A transcription factor gene LrbHLH1 from Minjiang lily and its application

By introducing the Minjiang lily transcription factor gene LrbHLH1 into tobacco, the problems of soil pollution and poor control effect of chemical pesticides for plant diseases have been solved, achieving high-efficiency antifungal ability and sustainable agricultural development.

CN118792317BActive Publication Date: 2026-05-26KUNMING UNIV OF SCI & TECH
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
KUNMING UNIV OF SCI & TECH
Filing Date
2024-08-21
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

In existing technologies, the use of chemical pesticides to control plant diseases results in problems such as agricultural product residues and soil pollution. Furthermore, the pesticides are less effective at controlling plants with long cultivation cycles, which affects the sustainable development of agriculture.

Method used

Using genetic engineering, the transcription factor gene LrbHLH1 from Minjiang lily was introduced into tobacco and overexpressed to enhance its resistance to *Pseudomonas stolonifera* and *Alternaria alternata*. A plant overexpression vector was constructed and transferred into tobacco using *Agrobacterium tumefaciens*, and highly resistant transgenic plants were screened.

Benefits of technology

It significantly enhances tobacco's resistance to fungal diseases, shortens the breeding cycle, reduces the use of chemical pesticides, lowers environmental pollution, and provides highly efficient resistant plant materials.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118792317B_ABST
    Figure CN118792317B_ABST
Patent Text Reader

Abstract

This invention discloses a transcription factor gene of Minjiang lily. LrbHLH1 Its nucleotide sequence is as described in SEQ ID NO: 1, encoding a protein with the amino acid sequence shown in SEQ ID NO: 2. This invention has confirmed this through reverse genetics technology. LrbHLH1 The gene has the function of enhancing plant resistance to fungi, and the present invention will... LrbHLH1 Genes were constructed into plant expression vectors and overexpressed in tobacco. The transgenic tobacco plants exhibited strong resistance to fungal infection, demonstrating the effectiveness of overexpression. LrbHLH1 The genetically modified tobacco plants exhibit high levels of resistance to infection by *Alternaria alternata* and *Alternaria solani*.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and genetic engineering, specifically to a transcription factor gene in *Lilium minjiangense* that enhances the plant's resistance to fungal infection. LrbHLH1 And its applications. Background Technology

[0002] During their growth and development, plants are susceptible to biotic and abiotic stresses, which ultimately affect the yield and quality of plant products. Diseases caused by pathogenic fungi seriously affect plant growth and development, with fungal diseases accounting for approximately 70% to 80% of all diseases (Du Yannan, Wang Meng, Ma Jianqiang, et al. Early detection technology of plant pathogenic fungi and its application in the prediction and forecasting of anthracnose in rubber trees. Journal of Tropical Biology, 2021, 12(1): 124-131.). Currently, the main method for controlling plant diseases is chemical pesticide control, but this method is less effective for plants with long cultivation cycles and also has some drawbacks. Pesticide residues on agricultural products seriously affect their quality. In addition, pesticide residues in the soil affect the health of the soil and are detrimental to the sustainable development of agriculture. With the development of transgenic technology, molecular breeding using genetic engineering technology can enhance the plant's ability to defend against pathogenic fungal infections, overcome the drawbacks of chemical control, and promote the sustainable development of agriculture.

[0003] In response to various developmental signals and environmental changes, plants establish effective defense responses through complex signaling pathways. These pathways produce stress-induced phytochemicals that play an indispensable role in plant immunity. Transcription factors regulate plant defense responses by sensing stress signals and controlling the expression of downstream defense genes. Transcription factors, also known as trans-acting factors, are proteins that can specifically bind to cis-acting elements in the promoter regions of target genes. Typical plant transcription factors generally consist of four functional domains: a DNA-binding domain, a transcription regulation domain, a nulcear localization signal domain, and an oligomerization site (Chen Xia, Luo Shiqiao, Duan Cuifang, et al. Research progress on transcription factors in higher plants. Anhui Agricultural Science Bulletin, 2008, 14(9): 48-52, 65.). Overexpressing a disease-resistant transcription factor gene in plants through genetic engineering is equivalent to introducing multiple disease-resistant genes, thereby improving overall disease resistance. Therefore, transcription factors have become a research hotspot in plant disease resistance genetic engineering in recent years. There are about 58 transcription factor families in plants, among which six major transcription factor families, AP2 / ERF (APETALA2 / ethylene responsive factor), bHLH (basic helix-loop-helix), myeloblastosis related (MYB), NAC [NAM (no apical meristem), ATAF1 / 2 (Arabidopsis transcription activation factor), CUC2 (cup-shaped cotyledon)], WRKY and bZIP (basic leucine zipper), are involved in biotic and abiotic stress responses (Ng DW, Abeysinghe JK, Kamali M. Regulating the regulators: the control of transcription factors in plant defense signaling. International journal of molecular sciences. 2018, 19(12): 3737).

[0004] The bHLH family has been shown to be regulators of plant defense responses. bHLH proteins contain a conserved 60-amino acid domain, in which the terminal basic residue binds to DNA sites. α Helices mediate their interactions with proteins to construct homodimeric or heterodimeric complexes (Atchley WR, Fitch WM. A natural classification of the basic helix-loop-helix class of transcription factors. Proceedings of the National Academy of Sciences of the United States of America. 1997, 94(10): 5172-5176.). bHLH transcription factors can regulate plant defense responses by modulating the biosynthesis of secondary metabolites, such as flavonoids, anthocyanins, glucosinolates, diterpenoid phytoalexins, and saponins (Meraj TA, Fu J, Raza MA, et al. Transcriptional factors regulate plant stress responses through mediating secondary metabolism. Genes (Basel). 2020, 11(4): 346). Chrysanthemum CmbHLH18 Heterologous overexpression of [a specific gene] enhances Arabidopsis resistance to necrotrophic fungi by increasing callose deposition, preventing spore entry into leaves, reducing ROS accumulation, increasing the activity of antioxidant and defensive enzymes, and promoting the expression of resistance-related genes (Ding Y, Wang X, Wang D, et al. Identification of CmbHLH transcription factorfamily and excavation of [a specific gene]. CmbHLHs resistant to necrotrophic fungus Alternaria in C hrysanthemum Genes (Basel). 2023, 14(2): 275.). The transcription factor GhPAS1 belongs to the bHLH family. GhPAS1Silencing of GhPAS1 increases susceptibility to Verticillium wilt in cotton, while overexpression of GhPAS1 increases resistance to Verticillium dahliae (Zhang J, Gu M, Wu H, et al. GhPAS1, a bHLH transcription factor in uplandcotton). Gossypium hirsutum ), positively regulates Verticillium dahlia resistance. Industrial Crops&Products, 2023, 192: 116077).

[0005] Lilies belong to the genus *Lilium* in the family Liliaceae. Lilium Lilies are perennial herbaceous plants. They have high ornamental value and market demand, and have become one of the major flowers in the global cut flower market. However, with the continuous expansion of lily planting area, they are threatened by various diseases from bulb propagation to cut flower production, including wilt, gray mold, and viral diseases (Zhu Maoshan, Guan Tianshu. Major diseases of lilies and their key control technologies. Liaoning Agricultural Sciences, 2007(6):41-43.). Among them, those caused by the genus *Falcae* (… Fusarium Fusarium wilt caused by fungi is the most serious disease in lily production (Huang Juan, Fu Liang, Wang Qiang, et al. Causes and control measures of lily wilt. Southern Agriculture, 2015, 9(15): 23-24). After Fusarium wilt infects lily bulbs, it causes basal necrosis, scale rot and shedding, resulting in a decline in bulb quality; after plants are infected with Fusarium, the leaves turn yellow, wilt and droop, and the plants wither and die prematurely, seriously affecting the yield and quality of cut lily flowers. Among them, Fusarium oxysporum (Fusarium oxysporum) Fusarium oxysporum This fungus is highly pathogenic and has the highest isolation frequency, making it the main pathogen causing lily wilt. (Minjiang lily (…) Lilium regale *Lilium Wilson* is a wild lily endemic to my country, mainly distributed in rock crevices in river valleys and mountainsides at altitudes of 800–2700 m in the Minjiang River basin of Sichuan Province. It exhibits strong resistance to Fusarium wilt and is an important germplasm resource for modern lily breeding. Transcription factors of the bHLH family play a crucial role in plant defense responses; therefore, research on *Lilium Wilson* is essential. LrbHLH1 The discovery and functional analysis of [the organism] have significant research and application value. Summary of the Invention

[0006] This invention provides a transcription factor gene of Minjiang lily. LrbHLH1 And its ability to improve the resistance of tobacco to mold growth on grass stems ( Phoma herbarum Alternaria alternifolia ( ) Alternaria solani Applications in resistance.

[0007] This invention clones transcription factor genes from Lilium minjiangense. LrbHLH1 , LrbHLH1 The nucleotide sequence is shown in SEQ ID NO:1. The full-length cDNA sequence of this gene is 972 bp, containing a 735 bp open reading frame, a 46 bp 5' untranslated region, and a 191 bp 3' untranslated region, encoding a protein with the amino acid sequence shown in SEQ ID NO:2.

[0008] In this invention LrbHLH1 The coding region of the gene is the nucleotide sequence shown in SEQ ID NO:1, positions 47-781.

[0009] This invention isolates and clones a transcription factor gene from the Minjiang lily. LrbHLH1 The complete cDNA fragment was obtained using Agrobacterium tumefaciens (Gastrointestinal rust) Agrobacterium tumefaciens The inventors mediated the transfer of the target gene into recipient plants and overexpressed it. Further experiments were conducted to verify whether this gene could enhance the plant's antifungal activity, laying the foundation for future applications in improving the resistance of tobacco and other plants to fungal diseases. The gene was named... LrbHLH1 .

[0010] The above LrbHLH1 The gene was applied to improve the antifungal ability of tobacco, and the specific operation is as follows:

[0011] (1) Amplification LrbHLH1 Specific primers were used to extract total RNA from the roots of *Lilium minjiangense*, and the RNA was amplified by reverse transcription-polymerase chain reaction (RT-PCR). LrbHLH1 The coding region was then ligated into the pGEM-T vector, and clones containing the target gene were obtained by sequencing.

[0012] (2) Using restriction endonucleases Eco RⅠ and Bam HI enzyme digestion of pGEM-T- LrbHLH1 The target gene fragment was obtained by gel extraction from the vector. The plant expression vector pCAMBIA2300s was digested with the same restriction enzyme, and the desired large vector fragment was obtained by gel extraction. The obtained fragment was then... LrbHLH1 The gene fragment was linked with the pCAMBIA2300s fragment to construct a plant overexpression vector, and then the constructed recombinant vector was transformed into tobacco for expression via Agrobacterium tumefaciens.

[0013] (3) Transformants were screened using the resistance markers on the recombinant vector T-DNA, and real transgenic plants were obtained by PCR detection. The ability of transgenic plants to resist fungal infection was analyzed, and finally transgenic plants with significantly enhanced resistance to fungi were screened.

[0014] This invention provides a novel method for improving plant resistance to fungal diseases. By using genetic engineering to cultivate disease-resistant plants, it overcomes the shortcomings of traditional breeding methods, shortening the breeding cycle, simplifying the process, and making it easier to obtain highly resistant materials. This invention originates from the Minjiang lily. LrbHLH1 Genes can enhance plant resistance to fungi. Introducing this gene into tobacco can produce new varieties and materials with fungal resistance. The use of genetic engineering technology to cultivate resistant plant varieties and materials has significant advantages and irreplaceable importance; it not only facilitates large-scale production of crops, medicinal herbs, and horticultural plants, greatly reducing the use of chemical pesticides, but also saves costs in agricultural production and reduces environmental pollution. Therefore, this invention has broad market application prospects. Attached Figure Description

[0015] Figure 1 The plant expression vector pCAMBIA2300s- of this invention LrbHLH1 The image shows the PCR detection results of Agrobacterium tumefaciens LBA4404. The marker in the image is the DL2000 DNA Marker (Takara Bio Engineering (Dalian) Co., Ltd., China), which consists of five DNA fragments of 2,000 bp, 1,000 bp, 750 bp, 500 bp, and 250 bp. The positive control is plasmid pGEM-T- LrbHLH1 The negative control is the PCR product with sterile water as the template; the negative control is the PCR product with sterile water as the template; serial numbers 1-20 are the plant expression vector pCAMBIA2300s- LrbHLH1 PCR products using bacterial culture as a template after being transformed into Agrobacterium tumefaciens LBA4404;

[0016] Figure 2 This is the present invention. LrbHLH1 The image shows the PCR detection results of genomic DNA from transgenic tobacco. The marker in the image is the DL2000 DNA Marker (Takara Bio Engineering Dalian Co., Ltd., China), which consists of five DNA fragments of 2,000 bp, 1,000 bp, 750 bp, 500 bp, and 250 bp. The positive control is plasmid pGEM-T- LrbHLH1 The first PCR product used as the template; the negative control was a PCR product using sterile water as the template; the WT was a PCR product using total DNA from non-transgenic tobacco (wild-type) as the template; numbers 1-21 represent partial... LrbHLH1 PCR products using transgenic tobacco genomic DNA as a template;

[0017] Figure 3 This is the present invention. LrbHLH1 The antibacterial activity analysis of the methanol extract of transgenic tobacco is shown in Figures a and b, where the fungi shown are *Pseudomonas aeruginosa* and *Alternaria solani*, respectively; WT represents 60% methanol extract of wild-type tobacco, and Buffer represents the blank control, i.e., methanol solution (60%); I-6, I-10, and I-15 represent... LrbHLH1 Genetically modified tobacco;

[0018] Figure 4 This is the present invention. LrbHLH1 Resistance analysis diagram of transgenic tobacco; where Figures a and b are wild-type tobacco and *Alternaria alternata* inoculated with *Pseudomonas aeruginosa* and *Alternaria solani*, respectively. LrbHLH1 Disease symptoms in transgenic tobacco leaves; WT in the image represents wild-type tobacco; I-6, I-10, and I-15 are respectively... LrbHLH1 Genetically modified tobacco. Detailed Implementation

[0019] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. However, the scope of protection of the present invention is not limited to the contents described. Unless otherwise specified, the methods in the embodiments are conventional methods, and the reagents used are conventional commercial reagents or reagents prepared according to conventional methods unless otherwise specified.

[0020] Example 1: LrbHLH1 Gene cloning and sequence analysis

[0021] Total RNA was extracted from the roots of *Lilium spp.* The roots, inoculated with *Fusarium wilt*, were ground into powder using liquid nitrogen and then transferred to centrifuge tubes. Total RNA was extracted using the guanidine isothiocyanate method. The first strand of cDNA was synthesized using reverse transcriptase M-MLV (Promega, USA) as a template. The reaction system and procedure were as follows: 5 μg of total RNA was added, followed by 50 ngoligo (dT), 2 μL of dNTP (2.5 mM), and DEPC water, until the reaction volume reached 14.5 μL. After mixing, the mixture was denatured at 70°C for 5 min and then rapidly cooled on ice for 5 min. Then, 4 μL of 5× First-stand buffer, 0.5 μL of RNasin (200 U), and 1 μL of M-MLV (200 U) were added sequentially. The mixture was mixed and briefly centrifuged, then incubated at 42°C for 1.5 h. The reaction was terminated by heating at 70°C for 10 min. The synthesized first strand of cDNA was stored at -20°C for later use.

[0022] Using the synthesized first-strand cDNA as a template, the target gene is amplified. LrbHLH1The upstream and downstream primer sequences used were 5'ATGAGCTCCGGCCTACTCCGTTA3' and 5'AATACAGCTGCTTAGATTCGTCGAGGA3', respectively. Advantage was adopted. TM The target gene was amplified using PCR Enzyme (Clontech, USA). The PCR reaction conditions were 94℃ for 5 min, 94℃ for 30 s, 54℃ for 30 s, 72℃ for 30 s (32 cycles), and 72℃ for 7 min. The reaction volume (20 μL) consisted of 0.5 μL cDNA, 2 μL 10×Advantage2 PCR Buffer, 0.4 μL 50×dNTP Mix (10 mM each), 0.4 μL forward primer (10 μM), 0.4 μL reverse primer (10 μM), 0.4 μL Advantage 2 PCR Polymerase Mix, and 15.9 μL PCR-Grade water. After PCR, 5 μL was used for agarose gel electrophoresis to detect the specificity and size of the amplified products.

[0023] TA cloning was performed using the pGEM-T Vector System I kit (Promega, USA). The reaction system and procedure were as follows: 1.5 μL of PCR product was added to 1 μL of pGEM-T Vector (50 ng / μL) and 2.5 μL of 2×Ligation solution I, mixed well, and incubated overnight at 16°C. The ligation product was then transformed into *E. coli* DH5α using the heat shock transformation method. Positive clones were screened using LB agar containing ampicillin (Amp), and several single colonies were selected. After shaking, amplification was performed. LrbHLH1 Specific primers were used to identify the inserted... LrbHLH1 Clones. The identified clones were sequenced, and the final results were obtained. LrbHLH1 The full-length cDNA is 972 bp. Analysis using the NCBI ORF finder (http: / / www.ncbi.nlm.nih.gov / gorf / gorf.html) revealed that it contains a 735 bp open reading frame. LrbHLH1 It encodes a protein containing 244 amino acids, with a molecular weight of approximately 27.23 kDa and an isoelectric point of approximately 5.20.

[0024] Example 2: Construction of plant overexpression vectors

[0025] Insertion plasmid DNA was extracted using the SanPrep column-based plasmid DNA mini-extraction kit (Sangon Biotech (Shanghai) Co., Ltd., China). LrbHLH1pGEM-T-E. coli plasmid LrbHLH1 The plant expression vector pCAMBIA2300s plasmid was also used; 1 μL was used for agarose gel electrophoresis to detect the integrity and concentration of the extracted plasmid. Restriction endonucleases were then used... Eco RI (TaKaRa, Japan) and Bam HI (TaKaRa, Japan) separately tested plasmid pGEM-T- LrbHLH1 Double digestion with pCAMBIA2300s (50 μL system) was performed. The reaction system and operation procedure were as follows: Take 20 μL of pGEM-T- LrbHLH1 Add 7.5 μL of 10×K buffer and 2.5 μL of pCAMBIA2300s plasmid sequentially. Eco RI, 2.5μL Bam Add HI and 17.5 μL ddH2O, mix well, centrifuge briefly, and incubate at 37°C for 3 hours for enzyme digestion. Spot all digested products onto an agarose gel for electrophoresis, then... LrbHLH1 The fragments and the large fragment of the pCAMBIA2300s vector were separately recovered using a gel extraction kit (SanPrep DNA Gel Extraction Column Kit, Sangon Biotech (Shanghai) Co., Ltd., China). 1 μL of the recovered product was analyzed by agarose gel electrophoresis to determine the size and concentration of the recovered fragments, and then stored at -20°C for later use.

[0026] Using T4 DNA Ligase (TaKaRa, Japan), the recovered DNA was... LrbHLH1 The DNA fragment and the pCAMBIA2300s vector fragment were ligated. The reaction system (20 μL) and the operation procedure were as follows: Take 10 μL... LrbHLH1 The DNA fragment was added sequentially with 2 μL pCAMBIA2300s vector DNA, 2 μL 10×T4 DNA Ligase Buffer, 1 μL T4 DNA Ligase, and 5 μL ddH2O. After mixing, the mixture was briefly centrifuged and then incubated overnight at 16°C. The ligation product was then transformed into *E. coli* DH5α using a heat shock transformation method. Positive clones were screened using solid medium containing 50 mg / L kanamycin (Km). Single colonies were selected and cultured, and the bacterial culture was used as a template for amplification. LrbHLH1 PCR was performed using specific primers to select... LrbHLH1 Clones that have been successfully ligated to pCAMBIA2300s, if the tested strain is positive, add glycerol and store at -80℃ for later use.

[0027] Extract and purify pCAMBIA2300s- from the above-mentioned Escherichia coli. LrbHLH1Plasmid. The constructed plant expression vector pCAMBIA2300s- was then frozen and thawed in liquid nitrogen. LrbHLH1 Transfected into Agrobacterium tumefaciens LBA4404 competent cells. The procedure was as follows: Take 2 μg of pCAMBIA2300s- LrbHLH1 The plasmid was added to a centrifuge tube containing 200 μL of competent cells, gently mixed, and incubated on ice for 5 min. Then, it was transferred to liquid nitrogen and frozen for 1 min, followed by immediate incubation at 37°C for 5 min, then immediately incubated on ice for 2 min. 800 μL of LB broth was added, and the cells were incubated at 28°C with shaking for 4 h. The activated Agrobacterium was plated on LB solid medium containing 50 mg / L Km and incubated statically at 28°C. Single colonies were selected and shaken for further amplification. LrbHLH1 PCR was performed using specific primers to detect pCAMBIA2300s- LrbHLH1 To determine whether to transfer the bacteria into Agrobacterium, for positive clones, add glycerol and store at -80°C for later use. Detect pCAMBIA2300s- LrbHLH1 PCR analysis results of Agrobacterium LBA4404 were as follows: Figure 1 As shown, the plant overexpression vector pCAMBIA2300s- was successfully constructed. LrbHLH1 .

[0028] Example 3: Agrobacterium-mediated plant genetic transformation and screening of transgenic plants

[0029] The transgenic recipient in this experiment was tobacco. Tobacco seeds were soaked in 75% alcohol for 30 seconds, washed with sterile water, soaked in 0.1% HgCl2 for 8 minutes, washed several times with sterile water, sown on 1 / 2 MS medium, and cultured in the dark at 28℃ for 6 days. After germination, they were transferred to a light incubator (25℃, 16 h / d light). Subcultured monthly with 1 / 2 MS medium thereafter.

[0030] Removed from a -80℃ freezer containing pCAMBIA2300s- LrbHLH1 Agrobacterium LBA4404 strain containing plasmids was inoculated into 5 mL of LB liquid medium containing 50 mg / L Km and 20 mg / L rifampin, and cultured at 28°C until the medium became turbid. 1 mL of the turbid bacterial culture was transferred to LB solid medium containing 50 mg / L Km and cultured at 28°C for 48 h. Subsequently, an appropriate amount of Agrobacterium was scraped from the LB solid medium and inoculated into MGL liquid medium supplemented with 20 mg / L acetylsyleugenol, and cultured at 28°C with shaking for 2-3 h to activate the Agrobacterium.

[0031] Take leaves from sterile tobacco seedlings and cut them into 1 cm pieces. 2The leaf discs on both sides were completely immersed in the MGL liquid medium containing activated Agrobacterium for 15 min. The bacterial solution on the leaf surface was then blotted dry with sterile filter paper. The leaf discs were then placed on a co-culture medium for room temperature incubation. The co-culture medium for tobacco transformation was MS + 0.02 mg / L 6-BA + 2.1 mg / L NAA + 30 g / L sucrose + 6 g / L agar, and incubated in the dark at 22°C for 2 days.

[0032] After co-culture, the leaf discs were transferred to MS selection medium supplemented with antibiotics for differentiation into seedlings, and transgenic plants were screened simultaneously. The tobacco selection medium consisted of MS medium supplemented with 0.5 mg / L 6-BA, 0.1 mg / L NAA, 30 g / L sucrose, 6 g / L agar, 50 mg / L Km, and 200 mg / L cefotaxime sodium salt (Cef). During selection culture, the culture flasks were transferred to a light incubator (25℃, 16 h / d light, 8 h / d dark). After the tobacco plants sprouted, they were subcultured on MS medium containing 50 mg / L Km and 200 mg / L Cef. The regenerated tobacco seedlings were then transferred to MS medium containing 50 mg / L Km to allow rooting. Finally, the best-rooted regenerated seedlings were selected for PCR detection.

[0033] Genomic DNA was extracted from the leaves of transgenic tobacco plants using the CTAB method. 1 μL of the extracted genomic DNA was analyzed for integrity and concentration by agarose gel electrophoresis. The genomic DNA from the transgenic plants was then used as a template for amplification. LrbHLH1 PCR was performed using specific primers. After PCR, 8 μL of the product was used for agarose gel electrophoresis to detect positive transgenic plants. The amplification results of some tobacco transgenic plants are shown below. Figure 2 As shown, a total of 32 positive transgenic plants were screened.

[0034] Example 4: LrbHLH1 In vitro antibacterial test of methanol extract of genetically modified tobacco

[0035] Laboratory-preserved pathogenic fungi were inoculated onto PDA solid medium (200 g / L potato, 15 g / L agar, 20 g / L glucose) and incubated in the dark at 28°C. When colonies grew to approximately 2-3 cm in diameter, methanol extract was added, and their antibacterial activity was analyzed. 5 g of transgenic tobacco plants (numbered I-6, I-10, and I-15) and wild-type leaves were placed in a mortar, ground into powder with liquid nitrogen, and then 20 mL of 60% methanol was added. Extraction was performed using an ultrasonic shaker for 45 min. After extraction, the mixture was centrifuged at 10,000 g for 10 min, and the supernatant was collected for further analysis. 20 μL of 60% methanol solution (blank control), wild-type tobacco methanol extract, and I-6 / I-10 / I-15 transgenic tobacco methanol extract were dropped onto sterile filter paper discs of the fungal culture medium. The fungal growth was observed after incubation at 28°C for 3-5 days, and the results were evaluated. LrbHLH1 The in vitro antifungal activity of genetically modified tobacco was as follows: Figure 3 As shown, LrbHLH1 Methanol extracts of genetically modified tobacco (I-6 / I-10 / I-15) showed significant inhibitory effects on the growth of *Pseudomonas stolonifera* and *Alternaria alternata*.

[0036] Example 5: LrbHLH1 Analysis of resistance of genetically modified tobacco to pathogenic fungi

[0037] The pathogenic fungus preserved in the laboratory was inoculated onto PDA solid medium (200 g / L potato, 15 g / L agar, 20 g / L glucose), and incubated in the dark at 28°C for 7 days to prepare a spore suspension (10... 5 / mL). In wild-type tobacco and LrbHLH1 Uniformly sized wounds were developed on the leaves of transgenic tobacco (I-6 / I-10 / I-15), and 20 μL of spore suspension was applied to these wounds. The leaves were placed on filter paper moistened with sterile water and incubated at 28°C under light for 7 days. The leaves were then removed and the disease development was observed. The results are shown in Figure 4. LrbHLH1 Genetically modified tobacco exhibits high levels of resistance to *Alternaria alternata* and *Alternaria solani*.

Claims

1. A transcription factor gene of *Lilium minjiangense* LrbHLH1 In improving the resistance of tobacco to mold growth on stems ( Herbs Alternaria alternifolia ( ) Alternaria solani Its application in resistance is characterized by: Minjiang lily transcription factor gene LrbHLH1 The nucleotide sequence is shown in SEQ ID NO:1.

Citation Information

Patent Citations

  • CN118599860A

  • CN118685428A

  • CN120330250A

  • CN120366334A

  • CN120485272A