A special intestinal protective agent for scorpionfish and its application

Abstract

The present invention discloses a special intestinal protective agent for Xu's flathead mullet and its application, belonging to the technical field of aquatic feed additives. It is composed of the following components in parts by weight: 0.3-1 parts of plant polyphenols, 3-5 parts of antimicrobial peptides, 15-25 parts of taurine and 20-30 parts of arginine. The present invention prevents and repairs intestinal damage caused by food sources and environmental factors from multiple angles such as anti-inflammatory, antibacterial, anti-oxidant, and promoting the growth of mucosal cells, promotes the growth of intestinal mucosa, ensures the integrity of intestinal structure, increases intestinal absorption surface area, improves the body's antioxidant performance, relieves intestinal inflammation, enhances the body's immunity, and has a certain attractant effect, improves feed efficiency, is safe and efficient, has no toxic side effects, and is environmentally friendly.

Description

Technical Field

[0001] The invention relates to the technical field of aquatic feed additives, and in particular to a special intestinal protective agent for flathead mullet and its application. Background Art

[0002] The flatfish is an important species of artificial breeding in the northern coastal areas of my country. It is characterized by its resistance to low temperatures, strong reproductive capacity, and natural overwintering. In recent years, with the rapid development of cage aquaculture technology, the scale and output of the flatfish cage aquaculture have increased year by year. However, due to the influence of factors such as the breeding environment, stocking density, and seed source, the flatfish breeding has suffered from frequent diseases and a decreased survival rate, which has seriously restricted the healthy development of the flatfish industry.

[0003] The intestine is the main place for fish to absorb nutrients and is also the largest immune organ in the body. It is not only responsible for the absorption and metabolism of nutrients, but also for the defense against the invasion of pathogens and the body's immunity. However, in cage culture of Xu's flatfish, the dual stress of low temperature and hunger in winter, infection by bacterial pathogens, and anti-nutritional factors in plant protein sources can cause intestinal damage to Xu's flatfish. Intestinal health issues have become one of the important factors restricting the efficiency of Xu's flatfish farming.

[0004] In terms of drugs for treating intestinal problems, the country has been paying more and more attention to food safety and ecological environment in recent years. Antibiotics have been banned because they are easy to develop drug resistance and are harmful to human health. In terms of treatment methods, in the process of cage farming in natural sea areas (especially deep-sea farming), water exchange is fast. Once fish are sick, drug spraying and mixing with bait cannot play a good therapeutic effect and will have an adverse effect on the ecological environment of the surrounding sea areas. Therefore, it is an urgent problem to provide an intestinal protective agent that can be added to compound feed to prevent and repair intestinal damage, inhibit bacterial infection, and improve the body's resistance, thereby ensuring the healthy and sustainable development of Xu's flatfish farming. Summary of the invention

[0005] The purpose of the present invention is to provide a special intestinal protective agent for flatfish and its application, so as to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] One of the technical solutions of the present invention is an intestinal protective agent specially used for flatfish, which is composed of the following components in parts by weight: 0.3 to 1 part of plant polyphenols, 3 to 5 parts of antimicrobial peptides, 15 to 25 parts of taurine and 20 to 30 parts of arginine.

[0008] Plant polyphenols are complex phenolic secondary metabolites in plants. They have antibacterial, anti-inflammatory and antioxidant effects. They can scavenge active oxygen free radicals in the body, improve the body's antioxidant capacity, maintain the integrity of tissue structure and enhance the body's disease resistance.

[0009] Antimicrobial peptides are a class of small molecule polypeptides with antibacterial effects. They are widely present in organisms and are an important component of the body's immune defense system. They have inhibitory effects on parasites, bacteria, viruses, fungi, etc., and have the functions of repairing intestinal cells, balancing intestinal flora, inhibiting pathogen infection, and enhancing the body's immunity.

[0010] Taurine is a small molecule β-sulfur non-protein amino acid, which is rich in fish meal and almost non-taurine in plant protein raw materials. Taurine can protect cells and improve the body's immunity. It can also combine with bile acid to form bile, promote the body's digestion and absorption of lipids and fat-soluble nutrients. Its metabolic intermediates can regulate the body's immune response and eliminate inflammation by downregulating the production of pro-inflammatory factors such as interleukins, tumor necrosis factor-α, and nitric oxide synthase, and has a certain appetite-inducing effect.

[0011] L-arginine is an essential amino acid for fish. It is involved in the synthesis of proteins and pyrimidines, and the release of hormones. It is a precursor for the synthesis of biologically active substances such as polyamines, creatine, glutamate, proline and nitric oxide. It participates in various metabolic regulations such as growth, immunity, and endocrine system, and plays an important role in cell growth, tissue regeneration, and inflammation repair.

[0012] The invention provides a protective agent for preventing and repairing intestinal damage of Xu's flatfish. Specifically, plant polyphenols, antimicrobial peptides, taurine and L-arginine are mixed in proportion and added into compound feed, so that the protective agent has the effects of anti-inflammatory, antibacterial, antioxidant and intestinal mucosal cell repair, thereby achieving the purpose of promoting growth, improving body immunity, protecting intestinal structure and improving breeding efficiency.

[0013] The second technical solution of the present invention is the use of the intestinal protective agent specifically for S. philippinarum in the breeding of S. philippinarum.

[0014] The third technical solution of the present invention is a feed special for Xu's flathead mullet, comprising the above-mentioned intestinal protective agent special for Xu's flathead mullet.

[0015] A fourth technical solution of the present invention is a method for breeding flatfish, comprising feeding the flatfish with the special feed for flatfish.

[0016] Based on the above technical solution, the present invention has the following technical effects:

[0017] ① This intestinal protective agent contains plant polyphenols, antimicrobial peptides, taurine and L-arginine. The four active ingredients work together to effectively make up for the single function of each ingredient when used alone. It plays a role in intestinal damage repair from multiple angles such as anti-inflammatory, antibacterial, anti-oxidation, and promoting mucosal cell growth, improves the body's antioxidant properties, relieves intestinal inflammation, and enhances the body's immunity;

[0018] ② The protective agent is used to prevent and repair intestinal damage caused by feeding high-plant protein feed and low temperature and hunger stress during the winter. It does not produce drug resistance, is safe and efficient, has no toxic side effects, and is environmentally friendly;

[0019] ③This protective agent can increase the relative expression of intestinal tight junction protein genes, ensure the integrity of the intestinal structure, promote the growth of intestinal mucosa, increase the intestinal absorption surface area, improve the digestion and absorption rate of feed, and improve the breeding efficiency of Xu's flatfish. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 The intestinal tissue structure of the flatfish induced by a high soybean meal diet, where a shows that the height of the fish intestinal folds is reduced, b shows that the nuclei of the single-layer columnar epithelial cells of the intestinal villi are disordered, the lamina propria is wide, and a large number of inflammatory cells infiltrate under the lamina propria and mucosal epithelium;

[0022] Figure 2 The effect of intestinal protective agents on the relative expression of Occludin in the intestine of experimental fish;

[0023] Figure 3 The intestinal protective agent repairs the intestinal tissue structure of the flathead raccoon;

[0024] Figure 4 This is the intestinal tissue structure of the flatfish after wintering.

[0025] Figure 5 It is an intestinal protective agent for repairing the intestinal tissue structure of juvenile scorpionfish after wintering;

[0026] Figure 6 It is an intestinal protective agent for repairing the intestinal tissue structure of the flathead mullet during the post-wintering stage;

[0027] Figure 7 This is a transmission electron micrograph of the intestine of adult Scorpionfish after overwintering. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0033] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or are publicly available.

[0034] The embodiment of the present invention provides a special intestinal protective agent for Xu's flathead mullet, which is composed of the following components in parts by weight: 0.3 to 1 part of plant polyphenols, 3 to 5 parts of antimicrobial peptides, 15 to 25 parts of taurine and 20 to 30 parts of arginine.

[0035] In some specific embodiments, the intestinal protective agent specifically for Xu's flathead mullet, aimed at intestinal damage caused by ingesting high-plant protein compound feed, is composed of the following components in parts by weight: 1 part of plant polyphenols, 5 parts of antimicrobial peptides, 20 parts of taurine and 30 parts of arginine.

[0036] In some specific embodiments, in order to target intestinal damage caused by environmental and hunger stress during the winter, the intestinal protective agent specifically for Xu's flathead mullet is composed of the following components in parts by weight: 1 part of plant polyphenols, 3 parts of antimicrobial peptides, 25 parts of taurine and 20 parts of arginine.

[0037] The embodiment of the present invention provides the use of the intestinal protective agent dedicated to S. schrenkiana in S. schrenkiana breeding.

[0038] The embodiment of the present invention provides a feed special for Scolopendra subspinipes, comprising the intestinal protective agent special for Scolopendra subspinipes.

[0039] In some specific embodiments, the amount of the intestinal protective agent specifically for flatfish in the feed is 3.83% to 6.1%, preferably 4.9% to 5.6%.

[0040] The embodiment of the present invention provides a method for breeding flatfish, which uses the flatfish-specific feed to feed the flatfish.

[0041] In some specific embodiments,

[0042] The plant polyphenols in the embodiment of the present invention are from commercially available plant polyphenols (Shandong Lien Biotechnology Co., Ltd.), and the main components are carnosic acid, resveratrol, tannin, quercetin, sanguisorba officinalis and other polyphenols. The main role of the protective agent is to remove active oxygen free radicals and repair damaged intestinal mucosal cells.

[0043] The antimicrobial peptides in the embodiments of the present invention are commercially available antimicrobial peptides (Shandong Deep Sea Biological Co., Ltd.), which are small molecule polypeptides extracted from microorganisms. The main functions of the protective agent are to inhibit bacterial infection, balance intestinal flora, etc.

[0044] The taurine in the embodiment of the present invention is commercially available taurine with a purity of ≥99%. The main functions of the taurine in the protective agent are to reduce inflammatory response, promote intestinal cell proliferation, improve intestinal mucosal structure, alleviate oxidative damage, induce appetite, etc.

[0045] The L-arginine in the embodiment of the present invention is commercially available L-arginine with a purity of ≥98%. The main function of the L-arginine in the protective agent is to promote cell growth, tissue regeneration and inflammation repair.

[0046] Example 1

[0047] Repairing effect of intestinal protective agent on intestinal damage of Scorpio schrenkiana induced by high soybean meal diet

[0048] 1. Experimental Methods

[0049] 1. Experimental subjects

[0050] The same batch of juvenile flatfish, which had been fed with a high soybean meal (40%) feed for 28 days and had caused intestinal damage, were selected as the research subjects. 364 juvenile flatfish of uniform size (54.96±0.10g) were selected, and the hind intestines (0.8cm) of 4 fish were taken before the experiment to make initial fish intestinal tissue sections. Figure 1 As shown, the height of the intestinal folds of the initial fish was lower ( Figure 1 Middle (a), the nuclei of the single-layer columnar epithelial cells of the intestinal villi are disordered, the lamina propria is wide, and a large number of inflammatory cells infiltrate the lamina propria and the subepithelial mucosa ( Figure 1 (b), the bidirectional arrows in the figure indicate the width of the lamina propria, and the arrows indicate the disordered arrangement of the nuclei of the single-layer columnar epithelial cells, and a large number of inflammatory cells infiltrated under the mucosal epithelium). The remaining 360 fish were randomly divided into 3 groups, each with 3 replicates and 40 fish in each replicate.

[0051] (II) Feeding method

[0052] Three barrels of experimental fish were randomly selected to be fed with soybean meal group feed, three barrels of experimental fish were fed with fish meal group feed, and three barrels were fed with protectant group feed. The specific feed formula and nutritional composition are shown in Table 1. The initial feeding amount was 1% of the fish wet weight, and the feeding amount was adjusted to apparent satiation according to the feeding situation. The breeding experiment lasted for 6 weeks.

[0053] Table 1 Experimental feed formula and nutritional composition (g / kg)

[0054]

[0055]

[0056] Note: ① α-starch 60g / kg; vitamin mixture 10g / kg; mineral mixture 10g / kg; antioxidant 1g / kg; choline chloride 5g / kg; betaine 10g / kg; soy lecithin 10g / kg. Microcrystalline cellulose is a common balancing substance in aquatic feeds and is not absorbed by the intestines. Therefore, the increase in its addition will not cause changes in weight gain rate and specific intestinal weight.

[0057] (III) Experimental sample collection

[0058] After the 6-week breeding experiment, the fish in each barrel were counted and weighed for the calculation of weight gain rate. Ten fish were randomly selected for anesthesia, and the internal organs were separated after blood was collected from the tail vein. The intestinal fat of 6 fish was dissected and the intestinal weight was weighed for the calculation of specific intestinal weight. About 1 cm of the hind intestine was quickly placed in liquid nitrogen for the determination of the relative expression of intestinal tight junction protein genes; the hind intestine (0.8 cm) of the remaining 4 fish was fixed in Bouin's solution for 24 hours and then transferred to 70% alcohol for the preparation of tissue sections.

[0059] (IV) Real-time fluorescence quantitative PCR detection

[0060] After extracting mRNA from the collected hindgut samples, the RNA concentration and purity were tested, and 1% agarose gel electrophoresis was used to detect RNA integrity and genomic contamination. After reverse transcription into cDNA, real-time fluorescence quantitative PCR analysis was performed. Ribosomal protein L17 (RPL17, forward primer: AGGCGACGCACCTACCG, reverse primer: CCTCTGGTTTGGGGACGA) was used as the internal reference gene. -ΔΔCt The relative expression level of the target gene Occludin (amplification efficiency was 1.03, forward primer: ACACCACAGGAGGAGAAACG, reverse primer: CTCTAAGGTCGG CATCAAATT) was calculated.

[0061] 2. Experimental Results

[0062] (I) Effects of intestinal protective agents on weight gain rate and specific intestinal weight of experimental fish

[0063] The experimental results are shown in Table 2. For the experimental fish suffering from soybean meal-type enteritis, the use of intestinal protectants significantly increased the weight gain rate of the experimental fish (P < 0.05), and was significantly higher than the positive control fish meal group (P < 0.05); the specific intestinal weight of the protectant group was significantly lower than that of the soybean meal group (P < 0.05).

[0064] Table 2 Effects of intestinal protective agents on weight gain rate and specific intestinal weight of experimental fish

[0065]

[0066] (II) Effects of intestinal protective agents on the relative expression of intestinal tight junction protein genes

[0067] Depend on Figure 2 It can be seen that compared with the soybean meal group, the relative expression level of Occludin gene in the intestine of the experimental fish in the protective agent group was significantly upregulated (P < 0.05), and there was no significant difference between the fish meal group and the soybean meal group (P > 0.05).

[0068] (III) Effects of intestinal protective agents on the intestinal tissue structure of experimental fish

[0069] Depend on Figure 3 It can be seen that the intestinal structure of the experimental fish in the soybean meal group was different from that of the initial fish ( Figure 1 ) are similar, with lower intestinal fold height ( Figure 3 In the soybean meal group a), the nuclei of intestinal villus epithelial cells were disordered, the number of goblet cells was small, the lamina propria was wide, and there were still a large number of inflammatory cells infiltrating in the lamina propria and under the mucosal epithelium ( Figure 3In the soybean meal group b, the double-headed arrows in the figure indicate the width of the lamina propria, and the arrows in the soybean meal group b indicate the disordered arrangement of the cell nuclei), and the height of the intestinal villi of the experimental fish in the fish meal group increased ( Figure 3 In the fish meal group a), the nuclei of the single-layer columnar epithelial cells were arranged neatly, but the width of the lamina propria was still wide, and the infiltration of inflammatory cells in the mucosal epithelium was improved compared with the negative control group ( Figure 3 Fish meal group b, the arrow in fish meal group b indicates that the inflammatory cell infiltration is improved compared with the soybean meal group). Figure 3 The protective agent group a) was significantly higher than the soybean meal group, the width of the lamina propria was significantly reduced, the nuclei of the single-layer columnar epithelial cells were arranged neatly, the number of goblet cells increased, and no inflammatory cell infiltration occurred ( Figure 3 Protective agent group b: The arrows in protective agent group b indicate neatly arranged cell nuclei and no inflammatory infiltration occurs).

[0070] Example 2

[0071] Repair of the intestinal tract of juvenile Scorpionfish after wintering by intestinal protective agent

[0072] 1. Experimental Methods

[0073] 1. Experimental subjects

[0074] The juveniles of Scorpionfish that had overwintered in natural waters for four months were selected as the research subjects. 184 Scorpionfish of uniform size (25.13±3.68g) were selected. Before the experiment, the hind intestines (0.8cm) of four fish were randomly taken and placed in Bouin's solution for the preparation of initial fish intestinal tissue sections. Figure 4 As shown, the intestinal folds of the initial fish were atrophied and reduced in height ( Figure 4 Middle (a), the nuclei of the single-layer columnar epithelial cells are disordered, the lamina propria is wide, and a large number of inflammatory cells infiltrate the lamina propria and the subepithelial mucosa ( Figure 4 The remaining 180 fish were randomly divided into two groups, with three replicates in each group and 30 fish in each replicate.

[0075] (II) Feeding method

[0076] Three buckets of experimental fish were randomly selected to be fed with the control group feed, and the other three buckets of experimental fish were fed with the protectant group feed. The specific feed formula and nutritional composition are shown in Table 3. The fish were fed twice a day at regular intervals (8:00 and 16:00), with the initial feeding amount being 1% of body weight. The feeding amount was adjusted in time according to the feeding situation to the apparent satiation. The breeding experiment lasted for 4 weeks.

[0077] Table 3 Feed formula and nutritional composition (g / kg)

[0078]

[0079] Note: ② Fish oil 80mg / kg; α-starch 80mg / kg; vitamin mixture 10g / kg; mineral mixture 10g / kg; antioxidant 1g / kg; choline chloride 5g / kg; betaine 10g / kg; soy lecithin 10g / kg.

[0080] (III) Experimental sample collection

[0081] After the breeding experiment, 4 fish were randomly selected from each barrel and anesthetized. Blood was collected from the tail vein and the internal organs were separated. The intestinal fat was dissected and the hind intestine (0.8 cm) was fixed in Bouin's solution for 24 h and then transferred to 70% alcohol for storage for the preparation of tissue sections.

[0082] 2. Experimental Results

[0083] Depend on Figure 5 It can be seen that after 4 weeks of feeding with the control group and the protective agent group, the fish Figure 4 ) compared with the control group, the height of intestinal folds and the infiltration of inflammatory cells under the mucosal epithelium were not significantly improved ( Figure 5 The height of intestinal folds of the experimental fish in the protective agent group was significantly higher than that in the fish meal control group ( Figure 5 In the medium protective agent group a), the cell nuclei were neatly arranged in the middle and lower part of the single-layer columnar epithelial cells, and the width of the lamina propria was reduced ( Figure 5 Medium protective agent group b).

[0084] Example 3

[0085] Repair of the intestinal tract of Scorpionfish in the grow-out stage after wintering by intestinal protective agents

[0086] 1. Experimental Methods

[0087] 1. Experimental subjects

[0088] The cultured flatfish of Xu's striped mullet that overwintered in cages in natural waters for about 4 months were selected as the experimental subjects. 72 flatfish of uniform size and strong physique were selected and randomly divided into 2 groups, with 3 replicates in each group and 12 fish in each replicate.

[0089] (II) Feeding methods and breeding management

[0090] The two experimental groups were fed with control group and protective agent group feeds (Table 4), respectively. The feeding amount was adjusted to apparent satiation according to the feeding situation. The experiment lasted for 3 weeks.

[0091] Table 4 Example 3 Experimental feed formula and nutritional composition (g / kg)

[0092]

[0093] Note: ③ Gluten 80mg / kg; fish oil 70mg / kg; vitamin mixture 10mg / kg; mineral mixture 10mg / kg; antioxidant 1mg / kg; choline chloride 5mg / kg; betaine 10mg / kg; soy lecithin 10mg / kg.

[0094] (III) Experimental sample collection

[0095] After the breeding was completed, 7 fish were taken from each barrel to separate the internal organs, and the hind intestines (0.8 cm) of 4 fish were taken to make tissue sections. The hind intestines of another 3 fish were cut open and cut into 1*1*3 mm rectangles in 2.5% glutaraldehyde fixative for the preparation of intestinal transmission electron microscopy.

[0096] 2. Experimental Results

[0097] (I) Effects of intestinal protective agents on the intestinal tissue structure of experimental fish

[0098] From Table 5 and Figure 6 It can be seen that the intestinal fold height (DH) of the protective agent group was significantly higher than that of the control group. Figure 5 The control group 2 showed that the nuclei of intestinal epithelial cells were arranged in a disorderly manner (indicated by the arrows), the number of goblet cells was small, the lamina propria was wide, and a large number of inflammatory cells infiltrated in the lamina propria and under the mucosal epithelium. The protective agent group 2 showed that the nuclei of epithelial cells were neatly arranged in the lower and upper parts of the cells, the number of goblet cells increased, the width of the lamina propria was significantly reduced, and the inflammatory infiltration in the lamina propria and under the mucosal epithelium was significantly improved.

[0099] Table 5 Effects of intestinal protective agents on the intestinal tissue structure of Scorpionfish during the post-wintering grow-out stage

[0100]

[0101]

[0102] (II) Transmission electron microscopy of the intestine

[0103] According to transmission electron microscopy ( Figure 7 ), control group 1 (4000×) showed that the microvilli of the intestinal mucosal single-layer columnar epithelial cells were sparse, and there were a large number of lipid droplets in the single-layer columnar epithelial cells; control group 2 (25000×) showed that the tight junction gaps near the luminal surface were enlarged; protective agent group 1 showed that the microvilli of the intestinal mucosal epithelial cells were arranged neatly and orderly, the microvilli were uniform in length, and there were no lipid droplets in the cells; protective agent group 2 showed that the tight junctions between epithelial cells were tight and the structure was clear.

[0104] In summary, the present invention provides a special intestinal protective agent for scorpionfish. The protective agent is applied to the compound feed of scorpionfish, which can prevent and alleviate the intestinal structure and function damage caused by eating a large amount of plant protein or the dual stress of environment and hunger during wintering, and has the function of maintaining the integrity of the intestinal structure, improving the body's antioxidant and anti-inflammatory abilities, and has a certain appetite-inducing effect.

[0105] The present invention prevents and repairs intestinal damage caused by food-based and environmental factors from multiple angles such as anti-inflammatory, antibacterial, anti-oxidant, and promoting mucosal cell growth, promotes the growth of intestinal mucosa, ensures the integrity of intestinal structure, increases intestinal absorption surface area, improves the body's antioxidant properties, relieves intestinal inflammation, enhances the body's immunity, and has a certain appetite-inducing effect, thereby improving feed efficiency. It is safe and efficient, has no toxic side effects, and is environmentally friendly.

[0106] Obviously, the above embodiments of the present invention are merely examples for clearly explaining the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A special intestinal protective agent for scorpionfish, characterized in that: The invention is composed of the following components in parts by weight: 0.3-1 parts of plant polyphenols, 3-5 parts of antimicrobial peptides, 15-25 parts of taurine and 20-30 parts of arginine; The intestinal protective agent specifically for the flatfish significantly increases the relative expression of the Occludin gene in the intestine of the flatfish, and repairs the tight junction structure between the monolayer columnar epithelial cells of the intestinal mucosa.

2. The intestinal protective agent for the flathead mullet according to claim 1, characterized in that: The invention is composed of the following components in parts by weight: 1 part of plant polyphenols, 5 parts of antimicrobial peptides, 20 parts of taurine and 30 parts of arginine.

3. The intestinal protective agent for Scorpionfish according to claim 1, characterized in that: The invention is composed of the following components in parts by weight: 1 part of plant polyphenols, 3 parts of antimicrobial peptides, 25 parts of taurine and 20 parts of arginine.

4. A special feed for Xu's flathead mullet, characterized in that: The invention comprises the intestinal protective agent for flatfish according to any one of claims 1 to 3.

5. The special feed for Scorpionfish according to claim 4, characterized in that: The addition amount of the special intestinal protective agent for flatfish in the feed is 3.83%~6.1%.

6. The feed for Scorpionfish according to claim 5, characterized in that: The intestinal protective agent specially used for flatfish is added in an amount of 4.9% to 5.6% in the feed.

Images