Nucleic acid, kit and micro-fluidic chip for detecting natural epidemic disease pathogens

Abstract

The invention relates to nucleic acid, a kit and a micro-fluidic chip for detecting natural epidemic disease pathogens. The nucleic acid comprises a primer pair and a probe for detecting forest encephalitis virus and / or Crimean-Congo hemorrhagic fever virus. The invention also provides micro-fluidic chips which are respectively coated and used for detecting the forest encephalitis virus and the Crimean-Congo hemorrhagic fever virus. The nucleic acid provided by the invention can be used for detecting a single forest encephalitis virus or a Crimean-Congo hemorrhagic fever virus, can also be used for simultaneously detecting the forest encephalitis virus and the Crimean-Congo hemorrhagic fever virus in a combined manner, and can be flexibly combined. The invention also provides a micro-fluidic chip for simultaneously detecting the forest encephalitis virus and the Crimean-Congo hemorrhagic fever virus, the use of the micro-fluidic chip can effectively save time, the detection cost is low, rapid screening is realized, and the detection method has strong specificity and high sensitivity and can effectively avoid missing detection.

Description

Technical Field

[0001] The invention relates to a nucleic acid, a test kit and a microfluidic chip for detecting pathogens of natural epidemic-focus diseases, and belongs to the technical field of biological detection. Background Art

[0002] Natural epidemic focus diseases refer to diseases that can survive and reproduce in nature without relying on humans, and can be transmitted to humans under certain conditions. Some areas have animal sources of infection, transmission media and natural conditions for the transmission of pathogens between animals. When humans enter such areas, they can be infected and become sick. These areas are called natural epidemic focus areas.

[0003] Forest encephalitis is caused by the bite of hard ticks carrying forest encephalitis virus. It is an acute infectious disease with natural epidemic sources in forest areas, mainly characterized by central nervous system lesions. Crimean-Congo hemorrhagic fever virus is classified as Bunyaviridae and Nairovirus. It is a single-stranded negative-strand RNA virus, round or oval, with an envelope and a diameter of 85-105nm. Its genome can be divided into three large, medium and small fragments, encoding RNA polymerase, glycoprotein G1, G2 and nucleocapsid protein respectively. The virus is pathogenic to newborn mice, rats and all-yellow hamsters, and can be propagated and cross-passaged in suckling mouse brains, chicken embryos, hamster kidneys, suckling rabbit kidneys and VeroE cells.

[0004] How to effectively prevent forest encephalitis and Crimean-Congo hemorrhagic fever virus infection requires screening or detection of forest encephalitis virus or Crimean-Congo hemorrhagic fever virus. The most common methods for existing virus detection are detection of genomic RNA, virus-specific antibodies and virus separation detection. Detection of genomic RNA is also the detection of a single viral RNA, and it cannot detect forest encephalitis virus and Crimean-Congo hemorrhagic fever virus at the same time. The detection method of virus separation can only detect a single virus, and this method is time-consuming and laborious. At present, there is a forest encephalitis IgM detection kit (ELISA), and the forest encephalitis antibodies detected are mainly for the detection of antibodies produced after human or animal infection. However, whether the environment or ticks or some animal feces carry forest encephalitis virus and Crimean-Congo hemorrhagic fever virus cannot be carried out using antibody detection kits. Therefore, it is urgent to develop a detection reagent that can detect forest encephalitis virus and Crimean-Congo hemorrhagic fever virus at the same time. Summary of the invention

[0005] 1. Technical issues to be resolved

[0006] In order to solve the above problems in the prior art, the present invention provides a nucleic acid, a kit and a microfluidic chip for detecting pathogens of natural epidemic focal diseases.

[0007] (II) Technical solution

[0008] In order to achieve the above object, the main technical solutions adopted by the present invention include:

[0009] A nucleic acid for detecting pathogens of natural epidemic-focus diseases, comprising a primer pair and a probe for detecting forest encephalitis virus and / or Crimean-Congo hemorrhagic fever virus; wherein the nucleic acid sequence of the primer pair for forest encephalitis virus is shown in SEQ ID No.1 and SEQ ID No.2, and the nucleic acid sequence of the probe is shown in SEQ ID No.3;

[0010] The nucleic acid sequence of the primer pair for Crimean-Congo hemorrhagic fever virus is shown in SEQ ID No.4 and SEQ ID No.5, and the nucleic acid sequence of the probe is shown in SEQ ID No.6.

[0011] Preferably, the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quencher group.

[0012] When fluorescence quantitative PCR is used to simultaneously detect forest encephalitis virus and Crimean-Congo hemorrhagic fever virus, the 5' end and 3' end of the two probes are respectively labeled with fluorescent groups and quenching groups of different detection channels, such as FAM-BHQ1 and CY5-BHQ3.

[0013] A kit for detecting pathogens of natural epidemic focus diseases, wherein the pathogens of natural epidemic focus diseases include forest encephalitis virus and Crimean-Congo hemorrhagic fever virus, which includes the nucleic acid as described above, wherein the 5' end of each probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group and MGB, the fluorescent group is any one of FAM, CY5, Texred or JOE, and the quenching group is any one of BHQ1, BHQ3, BHQ2 or TAMRA.

[0014] The kit as described above further includes a primer pair and a probe for amplification control and a positive template for amplification control, wherein the positive template for amplification control is genomic DNA of Bacillus atrophaeus, the nucleic acid sequence of the primer pair for amplification control is shown in SEQ ID No.7 and SEQ ID No.8, and the probe sequence is shown in SEQ ID No.9, and the 5' end of each probe is labeled with a FAM group and the 3' end is labeled with NFQ-MGB.

[0015] The kit as described above also includes a positive control for forest encephalitis virus and a positive control for Crimean-Congo hemorrhagic fever virus, wherein the positive control for forest encephalitis virus contains the sequence shown in SEQ ID No.10, and the positive control for Crimean-Congo hemorrhagic fever virus contains the sequence shown in SEQ ID No.11.

[0016] The kit as described above further comprises 2×RT-PCR buffer and 25×RT-PCR Enzyme Mix.

[0017] A microfluidic chip for simultaneously detecting forest encephalitis virus and Crimean-Congo hemorrhagic fever virus, comprising a primer pair and a probe for detecting forest encephalitis virus, respectively coated in each chamber hole on a detection sheet body of the microfluidic chip, and a primer pair and a probe for detecting Crimean-Congo hemorrhagic fever virus; wherein the upstream primer sequence of the forest encephalitis virus is shown in SEQ ID No.1, the downstream primer sequence is shown in SEQ ID No.2, and the probe sequence is shown in SEQ ID No.3;

[0018] The upstream primer sequence of the Crimean-Congo hemorrhagic fever virus is shown in SEQ ID No.4, the downstream primer sequence is shown in SEQ ID No.5, and the probe sequence is shown in SEQ ID No.6;

[0019] All probes were labeled with FAM at the 5' end and NFQ-MGB at the 3' end.

[0020] The microfluidic chip as described above preferably further comprises a chamber well having upstream and downstream primers, a probe and a positive amplification product of an amplification control, a chamber well having nuclease-free water as a negative control, and a blank control well; the sequences of the upstream and downstream primers of the amplification control are shown in SEQ ID No.7 and SEQ ID No.8, the probe sequence is shown in SEQ ID No.9, and the positive amplification of the amplification control is a template DNA of Bacillus atrophaeus;

[0021] The 5' end of the probe was labeled with a FAM group, and the 3' end was labeled with NFQ-MGB.

[0022] Also included are 2×RT-PCR buffer and 25×RT-PCR Enzyme Mix.

[0023] A method for simultaneously detecting forest encephalitis virus and Crimean-Congo hemorrhagic fever virus using a microfluidic chip, which uses the microfluidic chip prepared above for detection, and comprises the following steps:

[0024] S1. Extract RNA from samples;

[0025] S2. Utilize the extracted RNA to configure the RT-PCR amplification system;

[0026] S3, injecting the amplification system into the sample loading hole in the microfluidic chip, and after the liquid fills the microfluidic chip, sealing the sample loading hole with a sealant;

[0027] S4, placing the microfluidic chip into a nucleic acid amplification analyzer, setting amplification reaction parameters for amplification;

[0028] S5. After amplification is completed, the software of the nucleic acid amplification analyzer performs data processing and compares it with the blank control well. If the test well has an obvious amplification curve on the nucleic acid amplification analyzer, it is judged as positive; if there is no obvious amplification curve, it is judged as negative.

[0029] As described above, preferably, the amplification reaction parameters are as follows: the reverse transcription step is 50°C, 10 min; the pre-denaturation step is 95°C, 3 min; the amplification cycle steps are 95°C, 10 sec; and 60°C, 30 sec for a total of 40 cycles, and the fluorescence signal is collected at 60°C.

[0030] In the method as described above, preferably, the template RNA is extracted using an RNA extraction kit.

[0031] (III) Beneficial effects

[0032] The beneficial effects of the present invention are:

[0033] The present invention provides a nucleic acid for detecting pathogens of natural epidemic focus diseases, which can be used to detect forest encephalitis virus and Crimean-Congo hemorrhagic fever virus. The nucleic acid group can be used for the detection of a single pathogen, and can also be used for the simultaneous screening of forest encephalitis virus and Crimean-Congo hemorrhagic fever virus. When used for the simultaneous detection of these two pathogens, it has been verified that the detection sensitivity is high, there is no cross reaction between them, and the specificity is strong.

[0034] The present invention also provides a kit for detecting forest encephalitis virus and Crimean-Congo hemorrhagic fever virus. The detection kit is easy to use, simple to operate, and has a high degree of automation. It can effectively replace traditional virus separation and culture to obtain detection results. The kit uses fewer reagents, reduces the operation process, and also reduces pollution during the operation process, avoids repeated operations and excessive labor consumption, saves time, and can effectively save detection costs, realizing rapid screening. The detection effect of the kit used is good, the specificity is strong, the sensitivity is high, and missed detection can be effectively avoided.

[0035] The present invention establishes a relatively efficient and sensitive method for simultaneously screening the two forest encephalitis viruses and Crimean-Congo hemorrhagic fever viruses. The method can effectively improve the sensitivity of detection and avoid the occurrence of false negative results.

[0036] The present invention also provides a microfluidic chip for simultaneously detecting forest encephalitis virus and Crimean-Congo hemorrhagic fever virus. After the mixed reaction solution is configured, only one sample needs to be added to achieve simultaneous detection of the two viruses, which can effectively avoid the possibility of sample contamination during subpackaging and testing, greatly reduce the operation steps, and is simple to operate, fast to detect, and low in cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is the sensitivity amplification curve of real-time fluorescence quantitative PCR for detecting forest encephalitis virus; Figure 2 This is the sensitivity amplification curve of real-time fluorescence quantitative PCR for detecting Crimean-Congo hemorrhagic fever virus. DETAILED DESCRIPTION

[0038] In order to better explain the present invention and facilitate understanding, the present invention is described in detail below through specific embodiments. The embodiments of the present invention are not limited thereto. The complementary sequence of the nucleotide sequence provided by the present invention can also realize the present invention. Unless otherwise specified, the reagents used are conventional reagents and can be commercially obtained from regular channels. Therefore, all equivalent replacements in the art made in accordance with the present disclosure belong to the protection scope of the present invention. Unless otherwise specified, the virus strain plasmid RNA and Bacillus atrophaeus strains used in the following examples are provided and preserved by the Henan Industrial Microbial Strain Engineering Technology Research Center.

[0039] Example 1 Design of primers and probes

[0040] First, the specific target genes of forest encephalitis virus and Crimean-Congo hemorrhagic fever virus were screened respectively. According to the purpose of detection, multiple viral gene sequences were downloaded from GenBank for each virus, and the conservative sequences were selected. Then, Primer Premier5, Beacon designer software and Primer-BLAST (NCBI) were combined for analysis. The probes were designed according to the parameters such as annealing temperature at 60°C, amplification product length at 100-150bp, and Tm value of the probe at least 5 degrees higher than the primer. The primer probe sequences corresponding to each pathogen are shown in Table 1. After the design, it was handed over to a company with synthesis qualifications for synthesis, and the probe 5' end was labeled with FAM group and the 3' end was labeled with NFQ-MGB.

[0041] In addition, in order to monitor the quality of samples and amplification reagents, it is necessary to set up extraction controls and amplification controls. The extraction control generally selects a housekeeping gene that is stably expressed in the human body. In this scheme, the GAPDH gene is selected. The amplification control selects a gene with low homology or no homology to the pathogen to be tested. In the present invention, the Bacillus atrophaeus gene is selected. The primers and probes of these two genes are designed according to the same parameter requirements as the pathogens. The sequences are shown in Table 1.

[0042] Table 1 Primers and probes for each target

[0043]

[0044] Note: The primer and probe names containing F represent upstream primers, those containing R represent downstream primers, and those containing P represent probes. Y represents C or T, and R represents A or G.

[0045] The present invention screens the N gene of forest encephalitis virus, the sequence number of which is MH645619 in GenBank, and designs primers and probes by screening conservative sequences. It is finally determined that the fragment size amplified by the designed forest encephalitis virus primers is 97 bp, and the amplified sequence is as shown in SEQ ID No. 10. SEQ ID No. 10: GGACTTCAG ACAGGAACCAACACACGAAT GTGACACTGG AGTGATGGGGGCTGCCGTCAAGAATGGCAT GGCGGTCCAC AC TGACCAAA GTCTCTGG.

[0046] The S gene of Crimean-Congo hemorrhagic fever virus screened by the present invention has a sequence number of OL774851 in GenBank, and the conserved sequence screened is used to design primers and probes. It is finally determined that the fragment size amplified by the designed Crimean-Congo hemorrhagic fever virus primers is 95 bp, and the amplified sequence is shown in SEQ ID No. 11.

[0047] SEQ ID No. 11: GCCAAGAGGTACTAAGAAAATGAAGAAGGCTCT GCTGAGC ACCCCAATGAAGTGGGGAAAGAAACTTTATGAACTCTT TG CCGACGATTCTTTCC.

[0048] The primers and probes in the above table were sent to Beijing BGI for synthesis, and the 5′ end of the probe was labeled with a fluorescent group FAM, and the 3′ end was labeled with NFQ-MGB; and plasmid RNA was synthesized according to the above amplification sequence.

[0049] The present invention also labels the 3' end of the probe with MGB (dihydrocyclopyrrole tripeptide), which can non-covalently bind to the minor groove of double-stranded DNA to stabilize the DNA structure. The MGB molecule is coupled to the probe through a CN bond, which can make the oligonucleotide probe bind to the complementary DNA and RNA target sequences more stably; it should be noted that when using fluorescent quantitative PCR to simultaneously detect forest encephalitis virus and Crimean-Congo hemorrhagic fever virus, the 5' ends of the two probes are labeled with fluorescent groups of different detection channels, and the 3' ends are labeled with quenching groups and MGB, such as the fluorescent group is any one of FAM, CY5, Te xred or JOE, and the quenching group is any one of BHQ1, BHQ3, BHQ2 or TAMRA.

[0050] Example 2 Sensitivity Detection

[0051] The plasmid RNA of forest encephalitis virus and Crimean-Congo hemorrhagic fever virus synthesized in Example 1 was measured and calculated to determine the copy number, and the plasmids were diluted respectively so that the initial bacterial solution concentration was 3×10 9 After diluting the virus by 10 times, the dilution gradient of each virus was 10 -6 -10 -9 Plasmid RNA template; using the single detection target pathogen primer pair and the corresponding probe of Example 1, the above-mentioned RNA templates of different concentrations were respectively tested for sensitivity, and forest encephalitis virus and Crimean-Congo hemorrhagic fever virus were detected, for example, for a single detection of forest encephalitis virus, the amplification system can be used

[0052] 1) NTC: nuclease-free water;

[0053] The reaction system used a 25μL reaction system, consisting of 2×RT-PCR buffer 12.5μL; 25×RT-PCR EnzymeMix 1.0μL, single forest encephalitis virus-F / R, i.e. upstream and downstream primers (10μM), both 0.4μL; forest encephalitis virus-P, i.e. probe (10μM), 0.2μL, nuclease-free water, 5.5μL, and sample RNA, i.e. plasmid RNA of forest encephalitis virus, 5μL.

[0054] That is, the sample plasmid RNA is detected using the diluted positive template, and the preferred amplification conditions are: reverse transcription step at 50°C, 10min; denaturation step at 95°C, 3min; amplification cycle step at 95°C, 10sec; 60°C, 30sec for a total of 40 cycles, and the fluorescence signal is collected at 60°C. Real-time fluorescence quantitative PCR detection is performed on an ABI7500 PCR instrument.

[0055] 2) Make three parallel samples for each gradient.

[0056] Result determination: Ct value ≤ 35 with obvious amplification curve is positive result, Ct value > 40 without obvious amplification curve is negative result. The detection of other types of botulinum toxin is the same as above.

[0057] Fluorescence value diagram of the test results, among which the sensitivity test results of forest encephalitis virus are as follows Figure 1 As shown in the figure, the template copy numbers shown by the curves from left to right are 3×10 3 copies / μL, 3×10 2 The results show that the primers and probes used in the present invention can detect forest encephalitis virus RNA at a concentration of 3 copies / μL, 3×10 copies / μL, and 3 copies / μL.

[0058] The results of the sensitivity test for Crimean-Congo hemorrhagic fever virus are as follows Figure 2 As shown in the figure, the template copy numbers shown by the curves from left to right are 3×10 3 copies / μL, 3×10 2 The results show that the method established by the present invention can detect Crimean-Congo hemorrhagic fever virus RNA with a concentration of 3 copies / μL.

[0059] Example 3 Specificity Detection

[0060] The present invention uses primers and probes for detecting a single virus (such as forest encephalitis virus) to perform specific detection on plasmid RNA of forest encephalitis virus, Crimean-Congo hemorrhagic fever virus and genomic DNA of Bacillus atrophaeus, respectively. Specifically, real-time fluorescence RT-PCR detection is performed according to the real-time fluorescence RT-PCR reaction system configuration and amplification conditions in Example 2. The detection results show that the specificity of single virus strain detection is good, and the primers and probes for single virus detection can only detect the plasmid RNA template of the target virus strain as positive, and the RNA templates of other virus strains are negative. This shows that the primers and probes designed by the present invention have good specificity, no cross reaction, and no false positive results.

[0061] And all the primers and probes in Table 1 were mixed, and the specific dosage was based on the dosage of each primer and probe: 0.4 μL of upstream primer (10 μmol / L), 0.4 μL of downstream primer (10 μmol / L) and 0.2 μL of probe (10 μM), 1.5 μL of nuclease-free water in the 25 μL PCR reaction system, and other dosages remained unchanged. The RNA templates of the above strains were amplified respectively, and the results showed that only the plasmid RNA of forest encephalitis virus, Crimean-Congo hemorrhagic fever virus, and the plasmid DNA of Bacillus atrophaeus were positive, and the others were negative. It shows that the primers and probes designed by the present invention have no cross reaction between the primers, probes and amplification products, and no false positive results will occur.

[0062] Example 4 Detection kit for forest encephalitis virus and Crimean-Congo hemorrhagic fever virus

[0063] The detection kit for forest encephalitis virus and Crimean-Congo hemorrhagic fever virus comprises the following components: the upstream primer sequence for detecting forest encephalitis virus is shown in SEQ ID No.1, the downstream primer sequence is shown in SEQ ID No.2, and the probe sequence is shown in SEQ ID No.3;

[0064] The upstream primer sequence for detecting Crimean-Congo hemorrhagic fever virus is shown in SEQ ID No.4, the downstream primer sequence is shown in SEQ ID No.5, and the probe sequence is shown in SEQ ID No.6;

[0065] The above probes are all labeled with FAM group at their 5' end and BHQ1 and MGB at their 3' end.

[0066] For specific virus types to be detected, real-time fluorescence quantitative RT-PCR can be used for detection using separate corresponding primer probes; for simultaneous detection and screening of forest encephalitis virus and Crimean-Congo hemorrhagic fever virus, the above four probes can also be labeled with fluorescent groups and quenching groups in different detection channels to achieve simultaneous detection by real-time fluorescence quantitative PCR.

[0067] Furthermore, in order to prevent the reagents from becoming ineffective or contaminated, positive control and negative control reagents were provided, and nuclease-free water was used for the negative control; the upstream primer sequence for amplifying the positive control was shown in SEQ ID No.6, the downstream primer sequence was shown in SEQ ID No.7, and the probe sequence was shown in SEQ ID No.8.

[0068] The amplification positive control uses the genomic DNA of Bacillus atrophaeus. The detection of the amplification positive control is a detection of the entire reaction system process. If the result is positive, it means that there is no problem in the detection process. If it is a negative result, it means that the detection process is improperly operated or there is a problem. The test result is unreliable, so the reaction system should be reconfigured for detection.

[0069] The design of negative controls can effectively verify whether the reagents used are contaminated and avoid false positives. The design of positive controls can effectively verify the effectiveness of the reagents used and avoid false negatives.

[0070] The above primers or probes can be packaged separately one by one, or primers or probes for one type of botulinum toxin can be configured and mixed together and packaged according to the detection of a single strain, which can save configuration time during the detection operation.

[0071] Another object of the present invention is to provide a microfluidic chip that can be used to simultaneously detect or screen forest encephalitis virus and Crimean-Congo hemorrhagic fever virus, wherein the structure of the microfluidic chip itself can be adopted to include a detection sheet body, the detection sheet body can be a sheet-like plate body, including a first side and a second side, a plurality of chamber holes are recessed on the first side, a branch injection flow channel connected to the first end of the chamber hole and an exhaust flow channel connected to the second end, and an exhaust hole connected to each exhaust flow channel, a main flow channel connected to each branch injection flow channel, and a main flow channel located at the beginning of the main flow channel. The injection hole at the starting end and the chamber hole are through-hole structures; the branch injection channel, the exhaust channel and the exhaust hole are non-through-hole structures; the opening side of the exhaust hole is covered with a hydrophobic breathable membrane, and a first sealing sheet is compounded on the first side of the detection sheet body to block the branch injection channel, the exhaust channel and the first side of the chamber hole; the second side of the detection sheet body is compounded with a second sealing sheet to block the second side of the chamber hole, so that the chamber hole becomes the sealed chamber; the microfluidic chip also includes a third sealing sheet and a cover plate for closing the exhaust hole and the injection hole after the injection is completed.

[0072] The preparation method of the microfluidic chip for detecting botulinum toxin is as follows:

[0073] S1. Take the microfluidic chip (the second side of the detection chip body has been sealed with a membrane, and the first side is open), first ultrasonically clean it in acetone for 10 minutes, then ultrasonically clean it in anhydrous ethanol for 10 minutes, and then ultrasonically clean it in deionized water for 10 minutes, and finally take it out and dry it in an oven for later use;

[0074] S2. Place the microfluidic chip on a clean work surface, and use a pipette to take 1 μL of a mixture of upper and lower primers and probes for a virus (such as 0.3 μL of upstream primer (10 μmol / L), 0.3 μL of downstream primer (10 μmol / L) and 0.2 μL of probe (10 μmol / L) for forest encephalitis virus, and 0.2 μL of TE solution) and apply it to different chambers; at the same time, an amplification positive control (PC) is set up, and its chamber contains 0.35 μL of upstream primer (10 μmol / L), 0.35 μL of downstream primer (10 μmol / L) and 10 μmol / L of probe for amplification control 0.2μL and 0.1μL of genomic DNA template of the positive template Bacillus atrophaeus for amplification control; negative control and blank control are also provided, 1μL of nuclease-free water is added to the negative control chamber; no reagent is added to the blank control chamber and it is naturally dried. The corresponding detection purposes and amplification positive controls (PC) in Table 1 are arranged and marked in the chip to distinguish the detection purposes accordingly.

[0075] S3, a hot press coats the chip to form a closed microfluidic chip;

[0076] S4. Use a vacuum device to evacuate the microfluidic chip and package it, then store it away from light for future use.

[0077] The operation of using the microfluidic chip prepared above for detecting Clostridium botulinum toxin is as follows:

[0078] (1) Sample processing and sample template RNA extraction can be performed using Roche's viral RNA kit.

[0079] (2) Preparation of amplification system

[0080] ABI's AgPath-ID One-step RT-PCR was used, with a 25 μL reaction system per well: 12.5 μL 2×RT-PCR buffer; 1.0 μL 25×RT-PCR Enzyme Mix; 5.0 μL RNA template, 6.5 μL nuclease-free water. The amount was configured so that the amount in each chamber was 20-25 μL, and the reaction system was prepared (the reaction solution was prepared on ice), vortexed and mixed, and centrifuged briefly.

[0081] (3) Chip loading

[0082] Use a pipette to absorb the amplification system and inject the liquid into the microfluidic chip. After the liquid fills the microfluidic chip, pull out the pipette tip and seal the sample loading hole with sealant.

[0083] (4) PCR amplification

[0084] Place the microfluidic chip into a nucleic acid amplification analyzer (Tianjin Zhishan chip-type fluorescence quantitative PCR instrument), set the amplification program as reverse transcription step at 50°C, 10 min; denaturation step at 95°C, 3 min; amplification cycle step at 95°C, 10 sec; 60°C, 30 sec for a total of 40 cycles, and collect fluorescence signals at 60°C.

[0085] (5) Results analysis

[0086] After amplification, the software of the nucleic acid amplification analyzer performs data processing and compares the test wells with the blank control wells. If there is an obvious amplification curve on the nucleic acid amplification analyzer, it is judged as positive; if there is no obvious amplification curve, it is judged as negative.

[0087] Example 5 Detection of samples

[0088] In order to verify the accuracy of the detection, the microfluidic chip prepared according to Example 4 was used, and the collected positive samples were used. For some clinical positive samples that could not be collected, plasmid RNA was used to prepare simulated positive samples. According to the detection method of Example 4, the RNA template of the individual positive sample was first detected, and the detection result was a single corresponding positive sample, that is, the position of the detection target marked with the corresponding detection of forest encephalitis virus and Crimean-Congo hemorrhagic fever virus corresponded to the amplification curve, and the PC had an amplification curve, that is, the test result was positive.

[0089] In addition, after all positive samples (plasmid RNA of forest encephalitis virus and Crimean-Congo hemorrhagic fever virus) were mixed, the above method was used for detection. The test results showed that there was an amplification curve at the position corresponding to the detection of forest encephalitis virus, Crimean-Congo hemorrhagic fever virus, and PC, that is, the test result was positive. This shows that the test result is accurate, and the operation only needs to add the sample once to detect whether the same sample contains forest encephalitis virus and Crimean-Congo hemorrhagic fever virus. There is no need to repeat the operation, saving samples and testing costs.

[0090] The above is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any person skilled in the art can use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still belongs to the protection scope of the technical solution of the present invention.

Claims

1. A nucleic acid for detecting pathogens of natural epidemic diseases, characterized in that: It includes a primer pair and a probe for detecting forest encephalitis virus and / or Crimean-Congo hemorrhagic fever virus; wherein the nucleic acid sequence of the primer pair for forest encephalitis virus is shown as SEQ ID No.1 and SEQ ID No.2, and the nucleic acid sequence of the probe is shown as SEQ ID No.3; The nucleic acid sequences of the primer pair for Crimean-Congo hemorrhagic fever virus are shown in SEQ ID No.4 and SEQ ID No.5, and the nucleic acid sequence of the probe is shown in SEQ ID No.

6.

2. The nucleic acid according to claim 1, characterized in that The 5' end of each probe is labeled with a fluorescent group, and the 3' end is labeled with a quencher group.

3. A kit for detecting pathogens of natural epidemic diseases, characterized in that: The pathogens of natural epidemic diseases include forest encephalitis virus and Crimean-Congo hemorrhagic fever virus, which include the nucleic acid as described in claim 1 or 2, wherein the 5' end of each probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group and MGB, the fluorescent group is any one of FAM, CY5, Texred or JOE, and the quenching group is any one of BHQ1, BHQ3, BHQ2 or TAMRA.

4. The kit according to claim 3, characterized in that It also includes a primer pair and a probe for amplification control and a positive template for amplification control. The positive template for amplification control is genomic DNA of Bacillus atrophaeus. The nucleic acid sequence of the primer pair for amplification control is shown in SEQ ID No.7 and SEQ ID No.8, and the probe sequence is shown in SEQ ID No.

9. The 5' end of each probe is labeled with a FAM group, and the 3' end is labeled with NFQ-MGB.

5. The kit according to claim 3, characterized in that It also includes a positive control for forest encephalitis virus and a positive control for Crimean-Congo hemorrhagic fever virus, wherein the positive control for forest encephalitis virus contains the sequence shown in SEQ ID No.10, and the positive control for Crimean-Congo hemorrhagic fever virus contains the sequence shown in SEQ ID No.

11.

6. The kit according to claim 3, characterized in that Also includes 2×RT-PCR buffer and 25×RT-PCREnzyme Mix.

7. A microfluidic chip for simultaneous detection of forest encephalitis virus and Crimean-Congo hemorrhagic fever virus, characterized in that: The microfluidic chip includes a detection sheet body on which each chamber hole is coated with an upstream and downstream primer and probe for detecting forest encephalitis virus, and an upstream and downstream primer and probe for detecting Crimean-Congo hemorrhagic fever virus; wherein the sequence of the upstream primer of the forest encephalitis virus is shown in SEQ ID No.1, the sequence of the downstream primer is shown in SEQ ID No.2, and the sequence of the probe is shown in SEQ ID No.3; The sequence of the upstream primer of the Crimean-Congo hemorrhagic fever virus is shown in SEQ ID No.4, the sequence of the downstream primer is shown in SEQ ID No.5, and the sequence of the probe is shown in SEQ ID No.6; All probes were labeled with FAM at the 5' end and NFQ-MGB at the 3' end.

8. The microfluidic chip according to claim 7, characterized in that: It also includes chamber wells with upstream and downstream primers, probes and positive amplification products of amplification controls, chamber wells with nuclease-free water as negative controls, and blank control wells; the upstream primer sequence of the amplification control is shown in SEQ ID No.7, the downstream primer sequence is shown in SEQ ID No.8, and the probe sequence is shown in SEQ ID No.9; the template DNA of the positive amplification of the amplification control is Bacillus atrophaeus.

9. A method for simultaneously detecting forest encephalitis virus and Crimean-Congo hemorrhagic fever virus using a microfluidic chip, which uses the microfluidic chip of claim 7 or 8 for detection, comprising the following steps: S1. Extract RNA from samples; S2. Utilize the extracted RNA to configure the RT-PCR amplification system; S3, injecting the amplification system into the sample loading hole in the microfluidic chip, and after the liquid fills the microfluidic chip, sealing the sample loading hole with a sealant; S4, placing the microfluidic chip into a nucleic acid amplification analyzer, setting amplification reaction parameters for amplification; S5. After amplification is completed, the software of the nucleic acid amplification analyzer performs data processing and compares it with the blank control well. If the test well has an obvious amplification curve on the nucleic acid amplification analyzer, it is judged as positive; if there is no obvious amplification curve, it is judged as negative.

10. The method according to claim 9, characterized in that The amplification reaction parameters are as follows: the reverse transcription step is 50°C, 10 min; the pre-denaturation step is 95°C, 3 min; the amplification cycle steps are 95°C, 10 sec; 60°C, 30 sec for a total of 40 cycles, and the fluorescence signal is collected at 60°C.

Images