A polymyxin secretion engineering strain, a construction method and application thereof
By constructing a polymyxin-synthesizing engineered strain SC2-M1-Ppmx:∷PxylA-ΔC/D in Bacillus polymyxinus, and expressing polymyxin synthesis gene clusters using exogenous inducible promoters and endogenous promoters, the problem of polymyxin inhibition on the strain itself was solved, enabling controllable synthesis and enhanced secretion of polymyxin, thereby enhancing resistance to pathogens.
Patent Information
- Application Number
- CN202410673453.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-28
- Publication Date
- 2026-03-24
- Estimated Expiration
- 2044-05-28
AI Technical Summary
Existing technologies lack effective endogenous inducible promoters to control the synthesis and secretion of polymyxins in Bacillus polymyxa, resulting in polymyxins being harmful to the strains themselves and making it difficult to increase secretion in the presence of pathogens.
A polymyxin-synthesizing engineered strain, SC2-M1-Ppmx::PxylA-ΔC/D, was constructed. The polymyxin synthesis gene cluster was expressed in Bacillus polymyxinus using the exogenous xylose-inducible promoter PxylA, and the exogenous transporter genes pmxC and pmxD were knocked out. Subsequently, the pathogen-preferred endogenous promoter PlipA1 was added to express pmxD, thereby achieving the induced expression and secretion of polymyxin.
This study achieved the controllable synthesis and enhanced secretion of polymyxins, avoiding damage to the strain itself, enhancing the elimination effect on pathogens, and providing a molecular-directed evolutionary model for polymyxin efflux transport proteins.
Smart Images

Figure CN118792230B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and particularly relates to a polymyxin secretion engineering strain and a construction method and application thereof. BACKGROUND
[0002] The statements in this section merely provide background information related to the present application and do not necessarily constitute the prior art.
[0003] In medical use, polymyxin has been used for more than 50 years. Polymyxin has various types, among which polymyxin B and polymyxin E were widely used in clinical treatment in the 1950s, but were gradually abandoned due to their large side effects. In recent years, the abuse of antibiotics has led to the continuous emergence of multi-drug resistant (MDR) gram-negative bacteria, and the incidence of infection has been increasing, so polymyxin was applied to clinical treatment again in the 1980s and was considered as the last line of defense against multi-drug resistant bacteria. In 1947, Ainsworth et al. first discovered the presence of polymyxin in the product of Paenibacillus polymyxa. The polymyxin produced by P. polymyxa can inhibit the growth of most bacteria, including most gram-negative bacteria and part of gram-positive bacteria, so polymyxin can also be used as a biological control agent to prevent some pathogenic bacteria that cause plant infectious diseases. However, the polymyxin synthesized by P. polymyxa can cause damage to the cells to some extent, so P. polymyxa needs to use the efflux transport system to transport polymyxin outside the cell while synthesizing polymyxin, and this process mainly depends on the functions of efflux transport proteins such as PmxC and PmxD. Polymyxin has various types, and all of them are synthesized by non-ribosomal peptide synthetases, and different polymyxins have different utilization values. The biosynthetic gene cluster for synthesizing polymyxin in P. polymyxa is called pmx gene cluster, which is composed of five genes, pmxA, pmxB, pmxC, pmxD and pmxE, pmxA, pmxB and pmxE encode non-ribosomal peptide synthetase system (NRPS) for synthesizing polymyxin, and pmxC and pmxD mainly encode ABC-type efflux transport proteins.
[0004] There are some cis-acting elements in inducible promoters, which are relatively conservative and can regulate the initiation or shutdown of functional gene transcription under specific environmental factors. Among them, the xylose-inducible promoter (P xylA), which is induced by xylose but inhibited by glucose. Noguchi et al. realized the use of xylose induction system to perform engineering induction protein expression in Streptomyces by constructing a xylose-induced protein expression system; Wang et al. established a T7 RNA polymerase (T7P) cascade expression system regulated by sucrose operon and T7 promoter in P. polymyxa, and realized the controllable expression of genes under the action of sucrose and regulatory elements. In P. polymyxa, inducible promoters have the potential to be used as ideal synthetic biology tools, and their gene expression intensity can be dynamically regulated by inducers, but there is still a lack of research on endogenous inducible promoters. Whether the P. polymyxa engineering bacteria for inducing synthesis and secretion of polymyxin can be constructed is currently unknown. SUMMARY
[0005] To overcome the above-mentioned deficiencies of the prior art, the present application provides a polymyxin secretion engineering strain and a construction method and application thereof. One of the purposes of the present application is to provide a polymyxin synthesis strain, which can be induced to synthesize polymyxin and can be used for molecular directed evolution research, molecular and phenotypic research, etc. of polymyxin efflux transporter protein; the second purpose of the present application is to provide a polymyxin secretion strain, which realizes the induced expression and secretion of polymyxin by expressing polymyxin efflux transporter protein on the basis of the polymyxin synthesis strain, and constructs a polymyxin secretion model, which can be used for molecular directed evolution research, molecular and phenotypic research, etc. of polymyxin efflux transporter protein, and can also be used for agricultural production to improve the resistance of plants to pathogenic bacteria.
[0006] To achieve the above-mentioned purposes, one or more embodiments of the present application provide the following technical solutions:
[0007] In a first aspect of the present application, a polymyxin synthesis engineering strain SC2-M1-P is provided. pmx ∷P xylA -ΔC / D, which expresses the polymyxin synthesis gene cluster by using an exogenous inducible promoter in P. polymyxa SC2-M1, and then knocks out the polymyxin efflux transporter genes pmxC and pmxD to obtain.
[0008] The aforementioned polymyxa SC2-M1 was disclosed in the article Jikun Zhang, Jianzhi Zhao, Quanbin Fu, Haiyang Liu, Min Li, Zhongyue Wang, Wei Gu, Xueming Zhu, Rongshan Lin, Li Dai, Kai Liu, Chengqiang Wang*. Metabolic engineering of Paenibacillus polymyxa for effective production of 2,3-butanediol from poplarhydrolysate. Bioresource Technology, 2024, 392:130002.
[0009] In a specific embodiment of the present invention, the exogenous inducible promoter is a xylose-inducible promoter;
[0010] Preferably, the xylose-inducible promoter is P xylA ;
[0011] The P xylA The nucleic acid sequence is shown in SEQ ID NO.1.
[0012] SEQ ID NO.1:
[0013] TCAAAACCATCAAAAAAAGACACCTTTTCAGGTGCTTTTTTTATTTTATAAACTCATTCCCTGATC
[0014] TCGACTTCGTTCTTTTTTTACCTCTCGGTTATGAGTTAGTTCAAATTCGTTTCTTTTTAGGTTCTAAA
[0015] TCGTGTTTTTCTTGGAATTGTGCTGTTTATCCTTTACCTTGTCTACAAACCCCTTAAAAACGTTT
[0016] TTAAAGGCTTTTAAGCCGTCTGTACGTTCCTTAAGATCAACGTGATATAGGTTTTGCTAACCTTTGC
[0017] GTTCACTTAACTAACTTATAGGGGTAACACTTAAAAAAGAATCAATAACGATAGAAACCGCTCCT
[0018] AAGCAGGTGCATTTTTTCCTAACGAAGAAGGCAATAGTTCACATTTATTGTCTAAATGAGAATG
[0019] GACTCTAGAAGAAACTTCGTTTTTAATCGTATTTAAAACAATGGGATGAGATTCAATTATATGATT
[0020] TCTCAAGATAACAGCTTCTATATCAAATGTATTAAGGATATTGGTTAATCCAATTCCGATATAAAAG
[0021] CCAAAGTTTTGAAGTGCATTTAACATTTCTACATCATTTTTATTTGCGCGTTCCACAATCTCTTTTC
[0022] GAGAAATATTCTTTTCTTCTTTAGAGAGCGAAGCCAGTAACGCTTTTTCAGAAGCATATAATTCCC
[0023] AACAGCCTCGATTTCCACAGCTGCATTTGGGTCCATTAAAATCTATCGTCATATGACCCATTTCCC
[0024] CAGAAAAACCCTGAACACCTTTATACAATTCGTTGTTAATAACAAGTCCAGTTCCAATTCCGATAT
[0025] TAATACTGAGTAAACGATGTTTTCATAGTTTTTTGTCATACCAAATACTTTTTCACCGTATGCTCC
[0026] TGCATTAGCTTCATTTTCAACAAACCGGAACATTAAACTCACTCTCAATTAAAAACTGCAAAT
[0027] CTTTGATATTCCAATTTAAGTTAGGCATGAAAATAATTTGCTGATGACGATCTACAAGGCCTGGAA
[0028] CACAAATTCCTATTCCGACTAGACCATAAGGGGACTCAGGCATATGGGTTACAAAACCATGAATA
[0029] AGTGCAAATAAAATCTCTTTTACTTCACTAGCGGAAGAACTAGACAAGTCAGAAGTCTTCTCGA
[0030] GAATAATATTTCCTTCTAAGTCGGTTAGAATTCCGTTAAGATAGTCGACTCCTATATCAATACCAAT
[0031] CGAGTAGCCTGCATTCTTATTAAAAACAAGCATTACAGGTCTTCTGCCGCCTCTAGATTGCCCTG
[0032] CCCCAATTTCAAAAATAAAATCTTTTTCAAGCAGTGTATTTACTTGAGAGGAGACAGTAGACTTG
[0033] TTTAATCCTGTAATCTCAGAGAGAGTTGCCCTGGAGACAGGGGAGTTCTTCAAAATTTCATCTAA
[0034] TATTAATTTTTGATTCATTTTTTTTACTAAAGCTTGATCTGCAATTTGAATAATAACCACTCCTTTGT
[0035] TTATCCACCGAACTAAGTTGGTGTTTTTTGAAGCTTGAATTAGATATTTAAAAGTATCATATCTAAT
[0036] ATTATAACTAAATTTTCTAAAAAAAACATTGAAATAAACATTTATTTTGTATATGATGAGATAAAGT
[0037] TAGTTTATTGGATAAACAAACTAACTCAATTAAGATAGTTGATGGATAAACTTGTTCACTTAAATC
[0038] AAAGGGGGAAATGTACA
[0039] In a specific embodiment of the present invention, the gene numbers of pmxC and pmxD are 15677987 and 15677988, respectively.
[0040] In a second aspect, the present invention provides a polymyxin-secreting engineered bacterium SC2-M1-P pmx ∷P xylA -ΔC / D-pmxD is obtained by adding the pathogen-preferred endogenous promoter expression gene pmxD to the polymyxin-synthesizing engineered strain described in the first aspect;
[0041] The pathogen's preferred endogenous promoter is P. lipA1 ;
[0042] The P lipA1 The gene sequence is shown in SEQ ID NO.2.
[0043] SEQ ID NO.2:
[0044] GCAAGTAAAGCAGCTGAAATCGTAAAACTGATGACTTTTTTAGTTCCTGGCATGAACTCATCCTCCATACATATAAAATGTGTGACGAGATTAGCATGCGCCATCAATCTTAGGGATATCCTGACTAAAAAATGACTGAAAAAATAAAATTTTAATGTAAATATGAAATACAATTGATGATTTACCACAAGATGGCATGTATAATAAGTTTGAAATACTTAATTTTACAAAAAGGAGGATTTACAGT
[0045] Preferably, the polymyxin-secreting engineered bacterium is *Paenibacillus polymyxa*, with accession number CGMCC No. 30139 from the China General Microbiological Culture Collection Center.
[0046] In this invention, a chassis cell SC2-M1-P is constructed by expressing a polymyxin synthesis gene cluster in *P. polymyxa* SC2-M1 using an exogenous inducible promoter. pmx ∷P xylA Using chassis cells as the starting strain, the efflux transporter genes pmxC and pmxD were knocked out to construct a polymyxin-synthesizing engineered strain SC2-M1-P. pmx ∷P xylA-ΔC / D; A recombinant vector containing the pmxD gene is reintroduced into the polymyxin-synthesizing engineered strain. This recombinant vector utilizes a pathogen-preferred endogenous promoter to initiate pmxD expression. Thus, an engineered strain capable of enhanced polymyxin secretion through exogenous induction by the pathogen can be obtained, as illustrated in the attached diagram. Figure 1 As shown.
[0047] The engineered polymyxin-secreting strain can enhance polymyxin secretion in the presence of exogenous inducers and pathogens, which not only avoids the damage of polymyxin to Bacillus polymyxin itself, but also allows for the controllable production of polymyxin to eliminate pathogens. At the same time, this engineered strain can be used as a model for molecular-directed evolution studies of polymyxin efflux transport proteins.
[0048] In a third aspect, the present invention provides the above-mentioned polymyxin-synthesizing engineered strain SC2-M1-P pmx ∷P xylA The method for constructing -ΔC / D includes the following steps:
[0049] S1: The polymyxin synthesis gene cluster promoter was replaced with the xylose-inducible promoter P by homologous recombination. xylA Constructing chassis cells SC2-M1-P pmx ∷P xylA ;
[0050] S2: In the chassis cells obtained in S1, the polymyxin efflux transporter genes pmxC and pmxD were knocked out by homologous recombination to construct the polymyxin-synthesizing engineered strain SC2-M1-P. pmx ∷P xylA -ΔC / D;
[0051] Specifically, the homologous recombination plasmid pBVGh-P pmx ∷P xylA Chassis cells SC2-M1-P were obtained by screening after transformation into Bacillus polymyxa. pmx ∷P xylA ;
[0052] The homologous recombinant plasmid pBVGh-△pmxC / D was transformed into chassis cells, and polymyxin-synthesizing engineered strain SC2-M1-P was obtained through screening. pmx ∷P xylA -ΔC / D.
[0053] In a specific embodiment of the present invention, the homologous recombinant plasmid pBVGh-P pmx ∷P xylA The construction methods include:
[0054] The vector pBVGh was linearized using restriction endonucleases BglⅡ and BcuⅠ;
[0055] Primer P xylA -Up-F / P xylA -Up R, P xylA -China-F / P xylA -in-R and P xylA -Down-F / P xylA -The following-R used the genome of strain P. polymyxa SC2-M1, shuttle plasmid pSTOP1622, and strain P. polymyxa SC2-M1 as templates for PCR amplification to obtain homologous arm 1 and promoter P. xylA Sequence and homologous arm 2;
[0056] The pSTOP1622 vector was disclosed in the article Sen Yang, Yang Wang, Chaobao Wei, Qingtao Liu, Xuerong Jin, Guocheng Du, Jian Chen, Zhen Kang*. A new sRNA-mediated posttranscriptional regulation system for Bacillus subtilis. Biotechnology and Bioengineering, 2018, 115(12), 2986-2995.
[0057] Linearized vector pBVGh, homology arm 1, promoter P xylA pBVGh-P was obtained by sequentially linking the sequence and homologous arm 2 through homologous recombination. pmx ∷P xylA ;
[0058] or,
[0059] The method for constructing the homologous recombination plasmid pBVGh-△pmxC / D includes:
[0060] The vector pBVGh was linearized using restriction endonucleases BglⅡ and BcuⅠ;
[0061] The primer pairs CD double knock-up-upF / CD double knock-up-upR and CD double knock-downF / CD double knock-downR were amplified by PCR using the genome of strain P. polymyxa SC2-M1 as a template to obtain homologous arm 3 and homologous arm 4, respectively.
[0062] pBVGh-ΔpmxC / D was obtained by homologous recombination of linearized vector pBVGh, homologous arm 3, and homologous arm 4.
[0063] The pBVGh vector is disclosed in the article Jikun Zhang, Jianzhi Zhao, Quanbin Fu, Haiyang Liu, Min Li, Zhongyue Wang, Wei Gu, Xueming Zhu, Rongshan Lin, Li Dai, Kai Liu, Chengqiang Wang*. Metabolic engineering of Paenibacillus polymyxa for effective production of 2,3-butanediol from poplar hydrolysate. Bioresource Technology, 2024, 392:130002.
[0064] In a specific embodiment of the present invention, the sequences of the primers are as follows:
[0065] P xylA -Up-F: 5'-cacattaactagacagatctGCACATTCTATCAAACCTTCTAACAAG-3' (SEQ ID NO. 3);
[0066] P xylA -Up-R: 5'-TGATGGTTTTGATCTCGGCTGTCATTTCC-3' (SEQ ID NO. 4);
[0067] P xylA -Mid-F: 5'-GACAGCCGAGATCAAAACCATCAAAAAAAGACAC-3' (SEQ ID NO.5);
[0068] P xylA -Middle-R: 5'-GCCTTTTCAAACATTGTACATTTCCCCCTTTGATTTAAG-3' (SEQ ID NO. 6);
[0069] P xylA -Down-F: 5'-GGAAATGTACAATGTTTGAAAAGGCGGGGAG-3' (SEQ ID NO.7);
[0070] P xylA -Down-R: 5'-gccgctctagaactagtCAATGTCCAGCTCCAACTCGTA-3' (SEQ ID NO. 8);
[0071] CD double knock-up F: 5'-cacattaactagacagatctCGTGCTCATGGTGGACTCGTGGATT-3' (SEQ IDNO.9);
[0072] CD Double Tap - Up R: 5'-TGTCGACAAGCACTAACAGCAGGCTGTACAGCATC-3'(SEQ ID NO.10);
[0073] CD double knock-down F: 5'-GCCTGCTGTTAGTGCTTGTCGACATCTCCATG-3'(SEQ ID NO.11);
[0074] CD double knock-down R: 5'-GCCGCTCTAGAACTAGTGATCTCGCCCGTAATCTGGTAGGT-3' (SEQ ID NO. 12).
[0075] In a fourth aspect, the present invention provides the above-mentioned polymyxin-secreting engineered bacterium SC2-M1-P. pmx ∷P xylA The construction method of -ΔC / D-pmxD includes the following steps:
[0076] S11, in polymyxin-synthesizing engineered strain SC2-M1-P pmx ∷P xylA Import recombinant plasmid pHY300PLK-P into ΔC / D lipA1 -pmxD, filtered to obtain;
[0077] The recombinant plasmid pHY300PLK-P lipA1 The construction methods for -pmxD include:
[0078] The vector pHY300PLK was linearized using restriction endonucleases Xba I and BamHI;
[0079] Primer pair cm+P lipA1 -Up F / cm+P lipA1 -Up R and cm+P lipA1 -Down F / cm+P lipA1 The gene fragment cm was obtained by PCR amplification using plasmid pDG1661 sequence and strain P. polymyxa SC2-M1 genome as templates. r and promoter fragment P lipA1 ;
[0080] The linearized vector pHY300PLK, gene fragment cm, and promoter fragment P were used. lipA1 The empty plasmid pHY300PLK-cm was obtained through homologous recombination.r -P lipA1 ;
[0081] The vector pHY300PLK-cm was linearized using restriction endonucleases BamHI and EcoRI. r -P lipA1 ;
[0082] Primer pair P lipA1 +DF / P lipA1 +DR obtained the gene fragment pmxD by PCR amplification using the genome of strain P. polymyxa SC2-M1 as a template;
[0083] linearized vector pHY300PLK-cm r -P lipA1 The gene fragment pmxD was homologously recombinated to obtain the plasmid pHY300PLK-P. lipA1 -pmxD.
[0084] Among them, the resistance gene cm r The plasmids pHY300PLK and pDG1661 were amplified from plasmid pDG1661. The plasmids pHY300PLK and pDG1661 were used in the article Hui Li, Yanqin Ding, Jianzhi Zhao, Ruofei Ge, Benhua Qiu, Xiaoli Yang, Liangtong Yao, Kai Liu, Chengqiang Wang*, Binghai Du. Identification of a native promoter P LH-77 For gene expression in Paenibacillus polymyxa. Journal of Biotechnology, 2019; 295:19-27. Published in
[0085] In a specific embodiment of the present invention, the primers used in the method include:
[0086] cm+P lipA1 - Upper F: 5'-CGCTTTGCCCAAGCTTCTAGATCATGTTTGACAGCTTATCATCG-3' (SEQ IDNO.13);
[0087] cm+P lipA1 - Upper R: 5'-TCAGCTGCTTTACTTGCCCACGCCGAAACAAGCG-3' (SEQ ID NO. 14);
[0088] cm+P lipA1- Lower F: 5'-CTTGTTTCGGCGTGGGCAAGTAAAGCAGCTG-3' (SEQ ID NO. 15);
[0089] cm+P lipA1 - Lower R: 5'-CAGGAATTCCCGGGGATCCACTGTAAATCCTCCTTTTTG-3' (SEQ ID NO. 16);
[0090] P lipA1 +DF: 5'-GAGGATTTACAGTGGATCCATGAAAAAGGGCGGATG-3' (SEQ ID NO. 17);
[0091] P lipA1 +DR: 5'-CTTTTTTTATAACAGGAATTCCTAGCCGTACAGCCGGGCGT-3' (SEQ ID NO. 18).
[0092] It should be noted that any plasmid involved in the above methods is also within the scope of protection of this invention.
[0093] In a fifth aspect, the present invention provides the above-mentioned polymyxin-synthesizing engineered strain SC2-M1-P pmx ∷P xylA Applications of -ΔC / D in constructing molecularly oriented models of polymyxin efflux transporters, studying the relationship between genotype and phenotype, or optimizing genetically engineered strains.
[0094] In a sixth aspect, the present invention provides the above-mentioned polymyxin-secreting engineered bacterium SC2-M1-P. pmx ∷P xylA Applications of -ΔC / D-pmxD in polymyxin production, preparation of microbial agricultural products, construction of molecular-directed models of polymyxin efflux transporters, genotype-phenotype relationship studies, or optimization of genetically engineered strains.
[0095] It should be noted that the microbial agricultural products include the polymyxin-secreting engineered bacteria SC2-M1-P described in this invention. pmx ∷P xylA -ΔC / D-pmxD cells, their ferments, metabolites, or any one or more of them;
[0096] The microbial agricultural products include various product forms, such as microbial inoculants and microbial fertilizers; they can be used in various forms such as irrigation and spraying.
[0097] The polymyxin-synthesizing engineered strains and secretory engineered strains obtained in this invention have excellent expression efficiency and biological properties, and can be used for industrial fermentation and research.
[0098] A seventh aspect of the present invention provides a method for secreting polymyxins, wherein polymyxin-secreting engineered bacteria SC2-M1-P pmx ∷P xylA After -ΔC / D-pmxD and the pathogen were cultured separately to the stationary phase, they were transferred to fermentation medium for co-culture. In the fermentation medium, their initial OD values were... 600 All were cultured at 0.1-0.2 mg / L at 35-38°C until the 6th hour, at which point 0.5% xylose was added for induction.
[0099] Preferably, the fermentation medium is Assumption fermentation medium.
[0100] The above one or more technical solutions have the following beneficial effects:
[0101] In this invention, the polymyxin-synthesizing engineered bacteria utilize an exogenous xylose-inducible promoter to express and regulate the polymyxin synthesis gene cluster pmx. Compared with ordinary polymyxin-bacterial bacteria, the polymyxin synthesis of the engineered bacteria is artificially regulated, relieving the inhibitory effect of synthesized polymyxin on its own growth. This can be used for molecular-directed evolution studies of polymyxin efflux transport proteins, which helps to enhance polymyxin production and study related mechanisms.
[0102] The polymyxin-secreting engineered bacteria (polymyxin secretion model) described in this invention, compared with ordinary polymyxin-bacterial bacteria, achieves pathogen-preferred polymyxin secretion characteristics, increases the amount of polymyxin excreted and secreted in the presence of pathogens, and helps to enhance polymyxin production and study related mechanisms.
[0103] Advantages of additional aspects of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description
[0104] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0105] Figure 1 The polymyxin-secreting engineered bacterium SC2-M1-P in this invention pmx ∷P xylA A schematic diagram of -ΔC / D-pmxD and the induction of polymyxin secretion.
[0106] Figure 2 The promoter P in Embodiment 1 of the present invention xylA Replacement plasmid pBVGh-P pmx ∷P xylAConstruct the map. BglⅡ and BcuⅠ are the restriction enzyme sites used.
[0107] Figure 3 This is a construction map of the plasmid pBVGh-△pmxC / D for the gene knockout of pmxC and pmxD in Example 1 of this invention. BglⅡ and BcuⅠ are the restriction enzyme sites used.
[0108] Figure 4 The plasmid pHY300PLK-P is an example of the plasmid in Embodiment 1 of this invention. lipA1 The construction diagram of -pmxD. Xba I, BamHI, and EcoRI are the restriction enzyme sites used.
[0109] Figure 5 The bar chart for screening pathogen-preferred promoters in Example 2 of this invention. The pathogen *Erwinia persicina* showed no fluorescent expression. Promoter P... 04420 This is a constitutive strong promoter obtained from previous screening in the laboratory. The method for determining the differential changes in the promoter after interaction with pathogens is based on α(interacting pathogens, Bacillus polymyxa P)... 04420 rFU / OD of -gfp-expressing strains 600 The value divided by the P value of the non-interacting pathogen, *Bacillus polymyxa* P 04420 rFU / OD of -gfp-expressing strains 600 Value) compared to b (interacting pathogens, Bacillus polymyxa P) lipA1 rFU / OD of -gfp-expressing strains 600 The value divided by the P value of the non-interacting pathogen, *Bacillus polymyxa* P lipA1 rFU / OD of -gfp-expressing strains 600 In the form of (value), the promoter P was found. lipA1 The fluorescence value expressed after interaction with pathogens was significantly higher than that of non-interacting pathogens compared to the fluorescence value expressed by promoter P. 04420 The corresponding value, therefore the promoter P is selected. lipA1 This is an endogenous pathogen-preferred promoter used to construct a polymyxin secretion model. *: P < 0.05, indicating a significant difference; **: P < 0.01, indicating a highly significant difference.
[0110] Figure 6 This is a bar chart showing the diameter of the inhibition zone of the polymyxin-secreting engineered bacteria induced by xylose in Example 3 of the present invention. The antagonistic indicator bacterium used was *Escherichia coli* DH5α, and the amount of indicator bacterium added was 200 μL of *E. coli* DH5α per 200 mL of LB semi-solid medium. Induction was performed by adding 0.5% xylose. Black bars indicate no xylose was added, showing no inhibition zone formation; white bars indicate xylose addition, showing a clear inhibition zone.
[0111] Figure 7 This is a bar chart comparing the difference in inhibition zones under pathogen interaction conditions in Example 3 of the present invention. The antagonistic indicator bacterium used was *Escherichia coli* DH5α, and the amount of indicator bacterium added was 200 μL of *E. coli* DH5α per 200 mL LB semi-solid medium. Xylose was added at 6 h of culture for induction. The chart also shows the polymyxin secretion model of interacting pathogens (strain SC2-M1-P). pmx ∷P xylA The change in the diameter of the inhibition zone (ΔC / D-pmxD) relative to the diameter of the control, where the control strain is strain SC2-M1-P. pmx ∷P xylA -ΔC / D transformation of the empty plasmid (pHY300PLK-cm) that does not express pmxD r -P lipA1 It came from.
[0112] Preservation instructions:
[0113] The strain was Paenibacillus polymyxa SC2-M1-P pmx ∷P xylA -ΔC / D-pmxD was deposited on March 26, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 30139. Detailed Implementation
[0114] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the materials, reagents, etc., used in the following embodiments are commercially available. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer.
[0115] It should be noted that any aspects of this invention not described in detail are well known to those skilled in the art. Experimental methods not specifically described in the following examples are generally performed under conventional conditions or as recommended by the manufacturer. Experimental steps not described in detail are based on references to *Molecular Cloning: A Laboratory Manual* (edited by Michael R. Green and Joseph Sambrook, 4th edition), pathophysiological experiments, online databases, etc.
[0116] In this invention, *P. polymyxa* SC2-M1 is disclosed in the article Jikun Zhang, Jianzhi Zhao, Quanbin Fu, Haiyang Liu, Min Li, Zhongyue Wang, Wei Gu, Xueming Zhu, Rongshan Lin, Li Dai, Kai Liu, Chengqiang Wang*. Metabolic engineering of *Paenibacillus polymyxa* for effective production of 2,3-butanediol from poplarhydrolysate. Bioresource Technology, 2024, 392:130002.
[0117] In this invention, the pSTOP1622 vector is disclosed in the article Sen Yang, Yang Wang, Chaobao Wei, Qingtao Liu, Xuerong Jin, Guocheng Du, Jian Chen, Zhen Kang*. A new sRNA-mediated posttranscriptional regulation system for Bacillus subtilis. Biotechnology and Bioengineering, 2018, 115(12), 2986-2995.
[0118] In this invention, the pBVGh vector is disclosed in the article Jikun Zhang, Jianzhi Zhao, Quanbin Fu, Haiyang Liu, Min Li, Zhongyue Wang, Wei Gu, Xueming Zhu, Rongshan Lin, Li Dai, Kai Liu, Chengqiang Wang*. Metabolic engineering of Paenibacillus polymyxa for effective production of 2,3-butanediol from poplar hydrolysate. Bioresource Technology, 2024, 392:130002.
[0119] In this invention, plasmids pHY300PLK and pDG1661 are used in the article Hui Li, Yanqin Ding, Jianzhi Zhao, Ruofei Ge, Benhua Qiu, Xiaoli Yang, Liangtong Yao, Kai Liu, Chengqiang Wang*, Binghai Du. Identification of a native promoter P LH-77 For gene expression in Paenibacillus polymyxa. Journal of biotechnology, 2019; 295:19-27. Published in
[0120] In a specific embodiment of the present invention, the enzyme used for PCR amplification is 2×Phanta Flash Master Mix, purchased from Vazyme, catalog number P520-03-AA.
[0121] In a specific embodiment of the present invention, the enzyme used to construct the vector in homologous recombination is the ClonExpress II OneStep Cloning Kit, purchased from Vazyme, catalog number C112-02.
[0122] In this invention, the Assumption fermentation medium formula is as follows: sucrose: 49.63g, MgSO4: 0.2g, KH2PO4: 0.2g, NaCl: 0.2g, CaCO3: 5.06g, (NH4)2SO4: 6.94g, deionized water: 1000mL, sterilized at 115℃ for 15min.
[0123] The present invention will be further described in detail below with reference to specific embodiments. It should be noted that the specific embodiments are explanations of the present invention and not limitations thereof.
[0124] Example 1
[0125] During the invention process, the technicians discovered that polymyxins can inhibit the growth of the producing strains themselves. The polymyxin synthesis gene cluster begins transcription during mid-logarithmic growth, and its production can be detected at the end of the logarithmic growth phase, thus inhibiting the strain's own growth to some extent. To avoid this self-inhibition, a series of strains were constructed according to this invention.
[0126] This embodiment discloses a polymyxin-synthesizing engineered strain SC2-M1-P pmx ∷P xylA -ΔC / D and its construction methods, including strain selection and construction of exogenous xylose-inducible promoter P xylAHomologous recombinant plasmid pBVGh-P pmx ∷P xylA The pmxC and pmxD gene knockout plasmid pBVGh-△pmxC / D.
[0127] Specifically as follows:
[0128] 1. Strain selection: P. polymyxa SC2-M1 was selected as the recipient strain.
[0129] 2. Construction of plasmid pBVGh-P pmx ∷P xylA and chassis cells SC2-M1-P pmx ∷P xylA
[0130] In this embodiment, the xylose-inducible promoter P xylA The gene sequence was amplified using our laboratory shuttle plasmid pSTOP1622, and the backbone vector was the laboratory plasmid pBVGh (Temperature-sensitive plasmid, Erythrocyte sedimentation rate). r ).
[0131] 1): The vector pBVGh was linearized using restriction endonucleases BglⅡ and BcuⅠ;
[0132] 2): Primer P xylA -Up-F / P xylA -Up R, P xylA -China-F / P xylA -in-R and P xylA -Down-F / P xylA -The following-R used the genome of strain P. polymyxa SC2-M1, shuttle plasmid pSTOP1622, and strain P. polymyxa SC2-M1 genome as templates for PCR amplification to obtain homology arm 1 (upper homology arm) and promoter P. xylA Sequence and homologous arm 2 (lower homologous arm);
[0133] 3): Linearized vector pBVGh, homologous arm 1 (upper homologous arm), promoter P xylA pBVGh-P was obtained through homologous recombination of the sequence and homologous arm 2 (lower homologous arm). pmx ∷P xylA (Temperature-sensitive plasmid, Ery r Its carrier schematic diagram is as follows: Figure 2 As shown.
[0134] 4): The constructed recombinant vector was transferred into the recipient strain by electrotransformation. The medium was LB solid medium with 20 mg / mL erythromycin resistance. Positive transformants were screened by culturing at 30 °C for 36 h. The correct positive transformants were cultured at 42 °C, and positive colonies of the first recombination were screened by antibiotic erythromycin (20 mg / mL) resistance. The first recombinant bacteria were transferred to LB medium without resistance for the second recombination to construct the chassis cell SC2-M1-P pmx ∷P xylA .
[0135] Among them, the primers P xylA -upper-F: 5’-cacattaactagacagatctGCACATTCTATCAAACCTTCTAACAAG-3’; P xylA -upper-R: 5’-TGATGGTTTTGATCTCGGCTGTCATTTTCC-3’; P xylA -middle-F:
[0136] 5’-GACAGCCGAGATCAAAACCATCAAAAAAAGACAC-3’; P xylA -middle-R:
[0137] 5’-GCCTTTTCAAACATTGTACATTTCCCCCTTTGATTTAAG-3’; P xylA -lower-F:
[0138] 5’-GGAAATGTACAATGTTTGAAAAGGCGGGGAG-3’; P xylA -lower-R: 5’-gccgctctagaactagtCAATGTCCAGCTCCAACTCGTA-3’.
[0139] 3. Construction of plasmid genes pmxC and pmxD knockout plasmids pBVGh-△pmxC / D and polymyxin synthesis engineering strain SC2-M1-P pmx ∷P xylA -ΔC / D:
[0140] The gene sequences of pmxC and pmxD were amplified from the genomic sequence of strain P. polymyxa SC2-M1. The gene numbers of pmxC and pmxD were: 15677987 and 15677988; The backbone vector used was the laboratory plasmid pBVGh (Temperature-sensitive plasmid, Ery r ).
[0141] 1): The vector pBVGh was linearized using restriction endonucleases BglⅡ and BcuⅠ;
[0142] 2): The homologous arms 3 (upper homologous arm) and 4 (lower homologous arm) were obtained by PCR amplification using the genome of strain P. polymyxaSC2-M1 as a template.
[0143] 3): Linearized vector pBVGh, homologous arm 3 (upper homologous arm), and homologous arm 4 (lower homologous arm) were homologously recombinated to obtain pBVGh-ΔpmxC / D (Temperature-sensitive plasmid, Erythropomorphic plasmid). r Its carrier schematic diagram is as follows: Figure 3 As shown.
[0144] 4): The recombinant vector pBVGh-△pmxC / D constructed was transformed into the recipient strain SC2-M1-P using electroporation. pmx ∷P xylA In this study, the culture medium was LB solid medium with 20 mg / mL erythromycin resistance. Positive transformants were screened after incubation at 30℃ for 36 h. Correct positive transformants were then incubated at 42℃, and recombinant positive colonies were screened for erythromycin (20 mg / mL) resistance. The recombinant colonies were then transferred to LB medium without resistance for secondary recombination, resulting in the polymyxin-synthesizing engineered strain SC2-M1-P. pmx ∷P xylA -ΔC / D.
[0145] The primers used are as follows:
[0146] Double-click CD up F: 5'-cacattaactagacagatctCGTGCTCATGGTGGACTCGTGGATT-3'; Double-click CD up R: 5'-TGTCGACAAGCACTAACAGCAGGCTGTACAGCATC-3'; Double-click CD down F:
[0147] 5'-GCCTGCTGTTAGTGCTTGTCGACATCTCCATG-3'; CD double knock-down R: 5'-GCCGCTCTAGAACTAGTGATCTCGCCCGTAATCTGGTAGGT-3'.
[0148] Example 2
[0149] This embodiment provides a polymyxin-secreting engineered bacterium SC2-M1-P pmx ∷P xylA -ΔC / D-pmxD and its construction method.
[0150] This embodiment uses the engineered bacteria SC2-M1-P obtained in Example 1. pmx ∷P xylA Based on -ΔC / D, obtained by overexpressing the gene pmxD in plasmid pHY300PLK-P lipA1 -pmxD converts to SC2-M1-P pmx ∷P xylA -ΔC / D was obtained through filtering.
[0151] Construction of the pmxD gene overexpression plasmid: P lipA1 The promoter sequence and pmxD gene sequence were amplified from the genome sequence of strain P. polymyxa SC2-M1, and the vector used was the laboratory empty plasmid pHY300PLK (E. coli and B. subtilis shuttle vector).
[0152] Recombinant plasmid pHY300PLK-P lipA1 The construction methods for -pmxD include:
[0153] 1): The vector pHY300PLK was linearized using restriction endonucleases Xba I and BamHI;
[0154] 2): Primer cm+P lipA1 -Up F / cm+P lipA1 -Up R and cm+P lipA1 -Down F / cm+P lipA1 The gene fragment cm was obtained by PCR amplification using plasmid pDG1661 sequence and strain P. polymyxa SC2-M1 genome as templates. r and promoter fragment P lipA1 ;
[0155] 3): Linearized vector pHY300PLK, gene fragment cm, and promoter fragment P were added. lipA1 The empty plasmid pHY300PLK-cm was obtained through homologous recombination. r -P lipA1 ;
[0156] 4): The vector pHY300PLK-cm was linearized using restriction endonucleases BamHI and EcoRI. r -P lipA1 ;
[0157] 5): Primer P lipA1 +DF / P lipA1 +DR obtained the gene fragment pmxD by PCR amplification using the genome of strain P. polymyxa SC2-M1 as a template;
[0158] 6): Linearized vector pHY300PLK-cm r -P lipA1 The gene fragment pmxD was homologously recombinated to obtain the plasmid pHY300PLK-P. lipA1 -pmxD.
[0159] The recombinant vector constructed was transformed into the recipient strain SC2-M1-P using electroporation. pmx ∷P xylA In a -ΔC / D culture at 37℃, positive colonies were selected by culturing with chloramphenicol (10 mg / mL) resistance for 36 h to construct polymyxin-secreting engineered bacteria SC2-M1-P. pmx ∷P xylA -ΔC / D-pmxD. The strain is Paenibacillus polymyxa SC2-M1-P. pmx ∷P xylA -ΔC / D-pmxD was deposited on March 26, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 30139.
[0160] Among them, the resistance gene cm r Obtained by amplification from plasmid pDG1661;
[0161] The plasmid pHY300PLK was linearized using the endonucleases Xba I and BamHI; primers cm+P were used. lipA1 -Up F / cm+P lipA1 -Up R and cm+P lipA1 -Down F / cm+P lipA1 The gene fragment cm was obtained by PCR amplification using plasmid pDG1661 sequence and strain P. polymyxaSC2-M1 genome as templates, respectively. r and promoter fragment P lipA1 ;
[0162] Linearized vector pHY300PLK and gene fragment cm r and promoter fragment P lipA1 The empty plasmid pHY300PLK-cm was obtained through homologous recombination. r -P lipA1 ;
[0163] The nucleases BamHI and EcoRI were used to linearize the vector pHY300PLK-cm. r -P lipA1 ;
[0164] Primer P lipA1 +DF / P lipA1 +DR obtained the gene fragment pmxD by PCR amplification using the genome of strain P. polymyxa SC2-M1 as a template;
[0165] linearized vector pHY300PLK-cm r -P lipA1 The gene fragment pmxD was homologously recombinated to obtain the plasmid pHY300PLK-P. lipA1 -pmxD.
[0166] The primers used are:
[0167] cm+P lipA1 - Upper F: 5'-CGCTTTGCCCAAGCTTCTAGATCATGTTTGACAGCTTATCATCG-3';
[0168] cm+P lipA1 - Upper R: 5'-TCAGCTGCTTTACTTGCCCACGCCGAAACAAGCG-3'cm+P lipA1 -Down F:
[0169] 5'-CTTGTTTCGGCGTGGGCAAGTAAAGCAGCTG-3';cm+P lipA1 -DownR:
[0170] 5'-CAGGAATTCCCGGGGATCCACTGTAAATCCTCCTTTTTG-3';P lipA1 +DF:
[0171] 5'-GAGGATTTACAGTGGATCCATGAAAAAGGGCGGATG-3';P lipA1 +DR: 5'-CTTTTTTTATAACAGGAATTCCTAGCCGTACAGCCGGGCGT-3'.
[0172] The pathogen is *Erwinia persicina*; the preferred endogenous promoter is P. lipA1 The P lipA1 The gene sequence is shown in SEQ ID NO.2.
[0173] Among them, the results of pathogen-preferred promoter screening are as follows: Figure 5 As shown. The pathogen *Erwinia persicina* showed no fluorescent expression. Promoter P... 04420This is a constitutive strong promoter obtained from previous screening in the laboratory. The method for determining the differential changes in the promoter after interaction with pathogens is based on α(interacting pathogens, Bacillus polymyxa P)... 04420 rFU / OD of -gfp-expressing strains 600 The value divided by the P value of the non-interacting pathogen, *Bacillus polymyxa* P 04420 rFU / OD of -gfp-expressing strains 600 Value) compared to b (interacting pathogens, Bacillus polymyxa P) lipA1 rFU / OD of -gfp-expressing strains 600 The value divided by the P value of the non-interacting pathogen, *Bacillus polymyxa* P lipA1 rFU / OD of -gfp-expressing strains 600 In the form of fluorescence values, it was found that the promoter P was expressed after interacting with pathogens and showed a higher fluorescence value than that of non-interacting pathogens. lipA1 Therefore, the promoter P is selected. lipA1 This serves as an endogenous pathogen-preferred promoter for constructing a polymyxin secretion model.
[0174] Among them, promoter P 04420 The article Huimin Sun, Jikun Zhang, Wenteng Liu, Wenhui E, XinWang, Hui Li, Yanru Cui, Dongying Zhao, Kai Liu, Binghai Du, Yanqin Ding*, Chengqiang Wang*. Identification and combinatorial engineering of indole-3-acetic acid synthetic pathways in Paenibacillus polymyxa. Biotechnology for Biofuels and Bioproducts, 2022, 15:81 was published.
[0175] Example 3
[0176] The application of the polymyxin-secreting engineered bacteria provided in this embodiment in the induction, expression, and secretion of polymyxins.
[0177] To verify the engineered polymyxin-secreting bacteria SC2-M1-P pmx ∷P xylA Whether -ΔC / D-pmxD is induced by xylose to synthesize polymyxin, the fermentation medium used was Aspa fermentation medium, cultured at 37℃, initial OD 600The concentration was 0.1. A control group and an experimental group were set up. The control group did not contain xylose, while the experimental group received 0.5% xylose at 6 hours of culture. Samples were taken at 6, 8, 10, 12, 24, and 36 hours for the Oxford cup antagonism test. The indicator bacterium *E. coli* was added to 1 μL of *E. coli* DH5α overnight culture medium per 1 mL of semi-solid LB medium. After 12 hours of culture, the formation and diameter of inhibition zones were observed. The diameter of the inhibition zone was used to observe the synthesis of polymyxins. The results are as follows: Figure 6 As shown, no obvious inhibition zone was generated without xylose addition; after xylose addition and induction, an obvious inhibition zone was generated, proving that polymyxin synthesis in engineered polymyxin-secreting bacteria is induced by xylose. No polymyxin was produced without xylose addition, but polymyxin was produced after xylose addition and induction.
[0178] Verification of polymyxin production induced by pathogens in the polymyxin secretion model.
[0179] (1) Detection of inhibition zones in a polymyxin secretion model under pathogen-pathogen interaction conditions: The fermentation medium used was Ashraf fermentation medium, and the initial OD of the secretion model strain and the pathogen was... 600 All samples were 0.1 mg / L and transferred to fermentation medium, then cultured at 37°C. After 6 hours of culture, 0.5% xylose was added for induction. Samples were taken at 6, 8, 10, 12, 24, and 36 hours for Oxford cup antagonism experiments. The indicator bacteria concentration was 1 μL of *E. coli* DH5α overnight culture medium per 1 mL of semi-solid LB. The diameter of the inhibition zone was observed after 12 hours of culture.
[0180] (2) Comparison of inhibition zones in polymyxin secretion models with and without pathogen interaction: The difference in inhibition zone diameter between the polymyxin secretion model and the control was compared between the presence and absence of pathogens. The antagonistic indicator bacterium used was *Escherichia coli* DH5α, and the amount of indicator bacterium added was 200 μL of overnight *E. coli* DH5α culture medium per 200 mL of LB semi-solid medium. Induction was initiated by adding 0.5% xylose after 6 hours of culture. Results are as follows: Figure 7 As shown, the polymyxin secretion model of interacting pathogens (strain SC2-M1-P) was used to determine whether or not the pathogens were interacting. pmx ∷P xylA The change in the diameter of the inhibition zone (ΔC / D-pmxD) relative to the diameter of the control, where the control strain is strain SC2-M1-P. pmx ∷P xylA -ΔC / D transformation of empty plasmid (pHY300PLK-cm) r -P lipA1 The difference was found to be even greater in the presence of pathogen-bacterial interactions, proving that the presence of pathogens stimulates an increase in the promoter P. lipA1The expression level of the pmxD gene increases the amount of polymyxin efflux and secretion.
[0181] Example 4
[0182] This embodiment provides a polymyxin-synthesizing engineered strain SC2-M1-P pmx ∷P xylA Application of -ΔC / D in high-throughput screening of the pmxD gene using a polymyxin secretion research model.
[0183] The gene sequence of the error-prone mutant pmxD, and the pathogen-preferred endogenous promoter P. lipA1 The mutated pmxD gene sequence was expressed, and high-throughput screening of the pmxD gene was performed using a polymyxin secretion model. The method involved determining the mutation status of the pmxD gene by verifying changes in polymyxin production, and finally screening for positive or negative mutations with significant pmxD mutation degrees.
[0184] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A polymyxin-secreting engineered bacterium SC2-M1- P pmx :: P xylA -ΔC / D- pmxD Its characteristics are, In a polymyxin-synthesizing engineered strain SC2-M1- P pmx :: P xylA Based on -ΔC / D, add pathogen-preferred endogenous promoter expression genes. pmxD plasmids were obtained; The pathogen-preferred endogenous promoter is P lipA1 The P lipA1 The gene sequence is shown in SEQ ID NO.2; The polymyxin-synthesizing engineered strain SC2-M1- P pmx :: P xylA -ΔC / D, including in Bacillus polymyxa ( P . polymyxa In this study, a polymyxin synthesis gene cluster was expressed using an exogenous inducible promoter, and then the polymyxin efflux transport protein gene was knocked out. pmxC and pmxD get.
2. The polymyxin-secreting engineered bacterium SC2-M1- as described in claim 1 P pmx :: P xylA -ΔC / D- pmxD Its characteristics are, The polymyxin-secreting engineered bacteria is *Bacillus polymyxinus* (… Paenibacillus polymyxa (), its accession number at the China General Microbiological Culture Collection Center is CGMCC No. 30139.
3. The polymyxin-secreting engineered bacterium SC2-M1- as described in claim 1 P pmx :: P xylA -ΔC / D- pmxD Its characteristics are, The exogenous inducible promoter is a xylose-inducible promoter.
4. The polymyxin-secreting engineered bacterium SC2-M1- as described in claim 3 P pmx :: P xylA -ΔC / D- pmxD Its characteristics are, The xylose-inducible promoter is P xylA .
5. The polymyxin-secreting engineered bacterium SC2-M1- as described in claim 4 P pmx :: P xylA -ΔC / D- pmxD Its characteristics are, The P xylA The nucleic acid sequence is shown in SEQ ID NO.
1.
6. The polymyxin-secreting engineered bacterium SC2-M1- as described in claim 1 P pmx :: P xylA -ΔC / D- pmxD The construction method is characterized by, Polymyxin-synthesizing engineered strain SC2-M1- P pmx :: P xylA The method for constructing -ΔC / D includes the following steps: S1: The polymyxin synthesis gene cluster promoter was replaced with a xylose-inducible promoter using homologous recombination. P xylA Build chassis cells; S2: In the chassis cells obtained in S1, the polymyxin efflux transporter gene was knocked out through homologous recombination. pmxC and pmxD Constructing polymyxin-synthesizing engineered strain SC2-M1- P pmx :: P xylA -ΔC / D; Homologous recombination plasmid pBVGh- P pmx :: P xylA Chassis cells were obtained by screening after transformation into Bacillus polymyxa. The homologous recombination plasmid pBVGh-△ pmxC / D The polymyxin-synthesizing engineered strain SC2-M1- was obtained by transformation into chassis cells and screening. P pmx :: P xylA -ΔC / D; The homologous recombinant plasmid pBVGh- P pmx :: P xylA The construction methods include: Using restriction endonuclease Bgl II and Bcu I. Linearized vector pBVGh; Primer pair P xylA -Upper-F / P xylA -Upper-R, P xylA -Middle-F / P xylA -Middle-R and P xylA -Lower-F / P xylA -Lower-R were respectively used with the strain P . polymyxa SC2-M1 genome, shuttle plasmid pSTOP1622 and the strain P . polymyxa SC2-M1 genome as templates for PCR amplification to obtain homologous arm 1, promoter P xylA sequence and homologous arm 2; Linearized vector pBVGh, homology arm 1, promoter P xylA pBVGh- was obtained through homologous recombination of the sequence and homologous arm 2. P pmx :: P xylA ; or, The homologous recombinant plasmid pBVGh-△ pmxC / D The construction methods include: Using restriction endonuclease Bgl II and Bcu I. Linearized vector pBVGh; CD double knock-up-up F / CD double knock-up-up R and CD double knock-down F / CD double knock-down R respectively use strains P . polymyxa Homologous arm 3 and homologous arm 4 were obtained by PCR amplification using the SC2-M1 genome as a template. pBVGh-Δ was obtained by homologous recombination of linearized vector pBVGh, homologous arm 3, and homologous arm 4. pmxC / D ; The method for constructing the polymyxin-secreting engineered bacterium SC2-M1-Ppmx::PxylA-ΔC / D-pmxD includes the following steps: S11, in the polymyxin-synthesizing engineered strain SC2-M1- P pmx :: P xylA Import recombinant plasmid pHY300PLK into ΔC / D- P lipA1 - pmxD Filter to obtain; The recombinant plasmid pHY300PLK- P lipA1 - pmxD The construction methods include: Using restriction endonuclease Xba I and Bam HI linearized vector pHY300PLK; primer pairs cm+P lipA1 -Up F / cm+P lipA1 -Up R and cm+P lipA1 -Down F / cm+P lipA1 - The following R represents the plasmid pDG1661 sequence and the strain, respectively. P . polymyxa Gene fragments were obtained by PCR amplification using the SC2-M1 genome as a template. cm r and promoter fragments P lipA1 ; Linearized vector pHY300PLK, gene fragment cm r and promoter fragments P lipA1 The empty plasmid pHY300PLK- was obtained through homologous recombination. cm r - P lipA1 ; Using restriction endonuclease Bam HI and Eco RI linearized vector pHY300PLK- cm r - P lipA1 ; Primers P lipA1 +DF / P lipA1 +DR strain P . polymyxa Gene fragments were obtained by PCR amplification using the SC2-M1 genome as a template. pmxD ; Linearized carrier pHY300PLK- cm r - P lipA1 Gene fragments pmxD plasmid pHY300PLK- was obtained through homologous recombination. P lipA1 - pmxD.
7. The polymyxin-secreting engineered bacterium SC2-M1- as described in claim 1 P pmx :: P xylA -ΔC / D- pmxD Applications in the production of polymyxins, the preparation of microbial agricultural products, the construction of molecular-oriented models of polymyxin efflux transporters, the study of the genotype-phenotype relationship of efflux transporters, and the optimization of genetically engineered strains for polymyxin production.
8. A method for secreting polymyxin, characterized in that, The polymyxin-secreting engineered bacteria SC2-M1- as described in claim 1 P pmx :: P xylA -ΔC / D- pmxD After being cultured separately from the pathogen to the stationary phase, they were transferred to a fermentation medium for co-culture. The initial OD values of both bacteria in the fermentation medium were... 600 All samples were cultured at 0.1-0.2°C at 35-38°C for 6 hours, at which point 0.5% xylose was added for induction.
9. The method for secreting polymyxin according to claim 8, characterized in that, The fermentation medium is Ashubei fermentation medium.
Citation Information
Patent Citations
Promoter expressing foreign genes and application of promoter
CN107142259A
Mutant of polymyxin efflux transporter and application thereof
CN121293300A
Genetically modified bacillus subtilis strain and use as a live delivery and production system
US20240390433A1
Paenibacillus strains producing low amounts of DAB comprising compounds
US20250008961A1