An ABA-inducible promoter and recombinant vector constructed based on ABA response elements and their application in improving the genetic transformation efficiency of Cucurbitaceae plants

Abstract

The present invention discloses an ABA-inducible promoter constructed based on an ABA response element, a recombinant vector, and an application thereof in improving the genetic transformation efficiency of Cucurbitaceae plants, relating to the technical field of plant genetic engineering. The present invention constructs a plant overexpression vector based on the inducible promoter CAEA and containing morphogenic genes, uses melon "P147", cucumber "Cu2" and pumpkin "Jingxinzhen No. 4" as materials, and performs genetic transformation using an Agrobacterium-mediated method. By comparing the transformation efficiency with that of empty transformation materials and transformation materials without the inducible promoter CAEA, it is found that the use of the CAEA promoter can significantly reduce the adverse effects of the introduction of morphogenic genes and improve the transgenic efficiency, thereby producing healthy transgenic plants. Ultimately, the inducible expression system is successfully applied to gene editing of melon, cucumber and pumpkin.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to an ABA-inducible promoter and a recombinant vector constructed based on an ABA response element, and applications thereof in improving the genetic transformation efficiency of Cucurbitaceae plants. Background Art

[0002] The Cucurbitaceae family comprises approximately 115 genera and 960 species. Cucurbitaceae fruits, formed by the enlargement of the inferior ovary, are known as gourds and have diverse appearances and flavors, encompassing a wide variety of vegetable and fruit crops. The rich Cucurbitaceae germplasm resources include major horticultural crops with high nutritional and economic value, as well as model plants for studying plant development and crop improvement. Melon, cucumber, and pumpkin are among the most important horticultural crops in the Cucurbitaceae family, cultivated worldwide. Improving the agronomic traits of these Cucurbitaceae crops has garnered considerable research attention. After years of research, genetic transformation and gene editing systems have been successfully established for a variety of Cucurbitaceae crops, including melon, cucumber, and pumpkin. For example, an "optimal infiltration intensity" strategy, combining multiple adjunctive methods, has been proposed for genetic transformation of melon. Researchers used ultrasonication and microbrush techniques to minimally invasively inoculate cotyledonary node explants, and created vacuum conditions with a sterile syringe to improve transformation efficiency in melon. However, the current lack of stable and efficient transgenic systems for genetic transformation in Cucurbitaceae severely limits the development and application of genetic transformation and gene editing technologies in research.

[0003] Recent studies have demonstrated that overexpressing morphogenetic genes can effectively improve transformation efficiency in multiple species, creating a new avenue for improving transformation efficiency in species with low transformation efficiency. However, overexpression of similar genes can trigger adverse reactions in plants. For example, constitutive overexpression of BBM and WUS can lead to severe growth defects, such as abnormal development of vegetative and reproductive organs and infertility.

[0004] Therefore, developing a transformation system based on restricted inducible expression of morphogenetic genes is crucial to improving the transformation efficiency of Cucurbitaceae crops. Summary of the Invention

[0005] In view of this, one of the objectives of the present invention is to provide an ABA-inducible promoter constructed based on an ABA response element.

[0006] The ABA-inducible promoter constructed based on the ABA response element introduced in the present invention can achieve the expression of morphogenic genes, especially the AtGRF5 gene, at a specific period, reducing the adverse effects of the accumulation of morphogenic genes during the transformation process on regenerated seedlings. In the present invention, the ABA-inducible promoter is represented by CAEA, and its nucleotide sequence is shown in SEQ ID NO: 1.

[0007] A second object of the present invention is to provide a recombinant vector having a nucleotide sequence as shown in SEQ ID NO: 1.

[0008] Furthermore, the recombinant vector also contains a morphogenetic gene, and the ABA-inducible promoter is connected to the upstream region of the morphogenetic gene.

[0009] Furthermore, the morphogenic gene includes any one of AtGRF5, TaGRF-OsGIF, ZmWUS, ZmWUS-ZmBBM, and ZmWUS-ipt; and the morphogenic gene is preferably AtGRF5.

[0010] The present invention constructs a plant overexpression vector based on the inducible promoter CAEA and containing AtGRF5, uses melon "P147", cucumber "Cu2" and pumpkin "Jingxinzhen No. 4" as materials, and uses Agrobacterium-mediated genetic transformation. By comparing the transformation efficiency with that of empty transformation materials and transformation materials without the inducible promoter CAEA, it is found that the use of the CAEA promoter can significantly reduce the adverse effects of the introduction of the morphogenetic gene AtGRF5 and produce healthy transgenic plants. Ultimately, the inducible expression system is successfully applied to gene editing of melon, cucumber and pumpkin.

[0011] The present invention also aims to provide the use of the above-mentioned ABA-inducible promoter or the above-mentioned recombinant vector in improving the efficiency of genetic transformation of Cucurbitaceae plants.

[0012] Furthermore, the cucurbitaceae plants include melon, cucumber and pumpkin.

[0013] The present invention also aims to provide a method for improving the genetic transformation efficiency of Cucurbitaceae plants, comprising expressing the AtGRF5 gene in the Cucurbitaceae plants, and expressing the AtGRF5 gene under the control of the above-mentioned ABA-inducible promoter.

[0014] Further, the following steps are included:

[0015] 1) Construction of recombinant vector:

[0016] The recombinant vector contains the AtGRF5 gene and the above-mentioned ABA-inducible promoter;

[0017] 2) Transform the recombinant vector into competent E. coli, culture, screen, and sequence the cells to identify positive colonies;

[0018] 3) Extracting plasmids from positive colonies, transferring the extracted plasmids into competent Agrobacterium cells, and obtaining Agrobacterium liquid containing the recombinant plasmid after culture, screening, and sequencing;

[0019] 4) The prepared cucurbitaceae plant explants are infected with an Agrobacterium solution containing the recombinant plasmid, and then co-cultivated, differentiated, and rooted.

[0020] Furthermore, in step 4), preparing the explant of the Cucurbitaceae plant comprises:

[0021] Seed sterilization and sowing treatment: Select seeds that are plump, uniform in size, free of deformities, mold, and yellowing or browning. Soak them in warm water at 50-60°C for 20-40 minutes, then remove the hard seed shells. Transfer the de-shelled seeds to a clean bench for disinfection, then rinse them 6-8 times with sterile water. When the seeds are dry to the point of being free of moisture, spread them flat on the sowing medium, seal them with breathable tape, and place them in a 26-30°C incubator for dark incubation.

[0022] Explant preparation: After the seeds have been cultured in the dark for 1-2 days, transfer them to a clean bench, remove the seed coat, and knock out the embryo. At the same time, cut off part of the cotyledons at the distal end, separate the two cotyledons, and obtain the processed explants.

[0023] Furthermore, in step 4), the infection treatment specifically includes: placing the explant in Agrobacterium bacterial solution, ultrasonicating at 30-50Khz for 4-8 seconds, then transferring the explant to a sterile syringe and injecting fresh bacterial solution; blocking the head outlet of the syringe, pulling the syringe to the maximum scale line, and maintaining it for 70-100 seconds; during this process, shaking the syringe to ensure that the explant can be evenly stressed and fully immersed in the Agrobacterium bacterial solution; after the holding time is over, draining the bacterial solution in the syringe, and repeating the operation once.

[0024] The beneficial effects of the present invention include at least:

[0025] This invention is the first to use the inducible promoter CAEA constructed based on the ABA response element in the genetic breeding of melon, cucumber and pumpkin. Research has found that this promoter can effectively reduce the adverse effects of AtGRF5 expression accumulation on regenerated seedlings, significantly improving crop conversion efficiency while producing healthy and heritable transgenic plants. Using this inducible expression system, an efficient gene editing system for melon, cucumber and pumpkin was constructed, which produced a rich variety of editing types. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The results of transformation of different morphogenetic genes in the examples of the present invention are shown in Figure 1. Among them, a is a bar graph of transformation efficiency; b is a graph of phenotypic results after transformation.

[0027] Figure 2 This is the result of overexpressing AtGRF5 in the examples of the present invention.

[0028] Figure 3 This is the physical map of the pw501 plasmid in the examples of the present invention.

[0029] Figure 4 Figure 1 shows a schematic diagram of the CAEA vector and transformation results from the examples of the present invention. Figure a shows the vector structure, Figure b shows the transformation efficiency of CAEA-containing vectors in cucumber, melon, and pumpkin, and Figure c shows the phenotype of positive seedlings produced by CAEA transformation.

[0030] Figure 5 Figure 1 shows the construction of a CAEA-induced AtGRF5 gene editing system in an embodiment of the present invention. Figure a is a schematic diagram of the vector structure, Figure b shows the transformation efficiency statistics of the CAEA-PDS vector in cucumber, melon, and pumpkin, and Figure c shows the phenotype of the albino seedlings produced by transformation. DETAILED DESCRIPTION

[0031] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0032] In addition, the technical solutions between the various embodiments of the present invention can be combined with each other, but it must be based on the fact that ordinary technicians in this field can implement it. When the combination of technical solutions is mutually contradictory or cannot be implemented, it should be deemed that such a combination of technical solutions does not exist and is not within the scope of protection required by the present invention.

[0033] Example 1

[0034] First, using melon "P147," cucumber "Cu2," and pumpkin "Jingxinzhen No. 4" as materials, the researchers used vectors pw501-506, provided by Researchers Zhang Wanggen and Zhang Huawei of the Modern Agriculture Research Institute of Peking University. pw501 is empty and lacks any morphogenetic genes, while pw502-506 carry five different morphogenetic genes: AtGRF5, TaGRF-OsGIF, ZmWUS, ZmWUS-ZmBBM, and ZmWUS-ipt, respectively. Agrobacterium-mediated genetic transformation was performed using cotyledons as explants. Explant fluorescence was observed using a handheld fluorescence gun and a fluorescence stereomicroscope. Fluorescence was defined as a positive bud, and explants containing one or more positive buds were defined as a single explant. Explants with positive buds were screened and the transformation efficiency was calculated (transformation efficiency = number of explants with one or more positive buds / total number of transformed explants × 100%).

[0035] like Figure 1As shown in the results, the comprehensive test results showed that the positive shoots produced by the vector pw502 carrying AtGRF5 were most similar to the regenerated shoots produced by wild-type or empty-transformed explants, and the transformation efficiency in melon "P147", cucumber "Cu2" and pumpkin "Jingxinzhen No. 4" was significantly improved. However, after rooting and culturing the pw502-transformed positive seedlings, it was found that Figure 2 As shown, the vegetative growth of regenerated shoots was affected, with varying degrees of deformity, and they were unable to eventually grow into complete plants. Analysis suggests that the cause may be that as positive buds continue to develop, gene expression accumulates, affecting the growth and development of regenerated seedlings. Based on this result, the inventors attempted to further reduce gene expression levels or limit the duration of gene expression, thereby enabling better application of morphogenetic genes to improve plant transformation efficiency.

[0036] Example 2 Synthesis of the inducible promoter CAEA

[0037] Based on existing reports and analysis of the AtRD29B promoter in the literature, we retrieved the sequence from the Arabidopsis thaliana online website (TAIR-Home Page (arabidopsis.org)) and located the core 77-bp key region of the promoter reported to be involved in ABA response. Jinan Tenas Biotechnology Co., Ltd. performed full gene synthesis of the 5-fold tandem repeat sequence, and simultaneously performed base substitutions on two of the sequences. The resulting CAEA sequence is shown in SEQ ID NO:1, as follows:

[0038] TCGCATAGCCACGTAGAGAGCAACTGGCTGAGACGTGGCAGGACGAAACGGACGCATCGTACGTGTCAGAATCCTACTCGCATAGCCAATCAATGAGCAACTGGCTGAGACGTGGCAGGACGAAACGGACGCATCGTACGTGTCAGAATCCTACTCGCATAGCCACGTAGAGAGCAACTGGCTGAGACGTGGCAGGACGAAACGGACGCATCGTACGTGTCAGAATCCTACTCGCATAGCCACGTAGAGAGCAACTGGCTGAGACGTGGCAGGACAATCAATACGCATCGTACGTGTCAGAATCCTACTCGCATAGCCACGTAGAGAGCAACTGGCTGAGACGTGGCAGGACGAAACGGACGCATCGTACGTGTCAGAATCCTACAGAAGTAAAGAGACAGAAGCCAGAGAGAGGTGGTTCGGCCATATGTCATCGTTCTCTCTATAAACTTTATGGAACTTTGTTCTGATTTTCTCA。

[0039] Example 3 Construction of CAEA-AtGRF5 Transformation Vector

[0040] The pw501 vector was used as the backbone for the transformation. The pw501 vector was digested with Hind III, and the HspT fragment was amplified using the pw502 vector as a template using HspT-F / HspT-R primers. CAEA was then introduced into the vector and recombined into the pw501-CAEA-HspT vector. The recombinant vector was digested with Kpn I, and the AtGRF5 fragment was amplified using the pw502 vector as a template using GRF-F: ATGATGAGTCTAAGTGGAAGTAGCGGG (SEQ ID NO: 2) / GRF-R: TTAGCTACCAGTGTCGAGTCTTGAGTG (SEQ ID NO: 3). The pw501-CAEA-AtGRF5 vector was further constructed by homologous recombination. The recombinant plasmid was transformed into competent DH5α Escherichia coli, and the transformed bacterial suspension was evenly plated onto solid LB medium containing kanamycin. The culture was incubated in the dark at 37°C. The next day, a single colony was selected from the culture medium and its sequence was verified by sequencing by Beijing Qingke Biotechnology Co., Ltd. After identification, the corresponding positive colonies were selected for sequencing. Comparison analysis was performed using SnapGene software to determine the correct positive colonies. Finally, plasmids were extracted from these positive colonies. The constructed plasmid was transferred into the GV3101 Agrobacterium competent cell, and the revived bacterial liquid was evenly spread on a solid LB medium containing kanamycin and rifampicin. The subsequent positive monoclonal colony identification steps were carried out according to the identification method of Escherichia coli; Agrobacterium containing the corresponding plasmid was obtained for use.

[0041] Example 4

[0042] Using the CAEA-AtGRF5 transformation vector, three independent genetic transformations were performed on melon "P147", cucumber "Cu2", and pumpkin "Jingxinzhen 4". The specific methods are as follows:

[0043] Seed sterilization and sowing treatment: Select seeds that are plump, uniform in size, free of deformities, mold, and yellowing or browning. Soak them in 55°C warm water for 30 minutes, then gently peel off the hard seed shells with tweezers. Transfer the de-shelled seeds to a clean bench and disinfect them with 75% alcohol for 30 seconds, rinse twice with sterile water, disinfect with 7% sodium hypochlorite solution for 15 minutes, and then rinse 6-8 times with sterile water. Once the seeds are dry and free of moisture, spread them flat on the sowing medium, seal them with breathable tape, and place them in a 28°C incubator for dark incubation.

[0044] Explant preparation: After the seeds have been cultured in the dark for one day, transfer them to a clean bench, remove the seed coat with tweezers and a blade, and gently knock off the embryo with the back of the knife. At the same time, cut off about 1 / 3 of the cotyledon at the distal end, separate the two cotyledons, and obtain the processed cotyledons.

[0045] Agrobacterium infection: Before inoculation, Agrobacterium should be activated by plating on the plate one day in advance. During infection, resuspend the Agrobacterium on the plate in liquid MS medium and adjust the concentration of the culture solution by dilution to an OD600 value of 0.2, which meets the infection requirements. Place the treated explant in the culture solution and sonicate at 40 kHz for 5 seconds. Then, transfer the explant to a 20 mL sterile syringe and inject 15 mL of fresh culture solution. To remove excess air from the syringe, seal the syringe head with a rubber stopper. After removing air, slowly and evenly pull the syringe to the 20 mL mark and hold for approximately 90 seconds. Gently shake the syringe during this process to ensure that the cotyledonary nodes are evenly stressed and fully immersed in the culture solution. After the time is up, drain the solution from the syringe and repeat the vacuuming process to ensure that the explant is fully infiltrated with the culture solution.

[0046] Co-cultivation: After completing the above steps, transfer the explants to a sterile culture dish. Gently remove excess moisture from the explant surface using filter paper, then transfer them to the co-cultivation medium. To ensure the stability of the culture environment, seal the culture dish with a breathable adhesive tape. Finally, place the treated explants in a 23°C incubator for 3 days in the dark.

[0047] Differentiation: After 3 days, transfer the explants to a sterile Erlenmeyer flask, wash with sterile water 8 times, and air-dry until there is no obvious moisture on the surface of the explants. Then, insert the flask with the U-mouth facing downward at a 45-degree angle into the recovery medium and culture at 26°C in the light.

[0048] Rooting: After 3-4 weeks of differentiation, use a handheld fluorescence gun and a fluorescence stereo microscope to observe the fluorescence of the explants, screen out the explants with positive buds, calculate the transformation efficiency, and cut out the positive buds and transfer them to the rooting medium for culture.

[0049] Hardening of seedlings: Take out the rooted positive seedlings from the bottle, clean the culture medium that the roots are stuck to, transplant the positive seedlings into sterilized nutrient soil, and cover them with plastic bags to keep them moist. After the seedlings have adapted, gradually remove the plastic bags, and then transfer the seedlings to a solar greenhouse for cultivation.

[0050] Result description:

[0051] The CAEA-AtGRF5 vector was used to transform melon, cucumber and pumpkin respectively. By regulating the addition of ABA, the action of morphogenetic genes was restricted to the differentiation stage, thereby reducing the adverse effects of the introduction of GRF. Figure 4 As shown in a, two treatments were set up, one with ABA added and the other without ABA added. After three biological replicates, the conversion efficiency was obtained as shown in Figure 4 As shown in the bar graph (4b) in . In the presence of inducer ABA, the transformation efficiency of melon was 40.63%, which was 20.82% lower than the transformation efficiency of pw502; when ABA was not added during tissue culture, the transformation efficiency was 19.78%, which was more than 20% lower than the transformation efficiency obtained by adding ABA, indicating that the inducible expression system CAEA-GRF can reduce the transformation efficiency. In the absence of ABA, positive transformation events still occurred, which may mean that there is a certain degree of escape in the system. The T0 generation regenerated complete plants were successfully obtained using this transformation system. After further culturing the obtained positive plants, the T1 generation was obtained, as shown in the figure. Figure 4 As shown in c, the T1 generation can normally take root, germinate, grow and develop into melon plants, and the grown plants have no obvious phenotypic defects.

[0052] Combined with the above results, a gene editing system based on the inducible promoter CAEA with the participation of GRF was further constructed. Using this induction system, the PDS gene was selected as the target gene and tested in melon, cucumber and pumpkin respectively. PDS, namely phytoene dehydrogenase, is an enzyme necessary for the synthesis of carotenoids. It has the function of protecting chlorophyll from photobleaching. After the PDS gene is silenced, the infected plants will show albinism symptoms, which is convenient for observation. The pBSE402-PDS (empty control) and pBSE402-CAEA-GRF-PDS vectors were respectively transferred into Agrobacterium GV3101 and transformed and tested. Two treatments were set up: applying ABA and not adding ABA. Figure 5 As shown in c, after 4 weeks of differentiation, regenerated shoots with obvious white leaves can be seen. The phenotypes of all transformed explants were counted, and those with albinism symptoms were counted as positive. The transformation efficiency was as follows: Figure 5 The results are shown in the middle bar graph (5b). Among them, the transformation efficiency of the empty control vector pBSE402-CmPDS for melon was 2.2%, and the transformation efficiency of pBSE402-CAEA-GRF-CmPDS with ABA added was 24.7%, which was more than 10 times higher than the transformation efficiency without the introduction of ABA induction system. This shows that the CAEA-induced expression system involving the morphogenetic gene GRF is also applicable to the CRISPR / Cas9 editing system of melon, cucumber and pumpkin, and the gene editing system based on the morphogenetic gene GRF is feasible.

[0053] It should be noted that, in this document, the terms "comprises," "includes," or any other variations thereof are intended to encompass non-exclusive inclusion, such that a process, method, article, or apparatus comprising a series of elements includes not only those elements but also other elements not explicitly listed, or elements inherent to such process, method, article, or apparatus. In the absence of further limitations, an element defined by the phrase "comprising a ..." does not exclude the presence of other identical elements in the process, method, article, or apparatus comprising the element.

[0054] The serial numbers of the above embodiments of the present invention are for description only and do not represent the advantages or disadvantages of the embodiments.

[0055] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, and all of these should be included in the scope of the claims of the present invention.

Claims

1. An application of a recombinant vector for improving the efficiency of genetic transformation of Cucurbitaceae plants, characterized in that: The recombinant vector contains a morphogenetic gene and an ABA-inducible promoter connected to the upstream region of the morphogenetic gene; Wherein, the nucleotide sequence of the ABA-inducible promoter is shown in SEQ ID NO: 1; The morphogenetic gene is AtGRF5 ; The cucurbitaceae plant is melon, cucumber or pumpkin; The application includes adding ABA during tissue culture, and limiting the effect of morphogenetic genes to the differentiation stage by regulating the addition of ABA, thereby reducing the adverse effects of introducing GRF.

2. A method for improving the genetic transformation efficiency of Cucurbitaceae plants, characterized in that: The cucurbitaceae plant is melon, cucumber or pumpkin; the method comprises adding ABA during the tissue culture process, and limiting the effect of the morphogenetic gene to the differentiation stage by regulating the addition of ABA, thereby reducing the adverse effects of the introduction of GRF; The method comprises the following steps: 1) Construction of recombinant vector: The recombinant vector contains AtGRF5 Genes and connections in the AtGRF5 An ABA-inducible promoter in the upstream region of the gene, the nucleotide sequence of which is shown in SEQ ID NO: 1; 2) Transform the recombinant vector into competent E. coli, culture, screen, and sequence the positive colonies; 3) Extract the plasmid from the positive colonies and transfer the extracted plasmid into competent Agrobacterium cells. After culture, screening, and sequencing, obtain the Agrobacterium liquid containing the recombinant plasmid; 4) preparing explants of cucurbitaceae plants, infecting the prepared explants of cucurbitaceae plants with an Agrobacterium solution containing the recombinant plasmid, and then co-culturing, differentiating, and rooting the explants.

3. The method for improving the genetic transformation efficiency of Cucurbitaceae plants according to claim 2, wherein: In step 4), preparing the explant of the Cucurbitaceae plant comprises: Seed sterilization and sowing treatment: Select seeds that are plump, uniform in size, free of deformities, mold, and yellowing or browning. Soak them in warm water at 50-60°C for 20-40 minutes, then remove the hard seed shells. Transfer the de-shelled seeds to a clean bench for disinfection, then rinse them 6-8 times with sterile water. When the seeds are dry to the point of being free of moisture, spread them flat on the sowing medium, seal them with breathable tape, and place them in a 26-30°C incubator for dark incubation. Explant preparation: After the seeds have been cultured in the dark for 1-2 days, transfer them to a clean bench, remove the seed coat, and knock out the embryo. At the same time, cut off part of the cotyledons at the distal end, separate the two cotyledons, and obtain the processed explants.

4. The method for improving the genetic transformation efficiency of Cucurbitaceae plants according to claim 2, wherein: In step 4), the infection treatment specifically includes: placing the explant in Agrobacterium bacterial solution, ultrasonicating at 30-50 kHz for 4-8 seconds, then transferring the explant to a sterile syringe and injecting fresh bacterial solution; blocking the head outlet of the syringe, pulling the syringe to the maximum scale line, and maintaining it for 70-100 seconds; during this process, shaking the syringe to ensure that the explant can be evenly stressed and fully immersed in the Agrobacterium bacterial solution; after the holding time is over, draining the bacterial solution in the syringe, and repeating the operation once.

Images