High-sensitivity nano system for early diagnosis of DILI, preparation method and application of high-sensitivity nano system

Abstract

The invention discloses a high-sensitivity nano system for early diagnosis of DILI (Dolfram Inhibitor Like Inhibitor) as well as a preparation method and application of the high-sensitivity nano system. The nano system comprises engineered vesicles carrying LHBs, a CRISPR-CHA (Clustered Regularly Interspaced Short Palindromic Repeats-CHA) system and Fe3O4 nano particles, the CRISPR-CHA system comprises a probe D-Tri (D-Tri), a probe H1, a probe H2 and a Cas13a / crRNA compound; the nucleotide sequence of D-Tri is as shown in SEQ ID NO.1, the nucleotide sequence of H1 is as shown in SEQ ID NO.2, the nucleotide sequence of H2 is as shown in SEQ ID NO.3, and the Cas13a / crRNA compound comprises a 10 * reaction buffer solution, crRNA and Cas13a nuclease. According to the high-sensitivity nano system for early diagnosis of DILI, the liver source exosome can be selectively recognized, immediate detection of exosome miRNA can be completed in situ on the exosome, extra extraction and enrichment of miRNA are not needed, and degradation caused in the miRNA extraction process is effectively avoided. The kit is used for detecting miR122 in hepatogenic cells, the specificity is high, the sensitivity is high, a new method is provided for early, high-precision, rapid and convenient diagnosis of DILI, and a new research thought is provided for early diagnosis of other diseases.

Description

Technical Field

[0001] The present invention relates to a highly sensitive nanosystem for early diagnosis of DILI, a preparation method and application thereof, and belongs to the field of medical technology. Background Art

[0002] Drug-induced liver injury (DILI) refers to liver damage caused by drugs themselves and their metabolites. According to statistics, DILI accounts for about 25% of clinical safety issues, and its incidence rate is as high as 19 / 100,000 to 40 / 100,000, which has become a serious clinical safety issue. The association between the onset of DILI and medication is often hidden. Clinically, the diagnosis of DILI is an exclusionary diagnosis. Due to the large individual differences among patients and the lack of effective diagnostic markers, the early diagnosis of DILI is still a key scientific problem that needs to be solved in the clinic. The commonly used DILI diagnostic methods in clinical practice have the following problems: ① Biochemical index examination: the "gold standard" for clinical diagnosis of DILI, indicators such as alanine aminotransferase (ALT) and aspartate aminotransferase (AST), are prone to false positive judgments due to lack of specificity when used for diagnosis, and these biochemical indicators are easily degraded, and fresh blood samples are often required in clinical practice; ② Imaging examination: It is highly equipment-dependent and requires high professional and technical requirements, making it difficult to use for large-scale screening; ③ Liver biopsy: Liver biopsy helps to clarify the diagnosis results and assess the extent of lesions, but it is highly damaging and has poor patient compliance. In order to make up for the shortcomings of current diagnostic methods, a variety of new DILI biomarkers have been developed. Studies have shown that liver-derived exosome miRNAs in serum can be used as biomarkers for early and specific diagnosis of DILI, such as liver conserved miR122, whose abnormal expression is closely related to the degree of DILI damage.

[0003] Existing exosomal miRNA detection technologies such as Northern Blot and RT-qPCR mainly include the experimental process of exosome separation, extraction and quantitative determination of miRNA, with complicated operation steps and expensive instruments. The lengthy separation steps can easily cause damage and contamination of exosomes, and it is difficult to isolate exosomes from tissue-specific sources; the extraction and amplification process of miRNA can easily cause miRNA degradation; therefore, the above detection methods are difficult to achieve accurate detection. Developing a method that can selectively identify and actively enrich liver-derived exosomes and complete instant and highly sensitive detection of miRNA in situ in exosomes is of great significance for achieving early and highly accurate diagnosis of DILI. Summary of the invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a highly sensitive nanosystem for early diagnosis of DILI, its preparation method and application.

[0005] Technical solution: The present invention provides a highly sensitive nanosystem for early diagnosis of DILI, which comprises an engineered vesicle carrying LHBs, a CRISPR-CHA system and Fe 3 O 4 Nanoparticles; the CRISPR-CHA system includes probes D-Tri, H1, H2, Cas13a / crRNA complex and 10×reaction buffer; the nucleotide sequence of D-Tri is shown in SEQ ID NO.1, the nucleotide sequence of H1 is shown in SEQ ID NO.2, the nucleotide sequence of H2 is shown in SEQ ID NO.3, and the Cas13a / crRNA complex includes 10×reaction buffer, crRNA and Cas13a nuclease.

[0006] The present invention also provides a method for preparing the highly sensitive nanosystem for early diagnosis of DILI, comprising the following steps:

[0007] (1) constructing a cell line stably transfected with the large surface protein LHBs of the hepatitis B virus, expanding the culture, extracting the cell membrane, and obtaining engineered vesicles carrying LHBs;

[0008] (2) 10× reaction buffer, crRNA, Cas13a nuclease and nuclease-free ultrapure water were mixed and incubated to obtain a Cas13a / crRNA complex; probes D-Tri, H1, and H2 were pretreated and heated for denaturation, cooled to room temperature, and then mixed with the Cas13a / crRNA complex to obtain a CRISPR-CHA system;

[0009] (3) FeCl 3 6H 2 O was added with ultrapure water, stirred continuously under nitrogen protection, and then Na 2 SO 3 solution, sodium polyaspartate solution, and ammonia water. After the reaction, the crude product was collected, acetone was added thereto, and the supernatant was removed by magnetic separation. Ethanol was added to the precipitate for magnetic separation again, and the precipitate was washed and dispersed in ddH 2 O, dialyze, take the supernatant and centrifuge, the supernatant is Fe 3 O 4 Nanoparticle solution;

[0010] (4) Engineered vesicles carrying LHBs, CRISPR-CHA system and Fe 3 O 4The nanoparticle solutions are mixed and purified to obtain a highly sensitive nanosystem for early diagnosis of DILI.

[0011] Furthermore, the final concentration of D-Tri, H1 and H2 probes in the CRISPR-CHA system in step (2) is 200 nM.

[0012] Furthermore, the volume ratio of the Cas13a / crRNA complex and 10×reaction buffer in the CRISPR-CHA system described in step (2) is 5:1.

[0013] The present invention also provides the use of the nanosystem in preparing a drug-induced liver injury detection reagent.

[0014] Furthermore, the final concentration of the nanosystem is 1×10 4 Pieces / μL.

[0015] Furthermore, the nanosystem is used to detect the concentration of miR122.

[0016] Furthermore, the application is to mix and incubate the nanosystem with different concentrations of miR122, measure the fluorescence intensity, and draw a linear method; mix and incubate the nanosystem with the serum to be tested, measure the fluorescence intensity, and substitute it into the linear equation to obtain the concentration of miR122 in the serum to be tested.

[0017] Furthermore, the concentration of miR122 is 10 -13 ~10 -7 M.

[0018] Furthermore, the incubation condition is 37° C. for 60 to 90 minutes.

[0019] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: The highly sensitive nanosystem for early diagnosis of DILI of the present invention can selectively identify liver-derived exosomes and perform instant detection of exosomal miRNA in situ in exosomes, without the need for additional extraction and enrichment of miRNA, effectively avoiding degradation caused by the miRNA extraction process. It is used to detect miR122 in hepatocytes with high specificity and sensitivity, which not only provides a new method for early, high-precision, rapid and convenient diagnosis of DILI, but also provides a new research idea for early diagnosis of other diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1(a) Preparation scheme of LHBs recombinant engineered cell membrane; (b) Confocal laser scanning microscopy (CLSM) imaging of L02 cells transfected with LHBs gene (LHBs gene labeled with eGFP protein, LHBs-eGFP); (c) Western blot analysis of L02 cell membrane proteins reconstructed with LHBs; (d) CLSM imaging of LHBs-FV (LHBs protein labeled with Flag-tag); (e) Western blot analysis of LHBs-FV membrane proteins.

[0021] Figure 2 (a) TEM image of LHBs-FV; (b) dynamic light scattering (DLS) determination of the hydrated particle size of LHBs-FVs; (c) size distribution (c) and particle concentration (d) of LHBs-FVs determined by nanoparticle tracer analysis (NTA).

[0022] Figure 3 TEM images (a) and DLS images (b) of exosomes isolated from the supernatant of L02 cells; size distribution of exosomes (c) and particle concentration (d) measured by NTA method; (e) Western blot analysis results of commonly used markers in L02 cells and L02 cell-derived exosomes.

[0023] Figure 4 (a) CLSM images of LHBs-FVs and Con-FVs after incubation with exosomes from L02 cells. LHBs-FVs and Con-FVs were labeled with DiO dye, and exosomes were labeled with DiI dye. The scale bar is 10μm; (b) TEM image of LHBs-FVs fused with exosomes from L02 cells, the scale bar is 100nm; (c) TEM image of HBVs-FVs after incubation with exosomes from L02 cells and (d) DLS image.

[0024] Figure 5 (a) The secondary structure simulation diagram of probes H1, H2, and D-Tri; (b) The fluorescence method was used to investigate the feasibility of using the CRISPR-CHA system for miR122 signal amplification and high-sensitivity detection. The concentrations of D-Tri, Tri-1, H1, H2, and miR122 were all 200 nM; (c) The PAGE method was used to investigate the feasibility of using the CRISPR-CHA system for miR122 signal amplification and high-sensitivity detection. M: Marker, L1: D-Tri, L2: H1, L3: H2, L4: D-Tri+H1+H2, L5: D-Tri+H1+H2+miR122+Cas13a / crRNA, L6: D-Tri+H1+Cas13a / crRNA; the concentrations of H1, H2, miR122, and D-Tri were all 1×10 -8M; (d) Relative fluorescence intensity of CRISPR-CHA system for detection of miR122, mis-miR122, miR192 and miR155; (e) Relative fluorescence intensity of CRISPR-CHA system for detection of miR122 when the ratio of H1 to H2 was different; (f) Relative fluorescence intensity of CRISPR-CHA system when incubated with miR122 for different time; (g) Relative fluorescence intensity of miR122 at 1×10 -13 M~1×10 -7 When the relative fluorescence intensity of CRISPR-CHA was used for miR122 detection within the range of 40.447 W / m, the linear relationship between the relative fluorescence intensity and the logarithm of the miR122 concentration value was linear, the linear regression equation was y=0.775x+10.542, and the correlation coefficient was r=0.996.

[0025] Figure 6 Fe 3 O 4 TEM image (a) and DLS image (b) of magnetic nanoparticles (scale bar is 20 nm).

[0026] Figure 7 TEM images (a) and DLS images (b) of MMVs; changes in particle size of MMVs stored in PBS (c) and 8-fold diluted serum (d) at different storage times and the leakage rate of the HIF probe.

[0027] Figure 8 (a) CLSM images of MMVs and MMVs, Con-FVs incubated with exosomes, scale bar is 10 μm; (b) TEM image after incubation of MMVs with exosomes; (c) fluorescence intensity image after incubation of MMVs, MMVs with exosomes (MMVs-Exo) and Con-FVs with exosomes (Con-FVs-Exo).

[0028] Fig. 9 (a) Fluorescence intensity of MMVs, MMVs(Tri-1)-Exo, and MMVs-Exo; the concentrations of MMVs, MMVs(Tri-1) and exosomes were all 1×10 5 / μL; (b) Statistical graph of fluorescence intensity of MMVs, MMVs(Tri-1)-Exo and MMVs-Exo; (c) MMVs were used for different concentrations of exosomes (1×10 4 / μL~1×10 7 The fluorescence intensity of the MMVs was 1×10 5 / μL; (d) Linear regression equation when MMVs were used for exosome detection; (e) Relative fluorescence intensity when MMVs were used for exosome detection derived from L02, MCF-7, HEK293T and A549 cells.

[0029] Fig.10 (a) RT-qPCR analysis of the relative expression of miR122 in L02 cells with overexpression and knockdown of miR122; (b) RT-qPCR analysis of the relative expression of miR122 in exosomes secreted by L02 cells with overexpression and knockdown of miR122; (c) relative fluorescence F / F0 when MMVs were used to detect exosomes secreted by L02 cells with overexpression and knockdown of miR122. (n=3).

[0030] Fig.11 Serum ALT activity (a), AST activity (b) and liver index (c) of mice treated with different doses of APAP; (d) liver histopathological evaluation (H&E staining) of mice treated with different doses of APAP; (e) relative fluorescence F / F0 detected by MMVs in serum of mice treated with different doses of APAP, the concentration of MMVs was 1×10 5 / μL; (f) RT-qPCR analysis of the relative expression of miR122 in peripheral circulating exosomes of mice administered with different doses of APAP (n=3). DETAILED DESCRIPTION

[0031] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0032] Example 1 Preparation and performance analysis of various components of the nanosystem

[0033] 1. Preparation of engineered vesicles LHBs-FVs

[0034] 1.1 Construction of LHBs gene stably transfected cell lines

[0035] L02 cells (normal human liver cells) were inoculated into T75 culture flasks (10 6 / bottle) and then incubate in a cell culture incubator for 24 hours, then add 2 μL of Myrcludex B (MedChemExpress Biotechnology Co., Ltd.) at a concentration of 1 mM to pretreat the cells for 4 hours to block the NTCP receptor and prevent cell fusion. Add 5 μL of lentivirus (Yiman Biological Company) containing the LHBs gene or the LHBs gene fused with green fluorescent protein (eGFP) (LHBs-eGFP) to 3 mL of complete cell culture medium and mix gently, then add 3 μL of Polybrene (Yiman Biological Company) and mix gently to prepare a virus dilution. Aspirate the original culture medium of the cells, add the virus dilution to the cells, shake gently, continue to incubate in the cell culture incubator for 48 hours, then aspirate the culture medium containing the lentivirus, replace it with fresh culture medium, and continue to incubate the cells in the cell culture incubator for 24 hours to construct an L02 cell line with a stable LHBs gene. Collect cells as needed to detect the expression of the target protein. The experimental operation process is as follows Figure 1 As shown in a.

[0036] Immunofluorescence ( Figure 1 b) and western blot( Figure 1 c) The experimental results showed that LHBs-eGFP was expressed on the L02 cell membrane, indicating that the L02 cell line stably transformed with the LHBs gene was successfully constructed.

[0037] 1.2 Extraction of cell membranes carrying LHBs protein

[0038] The cells were collected and placed in phosphate buffered saline (PBS) containing 2 mM ethylenediaminetetraacetic acid (EDTA) and centrifuged at 1000 g for 5 min. The collected cell pellets were suspended in 20 mM Tris-HCl (pH = 7.5), 10 mM KCl, 2 mM MgCl 2 The cells were completely broken by freezing and thawing three times in a hypotonic lysis buffer containing 1× mini protease inhibitor. The frozen and thawed cells were transferred to a centrifuge and centrifuged at 3200g for 5 min. The supernatant was collected and centrifuged at 20000g for 20 min. The precipitate was discarded, and the resulting mixture was centrifuged at 4°C and 100000g for 90 min. The precipitate was collected and resuspended in 1 mL of ultrapure water to obtain the cell membrane. The extracted cell membrane was stored at -80°C for the next experiment.

[0039] 2. Preparation of CRISPR-CHA Detection System

[0040] 1 μL 10× reaction buffer, 2 μL crRNA (7.5 ng·μL -1 ) and 2 μL Cas13a nuclease (100 ng·μL -1) was added to 5 μL of nuclease-free ultrapure water and incubated at 37°C for 10 min to obtain a Cas13a / crRNA complex.

[0041] The probes were pretreated: H1 (SEQ ID NO.2: TCAACATCAGTCTGATAAGCTACCATGTGTAGATAGCTTATCAGACTCCTAATG), H2 (SEQ ID NO.3: ATAAGC TAT CTA CAC ATG GTA GCT TATCAGACTCCA TGT GTA GA), D-Tri (SEQ ID NO.1: TCA ACA TCA GTC TT / rU-rU / TAG CTT ATC AGACTG ATG TTGA ATA AGC ATA GTC TT / rU-rU / CCATGTGTAGA) and Tri-1 (SEQ ID NO.4: TCA ACATCAGTC TT / rU-rU / TAG CTT ATC AGACTG ATG TTGA) probes were dissolved in 1×Tris-EDTA (1×TE) buffer to 10 μM, heat denatured at 95°C for 10 min using a PCR instrument, and then taken out and left to cool naturally to room temperature.

[0042] 3. Fe 3 O 4 Preparation of nanoparticles

[0043] 1.3 g FeCl 3 6H 2 O was added into 20 mL of ultrapure water (ddHO) 2 O) and stirred continuously under nitrogen protection. 2 SO 3 Dissolve in 5 mL ddH 2 O and then slowly add FeCl 3 Heat the mixture to 70°C and dissolve 2 g of polyaspartic acid sodium salt in 5 mL of ddH 2 O and then added to the reaction solution. Then, 2 mL of ammonia water (25% to 28%) was quickly injected into the reaction system under vigorous stirring. After reacting for 30 minutes, the reactant was immediately cooled. The crude product was collected, 32 mL of acetone was added to it, and the supernatant was removed by magnetic separation. A small amount of ethanol was added to the precipitate for magnetic separation again. The washing was repeated twice and the precipitate was dispersed in ddH 2 O, dialyzed in a dialysis bag (50K Da) for 3 days. The dialyzed sample was collected and centrifuged at 4000g for 30 minutes, the supernatant was taken, and the centrifugation was repeated twice, and the upper liquid was poured out as the final product. The final product was characterized by TEM and DLS method ( Figure 6), the results showed that Fe 3 O 4 The particle size of the nanoparticles is about 5 nm.

[0044] 4. Characterization and performance analysis of various parts of the nanosystem

[0045] 4.1 Characterization of LHBs-FVs and investigation of fusion performance

[0046] The cell membrane carrying LHBs protein was passed through 800nm, 400nm and 200nm polycarbonate porous membranes in sequence using a micro-extruder, and extruded repeatedly to prepare fusion vesicles carrying LHBs protein (LHBs-FVs), and LHBs-FVs were purified. Vesicles prepared from unmodified L02 cell membranes (Con-FVs) were used as the control group.

[0047] 4.1.1 Characterization of LHBs-FVs

[0048] The size, morphology and concentration of LHBs-FVs were characterized by ZS901 Zetasizer, transmission electron microscopy (TEM) and nanoparticle tracking analysis (NTA), respectively. Confocal laser scanning microscopy (CLSM) and western blot analysis were used to verify the LHBs (eGFP) protein on the LHBs-FVs membrane.

[0049] CLSM( Figure 1 d) and western blot( Figure 1 e) The results showed that LHBs-FVs carried LHBs protein, which indicated that the vesicles prepared by the extrusion method in this study had no effect on the LHBs protein on the cell membrane.

[0050] TEM results ( Figure 2 a) shows that the average particle size of HBV-mimicking fusion vesicles (LHBs-FVs) prepared by LHBs-reconstructed L02 cell membrane is about 100 nm, which is consistent with the DLS results ( Figure 2 b, PDI = 0.213) and NTA results ( Figure 2 c) is consistent. The concentration of LHBs-FVs determined by NTA method is about (2.1±0.3)×10 7 / mL( Figure 2 d).

[0051] 4.1.2 Investigation of LHBs-FVs fusion performance

[0052] (1) Extraction of exosomes

[0053] Normal L02 cell culture fluid was collected and centrifuged at 300g and 4℃ for 10min, the supernatant was taken, centrifuged at 2000g for 10min, and the precipitate was discarded. The supernatant was centrifuged again at 4℃ and 200000g for 90min. The supernatant was collected and filtered with a 0.22μm filter membrane to collect the filtrate. The filtrate was centrifuged at 110000g for 90min at 4℃, the supernatant was discarded, the precipitate was resuspended in 1×PBS and centrifuged again at 110000g for 90min. Finally, the precipitate was resuspended in 1×PBS. The size, morphology and concentration of exosomes were characterized by DLS, TEM and NTA, and the extracted exosome membrane proteins were analyzed by western blot.

[0054] TEM( Figure 3 a) and DLS( Figure 3 b) The results showed that the average particle size of the exosomes extracted in this study was about 186 nm, which was consistent with the results of NTA investigation ( Figure 3 c) is consistent. The concentration of the extracted exosomes measured by NTA method is about (3.7±0.5)×10 7 / mL( Figure 3 d). Western blot analysis confirmed that the exosomes secreted by L02 cells contained proteins such as CD63, TSG101 and NTCP ( Figure 3 e). In summary, the above results show that this study successfully extracted exosomes from L02 cells.

[0055] (2) CLSM and TEM were used to investigate the recognition and fusion performance of LHBs-FVs with liver-derived exosomes. In the CLSM study, LHBs-FVs and Con-FVs were incubated with 20 μM of the dye 3,3'-dioctadecyl-3,3,3',3'-tetramethylcarbocyanine perchlorate (DiO) for 1 h, and the exosomes were incubated with 20 μM of the dye 1,1'-dioctadecyl-3,3,3'-tetramethylcarbocyanine perchlorate (DiI) for 1 h. The samples were then ultracentrifuged at 120,000 g for 90 min to remove free DiO or DiI dyes. DiO-labeled LHBs-FVs (2 nM) and Con-FVs (2 nM) were then mixed and incubated with DiI-labeled exosomes (2 nM) for 2 h and imaged using a Leica Stellaris STED super-resolution confocal microscope. In the TEM imaging study, the sample after incubation of LHBs-FVs (2 nM) and exosomes (2 nM) for 2 h was dropped onto a 150-mesh copper grid and incubated for 10 min, washed with distilled water, stained with 2% uranyl acetate for 10 min, dried for 30 min, and imaged under a transmission electron microscope.

[0056] The results are as follows Figure 4As shown in a, after LHBs-FVs and exosomes were incubated for 2 hours, DiO fluorescence and DiI fluorescence had good co-localization, indicating that LHBs-FVs and exosomes had membrane fusion, while no co-localization fluorescence of DiI and DiO was detected in the samples after Con-FVs and exosomes were incubated. The above results indicate that the LHBs protein on LHBs-FVs is a necessary condition for inducing vesicle fusion. Similarly, TEM results ( Figure 4 b) showed that LHBs-FVs could fuse with exosomes. In addition, DLS results ( Figure 4 c) and NTA results ( Figure 4 d) showed that the particle size of LHBs-FVs after co-incubation with exosomes was significantly increased compared with that of LHBs-FVs and exosomes. This result also proves that LHBs-FVs can fuse with exosomes.

[0057] 4.2 Performance analysis of the CRISPR-CHA system

[0058] In order to solve the problem of low sensitivity of single amplification detection technology, the present invention combines CHA technology with CRISPR / Cas13a technology to construct a high-sensitivity detection system CRISPR-CHA with multiple signal amplification function.

[0059] The secondary structure of the probes contained in the CRISPR-CHA system is as follows Figure 5 As shown in a. The probe was synthesized by Sangon Biotechnology Co., Ltd.

[0060] The feasibility of using the CRISPR-CHA system for miR122 (UGGA GUG UGA CAA UGG UGU UUG) signal amplification detection was investigated by polyacrylamide gel electrophoresis (PAGE) and fluorescence methods.

[0061] The combinations investigated by fluorescence method were: H1+H2, D-Tri+H1+H2+Cas13a / crRNA complex, miR122+H1+H2+Cas13a / crRNA complex, Tri-1+miR122+H1+H2+Cas13a / crRNA complex, D-Tri+miR122+H1+H2+Cas13a / crRNA complex. The total volume of each group was 200 μL, of which 2 μL 10×reaction buffer was added to each group, 10 μL Cas13a / crRNA complex, and the final concentrations of miR122, H1, H2, D-Tri, and Tri-1 were all 200 nM. Incubate at 37°C for 1 hour. The results are shown in Figure 5 As shown in b.

[0062] The combinations investigated by PAGE method were: D-Tri, H1, H2, D-Tri+H1+H2, D-Tri+H1+H2+miR122+Cas13a / crRNA, D-Tri+H1+Cas13a / crRNA. The total volume of each group was 50μL, of which 1μL 10×reaction buffer was added to each group, the Cas13a / crRNA complex was 2.5μL, and the concentrations of H1, H2, miR122, and D-Tri were all 10nM. Each group of samples was incubated at 37°C for 60 minutes before loading. The electrophoresis conditions were a gel concentration of 20%, 80V electrophoresis for 20 minutes, and 100V electrophoresis for 1.5 hours in 1×Tris-boric acid (1×TBE) electrophoresis buffer. The sample loading volume for each group was 20μL, 10μL of 2×loading buffer, and the gel was stained with GelRed staining solution for imaging. The results are as follows Figure 5 As shown in c.

[0063] The results showed that the CRISPR-CHA system can achieve highly sensitive detection of miR122 signal amplification, and the biomarker miR122 and probes D-Tri, H1, and H2 play an indispensable role in the detection of signal amplification. The D-Tri+H1+H2+Cas13a / crRNA complex was determined to be the final CRISPR-CHA system.

[0064] The specificity of the CRISPR-CHA system was tested by fluorescence detection of miR122, mis-miR122 (AGCAGAGUGACAAUGGUGUUUG), miR192 (CUGGCCUAUGAAUUGACAGCC) and miR155 (UUAAUGCUAAUUGUGAUAGGGGU). The results showed that the CRISPR-CHA system showed good specificity when used for miR122 detection ( Figure 5 d), less affected by other miRNAs.

[0065] The fluorescence intensity of the CRISPR-CHA system for miR122 signal amplification detection was investigated by fluorescence method at different concentration ratios (2:1, 1.5:1, 1:1, 1:1.5, 1:2) of H1 / H2 (H2 concentration was 200nM) to optimize the optimal concentrations of H1 and H2. The fluorescence intensity of the CRISPR-CHA system incubated with miR122 for different times (15 to 90 minutes) was investigated by fluorescence method to optimize the optimal incubation time. The results showed that the ratio of H1 to H2 and the incubation time had an effect on the results. The optimal ratio of H1 to H2 was 1:1 ( Figure 5 e). As the incubation time increases, the relative fluorescence intensity of the sample increases rapidly and enters a plateau phase after 60 minutes ( Figure 5f), so we set the incubation time of the CRISPR-CHA system to 60 min. The concentration of miR122 was 10 -13 ~10 -7 M range, the relative fluorescence intensity of the detection system increased with the increase of miR122 concentration, and the relative fluorescence intensity had a good linear relationship with the logarithm of the miR122 concentration value ( Figure 5 g). In summary, the CRISPR-CHA detection system can be used for highly sensitive and rapid detection of miR122.

[0066] In summary, the optimal concentration of D-Tri, H1, and H2 probes in the 200 μL CRISPR-CHA detection system is 200 nM, the volume of Cas13a / crRNA complex added is 10 μL, and the amount of 10× reaction buffer added is 2 μL.

[0067] Example 2 Construction of multifunctional magnetic capsules MMVs and cell detection

[0068] 1 mL of the cell membrane solution carrying LHBs extracted in Example 1 was mixed with the finalized CRISPR-CHA system (D-Tri+H1+H2+Cas13a / crRNA complex) and Fe 3 O 4 The nanoparticles were mixed, and the concentrations of D-Tri, H1, and H2 probes in the resulting solution were 200 nM, the amount of Cas13a / crRNA complex added was 50 μL, the amount of 10× reaction buffer added was 10 μL, and the Fe 3 O 4 The amount added was 100 μL. A micro extruder was used to repeatedly extrude through 800, 400, and 200 nm polycarbonate porous membranes. The obtained MMVs were purified by ultrafiltration to remove unencapsulated probes and Fe 3 O 4 Nanoparticles. MMVs (Tri-1) were prepared by replacing D-Tri with Tri-1 as described above.

[0069] (1) Using TEM Figure 7 a) and DLS( Figure 7 b) The size and morphology of MMVs were investigated. The results showed that the MMVs were successfully prepared and had a particle size of approximately 160 nm, which was consistent with the size of LHBs-FVs.

[0070] (2) When MMVs are used for exosomal miRNA detection, their stability cannot be ignored. In this study, MMVs were dispersed in PBS and 8-fold diluted serum to examine their stability. After the samples were stored at 4°C for 5 days, their stability was evaluated by examining the changes in the particle size of MMVs and the leakage rate of the H1 probe (FAM-labeled H1 probe, denoted as H1F). Figure 7 c and Figure 7 d It can be seen that when MMVs are dispersed in PBS and serum, there is no significant change in the particle size. At the same time, the leakage of H1F is negligible. This result shows that MMVs have good stability.

[0071] (3) The fusion ability of MMVs and exosomes (extraction method is the same as in Example 1) was investigated by CLSM and TEM. MMVs and Con-FVs were incubated with DiI (20 μM) at room temperature for 1 h, followed by ultracentrifugation at 120,000 g for 90 min to remove free dyes, and then MMVs (2 nM) or Con-FVs (2 nM) were incubated with exosomes (2 nM) for 2 h, recorded as MMVs-Exo and Con-FVs-Exo, and imaged using a Leica Stellaris STED super-resolution confocal microscope and TEM.

[0072] From the CLSM images ( Figure 8 a) It can be seen that compared with the MMVs group and the Con-FVs and exosomes co-incubation group (Con-FVs-Exo), when MMVs were co-incubated with exosomes, MMVs restored fluorescence and showed good co-localization with exosomes. This result shows that MMVs can fuse with liver-derived exosomes, and after fusion, the CRISPR-CHA system carried by MMVs is triggered by miR122 in exosomes and completes highly sensitive detection of miR122 in situ in exosomes. TEM results ( Figure 8 b) It was also demonstrated that MMVs can recognize and fuse with liver-derived exosomes. Figure 8 c It can be seen that compared with the control group (MMVs, Con-FVs-Exo), the fluorescence intensity of the MMVs-Exo group was significantly enhanced. This result proves that MMVs can achieve high-sensitivity detection of mi122 in liver-derived exosomes.

[0073] (4) To investigate the feasibility of using MMVs for amplifying the detection of miRNA signals in liver-derived exosomes, first, MMVs were mixed with exosomes secreted by L02 cells and incubated in PBS at 37°C for 60 min, and their fluorescence intensity was measured. The concentrations of MMVs and exosomes were both 1×10 5 / μL, and MMVs (Tri-1) without signal amplification function were used as the control group. Fig. 9 a and Fig. 9b As can be seen, the fluorescence intensity of MMVs itself and MMVs (Tri-1) when used for liver-derived exosome detection (MMVs (Tri-1)-Exo) is relatively weak, while the fluorescence intensity of MMVs when used for liver-derived exosome detection (MMVs-Exo) is significantly enhanced. From this result, it can be seen that MMVs exhibits good signal amplification function when used for exosomal miR122 detection.

[0074] The sensitivity and specificity of MMVs for detecting miR122 in exosomes were further investigated. 5 / μL) and different numbers of liver-derived exosomes (1×10 4 / μL~1×10 7 The exosomes derived from L02, MCF-7, HEK293T and A549 cells were incubated with MMVs at 37°C for 60 min, and the fluorescence intensity of each sample was measured. Fig. 9 c It can be seen that the exosome concentration is 1×10 4 / μL~1×10 7 When the fluorescence intensity of MMVs used for exosome detection was within the range of 10 / μL, it gradually increased with the increase of exosome concentration; and the calibration curve corresponding to the relative fluorescence intensity of the detection system and the logarithmic relative value of the exosome concentration had a good linear relationship, the linear regression equation was y=2.443x-8.702, and the correlation coefficient was r=0.998. The detection limit of this detection method was 1.25×10 2 / μL( Fig. 9 d) The specificity of the detection method was investigated by detecting exosomes from different cell sources. Fig. 9 As shown in e, compared with liver-derived exosomes, when MMVs were used for exosomes derived from other cells (MCF-7, HEK293T, A549), the fluorescence signal was weaker. This result indicated that MMVs had higher sensitivity and specificity for liver-derived exosomes, while exosomes from other sources had less interference in its detection.

[0075] (5) To further explore the performance of the nanoprobe in DILI detection, we used L02 cells with miR122 overexpression or knockdown to simulate different states of DILI. The miR122 overexpression plasmid and knockdown plasmid were purchased from Shanghai Jima Biotechnology Co., Ltd. The preparation of Lipofectamine 3000 (Thermo) complex was as follows: 1 μg of plasmid and 5 μL P3000 were mixed into 100 μL opti-MEM culture medium, gently mixed, and placed at room temperature for 10 min to obtain solution A. 5 μL Lipofectamine 3000 was added to 100 μL opti-MEM culture medium, gently mixed, and placed at room temperature for 10 min to obtain solution B: Solution A and solution B were mixed and incubated at room temperature for 10 min to obtain Lipofectamine 3000 complex. Plasmid transfection: L02 cells were inoculated into 6-well plates and cultured in an incubator. After the cells adhered to the wall, the old culture medium was discarded, and the cells were rinsed with PBS for 3 times and serum-free culture medium was added, followed by DNA-Lipofectamine 3000 complex. After 4-8 hours of culture in a cell culture incubator, the serum-free culture medium was discarded and complete culture medium was added to continue culture for 48-72 hours.

[0076] L02 cells with miR122 overexpression or knockdown were collected, and total miRNA was extracted using the MiPure Cell / Tissue miRNA Kit (Novozymes). st Strand cDNA Synthesis Kit (Novozyme) was used to reverse total miRNA to obtain the first-strand cDNA, and finally the miRNAUniversal SYBR qPCR Master Mix Kit (Novozyme) was used for quantification in a Q6 real-time fluorescence quantitative PCR instrument (Thermo ABI, USA). The qPCR reaction procedure was the first stage of pre-denaturation: 95℃5min, 1 cycle; the second stage of cycle reaction: 95℃10s, 60℃30s, 40 cycles; the third stage of melting curve: 95℃15s, 60℃60s, 95℃15s, 1 cycle. U6 was used as the internal reference gene. The primers used in this experiment were ordered from Shanghai Sangon Biotechnology Co., Ltd., and the nucleic acid sequences are as follows:

[0077] Table 2 Primer nucleic acid sequences

[0078]

[0079] RT-qPCR analysis Fig.10As shown in a, the cell model of miR122 overexpression or knockdown was successfully constructed, and the relative expression level of miR122 in the exosomes secreted by L02 cells with miR122 overexpression or knockdown was consistent with the relative expression level of miR122 in L02 cells ( Fig.10 b) Fluorescence intensity of MMVs used to detect exosomes from miR122 overexpression or knockout cells Fig.10 As shown in c, compared with exosomes from normal cells, the F / F0 intensity of MMVs used to detect exosomes secreted by miR122 overexpressing cells was significantly increased. On the contrary, the F / F0 intensity of MMVs used to detect exosomes secreted by miR122 knockdown cells was significantly reduced. This result shows that MMVs can achieve in situ detection of miR122 in exosomes.

[0080] The above experimental results show that the detection method constructed in this study showed good performance in highly sensitive detection of miR122 in liver-derived exosomes in situ.

[0081] Example 3 Animal experiment of using MMVs to detect serum exosome miR122

[0082] Different doses of APAP (0 mg kg -1 , 200mg kg -1 , 350mg kg -1 , 500mg kg -1 ) pretreated mice to create a DILI model. Male ICR mice (4 weeks old, 20±2g) were purchased from the Comparative Medicine Center of Yangzhou University. The experiment could be carried out after they were adaptively fed for one week and adapted to the feeding environment. The light in the feeding room was controlled for 12h per day, the temperature was 25±1℃, and the relative humidity was 50±10%. During the entire adaptive feeding process, the mice had free access to water and food and were in normal health. The mice were divided into four groups, 5 in each group. The mice in the experimental group were intraperitoneally injected with 0mg·kg -1 , 200mg·kg -1 , 350mg·kg -1 or 500 mg kg -1APAP (Sigma), the control group (WT) was injected with 200 μL 0.5% sodium carboxymethylcellulose (CMC-Na, Sinopharm Group), and the mice were weighed and euthanized 24 hours later. Whole blood and liver tissue were collected by periocular bleeding, and the liver tissue was weighed. After collecting the blood sample, it was placed at room temperature for 2 to 4 hours (handle it gently to avoid hemolysis of red blood cells). Centrifuge at 2500rpm for 15 minutes at room temperature, and transfer the upper clear light yellow serum to a new 1.5mL centrifuge tube for subsequent biochemical index analysis. The ALT test kit (Nanjing Jiancheng Company) and AST test kit (Nanjing Jiancheng Company) were used to detect the ALT and AST biochemical indicators of the serum of each group of mice. H&E staining of mouse liver tissue was performed. The mouse liver tissue was placed in a 4% paraformaldehyde (Shanghai Biyuntian Company) solution and fixed for more than 24 hours. The liver tissue was embedded in paraffin and sliced ​​continuously by a microtome to obtain paraffin sections of the liver tissue with a thickness of about 6 μm. Dewax twice with xylene (Sinopharm), each time for 5-10 min, and then rinse twice with 100%, 95%, 80%, 75% ethanol (xylene) solution and deionized water, each time for 1-2 min. Stain in eosin staining solution (Solabo) for 30 s, and soak twice with 95%, 100% ethanol and xylene, each time for 1 min. The obtained liver tissue H&E tissue sections were observed under a microscope. Then MMVs or MMVs (Tri-1) were added to 200 μL serum, and the final concentration of MMVs was 1×10 4 After incubation at 37°C for 60 min, the fluorescence intensity was measured.

[0083] Rat serum ALT ( Fig.11 a) AST( Fig.11 b) Activity and liver weight ratio (ratio of mouse liver to body weight, Fig.11 c), and the area of ​​focal liver necrosis ( Fig.11 d) increased with the increase of APAP dosage. The above results show that the APAP-induced DILI mouse model was successfully established and the hepatotoxicity of APAP was dose-dependent. The results of MMVs detection of hepatic exosome miR122 in the serum of DILI mice are shown in Figure 2. Fig.11 As shown in Figure e, the F / F0 intensity increased with the increase of drug dose, which is consistent with the above RT-qPCR results ( Fig.11 f). The experimental results showed that the nanoprobe can accurately diagnose DILI using serum liver-derived exosome miR122 as a biomarker without the need for further extraction and purification of exosomes and miR122.

Claims

1. A highly sensitive nanosystem for early diagnosis of DILI, It is characterized in that The nanosystem includes engineered vesicles carrying LHBs, a CRISPR-CHA system and Fe 3 O 4 Nanoparticles; the CRISPR-CHA system includes probes D-Tri, H1, H2, Cas13a / crRNA complex and 10×reaction buffer; the nucleotide sequence of D-Tri is shown in SEQ ID NO.1, the nucleotide sequence of H1 is shown in SEQ ID NO.2, the nucleotide sequence of H2 is shown in SEQ ID NO.3, and the Cas13a / crRNA complex includes 10×reaction buffer, crRNA and Cas13a nuclease.

2. The method for preparing the highly sensitive nanosystem for early diagnosis of DILI according to claim 1, It is characterized in that The following steps are involved: (1) constructing a cell line stably transfected with the large surface protein LHBs of the hepatitis B virus, expanding the culture, extracting the cell membrane, and obtaining engineered vesicles carrying LHBs; (2) 10× reaction buffer, crRNA, Cas13a nuclease and nuclease-free ultrapure water were mixed and incubated to obtain a Cas13a / crRNA complex; probes D-Tri, H1, and H2 were pretreated and heated for denaturation, cooled to room temperature, and then mixed with the Cas13a / crRNA complex to obtain a CRISPR-CHA system; (3) FeCl 3 6H 2 O was added with ultrapure water, stirred continuously under nitrogen protection, and then Na 2 SO 3 solution, sodium polyaspartate solution, and ammonia water. After the reaction, the crude product was collected, acetone was added thereto, and the supernatant was removed by magnetic separation. Ethanol was added to the precipitate for magnetic separation again, and the precipitate was washed and dispersed in ddH 2 O, dialyze, take the supernatant and centrifuge, the supernatant is Fe 3 O 4 Nanoparticle solution; (4) Engineered vesicles carrying LHBs, CRISPR-CHA system and Fe 3 O 4 The nanoparticle solutions are mixed and purified to obtain a highly sensitive nanosystem for early diagnosis of DILI.

3. The preparation method according to claim 2, It is characterized in that The final concentration of D-Tri, H1 and H2 probes in the CRISPR-CHA system described in step (2) is 200 nM.

4. The preparation method according to claim 2, It is characterized in that The volume ratio of Cas13a / crRNA complex and 10×reaction buffer in the CRISPR-CHA system described in step (2) is 5:

1.

5. Use of the nanosystem according to claim 1 in the preparation of a reagent for detecting drug-induced liver injury.

6. The use according to claim 5, It is characterized in that The final concentration of the nanosystem was 1×10 4 Pieces / μL.

7. The use according to claim 5, It is characterized in that The nanosystem is used to detect the concentration of miR122.

8. The use according to claim 5, It is characterized in that The application is to mix and incubate the nanosystem with different concentrations of miR122, measure the fluorescence intensity, and draw a linear method; mix and incubate the nanosystem with the serum to be tested, measure the fluorescence intensity, and substitute it into the linear equation to obtain the concentration of miR122 in the serum to be tested.

9. The use according to claim 8, It is characterized in that The concentration of miR122 was 10 -13 ~10 -7 M.

10. The use according to claim 8, It is characterized in that The incubation condition is 37° C. for 60 to 90 minutes.

Images