Method for promoting maturation of tomato fruits

Abstract

The invention relates to the technical field of biology, in particular to application of tomatoes SlWRKY39 and SlWRKY40 in regulation and control of tomato fruit maturity. The invention discloses a method for promoting maturation of tomato fruits. According to the method, SlWRRY39 and SlWRKY40 genes are knocked out at the same time, and maturation of the tomato fruits is promoted. The invention also provides a gene editing vector for promoting the maturation of the tomato fruits, wherein the gene editing vector is pCAMBIA1300-pYAO: Cas9-(SlWRKY39 + SlWRKY40). Through fruit phenotype observation and average maturation time statistics, it is found that simultaneous knockout of SlWRKY39 and SlWRKY40 promotes maturation of tomato fruits.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of tomato SlWRKY39 and SlWRKY40 in regulating tomato fruit ripening. Background Art

[0002] Tomato is one of the most important vegetable crops in the world. It is deeply loved by growers and consumers because of its wide adaptability, unique flavor, sweet and sour taste, rich nutrition and high economic value. The ripening of the fruit is an important period for the formation and accumulation of tomato flavor and nutrients. It not only affects the quality and post-harvest storage time of tomatoes, but also affects the time to market and the commercial value of tomatoes. Therefore, studying the regulatory mechanism of tomato fruit ripening is not only a prerequisite for breeding new varieties of tomatoes with different maturity and improving tomato quality, but also the basis for the research and development of post-harvest storage and preservation technology, which is of great significance to the tomato industry.

[0003] Fruit ripening is a highly programmed and complex biological process, which is affected by external factors such as temperature, light, and water, as well as fine regulation by internal factors such as plant hormones, transcription factors, epigenetic modifications, and microRNA. Among them, transcription factors are a class of protein molecules that can specifically bind to specific gene sequences to ensure that the target gene is expressed at a specific intensity at a specific time and space, and play an important role in the regulation of fruit ripening (Wang Ying et al., 2014). According to bioinformatics prediction, there are at least 62 transcription factor families in tomatoes, among which WRKY is a plant-specific transcription factor family named because it contains a conserved sequence consisting of 7 amino acids WRKYGQK. Studies have shown that many WRKY transcription factors are involved in the regulation of tomato fruit ripening. For example, Zhang et al. (2024) found that phosphorylation of SlWRKY6 can promote its transcriptional activation of downstream genes SlSGR1 and SlSAG12, thereby promoting tomato fruit ripening; Shang et al. (2024) found that SlWRKY80 promoted tomato ripening and fruit coloring by recruiting HDA1; Yu Yue et al. (2023) constructed SlWRKY53b gene silencing tomato fruit through VIGS and found that the color breaking period of tomato fruit was delayed and the fruit ripening was delayed. The expression levels of SlWRKY31 and SlWRKY23 genes were upregulated during the color breaking period and red ripening period of the fruit. After inhibiting the expression of SlWRKY16, SlWRKY17, SlWRKY53 and SlWRKY54 genes by VIGS method, the redding process of tomato fruit was delayed.

[0004] Tomato SlWRKY39 (Solyc03g116890.2.1) is a type IIa transcription factor in the tomato WRKY transcription factor family, containing a WRKY domain and a Cys(2)-His(2) zinc finger structure, which is highly homologous to AtWRKY40 in Arabidopsis. Studies have shown that SlWRKY39 is involved in tomato resistance to the pathogen Pseudomonas syringae, salt stress, and drought stress (Sun et al., 2015).

[0005] SlWRKY40 (Solyc06g068460.2.1) is a homologous gene of SlWRKY39. It has been found that it can participate in the regulation of lycopene synthesis in tomato fruit (Zhejiang University, 2022) and can be induced by drought, salt, pathogens, elicitors and viruses (Huang et al., 2017).

[0006] The above functions of SlWRKY39 and SlWRKY40 are not related to the regulation of tomato fruit ripening.

[0007] It should be noted that SlWRKY31 is a class I WRKY transcription factor, SlWRKY6 (IIb), SlWRKY16 (IIb) and SlWRKY17 (IIb) belong to class IIb WRKY transcription factors, SlWRKY23 (IIc) belongs to class IIc WRKY transcription factors, SlWRKY80 (III), SlWRKY53b (III), SlWRKY53 (III) and SlWRKY54 (III) belong to class III WRKY transcription factors; and SlWRKY39 and SlWRKY40 belong to class IIe WRKY transcription factors, which differ from the above-mentioned WRKY transcription factors in protein structure and function.

[0008] The references mentioned above are as follows:

[0009] Huang S, Gao Y, Liu J, Peng X, Niu

[0010] Shang C,Chen G,Liu X,Zheng H,Li G,Wang J,Hu S,Li Z,Hu X.SlWRKY80recruits SlHDA1 to regulates the tomato fruit ripening and colortransformation.BioRxiv.2024.doi:https: / / doi.org / 10.1101 / 2024.01.31.578225.

[0011] Sun X, Gao Y, Li H, Yang S, Liu Y. Over-expression of SlWRKY39 leads to enhanced resistance to multiple stress factors in tomato. Journal of PlantBiology. 2015.58:52-60.

[0012] Zhang M, Hu K, Ma L, Geng M, Zhang C, Yao G, Zhang H. Persulfidation and phosphorylation of transcription factor SlWRKY6 differentially regulatetomato fruit ripening. Plant Physiology. 2024.196(1):210–227.

[0013] Wang Ying, Kong Junhua, Chen Weiwei, Zhou Ting, Lai Tongfei. Research progress on transcription factors related to tomato fruit ripening[J]. Acta Horticulturae Sinica, 2014, 41(9): 811-1820.

[0014] Yu Yue, Wang Siyue, Guo Wentong, Yao Gaifang, Zhang Hua, Hu Kangdi. VIGS silencing of SlWRKY53b gene inhibits tomato fruit ripening[J]. Chinese Journal of Biochemistry and Molecular Biology, 2023(11): 1598-1605.

[0015] Zhejiang University. A gene for increasing the lycopene content in tomato fruit and its application: CN116200421B[P]. 2022-12-06. Summary of the invention

[0016] The technical problem to be solved by the present invention is to provide the use of SlWRKY39 and SlWRKY40 genes - for regulating the ripening of tomato fruits.

[0017] In order to solve the above problems, the present invention provides a method for promoting the ripening of tomato fruits: knocking out the SlWRRY39 and SlWRKY40 genes simultaneously can promote the ripening of tomato fruits;

[0018] The nucleotide sequence of the SlWRRY39 gene is shown in SEQ ID No:1, and the nucleotide sequence of the SlWRRY40 gene is shown in SEQ ID No:2.

[0019] That is, the present invention provides the use of SlWRKY39 and SlWRKY40 genes in regulating tomato fruit ripening.

[0020] In the present invention, the protein encoded by the SlWRKY39 gene has an amino acid sequence as shown in SEQ ID NO: 3, and the protein encoded by the SlWRKY40 gene has an amino acid sequence as shown in SEQ ID NO: 4.

[0021] The present invention also provides a gene editing vector for promoting tomato fruit ripening: pCAMBIA1300-pYAO:Cas9-(SlWRKY39+SlWRKY40).

[0022] The present invention also provides a method for constructing the above gene editing vector, comprising the following steps:

[0023] (1) Design target:

[0024] The target sequence of SlWRKY39 is 5'AATTCATCGGAAACTCGAAG 3',

[0025] The target sequence of SlWRKY40 is 5′TGGTGGTGAAAAATGAGGCA 3′;

[0026] (2) Double gRNA cassette construction:

[0027] First, obtain the recombinant vector AtU6-26-sgRNA-SK-SlWRKY39 containing the SlWRKY39 target site and the recombinant vector AtU6-26-sgRNA-SK-SlWRKY40 containing the SlWRKY40 target site;

[0028] Then, the recombinant vector AtU6-26-sgRNA-SK-(SlWRKY39+SlWRKY40) containing both SlWRKY39 and SlWRKY40 gRNA cassettes was obtained;

[0029] The recombinant vector AtU6-26-sgRNA-SK-(SlWRKY39+SlWRKY40) was then double-digested with Nhe I and Spe I to obtain a double gRNA cassette containing both SlWRKY39 and SlWRKY40 gRNA cassettes;

[0030] (3) Binary vector construction:

[0031] The pCAMBIA1300-pYAO:Cas9 plasmid was digested with SpeI and connected to the double gRNA cassette to obtain pCAMBIA1300-pYAO:Cas9-(SlWRKY39+SlWRKY40).

[0032] As an improvement to the method for constructing the gene editing vector of the present invention, in step (1):

[0033] SlWRKY39 target primer: 5' ATTG AATTCATCG GAAACTCGAAG 3' (ATTG is the linker sequence) and 5' AAAC CTTCGAGTTTCCGATGAATT 3' (AAAC is the linker sequence);

[0034] SlWRKY40 target primer: 5' ATTG TGGTGGTGAAAAATGAGGCA 3' (ATTG is the linker sequence) and 5' AAAC TGCCTCATT TTTCACCACCA 3' (AAAC is the linker sequence).

[0035] The present invention also provides double gene knockout mutants of SlWRRY39 and SlWRKY40: double gene knockout mutants slwrky39slwrky40-1 and slwrky39slwrky40-2;

[0036] The CDS sequence of the SlWRKY39 gene in slwrky39slwrky40-1 is shown in SEQ ID No: 5, and the CDS sequence of the SlWRKY40 gene is shown in SEQ ID No: 6;

[0037] The CDS sequence of the SlWRKY39 gene in slwrky39slwrky40-2 is shown as SEQ ID No:5, and the CDS sequence of the SlWRKY40 gene is shown as SEQ ID No:7.

[0038] The present invention also provides the use of tomato SlWRKY39 and SlWRKY40 in regulating the ripening of tomato fruits.

[0039] As an improvement of the application of the present invention: knocking out SlWRRY39 and SlWRKY40 genes at the same time to promote the ripening of tomato fruits;

[0040] The nucleotide sequence of the SlWRRY39 gene is shown in SEQ ID No:1, and the nucleotide sequence of the SlWRRY40 gene is shown in SEQ ID No:2.

[0041] The present invention also provides a host cell containing the gene, wherein the host cell is an Escherichia coli cell or an Agrobacterium cell.

[0042] The present invention constructs a tomato SlWRKY39 and SlWRKY40 double gene knockout tomato for the first time and conducts functional studies. Through fruit phenotype observation and average ripening time statistics, it is found that simultaneous knockout of SlWRKY39 and SlWRKY40 promotes the ripening of tomato fruit. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] The specific implementation modes of the present invention are further described in detail below with reference to the drawings.

[0044] Figure 1 This is the vector map of AtU6-26-sgRNA-SK.

[0045] Figure 2 This is the pCAMBIA1300-pYAO:Cas9 vector map.

[0046] Figure 3 This is the map of the pCAMBIA1300-pYAO:Cas9-(SlWRKY39+SlWRKY40) vector.

[0047] Figure 4 is the slwrky39slwrky40 double mutant genotype;

[0048] Figure 4 middle:

[0049] The upper figure shows the genotype of SlWRKY40 in the wild-type material, slwrky39slwrky40-1 and slwrky39slwrky40-2 materials, and the lower figure shows the genotype of SlWRKY39 in the wild-type material, slwrky39slwrky40-1 and slwrky39slwrky40-2 materials.

[0050] Figure 5 The ripening process of the fruits of the slwrky39slwrky40 double mutant and the control.

[0051] Figure 6 is the average ripening time of the fruits of the slwrky39slwrky40 double mutant and the control, that is, the time from flowering to fruit color breaking. **** indicates that there is a significant difference between the transgenic line and the control (p<0.0001).

[0052] Figure 7 It is the CDS sequence of SlWRKY39 gene.

[0053] Figure 8 This is the CDS sequence of the SlWRKY40 gene in slwrky39slwrky40-1.

[0054] Fig. 9 This is the CDS sequence of the SlWRKY40 gene of slwrky39slwrky40-2. DETAILED DESCRIPTION

[0055] The present invention is further described below in conjunction with specific examples, but the protection scope of the present invention is not limited thereto. 1. Construction of gene editing vector pCAMBIA1300-pYAO:Cas9-(SlWRKY39+SlWRKY40) 1. Target design

[0056] The online search software http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR was used to search for targets in the CDS region of SlWRKY40 and SlWRKY39. The most suitable target primers were determined based on the criteria of high software score, good specificity, and proximity to the transcription start site ATG, and primer adapters were added to their 5' ends. The specific information is as follows: the target sequence of SlWRKY39 is 5'AATTCATCGGAAACTCGAAG 3', and the target primers of SlWRKY39 are 5' ATTG AATTCATCGGAAACTCGAAG 3' (ATTG is the linker sequence) and 5' AAAC CTTCGAGTT TCCGATGAATT 3' (AAAC is the linker sequence). The target sequence of SlWRKY40 is 5'TGGTGGTG AAAAATGAGGCA 3', and the target primers of SlWRKY40 are 5' ATTG TGGTGGTGAAAAATGAGGCA 3' (ATTG is the linker sequence) and 5' AAAC TGCCTCATTTTTCACCACCA3' (AAAC is the linker sequence).

[0057] 2. Binary vector construction

[0058] 2.1 Target primer annealing

[0059] Dissolve the target primer to a final concentration of 1uM, heat it in a PCR instrument at 98°C for 3 minutes, take it out immediately, and cool it naturally to room temperature to obtain the annealed target primer for connection.

[0060] 2.2 Double gRNA cassette construction

[0061] First, take 1ug of AtU6-26-sgRNA-SK plasmid (see Figure 1 ), digested with BsaI-HF at 37℃ for 60min in a 50μL system, purified with a DNA purification kit to obtain the digested AtU6-26-sgRNA-SK vector. The 50μL system is: 1μg plasmid, 2μL endonuclease, 5μL 10×buffer, 50μL ddH2O. Next, the annealed target primer and the digested AtU6-26-sgRNA-SK vector are connected. The reaction system (10μL) is as follows: 1μL 10×T4 DNA Ligase buffer, 40ng digested vector, 1μL annealed primer, 40U T4 DNA ligase, 10μL ddH2O. The reaction system is placed at room temperature for 30min to obtain a ligation product.

[0062] Afterwards, 10 μL of the ligation product was transformed into E. coli, spread on LB solid medium containing ampicillin (concentration of 50 mg / mL), cultured at 37°C for 10-12 hours, and a single colony was picked for colony PCR and sequencing to confirm whether the target was connected to the vector. The colony PCR front primer sequence was 5'CTCACTATAGGGCGAATTGG 3', the rear primer was the target rear primer, and the PCR fragment length was 499 bp.

[0063] When the target primer is the SlWRKY39 target primer, a recombinant vector containing the SlWRKY39 target is obtained, which is named AtU6-26-sgRNA-SK-SlWRKY39;

[0064] When the target primer is the SlWRKY40 target primer, a recombinant vector containing the SlWRKY40 target is obtained, which is named AtU6-26-sgRNA-SK-SlWRKY40.

[0065] AtU6-26-sgRNA-SK-SlWRKY39 was digested with Spe I as a vector, and AtU6-26-sgRNA-SK-SlWRKY40 was double-digested with Nhe I and Spe I. After recovery, the fragment was ligated with the vector digested with Spe I using T4 DNA ligase to form a recombinant vector containing both SlWRKY39 and SlWRKY40 gRNA cassettes, named AtU6-26-sgRNA-SK-(SlWRKY39+SlWRKY40). The recombinant vector was double-digested with Nhe I and Spe I, and the fragment of about 1280 bp was recovered by gel cutting after electrophoresis. The recovered fragment was the double gRNA cassette containing both SlWRKY39 and SlWRKY40 gRNA cassettes.

[0066] 2.3 Binary vector construction

[0067] First, in a 50 μL system, pCAMBIA1300-pYAO:Cas9 plasmid (see Figure 2 ) digested for 30 min, inactivated at 80°C for 20 min. 0.2 μL alkaline phosphatase was added to the system, reacted at 37°C for 10 min to dephosphorylate the vector to prevent the vector from self-ligation, and the digested vector was obtained.

[0068] Next, the digested vector was connected to the double gRNA cassette obtained in step 2.2. The reaction system (10 μL) was as follows: 10×T4 DNA Ligase buffer 1uL, digested vector 40ng, double gRNA cassette 20ng, T4 DNA ligase 40U, ddH2O supplemented to 10μL. The reaction system was placed at room temperature for 30min to obtain the ligation product.

[0069] After that, the ligation product was transformed into Escherichia coli and spread on LB solid medium containing 50 mg / mL kanamycin sulfate. Colony PCR was performed using the primer sequences on the binary vector (primers 1300-gRNA-F and 1300-gRNA-R). The correct single clone (PCR length was about 1400 bp) was picked and cultured. The plasmid was extracted and digested with Sal I and Kpn I. The digested fragment was about 1300 bp. The expression vector finally obtained was named pCAMBIA1300-pYAO:Cas9-(SlWRKY39+SlWRKY40) (see Figure 3 ).

[0070] The correctly identified plasmid was transformed into Agrobacterium and used to infect plants. The primers for colony PCR identification were located at both ends of the Spe I restriction site, and the primer sequences were as follows: 1300-gRNA-F: 5'CCAGTCACGACGTTGTAAAAC 3'; 1300-gRNA-R: 5'CAATGAATTTCC CATCGTCGAG 3'. The PCR fragment length was about 1400 bp.

[0071] 2. Creation of slwrky39slwrky40 double mutant

[0072] The gene editing vector containing SlWRKY39 and SlWRKY40 targets, pCAMBIA1300-pYAO:Cas9-(SlWRKY39+SlWRKY40), was transformed into the Agrobacterium LBA4404 strain, and wild-type tomato Alisa Craig was used as an explant for genetic transformation. The specific steps were referred to the method of Shao et al. (2020), and hygromycin was used for resistance screening to obtain positive seedlings. The genomic DNA of the T0 generation plants was extracted by the CTAB method, and the constructed plasmid was used as a positive control, the wild-type tomato DNA was used as a negative control, and 1300-gRNA-F and 1300-gRNA-R were used as primers for PCR amplification to determine the amplification of the exogenous genes. Afterwards, specific amplification primers were designed upstream and downstream of the target sites of SlWRKY39 and SlWRKY40, respectively. Using the genome as a template, DNA fragments covering the target area were obtained by PCR amplification and sent to the company for sequencing. The sequencing results were analyzed by http: / / shinyapps.datacurators.nl / tide / and DSDecodeM (http: / / skl.scau.edu.cn / dsdecode / ) (Xie et al., 2017) to determine the gene editing status of the target site. Through self-pollination purification, PCR detection and target site sequencing analysis, a homozygous strain with no exogenous DNA insertion and both target sites edited was screened out, which was the slwrky39slwrky40 double mutant (see Figure 4 ).

[0073] The specific amplification primer sequences of SlWRKY39 are as follows:

[0074] SlWRKY39-CRISPR-F: 5'TCAAAGCAAAATGGAGTTCACA 3'

[0075] SlWRKY39-CRISPR-R: 5'TCGATCCATCGCTGTTCTGA 3'

[0076] The specific amplification primers for SlWRKY40 are as follows:

[0077] SlWRKY40-CRISPR-F:5'TGAGCTTTAGGCCTCGTCAA3'

[0078] SlWRKY40-CRISPR-R:5'TGCAACAGGACTCTTCGTCA3'.

[0079] The double knockout mutants slwrky39slwrky40-1 and slwrky39slwrky40-2 were obtained respectively;

[0080] The CDS sequence of the SlWRKY39 gene in slwrky39slwrky40-1 is shown as SEQ ID No:5, and the CDS sequence of the SlWRKY40 gene is shown as SEQ ID No:6; the CDS sequence of the SlWRKY39 gene in slwrky39slwrky40-2 is shown as SEQ ID No:5, and the CDS sequence of the SlWRKY40 gene is shown as SEQ ID No:7.

[0081] Shao Z, Zhao Y, Liu L, Chen S, Li C, Meng F, Liu H, Hu S, Wang J, WangQ. Overexpression of FBR41 enhances resistance to sphinganine analogmycotoxin-induced cell death and Alternaria stem canker in tomato. PlantBiotechnol J. 2020.18(1):141-154.

[0082] Xie X,Ma

[0083] 3. Observation of fruit ripening characteristics of double gene knockout tomatoes

[0084] The slwrky39slwrky40 double mutant (slwrky39slwrky40-1 and slwrky39slwrky40-2) and wild-type tomatoes were planted in a single plastic greenhouse at the Zhijiang Base of the Hangzhou Academy of Agricultural Sciences in the spring of 2024, and all materials were managed uniformly in the field. The flowering period of tomatoes was uniformly marked during the flowering period (when the petals were fully unfolded) and the date was recorded. After the tomato fruits were fully expanded, they were observed and photographed until the fruits were fully mature. During this process, the average time required for the fruit to reach the color-breaking period (when the top of the fruit just began to change color) was calculated.

[0085] Research results: Figure 5 As shown in the figure, compared with wild-type tomato fruits, the color breaking time of slwrky39slwrky40 double mutant fruits was significantly advanced, with slwrky39slwrky40-1 double mutant fruits starting to break color around 36 days after flowering, and slwrky39slwrky40-2 double mutant fruits starting to break color around 37 days after flowering. Figure 6 As shown in the figure, the average time required for the fruits of the slwrky39slwrky40-1 and slwrky39slwrky40-2 double mutants to reach the color breaking stage was 36.6 days and 37.2 days, respectively, which was significantly shorter than the 39.8 days of the wild-type fruits. The above results indicate that the loss of SlWRKY39 and SlWRKY40 functions simultaneously promotes the ripening of tomato fruits.

[0086] During the invention process, the present invention found that: for the mutant with single gene knockout of SlWRKY39, the average time required for the color breaking period was about 39.6 days when the experiment was carried out according to the above method, and for the mutant with single gene knockout of SlWRKY40, the average time required for the color breaking period was about 39.4 days when the experiment was carried out according to the above method, which had no significant difference with the 39.8 days corresponding to the wild-type fruit.

[0087] Finally, it should be noted that the above examples are only some specific examples of the present invention. Obviously, the present invention is not limited to the above implementation cases, and there are many variations. All variations that can be directly derived or associated with the content disclosed by ordinary technicians in this field should be considered as the protection scope of the present invention.

Claims

1. A method for promoting tomato fruit ripening, characterized in that: Knocking out the SlWRRY39 and SlWRKY40 genes simultaneously promotes the ripening of tomato fruits; The nucleotide sequence of the SlWRRY39 gene is shown in SEQ ID No:1, and the nucleotide sequence of the SlWRRY40 gene is shown in SEQ ID No:

2.

2. A gene editing vector for promoting tomato fruit ripening, characterized in that: It is pCAMBIA1300-pYAO:Cas9-(SlWRKY39+SlWRKY40).

3. The method for constructing a gene editing vector according to claim 2, characterized in that The following steps are involved: (1) Design target: The target sequence of SlWRKY39 is 5'AATTCATCGGAAACTCGAAG 3', The target sequence of SlWRKY40 is 5′TGGTGGTGAAAAATGAGGCA3′; (2) Double gRNA cassette construction: First, obtain the recombinant vector AtU6-26-sgRNA-SK-SlWRKY39 containing the SlWRKY39 target site and the recombinant vector AtU6-26-sgRNA-SK-SlWRKY40 containing the SlWRKY40 target site; Then, the recombinant vector AtU6-26-sgRNA-SK-(SlWRKY39+SlWRKY40) containing both SlWRKY39 and SlWRKY40 gRNA cassettes was obtained; The recombinant vector AtU6-26-sgRNA-SK-(SlWRKY39+SlWRKY40) was then double-digested with Nhe I and Spe I to obtain a double gRNA cassette containing both SlWRKY39 and SlWRKY40 gRNA cassettes; (3) Binary vector construction: The pCAMBIA1300-pYAO:Cas9 plasmid was digested with SpeI and connected to the double gRNA cassette to obtain pCAMBIA1300-pYAO:Cas9-(SlWRKY39+SlWRKY40).

4. The method for constructing a gene editing vector according to claim 3, characterized in that In the step (1): SlWRKY39 target primer: 5' ATTG AATTCATCG GAAACTCGAAG 3' and 5' AAAC CTTCGAGTTTCCGATGAATT 3′; SlWRKY40 target primer: 5' ATTG TGGTGGTGAAAAATGAGGCA 3' and 5' AAAC TGCCTCATTTTTCACCACCA 3'.

5. A double knockout mutant of SlWRRY39 and SlWRKY40, characterized in that: They are the double knockout mutants slwrky39slwrky40-1 and slwrky39slwrky40-2; The CDS sequence of the SlWRKY39 gene in slwrky39slwrky40-1 is shown in SEQ ID No: 5, and the CDS sequence of the SlWRKY40 gene is shown in SEQ ID No: 6; The CDS sequence of the SlWRKY39 gene in slwrky39slwrky40-2 is shown as SEQ ID No:5, and the CDS sequence of the SlWRKY40 gene is shown as SEQ ID No:

7.

6. Application of tomato SlWRKY39 and SlWRKY40 in regulating tomato fruit ripening.

7. The use according to claim 6, characterized in that: Knocking out the SlWRRY39 and SlWRKY40 genes simultaneously promotes the ripening of tomato fruits; The nucleotide sequence of the SlWRRY39 gene is shown in SEQ ID No:1, and the nucleotide sequence of the SlWRRY40 gene is shown in SEQ ID No:2.

Images