Anti-hepatoma drug screening cell model and construction method and application thereof

Abstract

The invention discloses an anti-hepatoma drug screening cell model as well as a construction method and application thereof. The construction method of the model comprises the following steps: 1) fusing an EGFP (Enhanced Green Fluorescent Protein) gene to a C end of a Coilin gene, and constructing the fused gene to a CMV-MCS-EGFP-PGK-Puro lentiviral vector to obtain a virus vector for expressing Coilin-EGFP; 2) co-dyeing a virus vector and a virus packaging plasmid into a recipient cell for virus packaging, and centrifuging a collected cell culture solution containing the virus to obtain a virus supernatant for expressing the Coilinin-EGFP (Enhanced Green Fluorescent Protein); and (3) infecting the liver cancer cell line HCCLM3 by using the virus supernatant containing the expressed Coilinin-EGFP, and screening the cell strain capable of stably expressing the Coilinin-EGFP. According to the application, the obtained cell model is used for screening anti-hepatoma drugs. According to the method, the proper incision enzyme is selected, the enzyme digestion efficiency is high, the titer of the obtained virus vector expressing Coilinin-EGFP is high, the virus vector is applied to screening of anti-liver cancer drugs, positioning of Coilinin-EGFP agglomerates can be directly observed under a fluorescence microscope, the method is simple, visual and convenient to operate, and screening of compound small molecule drugs inhibiting cell nucleus positioning of Coilinin-EGFP is facilitated.

Description

Technical Field

[0001] The present invention relates to the technical field of tumor drug screening, and in particular to a cell model for screening anti-liver cancer drugs, a construction method and an application thereof. Background Art

[0002] Liver cancer is a malignant tumor with high morbidity and mortality. Due to the lack of early symptoms, most liver cancer patients are diagnosed in the late stage. Liver cancer is highly malignant, develops rapidly, has strong metastatic ability, and is prone to recurrence after treatment. Clinically, simple surgical treatment, hepatic artery ligation and catheterization, interventional treatment, local treatment, radiotherapy, and existing drug treatments are difficult to achieve satisfactory results.

[0003] The nervous system is emerging as an important regulator of the microenvironment of healthy and malignant cells throughout the body. Throughout life, the nervous system dominates organ development, tissue homeostasis and regeneration, and plays a central role in the physiological functions of all organ systems, including the immune system. The nervous system is composed of diverse populations of neurons and glial cells, which are widely distributed throughout the body and usually form an extensive neural regulatory network with microvesicles, participating in the occurrence, progression and metastasis of tumors. More importantly, tumor cells can also activate peripheral nerves and neural precursor cells by releasing neurotrophic factors and extracellular vesicles, promote tumor neurogenesis, and thus enhance the invasiveness and metastatic ability of tumors.

[0004] Some studies in recent years have shown that the nervous system is closely related to the drug resistance of tumor cells such as liver cancer cells. In clinical practice, an important reason why tumor treatment is difficult to achieve the expected effect is the neural signals in the tumor microenvironment. Neural signals not only communicate directly with malignant tumor cells through paracrine factors, but also affect the migration and function of immune cells through circulating signals, thereby producing indirect long-range effects. This cross-communication between the nervous system, immune system and tumors in the local microenvironment and throughout the body profoundly affects the immune escape and malignant progression of tumors. Current clinical studies have identified some potential therapeutic interventions that may improve tumor outcomes. Blocking the interaction between the nervous system and cancer that promotes tumor growth and spread has shown effectiveness in fighting tumors. Combining these treatments with cytotoxic therapy or immunotherapy may produce synergistic effects, thereby further improving the therapeutic effect.

[0005] Moreover, current research has discovered a class of membraneless organelles widely present in the cell nucleus - Cajal bodies, which were first discovered in neuronal cells. In recent years, they have also been found to be abnormally active in liver cancer cells, especially in the advanced stages of liver cancer patients. Most importantly, their high activity in tumor cells is often accompanied by an increase in neural signals. This provides us with a new idea for exploring and developing therapeutic strategies targeting nervous system-tumor interactions. However, it is difficult for existing tumor drug screening methods to effectively target the interaction between tumors and the nervous system, and it is difficult to overcome the deficiencies of immune and metabolic disorders in the tumor microenvironment. There is no mature technical solution with clinical value, such as building a fully usable, especially dynamically visualized screening cell model. Therefore, it is necessary to design a screening cell model for anti-liver cancer drugs to screen out the best small molecule drugs or drug treatment combinations with therapeutic effects targeting nervous system-tumor interactions. Summary of the invention

[0006] The main purpose of the present invention is to provide a cell model for screening anti-liver cancer drugs and a construction method and application thereof, which can be used to screen drugs targeting nervous system-tumor interaction and immunosuppressive combined therapy.

[0007] To achieve the above object, the technical solution of the present invention is as follows:

[0008] In a first aspect, the present invention provides a method for constructing a cell model for screening anti-liver cancer drugs, comprising the following steps:

[0009] 1) The EGFP gene was fused to the C-terminus of the Coilin gene and constructed into the CMV-MCS-EGFP-PGK-Puro lentiviral vector to obtain a viral vector expressing Coilin-EGFP;

[0010] 2) The viral vector expressing Coilin-EGFP and the viral packaging plasmid are co-transfected into the recipient cells for viral packaging, and the collected cell culture fluid containing the virus is centrifuged to remove dead cells and cell debris to obtain a supernatant containing the virus expressing Coilin-EGFP;

[0011] 3) Infecting the liver cancer cell line HCCLM3 with the virus supernatant containing the virus expressing Coilin-EGFP, and screening to obtain a cell line stably expressing Coilin-EGFP, which is the cell model for screening anti-liver cancer drugs.

[0012] In one or more embodiments, step 1) includes the following specific steps:

[0013] 11) Design a primer pair containing restriction endonuclease XhoI and BamHI restriction sites, perform PCR amplification on the full-length sequence of the Coilin gene, and obtain a Coilin gene fragment with double restriction sites of XhoI and BamHI;

[0014] 12) Use restriction endonucleases XhoI and BamHI for enzyme digestion to obtain a double enzyme digestion product of the Coilin gene fragment, and then perform DNA ligation to insert the Coilin gene into the lentiviral vector PGMLV-CMV-MCS-EGFP-PGK-Puro plasmid to obtain a positive plasmid PGMLV-CMV-Coilin-EGFP-PGK-Puro carrying the Coilin gene, which is a viral vector expressing Coilin-EGFP.

[0015] In one or more embodiments, in step 11):

[0016] The primer pairs are:

[0017] Primer-F:GCTACCGGACTCAGATCTCGAGGCCACCATGGCAGCTTCCGAGACGG;

[0018] Primer-R:CAAGTAACACATCAAGTACAGAACCTGCCGGATCCATGGTGAGCAAGGGC;

[0019] The reaction system of the PCR amplification is as follows: template: 10 ng; Primer-F: 2 μL; Primer-R: 2 μL; PCR mix: 25 μL; ddH2O supplemented to 50 μL;

[0020] The PCR amplification program is as follows: step one: 95°C, 5 minutes; step two: 95°C, 30 seconds; 58°C, 30 seconds; 72°C, 2 minutes; run 35 cycles; step three: 72°C, 5 minutes, end.

[0021] In one or more embodiments, the step 12) includes the following specific steps:

[0022] a) firstly digest the PGMLV-CMV-MCS-EGFP-PGK-Puro plasmid and Coilin gene fragment with XhoI enzyme, and then recover the digested fragments PGMLV-CMV-MCS-EGFP-PGK-Puro (XhoI) and Coilin (XhoI) through a gel recovery column;

[0023] The enzyme digestion conditions were as follows: PGMLV-CMV-MCS-EGFP-PGK-Puro 1ug, Coilin gene fragment 2ug; XhoI enzyme: 1.0ul; NEB buffer 3.1: 2.0ul; add deionized water to 20ul; 37°C water bath for 2 hours;

[0024] b) digesting the recovered digested fragments with BamHI, running the digested fragments on agarose gel electrophoresis and recovering PGMLV-CMV-MCS-EGFP-PGK-Puro (XhoI+BamHI) and Coilin (XhoI+BamHI);

[0025] The enzyme digestion conditions were as follows: PGMLV-CMV-MCS-EGFP-PGK-Puro (BamHI) 1ug, Coilin gene fragment (BamHI) 2ug; BamHI enzyme: 1.0ul; NEB buffer 1.1: 2.0ul; add deionized water to 20ul; 37°C water bath for 2 hours;

[0026] c) DNA ligation of PGMLV-CMV-MCS-EGFP-PGK-Puro (XhoI+BamHI) and Coilin (XhoI+BamHI) to obtain the positive plasmid PGMLV-CMV-Coilin-EGFP-PGK-Puro;

[0027] The connection conditions are: PGMLV-CMV-MCS-EGFP-PGK-Puro (XhoI+BamHI): 40ng; Coilin (XhoI+BamHI): 100ng; DNA connection buffer: 1.5ul; DNA ligase: 1.0ul; transformation was performed after connection at 16°C for 4 hours.

[0028] In one or more embodiments, the packaging plasmids are gag-pol and VSV-G plasmids; the recipient cells are 293T cells.

[0029] In one or more embodiments, the specific process of step 2) is:

[0030] The virus vector expressing Coilin-EGFP was co-transfected with the virus packaging plasmid gag-pol and VSV-G plasmid into 293T cells for virus packaging. The cell base was fresh DMEM culture medium with 10% FBS. Enhancing buffer was added 10 to 12 hours after co-transfection, and then fresh culture medium was replaced after 8 hours. Culture was continued for 48 hours. Since the virus was packaged in the cells and released into the culture medium, the collected culture medium contained the required virus. The collected cell culture fluid containing the virus was centrifuged to remove dead cells and cell debris to obtain a virus supernatant containing the expression of Coilin-EGFP.

[0031] In a second aspect, the present invention also provides a cell model for screening anti-liver cancer drugs obtained by the above construction method.

[0032] In a third aspect, the present invention also provides the use of the above-mentioned anti-liver cancer drug screening cell model in screening anti-liver cancer drugs.

[0033] In one or more embodiments, the method for screening anti-liver cancer drugs includes: treating a cell line stably expressing Coilin-EGFP with the small molecule drug to be screened, and observing the induced EGFP aggregates under a fluorescence microscope; if a small molecule drug that can disintegrate EGFP aggregates or transfer EGFP aggregates from the cell nucleus to the cytoplasm is screened out in the cell line stably expressing Coilin-EGFP, it is the screened anti-liver cancer drug.

[0034] Compared with the prior art, the present invention achieves at least the following beneficial effects:

[0035] (1) The method for constructing a cell model for screening anti-liver cancer drugs provided by the present invention comprises selecting XhoI and BamHI enzymes to construct a PGMLV-CMV-Coilin-EGFP-PGK-Puro positive plasmid carrying the Coilin gene, thereby obtaining a viral vector expressing Coilin-EGFP. By selecting a suitable endonuclease, the enzyme cleavage efficiency is high, and the titer of the viral vector expressing Coilin-EGFP is high.

[0036] (2) The tumor drug screening cell model of the present invention is applied to the screening of anti-liver cancer drugs. The localization of Coilin-EGFP aggregates can be directly observed under a fluorescence microscope, and small molecules of compounds that inhibit the nuclear localization of Coilin-EGFP can be screened, that is, drugs targeting the interaction between the nervous system and tumors. The method is simple, intuitive, and easy to operate. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 , PGMLV-CMV-MCS-EGFP-PGK-Puro lentiviral vector diagram.

[0038] Figure 2 , electrophoresis diagram of the restriction products of the positive plasmid PGMLV-CMV-Coilin-EGFP-PGK-Puro; wherein, 1: single restriction enzyme cutting XhoI; 2: single restriction enzyme cutting BamHI; 3: double restriction enzyme cutting XhoI / BamHI, 8738bp+1740bp; 4: plasmid.

[0039] Figure 3 , Sanger sequencing diagram of the linearized PGMLV-CMV-MCS-EGFP-PGK-Puro vector after the Coilin fragment of the target gene was inserted into the restriction site.

[0040] Figure 4 , experimental verification and analysis of EGFP-Coilin overexpressing cell lines; wherein, (A) qPCR experiment detects the RNA expression level of Coilin in liver cancer cell lines; (B) Western Blot experiment detects the protein expression level of EGFP-Coilin in liver cancer cell lines; (C) fluorescence microscopy directly observes the formation of EGFP-Coilin aggregates in cells.

[0041] Figure 5 , Fluorescence microscopy images of the Coilin-EGFP stable cell line expressing green fluorescent protein.

[0042] Figure 6 , immunofluorescence images of co-localization of EGFP-Coilin with Cajal body core components TCAB1, SMN, and GEMIN2.

[0043] Figure 7 , drug screening experiments to find small molecule drugs that can destroy the formation of Cajal body; among them, the name of the small molecule drug is marked on the first line, and the drug target is marked on the second line.

[0044] Figure 8 , Fluorescence microscopy images of the Coilin-EGFP stable cell line expressing green fluorescent protein after drug treatment. DETAILED DESCRIPTION

[0045] The present invention will be described in detail below with reference to the exemplary embodiments in the accompanying drawings. However, it should be understood that the present invention can be implemented in a variety of different forms and should not be construed as being limited to the embodiments described herein. These embodiments are provided herein to make the content of the present invention more complete and to fully convey the concept of the present invention to those skilled in the art.

[0046] Example 1. Cell model for screening anti-liver cancer drugs

[0047] A method for constructing a cell model for screening anti-liver cancer drugs comprises the following steps:

[0048] 1) First, the EGFP gene was fused to the C-terminus of Human_Coilin (Coilin) ​​and constructed into the CMV-MCS-EGFP-PGK-Puro lentiviral vector to obtain a viral vector expressing Coilin-EGFP;

[0049] 2) The viral vector expressing Coilin-EGFP and the viral packaging plasmid are co-transfected into the recipient cells for viral packaging, and the collected cell culture fluid containing the virus is centrifuged to remove dead cells and cell debris to obtain a supernatant containing the virus expressing Coilin-EGFP;

[0050] 3) Infecting the liver cancer cell line HCCLM3 with the virus supernatant containing the virus expressing Coilin-EGFP, and screening to obtain a cell line stably expressing Coilin-EGFP, which is the cell model for screening anti-liver cancer drugs.

[0051] Wherein, step 1) comprises the following specific steps:

[0052] 11) Design a primer pair containing restriction endonuclease XhoI and BamHI restriction sites, perform PCR amplification on the full-length sequence of the Coilin gene (NM_004645.3), and obtain a Coilin gene fragment with double restriction sites of XhoI and BamHI. The sequence of the gene fragment is SEQ ID NO: 1;

[0053] The primer pairs are:

[0054] Primer-F: GCTACCGGACTCAGATCTCGAGGCCACCATGGCAGCTTCCGAGACGG (SEQ ID NO: 2);

[0055] Primer-R:CAAGTAACACATCAAGTACAGAACCTGCCGGATCCATGGTGAGCAAGGGC (SEQ IDNO: 3);

[0056] The PCR reaction system is as follows: template: 10 ng; Primer-F: 2 μL; Primer-R: 2 μL; PCR mix: 25 μL; ddH2O supplemented to 50 μL;

[0057] The PCR amplification program was as follows: step 1: 95°C, 5 minutes; step 2: 95°C, 30 seconds; 58°C, 30 seconds; 72°C, 2 minutes; run 35 cycles; step 3: 72°C, 5 minutes, end;

[0058] 12) Use restriction endonucleases XhoI and BamHI to digest and obtain the double digestion product of Coilin gene fragment, then perform DNA ligation and insert Coilin gene into lentiviral vector PGMLV-CMV-MCS-EGFP-PGK-Puro plasmid (see lentiviral vector map for details) Figure 1 ) to obtain the positive plasmid PGMLV-CMV-Coilin-EGFP-PGK-Puro carrying the Coilin gene;

[0059] The specific experimental process is: using XhoI and BamHI enzymes to cut the cells in a sequential manner, including:

[0060] a) firstly digest the PGMLV-CMV-MCS-EGFP-PGK-Puro plasmid and Coilin gene fragment with XhoI enzyme, and then recover the digested fragments PGMLV-CMV-MCS-EGFP-PGK-Puro (XhoI) and Coilin (XhoI) through a gel recovery column;

[0061] The enzyme digestion conditions were as follows: PGMLV-CMV-MCS-EGFP-PGK-Puro 1ug, Coilin gene fragment 2ug; XhoI enzyme: 1.0ul; NEB buffer 3.1: 2.0ul; add deionized water to 20ul; 37°C water bath for 2 hours;

[0062] b) digesting the recovered digested fragments with BamHI, running the digested fragments on agarose gel electrophoresis and recovering PGMLV-CMV-MCS-EGFP-PGK-Puro (XhoI+BamHI) and Coilin (XhoI+BamHI);

[0063] The enzyme digestion conditions were as follows: PGMLV-CMV-MCS-EGFP-PGK-Puro (BamHI) 1ug, Coilin gene fragment (BamHI) 2ug; BamHI enzyme: 1.0ul; NEB buffer 1.1: 2.0ul; add deionized water to 20ul; 37°C water bath for 2 hours;

[0064] c) DNA ligation of PGMLV-CMV-MCS-EGFP-PGK-Puro (XhoI+BamHI) and Coilin (XhoI+BamHI) to obtain the positive plasmid PGMLV-CMV-MCS-EGFP-PGK-Puro carrying the Coilin gene;

[0065] The connection conditions are: PGMLV-CMV-MCS-EGFP-PGK-Puro (XhoI+BamHI): 40ng; Coilin (XhoI+BamHI): 100ng; DNA connection buffer: 1.5ul; DNA ligase: 1.0ul; transformation was performed after connection at 16°C for 4 hours.

[0066] Double enzyme digestion identification test:

[0067] The positive plasmid PGMLV-CMV-Coilin-EGFP-PGK-Puro was digested with restriction endonucleases XhoI and BamHI. The electrophoresis of the digestion product is shown in the figure below. Figure 2 As shown, it can be proved that the positive plasmid

[0068] PGMLV-CMV-Coilin-EGFP-PGK-Puro was constructed successfully.

[0069] Sanger sequencing identified positive clones:

[0070] The ligation product was transferred into competent cells, and the grown monoclonal colonies were identified by Sanger sequencing. After comparison, the inserted fragment sequence in the recombinant clone was completely consistent with the Coilin sequence, so the PGMLV-CMV-Coilin-EGFP-PGK-Puro vector was successfully constructed (such as Figure 3 shown).

[0071] Among them, the specific process of step 2) is: the virus vector expressing Coilin-EGFP is co-transfected with the virus packaging plasmid gag-pol and VSV-G plasmid into 293T cells for virus packaging, the cell base is a fresh DMEM culture medium with 10% FBS, and the Enhancing buffer is added after 10-12 hours of co-transfection, and then the fresh culture medium is replaced after 8 hours, and the culture is continued for 48 hours; because the virus is packaged in the cell and released into the culture medium, the collected culture medium contains the required virus, and the collected cell culture fluid containing the virus is centrifuged to remove dead cells and cell debris to obtain a virus supernatant containing the expression of Coilin-EGFP.

[0072] More specifically, the implementation process of step 2) and the lentiviral titer detection process include the following steps:

[0073] a) 293T cell division

[0074] One day before transfection, the grown cells were subcultured into 10 cm culture dishes at an appropriate ratio, and transfection was prepared when the cells grew to 70%-80%.

[0075] b) Change medium before transfection

[0076] 1-2 h before transfection, replace the cells to be transfected with fresh culture medium.

[0077] c) Transfection

[0078] Take a sterile 1.5mL EP tube or 15mL centrifuge tube, and the transfection system is as follows:

[0079] DMEM: 850 μL; PGMLV-CMV-Coilin-EGFP-PGK-Puro plasmid: 10 μg; Lenti-HG Mix: 10 μL; HG-transgene reagent: 60 μg.

[0080] After mixing, place at room temperature for 15-20 minutes, evenly add drops into the culture dish that has been replaced with liquid in advance, and then place in a CO2 incubator for culture.

[0081] d) Add Enhancing buffer

[0082] 10-12 hours after transfection, evenly add 100×Enhancing buffer to promote transfection, 120μL / dish.

[0083] e) Change the fluid

[0084] 18-20 hours after transfection, carefully aspirate the cell culture medium and discard it into a waste liquid cup containing disinfectant, then add 12 mL of fresh cell culture medium and continue culturing.

[0085] f) Virus collection

[0086] After 48 hours of fluid replacement, aspirate the cell supernatant into a 50mL centrifuge tube and centrifuge at 4°C, 4500g for 5 min. Filter the supernatant with a 0.22μm filter and transfer it to a new centrifuge tube. Finally, transfer the filtrate to a concentrator in batches and centrifuge at 4°C, 4500g for 10 min. Discard the lower layer of liquid into a waste liquid cup filled with disinfectant. Centrifuge for the last time at 4°C, 4500g for 20 min. At this time, the liquid in the upper layer of the filter is the virus concentrate.

[0087] g) Virus packaging and storage

[0088] The virus was aliquoted and stored at -80°C.

[0089] h) Lentivirus titer determination

[0090] 293T cells were cultured to the logarithmic growth phase, and the culture medium used for virus dilution was serum-free DMEM cell culture medium.

[0091] On the first day, cells were trypsinized and counted at 2 × 10 cells per well. 5Cells were seeded in 12-well plates and cultured overnight at 37°C. Cells grew to a confluency density of 20–30% at the time of infection;

[0092] On the second day, when transfecting the 12-well plate on the same day, melt the virus solution stored in the -80℃ refrigerator in an ice bath, and perform gradient dilutions with serum-free DMEM cell culture medium:

[0093] Dilution No. 1: 10 μL virus solution + 90 μL virus dilution medium;

[0094] Dilution No. 2: 10 μL dilution No. 1 + 90 μL virus dilution medium;

[0095] …

[0096] Select the desired cell wells, gently mix the lentiviral dilutions in each tube, take 90 μL and add it to each well of cells, and place it in a cell culture incubator at 37°C for overnight culture; add dilutions 1-4 to the control virus with known titers, and add dilutions 1 and 2 to the samples to be tested. On the fifth day, observe the cell state and fluorescence. If the cell state is good (no fluorescence contamination) and the cell density is higher than 80%, extract RNA and prepare for RT-qPCR.

[0097] i) Total RNA extraction

[0098] After the cells are successfully infected with lentivirus, add 500μL Trizol solution to each well of each 12-well plate cell, blow and mix with a pipette tip, try to lyse all the cells, and place at room temperature for 5min. Add 100μL chloroform to each tube, cover the centrifuge tube tightly, repeatedly invert and mix for 15s, and centrifuge at 12000g, 4℃ for 10min. Take the upper aqueous phase to a new centrifuge tube, add 300μL isopropanol to each tube, mix gently, place at room temperature for 10min, and centrifuge at 12000g, 4℃ for 10min. Discard the supernatant, add 500μL 80% alcohol (DEPC dilution) to each tube, gently wash the precipitate, and centrifuge at 12000g, 4℃ for 10min. Discard the supernatant and dry at room temperature for 5-10min. RNA is dissolved in 50-100μL DEPC water.

[0099] j) Reverse transcription of cDNA

[0100] Take a sterilized RNase free tube and add the following components to each sample to obtain a Mix: RNasefree ddH2O: 10μL; 5×gDNA digester Buffer: 2μL; gDNA digester: 1μL; Total RNA: 1ng. Use a pipette to gently blow and mix. Set the reverse transcription program to: 25℃: 5min; 42℃: 30min; 85℃: 5min. The obtained cDNA is stored at -80℃ for later use.

[0101] k) Real-time PCR detection

[0102] Primer sequence for target gene detection (5'-3'):

[0103] WPRE-F: CGCTATGTGGATACGCTGCTTTA (SEQ ID NO: 4);

[0104] WPRE-R: GCAACCAGGATTTATACAAGGAGGA (SEQ ID NO: 5).

[0105] Primer sequence for detection of internal reference gene (5'-3'):

[0106] GAPDH-F: GTCTCCTCTGACTTCAACAGCG (SEQ ID NO: 6);

[0107] GAPDH-R:ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO:7).

[0108] The volumes of the components in the PCR system are as follows: ultrapure water: 7.2 μL; 2×SYBR Mix: 10 μL; upstream primer (10 uM): 0.4 μL; downstream primer (10 uM): 0.4 μL; template: 2 μL; total system: 20 μL.

[0109] PCR reaction conditions: pre-denaturation: 95°C, 30s; PCR cycle: 95°C, 15s, 40 cycles; 60°C: 60s; melting curve 60°C→95°C.

[0110] (l) Experimental results and data

[0111] Well 1: Dilution No. 1, containing 1*10 2 mL lentiviral solution;

[0112] Well No. 2: Dilution No. 2, containing 1*10 3 mL lentiviral solution;

[0113] Well No. 3: Dilution No. 3, containing 1*10 4 mL lentiviral solution;

[0114] Well No. 4: Dilution No. 4, containing 1*10 5 mL lentiviral solution;

[0115] Well No. 5: Dilution No. 5, containing 1*10 6 mL lentiviral solution;

[0116]

[0117] Cell samples with different amounts of virus were added, and total RNA was extracted and reverse transcribed into cDNA, and then quantitative PCR was performed. The titer value was determined by comparing the difference in Ct values ​​between the standard curve of the control group and the test group.

[0118]

[0119] In summary, the titer of PGMLV-CMV-Coilin-EGFP-PGK-Puro lentivirus was 2.05×107, indicating that the titer of the viral vector expressing Coilin-EGFP was high.

[0120] Wherein, step 3) comprises the following specific steps:

[0121] a) Cell seeding plate: HCCLM3 liver cancer cell line was revived and cultured to a stable state; cells were digested with trypsin and counted, and 1×10 5 -1.2×10 5 The cells were cultured in 12-well plates at 37°C and 5% CO2 for 72 hours;

[0122] b) Determine the optimal screening concentration of puromycin: set different concentration ranges of puromycin 1-10 μg / mL (1 / 2 / 3 / 4 / 5 / 6 / 8 / 10 μg / mL); take out the 6-well plate that has been cultured for 72 hours, replace the culture medium and add the above concentration of puromycin, and continue to culture at 37°C, 5% CO2 for 48 hours to determine the optimal screening concentration;

[0123] c) Preparation of cell seeding plates before virus infection: After trypsin digestion and cell counting, 1×10 5 -1.2×10 5 The cells were cultured in 6-well plates at 37°C and 5% CO2 for 24 hours;

[0124] d) Virus infection: Take out the Coilin-EGFP overexpression lentivirus from the -80°C ultra-low temperature freezer and slowly thaw it on ice; discard the original culture medium in the 6-well plate, dilute the lentivirus according to the optimal MOI value and add polybrene dye to a final concentration of 2 μg / mL, 2 mL per well; set up control wells at the same time; continue to culture in an incubator at 37°C, 5% CO2 for 24 hours;

[0125] e) Change medium after virus transfection: discard the medium containing virus, replace with fresh complete medium, and continue culturing for 24 hours;

[0126] f) Puromycin selection of cells: according to the optimal puromycin screening concentration, add the corresponding volume of puromycin and culture in an incubator at 37°C and 5% CO2 for 48 hours;

[0127] g) Expansion culture: After 48 hours of screening, replace with fresh culture medium and continue culturing for 48 hours in an incubator at 37°C and 5% CO2;

[0128] h) Verification of overexpression efficiency: Extract cell RNA for reverse transcription and use qPCR to detect the overexpression efficiency of Coilin; extract cell protein and use WB to detect the overexpression efficiency of Coilin; use fluorescence microscopy to directly observe the fluorescence expression of EGFP-Coilin (verification results see Figure 4 );

[0129] i) Based on the validation results, select cell lines with better knockout efficiency for further expansion and culture, and freeze the cells in a -80°C ultra-low temperature freezer for future use.

[0130] Example 2: Screening of anti-liver cancer drugs

[0131] The liver cancer cell lines stably expressing Coilin-EGFP were treated with the small molecule drugs to be screened, and the EGFP aggregates induced by the stable expression of Coilin-EGFP were observed under a fluorescence microscope, in which the EGFP aggregates were significantly co-localized with the key components of the membraneless organelle Cajalbody. If a small molecule drug that can disintegrate the EGFP aggregates or transfer the EGFP aggregates from the cell nucleus to the cytoplasm is screened in the liver cancer cell lines stably expressing Coilin-EGFP, it is the screened anti-liver cancer drug.

[0132] The specific experimental process is:

[0133] (a) Immunofluorescence assay

[0134] (I) Cell plating: Count the cells and adjust to the appropriate density; place a coverslip at the bottom of each well in a 24-well plate. Carefully add an appropriate amount of cell suspension from the center of the coverslip to seed approximately 50,000 cells per well; then add enough culture medium to each well until the total volume reaches 1.5 mL.

[0135] (II) Cell fixation: 24-48 hours after drug treatment, cells were washed once with PBS and the liquid was discarded; 200 μL of 4% paraformaldehyde was slowly added to each well along the side wall of the well and fixed at room temperature for 20 minutes; after removing the paraformaldehyde, the cells were washed three times with PBS, each time for 1 minute.

[0136] (III) Cell membrane permeabilization: Prepare 0.2% Triton X-100 solution, the preparation system is as shown in the table below; carefully add 200 μL of the prepared membrane permeabilization solution to each well, and incubate at room temperature for 15 minutes to permeabilize the membrane.

[0137]

[0138] (IV) Primary antibody incubation: After permeabilization, remove the Triton X-100 solution and add 100 μL of diluted primary antibody (dilution ratio of 1:500) to each well. Place the well plate in a humidified incubation box and incubate overnight at 4°C. The primary antibodies used are key component proteins of GFP aggregates: Coilin, WRAP53, SMN and GEMIN2.

[0139] (V) Secondary antibody incubation: Wash with PBS three times, 1 minute each time. Then add 100 μL of fluorescent labeled secondary antibody diluted to 1:500 to each well; place the plate in a light-proof humidified incubation box and incubate at room temperature for 1 hour and 30 minutes; then wash with PBS three times, 2 minutes each time.

[0140] (VI) Counterstaining of nuclei: Add 100 μL of DAPI dye to each well and incubate in the dark for 10 minutes; discard the dye solution, then wash with PBS three times, 5 minutes each time.

[0141] (VII) Mounting: Carefully remove the cover glass from the well plate and mount the slide with about 10 μL of anti-fluorescence quencher mounting solution. Allow the mounting solution to dry naturally at room temperature, and then place the prepared slide in a -20°C refrigerator and store away from light.

[0142] (VIII) Using the Invitrogen EVOS FL Auto 2 fully automated live cell imaging system for fluorescence observation, we found that Coilin-EGFP was mainly localized in the cell nucleus and could spontaneously form EGFP aggregates (see Figure 5 More importantly, EGFP aggregates co-localize significantly with key components of Cajal bodies (see Figure 6 ).

[0143] (b) Drug screening experiments

[0144] (I) Cell plating: HCCLM3 EGFPCoilin overexpressing liver cancer cell lines were revived and cultured to a stable state; cells were digested with trypsin and counted, and 5×10 cells were plated per well. 5 The cells were cultured in 6-well plates at 37°C and 5% CO2.

[0145] (II) Drug treatment: After the cells adhered and grew stably for 16 h, the drug treatment experiment was started; the drugs were prepared into 20 mM stock solutions according to the molecular weight of each drug. The drugs were then diluted to a working concentration of 10 mM, and 2 μL of the diluted drug solution was added to the wells, and the final drug concentration achieved was 10 μM.

[0146] (III) Experimental setup: Take out the 6-well plate from the incubator and add 2 μL of diluted drug solution to 4 wells. Add only an equal volume of drug-free culture medium to the other 2 wells as a blank control group. Set up a 6-well plate for each drug treatment time point.

[0147] We have extensively included a variety of tumor-related small molecule drugs for drug screening, such as MYCMI-6, JQ1, GSK-LSD1, Verteporfin, Sorafenib, WZB117, AG1024, APTO-253, Camptothecin, GSK503, 2-deoxy-D-glucose, Ganetespib, PFK158, Cycloheximide, Brefeldin A, UK-5099, and LAT1-IN-1, which target oncogenic transcription factors MYC, YAP1, chromatin remodeling-related LSD1, proliferation-related Raf, metabolism-related IGF1R and GLUT1, hypoxia-related HIF1α, epigenetic-related EZH2, stress-related HSP90, glycolysis, lactate release, protein synthesis, secretory proteins, and mitochondrial pyruvate transport, respectively.

[0148] (c) Fluorescence microscopy observation and interpretation of experimental results:

[0149] (I) After a certain period of drug treatment, the liver cancer cell line stably expressing Coilin-EGFP was placed under a fluorescence microscope for observation, and the fluorescence intensity and aggregate morphology of EGFP-Coilin were observed under the fluorescence microscope. This was different from the phenomenon observed without drug treatment that Coilin-EGFP was mainly localized in the cell nucleus and could spontaneously form EGFP aggregates (see Figure 5 The results of drug screening experiments showed that after treatment with the small molecule drug Camptothecin, which inhibits hypoxia-related signals HIF1α and DNA Topo I, some Cajal body condensates were seen to disperse into multiple small condensates in the cell nucleus, indicating that hypoxia-related signals may play an important role in the formation of Cajal bodies ( Figure 7 A). After treatment with the small molecule drug JQ1, which inhibits the oncogenic transcription factor MYC and the BET bromodomain BRD4, we observed a slight disaggregation of some Cajal body aggregates ( Figure 7 B). It is particularly noteworthy that after treatment with the small molecule drug Stauprimide, which inhibits embryonic stem cell differentiation and MYC signal transcription, we found that the morphology and localization of Coilin-EGFP aggregates changed, the EGFP aggregates disintegrated, and the EGFP aggregates moved from the cell nucleus to the cytoplasm ( Figure 8 ).

[0150] (II) In view of the fact that EGFP-Coilin is localized in the cell nucleus and forms condensates, it can play the role of promoting tumor neurogenesis signals and cell-to-cell interaction signals, thereby enhancing the invasiveness and metastasis of the tumor. Therefore, inhibiting the nuclear localization and aggregation of EGFP-Coilin condensates will help inhibit tumor malignant progression and tumor immune escape. It can be combined with a small molecule library of compounds, and a liver cancer cell line stably expressing Coilin-EGFP is treated with 10 μM of small molecules of compounds for 12 hours, and then the localization of Coilin-EGFP condensates is directly observed under a fluorescence microscope to screen out small molecules of compounds that can disintegrate EGFP condensates or transfer them from the cell nucleus to the cytoplasm. Small molecules of compounds that inhibit the nuclear localization of Coilin-EGFP condensates can be screened, which are the screened anti-liver cancer drugs. This small molecule of compound can target Coilin and can be used to inhibit cancer cell metastasis, which is the anti-liver cancer drug screened by the present invention.

[0151] This application simulated tumor-related pathological conditions such as hypoxia and glucose deprivation in vitro and found that Cajal body can affect the metabolic reprogramming of tumor cells, showing strong clinical value. Existing tumor drug screening methods are difficult to effectively target the interaction between tumors and the nervous system, and it is difficult to overcome the immune and metabolic disorders in the tumor microenvironment. In order to solve this technical problem, this application combines the easy observability of exogenous eGFP with the scaffolding characteristics of Coilin protein in Cajal body, constructs an eGFP-Coilin fusion plasmid, and establishes a drug screening cell model in tumor cells that can spontaneously form GFP aggregates, realizing dynamic visualization screening of nervous system-tumor interactions, and then finding potential tumor treatments and interventions.

Claims

1. A method for constructing a cell model for screening anti-liver cancer drugs, characterized in that: The following steps are involved: 1) The EGFP gene was fused to the C-terminus of the Coilin gene and constructed into the CMV-MCS-EGFP-PGK-Puro lentiviral vector to obtain a viral vector expressing Coilin-EGFP; 2) The viral vector expressing Coilin-EGFP and the viral packaging plasmid are co-transfected into the recipient cells for viral packaging, and the collected cell culture fluid containing the virus is centrifuged to remove dead cells and cell debris to obtain a supernatant containing the virus expressing Coilin-EGFP; 3) Infecting the liver cancer cell line HCCLM3 with the virus supernatant containing the virus expressing Coilin-EGFP, and screening to obtain a cell line stably expressing Coilin-EGFP, which is the cell model for screening anti-liver cancer drugs.

2. The construction method according to claim 1, characterized in that: The step 1) comprises the following specific steps: 11) Design a primer pair containing restriction endonuclease XhoI and BamHI restriction sites, perform PCR amplification on the full-length sequence of the Coilin gene, and obtain a Coilin gene fragment with double restriction sites of XhoI and BamHI; 12) Use restriction endonucleases XhoI and BamHI for enzyme digestion to obtain a double enzyme digestion product of the Coilin gene fragment, and then perform DNA ligation to insert the Coilin gene into the lentiviral vector PGMLV-CMV-MCS-EGFP-PGK-Puro plasmid to obtain a positive plasmid PGMLV-CMV-Coilin-EGFP-PGK-Puro carrying the Coilin gene, which is a viral vector expressing Coilin-EGFP.

3. The construction method according to claim 2, characterized in that: In the step 11): The primer pairs are: Primer-F:GCTACCGGACTCAGATCTCGAGGCCACCATGGCAGCTTCCGAGACGG; Primer-R:CAAGTAACACATCAAGTACAGAACCTGCCGGATCCATGGTGAGCAAGGGC; The reaction system of the PCR amplification is as follows: template: 10 ng; Primer-F: 2 μL; Primer-R: 2 μL; PCR mix: 25 μL; ddH2O supplemented to 50 μL; The PCR amplification procedure is: step 1: 95°C, 5 minutes; step 2: 95°C, 30 seconds; 58°C, 30 seconds; 72°C, 2 minutes; run 35 cycles; step 3: 72°C, 5 minutes, end.

4. The construction method according to claim 2, characterized in that: The step 12) comprises the following specific steps: a) firstly digest the PGMLV-CMV-MCS-EGFP-PGK-Puro plasmid and Coilin gene fragment with XhoI enzyme, and then recover the digested fragments PGMLV-CMV-MCS-EGFP-PGK-Puro (XhoI) and Coilin (XhoI) through a gel recovery column; The enzyme digestion conditions were as follows: PGMLV-CMV-MCS-EGFP-PGK-Puro 1ug, Coilin gene fragment 2ug; XhoI enzyme: 1.0ul; NEB buffer 3.1: 2.0ul; add deionized water to 20ul; 37°C water bath for 2 hours; b) digesting the recovered digested fragments with BamHI, running the digested fragments on agarose gel electrophoresis and recovering PGMLV-CMV-MCS-EGFP-PGK-Puro (XhoI+BamHI) and Coilin (XhoI+BamHI); The enzyme digestion conditions were as follows: PGMLV-CMV-MCS-EGFP-PGK-Puro (BamHI) 1ug, Coilin gene fragment (BamHI) 2ug; BamHI enzyme: 1.0ul; NEB buffer 1.1: 2.0ul; add deionized water to 20ul; 37°C water bath for 2 hours; c) DNA ligation of PGMLV-CMV-MCS-EGFP-PGK-Puro (XhoI+BamHI) and Coilin (XhoI+BamHI) to obtain the positive plasmid PGMLV-CMV-Coilin-EGFP-PGK-Puro; The connection conditions are: PGMLV-CMV-MCS-EGFP-PGK-Puro (XhoI+BamHI): 40ng; Coilin (XhoI+BamHI): 100ng; DNA connection buffer: 1.5ul; DNA ligase: 1.0ul; transformation was performed after connection at 16°C for 4 hours.

5. The construction method according to claim 1, characterized in that: The packaging plasmids are gag-pol and VSV-G plasmids; the recipient cells are 293T cells.

6. The construction method according to claim 5, characterized in that: The specific process of step 2) is as follows: The virus vector expressing Coilin-EGFP was co-transfected with the virus packaging plasmid gag-pol and VSV-G plasmid into 293T cells for virus packaging. The cell base was fresh DMEM culture medium containing 10% FBS. Enhancing buffer was added 10 to 12 hours after co-transfection, and then fresh culture medium was replaced after 8 hours. Culture was continued for 48 hours. Since the virus was packaged in the cells and released into the culture medium, the collected culture medium contained the required virus. The collected cell culture fluid containing the virus was centrifuged to remove dead cells and cell debris to obtain a virus supernatant containing the expression of Coilin-EGFP.

7. A cell model for screening anti-liver cancer drugs obtained by the construction method as described in any one of claims 1 to 6.

8. Use of the anti-liver cancer drug screening cell model as claimed in claim 7 in screening anti-liver cancer drugs.

9. The use according to claim 8, characterized in that Methods for screening anti-liver cancer drugs include: The cell line stably expressing Coilin-EGFP is treated with the small molecule drug to be screened, and the induced EGFP aggregates are observed under a fluorescence microscope; if a small molecule drug that can disintegrate EGFP aggregates or transfer EGFP aggregates from the cell nucleus to the cytoplasm is screened out in the cell line stably expressing Coilin-EGFP, it is the screened anti-liver cancer drug.

Images