a graph showing the root viability assay of Arabidopsis thaliana with overexpression of the circular RNA PacircCNGC under mannitol treatment.
[0029] Figure 5 A graph showing the root viability assay of Arabidopsis thaliana with overexpression of the circular RNA PacircCNGC under PEG6000 treatment.
[0030] Figure 6 This is a graph showing the activity of Arabidopsis roots overexpressing the circular RNA PacircCNGC under NaCl treatment.
[0031] Figure 7 A represents the POD enzyme activity of two Arabidopsis thaliana genotypes under drought stress. Figure 7 B represents the SOD enzyme activity of two genotypes of Arabidopsis thaliana under drought stress.
[0032] Figure 8 Ca in two genotypes of Arabidopsis thaliana under drought stress 2+ content.
[0033] Figure 9 The root growth of Arabidopsis thaliana after 10 days of drought stress.
[0034] Figure 10 The expression levels of the PEX gene family in PacircCNGC transgenic Arabidopsis thaliana. Detailed Implementation
[0035] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.
[0036] Unless otherwise specified, all examples were conducted under standard experimental conditions, such as those described in Sambrook J & Russell DW, *Molecular Cloning: A Laboratory Manual* (2001), or according to the manufacturer's instructions. Reagents and instruments not explicitly named were all readily available products from reputable suppliers.
[0037] In the following examples, when constructing the overexpression vector of circular RNA, according to the "flanking intron-assisted circularization strategy", when cloning circular RNA, flanking introns of about 125 bp are extended at both ends of the circularization region to assist in circularization; the cDNA nucleotide sequence of the circular RNA and its flanking sequence are shown in SEQ ID NO.3; at the same time, a meaningless, non-expressed, and reverse complementary intron from *Phyllostachys edulis* is added to both ends of the circularization region and its flanking region to assist in circularization, and the nucleotide sequence of the intron is shown in SEQ ID NO.4.
[0038] Example 1: Cloning of cDNA and introns of the circular RNA PacircCNGC from *Phyllostachys edulis*
[0039] Total RNA was extracted from leaves of *Phyllostachys edulis*, and then RNase R enzyme was used to remove linear RNA, leaving only circRNAs. Finally, the delinearized RNA was reverse transcribed into delinearized cDNA. Plant-specific kits were used for these operations. For the DNA polymerase chain reaction (PCR), a high-fidelity enzyme was selected whenever possible. The specific procedures were strictly followed according to the manufacturer's instructions. In this example, total RNA extraction used the TRIZOL method combined with a small-volume total RNA extraction kit (Beijing Tianmo, TR251-200); RNA delinearization used a Ribonuclease R RNase R delinearization kit; reverse transcription used reverse transcriptase (Takara Bio); and the DNA polymerase used was a novel blue dye high-fidelity Taq polymerase mix (Beijing Jumei, 2×M5 HiPer plus Taq HiFi PCR mix).
[0040] The specific method is as follows:
[0041] (1) RNA delinearization:
[0042] Prepare the following reaction system according to the specific concentration of total RNA: RNA 2 μg; 10×Reaction Buffer 2 μL; RNase R 6 U; ddH2O to 20 μL. After the reaction system is prepared, place it in a 37°C water bath for 15 min, and then transfer it to a 70°C water bath for 10 min.
[0043] (2) RNA reverse transcription:
[0044] Prepare the following reaction mixture: 4 μL of 5×Primer Script RT Master Mix; 1 μg of RNA; and RNase-free water to a final volume of 20 μL. After preparation, heat the mixture in a 37°C water bath for 15 min, then immediately place it in an 85°C water bath for 5 s, and finally cool it in a 4°C refrigerator. Once the reaction mixture has completely cooled, add 80 μL of ultrapure water, mix well, and store at -20°C.
[0045] (3) Cloning of the helper circular intron, the circular region of the circular RNA PacircCNGC and its flanking regions (flanking length 100 / 125bp), primer sequences are as follows:
[0046] PacircCNGC A:GAAAAAGTTGCAGTCTGAGTAC (SEQ ID NO.5)
[0047] PacircCNGC S:CCAATTCATACTCACCTTACAC(SEQ ID NO.6)
[0048] Intron A: CTGCAGCAATTGCATAGAAG (SEQ ID NO.7)
[0049] Intron S: GTGAGTGCTTGCCTGCTT (SEQ ID NO.8)
[0050] The specific parameters for the polymerase chain reaction are as follows:
[0051] Reaction system: HiFi mix 10μL; upstream primer (10μM / L) 1μL; downstream primer (10μM / L) 1μL; DNA substrate (80ng / μL) 3μL; ultrapure water (sterilized by high temperature and high pressure) 5μL.
[0052] Reaction time: 95℃ for 3 min; 94℃ for 25 s, 55-64℃ for 25 s, 72℃ for 10-15 s / 1kb DNA, 37 cycles; 72℃ for 5 min, store the product at 4℃.
[0053] The recovered products were ligated into the pGEM-T Easy vector, transformed into DH5α competent cells, and positive clones were selected for plaque PCR detection. The positive clones were then subjected to Sanger sequencing, and the sequencing results were accurate. Figure 1 The nucleotide sequence of the circular RNA PacircCNGC gene and its flanking structures is shown in SEQ ID NO.3, and the nucleotide sequence of the introns is shown in SEQ ID NO.4.
[0054] Example 2: Construction of the plant expression vector PCAMBIAsuper1300-GFP-PacircCNGC
[0055] After cloning the target fragment, the intron fragment, the circular region cDNA of circRNAs (with flanking wings), and the reverse complementary sequence of the intron fragment are inserted into the empty vector in sequence according to the "flanking intron reverse complementation strategy".
[0056] The specific steps are as follows:
[0057] First, the circular region of circRNAs and the intron fragment were amplified and spliced by PCR. Then, the empty vector PCAMBIAsuper1300-GFP was linearized by double digestion with Hind III-Spe I. Finally, the spliced PCR product and the vector were ligated using a plant-compatible seamless cloning and recombination kit, strictly following the instructions. After successful transformation, the vector was plated, and positive clones were selected for sequencing verification. For vectors that were correctly sequenced and verified, plasmids were extracted and linearized by single digestion with Xba I. The linearized vector and the inverse complementary fragment of the intron were then ligated using a seamless cloning and recombination kit. After transformation, the vector was plated, and positive clones were selected for double digestion with Hind III-Spe I. Figure 2 After successful verification, Sanger sequencing is performed for further verification. Once successful verification, the desired overexpression vector can be obtained.
[0058] The specific steps of the double enzyme digestion experiment are as follows: Prepare the reaction system: 5 μL of 10×NEB rCutSmart buffer, 15 μL of the vector after two transformations, 1 μL of Spe I, 1 μL of Hind III, and 28 μL of sterile ultrapure water. After preparation, heat in a water bath at 37℃ for 4 h, and then detect the product bands using agarose gel electrophoresis.
[0059] The primers used in the process are as follows:
[0060] (1) PacircCNGC amplification primers:
[0061] A: (SEQ ID NO.9)
[0062] ATACACCAAATCGACTCTAGAAAGCTTGAAAAAGTTGCAGTCTGAGTACTTTCTTGCT
[0063] S:(SEQ ID NO.10)
[0064] GGTTTTAGTTCTTCTATGCAATTGCTGCAGCCAATTCATACTCACCTTACACTAATA
[0065] (2) Primers for intron fragment amplification:
[0066] A:CTGCAGCAATTGCATAGAAGAACTAAAACC(SEQ ID NO.11)
[0067] S:(SEQ ID NO.12)
[0068] CTCACCATGGTACCGGATCCACTAGTGGTGAGTGCTTGCCTGCTTGGTA
[0069] (3) Primers for amplifying intron fragment reverse complementary sequences:
[0070] A:(SEQ ID NO.13)
[0071] ATACACCAAATCGACTCTAGAAAGCTTGTGAGTGCTTGCCTGCTTGG
[0072] S:(SEQ ID NO.14)
[0073] TCTTTAATAAGAAACCCAGTGCCCTGCAGCAATTGCATAGAAG
[0074] Example 3: Transformation of Arabidopsis thaliana with the plant expression vector PCAMBIAsuper1300-GFP-PacircCNGC
[0075] (1) Thaw Agrobacterium competent cells in ice water. After thawing completely, add 1 μg of the constructed overexpression vector plasmid DNA to the Agrobacterium competent cells under aseptic conditions, gently mix with a pipette tip, and place back into ice water for 5 min. Place centrifuge tubes in liquid nitrogen and freeze for 5 min. Then immediately transfer the centrifuge tubes to a 37°C water bath and heat for 5 min. Finally, place the centrifuge tubes back into ice water for 5 min.
[0076] (2) Under aseptic conditions, add 800 μL of antibiotic-free YEP medium and incubate in a shaker at 28°C and 200 rpm for 2-3 hours. For solid YEP medium, add 100 μL of kanamycin sulfate (Kan) and 50 μL of rifampicin solution to every 100 mL of medium. Under aseptic conditions, take 20-60 μL of bacterial suspension and spread it onto the solid YEP medium containing antibiotics. After the bacterial suspension is completely dried, invert it in an incubator at 28°C and incubate for 2-3 days until colonies grow. For liquid YEP medium, after sterilization, add the antibiotics Kan and rifampicin. Pick colonies from the plate and place them into YEP medium, then incubate in a shaker at 28°C and 200 rpm for about 12-14 hours.
[0077] (3) PCR amplification and Sanger sequencing were performed using Agrobacterium bacterial culture as a substrate to ensure that the target gene and introns were completely transferred into Agrobacterium. The correctly tested Agrobacterium culture was transferred to YEP medium with antibiotics and cultured until the OD value reached 1.0-1.2. The culture with the target OD value was transferred to a 50 mL enzyme-free centrifuge tube and centrifuged at 4000 rpm for 15 min at 4℃. After centrifugation, the precipitate was collected, and an invasion dye was added to the precipitate. Silwet L-77 adsorbent was added to the invasion dye at a rate of 250 μL per 50 mL of invasion dye.
[0078] The formulation of the inoculum solution is as follows (per 100 mL): MS powder 0.43 g; sucrose 20 g. Adjust the pH to 5.8-6.0, sterilize in a high-temperature autoclave for 20 minutes, and then cool to room temperature before use.
[0079] (4) Treatment of Arabidopsis thaliana plants used for infection:
[0080] The Arabidopsis plants were cultivated until they produced several flower stalks, and watered thoroughly one day in advance. During infection, the opened flowers and pods were removed, leaving only the unopened flower buds. The Arabidopsis flower stalks were immersed in the infection solution for 45 seconds, and then the infected Arabidopsis were placed in the dark for 24 hours. Finally, they were placed in a constant temperature incubator for normal cultivation.
[0081] (5) Screening of positive plants:
[0082] After infecting Arabidopsis thaliana, place the Arabidopsis thaliana in a constant temperature incubator and culture normally until pods form. After the seeds are fully mature and completely dried, collect the seeds and screen them.
[0083] Hygromycin B solution was added to solid 1 / 2 MS medium, with 75 μL of hygromycin B solution added per 100 mL of MS medium. Sterilized seeds were sown in the medium in a clean bench and vernalized at 4°C for 48 h. Then, the seeds were transferred to a tissue culture room for further cultivation. After approximately 10 days, positive Arabidopsis seedlings showed normal growth, while wild-type Arabidopsis only exhibited simple germination and failed to grow and leaf out normally. Total RNA was extracted from the positive Arabidopsis plants and reverse transcribed to obtain cDNA. PCR amplification was performed using the reverse primer of the circular RNA, and the bands were detected by agarose gel electrophoresis. Sanger sequencing was also used to ensure the presence of the introduced DNA fragment in the transgenic plants. Figure 3 Successfully transferred positive Arabidopsis seedlings were selected as the T1 generation, and further screening and culture were carried out until the T3 generation of positive transgenic Arabidopsis lines were obtained.
[0084] The primer sequences used to verify positive plants are as follows:
[0085] divergent F:ACTGGGGTTGTTTGCTTTTTG(SEQ ID NO.15)
[0086] divergent R:ACCACTGCTGCCTCTTTTGT(SEQ ID NO.16)
[0087] Example 4: Detection of growth morphological indicators of transgenic Arabidopsis thaliana seedlings at 7 days old under drought and salt stress.
[0088] (1) Categories and levels of stress treatment
[0089] Several gradients of simulated drought stress culture media were prepared using PEG6000 (polyethylene glycol) and mannitol respectively to test the root development of Arabidopsis thaliana under drought stress. This experiment used solid 1 / 2 MS medium, with PEG6000 and mannitol added to simulate drought stress, and the specific concentration gradients are as follows:
[0090] PEG simulated drought: 0% PEG6000; 2% PEG6000; 4% PEG6000; 6% PEG6000.
[0091] Mannitol simulated drought: 0 mmol / L mannitol; 100 mmol / L mannitol; 200 mmol / L mannitol; 300 mmol / L mannitol; 400 mmol / L mannitol.
[0092] NaCl simulated salt stress: 0 mmol / L NaCl; 100 mmol / L NaCl; 150 mmol / L NaCl; 200 mmol / L NaCl.
[0093] (2) Transplanting Arabidopsis thaliana seedlings
[0094] Wild-type Arabidopsis thaliana seedlings (7 days old) growing on standard 1 / 2 MS medium and T3 generation transgenic Arabidopsis thaliana seedlings were placed on the surface of a gradient-simulated culture medium, ensuring the growth points of the seedlings were aligned horizontally as much as possible. Each gradient included one group of wild-type Arabidopsis thaliana seedlings and three groups of transgenic Arabidopsis thaliana seedlings from different lines. Each group contained three Arabidopsis thaliana seedlings from the same line with approximately the same root length and growth status. After the Arabidopsis thaliana seedlings were placed, the culture medium was placed vertically in a tissue culture room for incubation. After 7 days of continued incubation, the root length, number of lateral roots, and true leaf growth status, size, and color of the transgenic and wild-type Arabidopsis thaliana seedlings were observed under different drought and salt stress gradients.
[0095] (3) Observation of the growth morphology of transgenic Arabidopsis thaliana
[0096] After 7 days of drought stress, root elongation in wild-type Arabidopsis thaliana was significantly inhibited in the high-concentration stress medium, and the number of lateral roots was also significantly reduced. In contrast, the roots of transgenic Arabidopsis thaliana were significantly longer than those of wild-type, with more lateral roots, and were less affected. Their root activity was also greater in the stress medium than that of wild-type roots. Furthermore, the leaves of transgenic Arabidopsis thaliana were larger, had more true leaves, and showed less yellowing and drying than those of wild-type. Figure 4 , Figure 5 ).
[0097] Example 5: Drought resistance test of transgenic Arabidopsis thaliana seedlings at 20 days old.
[0098] When the transgenic Arabidopsis T3 generation reached 20 days of age, healthy and well-grown Arabidopsis seedlings were selected for subsequent drought resistance testing.
[0099] Transgenic Arabidopsis thaliana plants in good growth condition and wild-type Arabidopsis thaliana plants were thoroughly watered the night before. Water was then withheld to allow for natural drought. The control group was not subjected to water withholding and was watered normally throughout the entire process. Simultaneously, samples were collected on days 0, 2, 4, 6, and 8. Arabidopsis thaliana leaves were immediately flash-frozen in liquid nitrogen for dehydration and then stored at -80°C. The activities of peroxidase (POD), superoxide dismutase (SOD), and calcium in Arabidopsis thaliana leaves under each drought treatment were measured using ultraviolet spectrophotometry. 2+ Ion concentration.
[0100] Without drought treatment, the POD and SOD activities of the PacircCNGC transgenic Arabidopsis were slightly higher than those of the wild type. The two enzyme activities were essentially the same in both genotypes, with no significant differences. However, with increasing drought duration, the POD and SOD activities of the transgenic strain were higher than those of the wild type, indicating that the circular RNA improved the drought resistance of Arabidopsis under arid conditions. Figure 6 Ca was detected in PacircCNGC transgenic Arabidopsis and wild-type Arabidopsis. 2+ Ion concentrations, the results showed, were higher in PacircCNGC transgenic Arabidopsis thaliana than in other strains. 2+ The ion concentration was higher than that of wild-type Arabidopsis, and the Ca concentration increased with increasing drought severity. 2+ The ion content gradually increased. This result indicates that, in order to regulate the osmotic pressure within the plant and ensure the plant's absorption of water, the transgenic plants increased their calcium absorption. 2+ The absorption of ions increases the osmotic pressure within the plant, maintaining water uptake and normal leaf growth. Figure 7 , Figure 8 ).
[0101] Furthermore, after ten days of drought, Arabidopsis thaliana was dug out of the soil, and the roots were washed clean. Observation of root growth revealed that the roots of the PacircCNGC transgenic Arabidopsis thaliana were significantly longer and more extensive than those of the wild-type Arabidopsis thaliana, with a marked increase in the number of lateral roots. Figure 9 ).
[0102] Note: Soil moisture content for each drought gradient is as follows: 0d: 39.02%; 2d drought: 37.98%; 4d drought: 28.28%; 6d drought: 19.35%; 8d drought: 10.50%.
[0103] Example 6: CNGC family gene expression analysis in transgenic Arabidopsis thaliana
[0104] The parent gene PH02Gene31681 of the circular RNA belongs to the CNGC family (cyclic nucleotide-gated channels). To explore the specific regulatory process of the circular RNA on its parent gene, two genes in this gene family were selected for subsequent experiments. Primers for these genes were designed using Primer Premier 5 software, and 18S (18S ribosomal RNA) was used as an internal control gene. Its expression level was detected using real-time quantitative PCR. The primers used are as follows:
[0105] Arabidopsis thaliana-CNGC2:
[0106] S:GGCGTGTCTTTACATGGATGGT(SEQ ID NO.17)
[0107] A:CCACAACCAACGACAAGCGACT(SEQ ID NO.18)
[0108] Arabidopsis thaliana-CNGC1:
[0109] S:CTTTGGGATATTCCTTGACGCAC(SEQ ID NO.19)
[0110] A:ACCCTCATCTCCTCCAATCTCG(SEQ ID NO.20)
[0111] Arabidopsis thaliana-18S:
[0112] S:ATCCAAGGAAGGCAGCAGG(SEQ ID NO.21)
[0113] A:GAAGGGACAAGCCGACCAA(SEQ ID NO.22)
[0114] In Arabidopsis plants overexpressing PacircCNGC, the expression level of the CNGC1 gene was significantly increased, while the expression level of the CNGC2 gene was slightly increased. This preliminarily demonstrates that PacircCNGC enhances the drought and salt tolerance of Arabidopsis plants by promoting the high expression of genes such as CNGC1 and CNGC2 within the CNGC gene family. Figure 10 ).
[0115] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A method for improving drought and salt tolerance in plants, characterized by, Comprising: overexpressing a circular RNA PacircCNGC in a plant body by a method of genetic engineering; a cDNA nucleotide sequence of the circular RNA PacircCNGC is shown as SEQ ID NO. 2; the plant is Arabidopsis thaliana or Pachyiphyllum.
2. The method of claim 1, wherein, The overexpression is in the form of introducing a vector containing the cDNA of the circular RNA PacircCNGC.
3. The method of claim 1, wherein, The overexpression is in the form of increasing the copy number of the cDNA of the circular RNA PacircCNGC on the chromosome of the plant.
4. The method of claim 1, wherein, The overexpression is in the form of operably linking a strong promoter to the cDNA of the circular RNA PacircCNGC.