Carboxylesterase mutant and application thereof in preparation of (S)-3-cyclohexene-1-formic acid
By mutation of CarEst3 esterase amino acid site, a highly selective carboxylate esterase mutant was developed, which solved the poor substrate selectivity and raw material cost of biological preparation of (S)-3-cyclohexene-1-formic acid The high problem achieves an efficient and low-cost preparation process without by-product generation.
Patent Information
- Application Number
- CN202310704738.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-14
- Publication Date
- 2024-12-17
AI Technical Summary
The substrate selectivity of the existing biological methods for preparing (S)-3-cyclohexene-1-formic acid is poor, resulting in the problems of high raw material costs and low yields.
Developing a carboxylate esterase mutant, which improves the development of a carEst3 esterase by mutation of amino acid at position 253 to D253Y, or amino acid at position 329 to N329F, or combined with position 133 and 329 to V133A/N329F, etc. The hydrolytic selectivity of the enzyme can efficiently transform and separate methyl (S)-3-cyclohexene-1-formate in racemic 3-cyclohexene-1-formate.
The product yield is significantly improved, the raw material cost for preparing (S)-3-cyclohexene-1-formic acid is reduced, the process flow is simplified, the production efficiency is improved, and there is no other by-product generation, and the selectivity is greatly improved.
Smart Images
Figure CN119144580A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of enzyme genetic engineering, in particular to a carboxylesterase mutant and application thereof in the preparation of (S)-3-cyclohexene-1-carboxylic acid. Background Art
[0002] S-3-cyclohexene-1-carboxylic acid is an important starting material for the intermediate 3,4-diaminocyclohexanecarboxylic acid derivative of the coagulation factor Xa specific inhibitor drug edoxaban (trade name: Savaysa). Compared with the same type of coagulation factor Xa inhibitor drugs, such as apixaban and rivaroxaban, edoxaban has the advantages of shorter half-life, lower bleeding risk, and less renal toxicity. In addition, no conflicting drugs have been found for edoxaban so far, so it can be used in combination with other drugs. These advantages make edoxaban have broad research and development prospects.
[0003] The methods for preparing (S)-3-cyclohexene-1-carboxylic acid mainly include chemical method and biological method. The chemical method can effectively obtain S-3-cyclohexene-1-carboxylic acid by using a diastereoisomer splitting method, using chiral phenylethylamine as a chiral splitting agent to obtain the diastereoisomers formed by racemic 3-cyclohexene-1-carboxylic acid and phenylethylamine, and the single configuration isomer is separated based on the difference in solubility of the diastereoisomers in acetone. However, this method generally has the disadvantages of complex process routes and process flows, a relatively long production cycle, a low total yield, and being unfriendly to the environment, which makes the production cost of (S)-3-cyclohexene-1-carboxylic acid high. Regarding the biological method, existing studies have found that pig liver esterase PLE, horse liver esterase HLE and pig pancreatic lipase PPL have the activity of splitting racemic 3-cyclohexene-1-carboxylic acid methyl ester, but the price is extremely expensive and the substrate loading is very low. Although the bioenzymatic method disclosed in Patent No. CN112813131A avoids the above problems, due to the low selectivity of the enzyme, while hydrolyzing (R)-3-cyclohexene-1-methyl carboxylate, part of (S)-3-cyclohexene-1-methyl carboxylate is also decomposed, resulting in a large amount of waste of raw materials. As a result, this method has the disadvantages of high raw material cost and low yield. Summary of the invention
[0004] The present invention firstly aims to overcome the problems of poor substrate selectivity and high raw material cost in the prior art biological method for preparing (S)-3-cyclohexene-1-carboxylic acid, and provides a carboxylesterase mutant. The carboxylesterase mutant has high hydrolysis selectivity for (R)-3-cyclohexene-1-carboxylic acid methyl ester and can efficiently convert and separate (S)-3-cyclohexene-1-carboxylic acid methyl ester from racemic 3-cyclohexene-1-carboxylic acid methyl ester during the preparation process of (S)-3-cyclohexene-1-carboxylic acid.
[0005] In order to achieve the above object, the present invention adopts the following technical solutions: A carboxylesterase mutant, which is obtained by subjecting a CarEst3 esterase having an amino acid sequence as shown in SEQ ID NO: 1 to a mutation at position 253 to obtain D253Y, or a mutation at position 329 to obtain N329F, or a combined mutation at positions 133 and 329 to obtain V133A / N329F, or a combined mutation at positions 133 and 253 to obtain V133A / D253Y, or a combined mutation at positions 253 and 329 to obtain N329T / D253Y, N329V / D253Y, N329S / D253Y, N329Q / D253Y, N329M / D253Y, N329L / D253Y, or N329H / D253Y.
[0006] Compared with the wild-type CarEst3 esterase, the carboxylesterase mutant of the present invention has higher selectivity in the process of converting racemic 3-cyclohexene-1-carboxylic acid methyl ester to prepare (S)-3-cyclohexene-1-carboxylic acid, so the product yield is improved, the raw material cost of preparing (S)-3-cyclohexene-1-carboxylic acid can be reduced, and the production efficiency can be improved.
[0007] Preferably, the amino acid sequence of the carboxylesterase mutant D253Y is shown in SEQ ID NO: 2; The amino acid sequence of the carboxylesterase mutant N329F is shown in SEQ ID NO: 3; The amino acid sequence of the carboxylesterase mutant V133A / N329F is shown in SEQ ID NO: 4; The amino acid sequence of the carboxylesterase mutant V133A / D253Y is shown in SEQ ID NO:5; The amino acid sequences of the carboxylesterase mutants N329T / D253Y, N329V / D253Y, N329S / D253Y, N329Q / D253Y, N329M / D253Y, N329L / D253Y and N329H / D253Y are shown in SEQ ID NOs: 6-12, respectively.
[0008] A gene encoding the above-mentioned carboxylesterase mutant, wherein the nucleotide sequence of the gene encoding the carboxylesterase mutant D253Y is shown in SEQ ID NO: 13; The nucleotide sequence of the gene encoding the carboxylesterase mutant N329F is shown in SEQ ID NO: 14; The nucleotide sequence of the gene encoding the carboxylesterase mutant V133A / N329F is shown in SEQ ID NO: 15; The nucleotide sequence of the gene encoding the carboxylesterase mutant V133A / D253Y is shown in SEQ ID NO: 16; The nucleotide sequences of the genes encoding the carboxylesterase mutants N329T / D253Y, N329V / D253Y, N329S / D253Y, N329Q / D253Y, N329M / D253Y, N329L / D253Y and N329H / D253Y are shown in SEQ ID NOs: 17-23, respectively.
[0009] Preferably, the encoding gene of the carboxylesterase mutant is obtained by amplifying the encoding gene of CarEst3 esterase by using a specific primer pair, and the nucleotide sequence of the encoding gene of CarEst3 esterase is shown in SEQ ID NO: 24; The specific primer pairs are one or two of D253Y-F / R, N329F-F / R, V133A-F / R, N329T-F / R, N329V-F / R, N329S-F / R, N329Q-F / R, N329M-F / R, N329L-F / R and N329H-F / R; The nucleotide sequence of D253Y-F is GGTTCTGACCGGTGCGTATGTTGATTACGTTACC, The nucleotide sequence of D253Y-R is GGTAACGTAATCAACATACGCACCGGTCAGAACC; The nucleotide sequence of N329F-F is CCCACGGCTTCCTGTTCCTGACCCCGGTTA; The nucleotide sequence of N329F-R is TAACCGGGGTCAGGAACAGGAAGCCGTGGG; The nucleotide sequence of V133A-F is GGCGGCTTCGTTGCGGGCGGTATGGAT; The nucleotide sequence of V133A-R is ATCCATACCGCCCGCAACGAAGCCGCC; The nucleotide sequence of N329T-F is GACCCACGGCTTCCTGACCCTGACCCC; The nucleotide sequence of N329T-R is GGGGTCAGGGTCAGGAAGCCGTGGGTC; The nucleotide sequence of N329V-F is CCCACGGCTTCCTGGTCCTGACCCCGGTTA; The nucleotide sequence of N329V-R is TAACCGGGGTCAGGACCAGGAAGCCGTGGG; The nucleotide sequence of N329S-F is GACCCACGGCTTCCTGAGCCTGACCCC; The nucleotide sequence of N329S-R is GGGGTCAGGCTCAGGAAGCCGTGGGTC; The nucleotide sequence of N329Q-F is CCCACGGCTTCCTGTTCCTGACCCCGGTTA; The nucleotide sequence of N329Q-R is TAACCGGGGTCAGGAACAGGAAGCCGTGGG; The nucleotide sequence of N329M-F is CCACGGCTTCCTGATGCTGACCCCGGTTAG; The nucleotide sequence of N329M-R is CTAACCGGGGTCAGCATCAGGAAGCCGTGG; The nucleotide sequence of N329L-F is GACCCACGGCTTCCTGCTACTGACCCCGGTTAGCC; The nucleotide sequence of N329L-R is GGCTAACCGGGGTCAGTAGCAGGAAGCCGTGGGTC; The nucleotide sequence of N329H-F is CACGGCTTCCTGCACCTGACCCCGG; The nucleotide sequence of N329H-R is CCGGGGTCAGGTGCAGGAAGCCGTG.
[0010] A recombinant expression vector containing the above-mentioned coding gene, wherein the recombinant expression vector is a plasmid, phage or virus vector containing a mutant coding gene.
[0011] An engineered bacterium expressing the above-mentioned carboxylesterase mutant is obtained by transforming the above-mentioned recombinant expression vector into a host bacterium.
[0012] A method for preparing (S)-3-cyclohexene-1-carboxylic acid comprises: using 3-cyclohexene-1-carboxylic acid methyl ester as a substrate, reacting with the carboxylesterase mutant according to claim 1 or 2 and a solvent to obtain (S)-3-cyclohexene-1-carboxylic acid methyl ester; and hydrolyzing the (S)-3-cyclohexene-1-carboxylic acid methyl ester to obtain (S)-3-cyclohexene-1-carboxylic acid.
[0013] The substrate 3-cyclohexene-1-methyl formate is a mixture of (S)-3-cyclohexene-1-methyl formate and (R)-3-cyclohexene-1-methyl formate. The carboxylesterase mutant of the present invention can catalytically decompose (R)-3-cyclohexene-1-methyl formate to obtain (S)-3-cyclohexene-1-methyl formate with high purity. At the same time, the carboxylesterase mutant of the present invention has high selectivity for (R)-3-cyclohexene-1-methyl formate, and its decomposition effect on (S)-3-cyclohexene-1-methyl formate is much lower than that of (R)-3-cyclohexene-1-methyl formate. Therefore, the loss of (S)-3-cyclohexene-1-methyl formate is small during the reaction process, and the substrate utilization rate is high. The preparation steps of the (S)-3-cyclohexene-1-carboxylic acid are simple and the reaction conditions are mild.
[0014] Preferably, the carboxylesterase mutant is added in the form of wet cells after fermentation and culture of the above-mentioned engineered bacteria, or in the form of crude enzyme solution obtained by crushing the wet cells.
[0015] Preferably, the solvent is an aqueous solution containing Tris-HCl and ethanol, the concentration of Tris-HCl is 100 mM, and the volume percentage of ethanol is 5%.
[0016] Preferably, the amount of the carboxylesterase mutant added to the mixed solution is 30-40 g / L based on wet bacteria, and the amount of 3-cyclohexene-1-carboxylic acid methyl ester added is 25-35 g / L.
[0017] Therefore, the present invention has the following beneficial effects: (1) the carboxylesterase mutant obtained by the present invention can be used for the biological preparation of (S)-3-cyclohexene-1-carboxylic acid, and no other by-products are generated in the preparation process, and the selectivity is greatly improved; (2) the method for preparing (S)-3-cyclohexene-1-carboxylic acid has the advantages of simple operation and low cost, which greatly reduces the production cost and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 This is the liquid phase standard spectrum in Example 23.
[0019] Figure 2 This is the liquid phase spectrum of the product obtained in Example 23.
[0020] Figure 3 This is the liquid phase spectrum of the product obtained in Example 24. DETAILED DESCRIPTION
[0021] The present invention is further described below in conjunction with the accompanying drawings and specific implementation methods.
[0022] The detection conditions of high performance liquid chromatography (HPLC) in the following specific implementation method are as follows: the chiral column uses CHIRALPAK DAICEL IG (4.6*250mm, 5um), the column temperature is 5°C, the mobile phase is n-hexane:ethanol=98:2, the flow rate is 0.3mL / min, the reaction solution is adjusted to pH 3, and then five volumes of ethyl acetate are added for extraction, and then centrifuged to take the supernatant; the supernatant after extraction with ethyl acetate needs to be vacuum filtered until the ethyl acetate is completely volatilized, and then the mobile phase n-hexane:ethanol=98:2 is added to dissolve the sample and sent to liquid phase detection; the standard liquid phase spectrum of each component is as shown Figure 1 As shown, (R)-3-cyclohexene-1-carboxylic acid methyl ester peaks at 19 min, (S)-3-cyclohexene-1-carboxylic acid methyl ester peaks at 20 min, (R)-3-cyclohexene-1-carboxylic acid peaks at 36 min, and (S)-3-cyclohexene-1-carboxylic acid peaks at 38 min.
[0023] Embodiment 1-11 The steps for constructing the CarEst3 carboxylesterase mutant are as follows: (1) Construction of recombinant cloning vector: CarEst3 carboxylesterase was used as a template to prepare mutants. The gene nucleic acid sequence of CarEst3 carboxylesterase is shown in SEQ ID NO: 24, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 1. The strain pET28a-CarEst3 containing the gene encoding CarEst3 carboxylesterase was activated on an LB plate containing 1‰ Kan resistance, cultured at 37°C for 18h, and a single colony was picked in a 50mL LB conical flask also containing 1‰ Kan resistance, cultured at 37°C, 220rpm until OD600 was about 0.6, and the plasmid was extracted according to the instructions of the plasmid mini-extraction kit; (2) The extracted plasmid was used as a template, and a point mutation kit was used to complete the carboxylesterase mutant. The PCR primers, PCR system and conditions were shown in Table 2-4. After PCR, 1 μL of Dpn I was added to the PCR reaction solution, and the reaction was carried out at 37°C for 1 h to obtain a Dpn I digestion template reaction system; (3) All the mutant plasmids constructed above were transformed into E. coli BL21 competent cells, mixed and placed on ice for 30 min. After that, the E. coli BL21 competent cells were placed in a heat shock at 42°C for 90 s and then placed on ice for 5 min. Then 1 mL of LB medium without added resistance was added. After that, the E. coli BL21 competent cells were placed at 37°C for 1 h. After that, 200 μL of the cells were spread on LB medium containing 1‰ Kan and cultured in a 37°C constant temperature incubator until a single colony grew; (4) After a single colony grows, pick a single colony and culture it in an LB tube with the same resistance at 37°C and 220 rpm overnight. Then, aspirate 200 μL of the bacterial solution under aseptic operation conditions in a clean bench for sequencing. If the sequencing is successful, add an equal volume of glycerol solution (40% glycerol) to the remaining bacterial solution and store it in a -80°C refrigerator for later use.
[0024] Table 1. Primers for mutant construction.
[0025] Table 2. PCR system. Components Volume (μL) <![CDATA[ddH2O]]> 21 5×KODⅠ 25 template 1 F-Primer 1.5 R-Primer 1.5 Total volume 50
[0026] Table 4. PCR conditions.
[0027] Examples 12-22 Inducible expression of CarEst3 carboxylesterase mutants with amino acid sequences as shown in SEQ ID NO: 2-12: The engineered bacteria E. coli BL21 / pET28a-CarEst3 constructed in Example 1-11 were inoculated into LB liquid culture medium containing 50 μg / mL kanamycin, cultured overnight at 37°C, and the prepared bacteria were stored and stored. Then, 1% inoculum (v / v) was inoculated into 50 mL LB culture medium containing 50 μg / mL kanamycin, and cultured at 37°C, 200 rpm until the bacterial concentration OD600 reached about 0.6. IPTG was added at a final concentration of 0.1 mM, and after induction culture at 25°C for 16 h, the bacteria were collected by centrifugation at 4°C and 8000 rpm for 10 min and stored at -80°C for later use.
[0028] Comparative Example 1 The inducible expression of the wild-type CarEst3 carboxylesterase having an amino acid sequence as shown in SEQ ID NO: 1 is different from that of Examples 12-22 in that the strain pET28a-CarEst3 containing a gene encoding CarEst3 carboxylesterase is used.
[0029] Embodiment 23 The CarEst3 carboxylesterase mutant reduces racemic 3-cyclohexene-1-carboxylic acid methyl ester as follows: (1) 0.7 g of methyl 3-cyclohexene-1-carboxylate and 0.8 g of the wet cells obtained in Example 12 were added to 20 mL of water containing Tris-HCl buffer (100 mM, pH 8.0) and 5% ethanol, and the mixture was placed in a constant temperature shaker at 30° C. and 220 rpm for reaction for 1 h; (2) After the reaction is completed, the reaction solution is adjusted to pH 3 with hydrochloric acid, and 5 volumes of ethyl acetate are added for extraction, followed by centrifugation to obtain the supernatant; (3) The supernatant was vacuum evaporated at 37°C for 1 h, and then a mobile phase of n-hexane:ethanol = 98:2 was added to dissolve and filter, and the substrate reaction and product generation were determined by high performance liquid chromatography (HPLC) equipped with a UV detector. Figure 2 As shown, the product is (S)-3-cyclohexene-1-carboxylic acid methyl ester; (4) After replacing the wet bacteria in step (1) with the wet bacteria obtained in Examples 13-22, repeat steps (2) and (3).
[0030] Comparative Example 2 The wild type CarEst3 carboxylesterase reduces racemic 3-cyclohexene-1-methyl carboxylate, and the steps differ from those in Example 23 in that the wet bacteria obtained in Comparative Example 1 are used.
[0031] The conversion rate and E value of (S)-3-cyclohexene-1-carboxylic acid methyl ester were calculated by high performance liquid chromatography. The conversion rate results of (S)-3-cyclohexene-1-carboxylic acid methyl ester in Example 23 and Comparative Example 2 are shown in Table 5 below.
[0032] Table 5. Response data of wild type and its mutants.
[0033] As can be seen from the above table, the CarEst3 carboxylesterase mutant of the present invention can convert racemic 3-cyclohexene-1-carboxylic acid methyl ester to prepare (S)-3-cyclohexene-1-carboxylic acid, and compared with the wild-type CarEst3 carboxylesterase, the selectivity of the CarEst3 carboxylesterase mutant of the present invention is greatly improved.
[0034] For single mutants, the mutant produced by the wild-type CarEst3 carboxylesterase with the sequence shown in SEQ ID NO: 1 and the amino acid mutation at position D253Y has the best reaction selectivity. Compared with CarEst3 carboxylesterase, the selectivity of mutant D253Y for substrate is 300% of that of wild-type. No other by-products are generated, and the selectivity is greatly improved. Among them, D253Y has an E value of up to 10.39 under the reaction conditions of 30°C, pH 8.0, and substrate concentration of 35g / L.
[0035] For double mutants, such as the 253rd amino acid mutant D253Y and the 329th amino acid mutant N329F / D253Y, such as the 329th amino acid mutant N329F and the 133rd amino acid mutant V133A / N329F. Among them, the mutant produced by the wild-type CarEst3 carboxylesterase through the amino acid mutation of the N329F position and the amino acid combination mutation of the V133A position has the best reaction selectivity. Compared with CarEst3 carboxylesterase, the selectivity of the mutant V133A / N329F for the substrate is 600% of that of the wild type. No other by-products are generated, and the selectivity is greatly improved. Under the reaction conditions of 30°C, pH8.0, and substrate concentration of 35g / L, the E value of V133A / N329F is as high as 16.38.
[0036] Embodiment 24 CarEst3 carboxylesterase mutants produce (S)-3-cyclohexene-1-carboxylic acid: (1) The substrate 3-cyclohexene-1-carboxylic acid methyl ester, the wet bacteria obtained in Example 12 and the solvent were mixed to obtain a 1L reaction system, the solvent was the same as in Example 23, the substrate concentration in the reaction system was 280 g / L, the wet bacteria were added every half an hour during the reaction process, and the final amount of wet bacteria was 200 g / L. During the reaction process, an automatic pH controller was used to maintain the overall pH of the reaction system at 8.0. After the reaction started, samples were taken once every hour, and the samples were processed according to the processing steps described in Example 23 and the residual content of the substrate was detected using high performance liquid chromatography. When the ee value reached 99%, the subsequent steps were performed; (2) After the reaction, adjust the pH to 12 with 4 M NaOH, then extract with dichloromethane three times, combine the extracts, add anhydrous sodium sulfate and dry overnight; (3) After removing the solvent by rotary evaporation, 1.0 M NaOH aqueous solution was added, heated to reflux at 50° C. and stirred for reaction for 6 h, and then 1.0 M HCl aqueous solution was added to adjust the pH to 5.0, and an equal volume of dichloromethane was added for extraction three times. The organic layers were combined, dried over anhydrous Na2SO4, filtered, and rotary evaporated to obtain a liquid with a special odor. The obtained product was analyzed by high performance liquid chromatography (HPLC), as shown in FIG. Figure 2 As shown, the obtained product is (S)-3-cyclohexene-1-carboxylic acid and the purity of the product is high.
Claims
1. A carboxylesterase mutant, characterized in that: The CarEst3 esterase with the amino acid sequence shown in SEQ ID NO: 1 is subjected to a mutation at the 253rd amino acid to obtain D253Y, or a mutation at the 329th amino acid to obtain N329F, or a combined mutation at the 133rd and 329th amino acids to obtain V133A / N329F, or a combined mutation at the 133rd and 253 amino acids to obtain V133A / D253Y, or a combined mutation at the 253rd and 329 amino acids to obtain N329T / D253Y, N329V / D253Y, N329S / D253Y, N329Q / D253Y, N329M / D253Y, N329L / D253Y, or N329H / D253Y.
2. A carboxylesterase mutant according to claim 1, characterized in that: The amino acid sequence of the carboxylesterase mutant D253Y is shown in SEQ ID NO: 2; The amino acid sequence of the carboxylesterase mutant N329F is shown in SEQ ID NO: 3; The amino acid sequence of the carboxylesterase mutant V133A / N329F is shown in SEQ ID NO: 4; The amino acid sequence of the carboxylesterase mutant V133A / D253Y is shown in SEQ ID NO:5; The amino acid sequences of the carboxylesterase mutants N329T / D253Y, N329V / D253Y, N329S / D253Y, N329Q / D253Y, N329M / D253Y, N329L / D253Y and N329H / D253Y are shown in SEQ ID NOs: 6-12, respectively.
3. A gene encoding a carboxylesterase mutant according to claim 1 or 2, characterized in that: The nucleotide sequence of the gene encoding the carboxylesterase mutant D253Y is shown in SEQ ID NO: 13; The nucleotide sequence of the gene encoding the carboxylesterase mutant N329F is shown in SEQ ID NO: 14; The nucleotide sequence of the gene encoding the carboxylesterase mutant V133A / N329F is shown in SEQ ID NO: 15; The nucleotide sequence of the gene encoding the carboxylesterase mutant V133A / D253Y is shown in SEQ ID NO: 16; The nucleotide sequences of the genes encoding the carboxylesterase mutants N329T / D253Y, N329V / D253Y, N329S / D253Y, N329Q / D253Y, N329M / D253Y, N329L / D253Y and N329H / D253Y are shown in SEQ ID NOs: 17-23, respectively.
4. The gene encoding the carboxylesterase mutant according to claim 3, characterized in that: The encoding gene of the carboxylesterase mutant is obtained by amplifying the encoding gene of CarEst3 esterase by using a specific primer pair, and the nucleotide sequence of the encoding gene of CarEst3 esterase is shown in SEQ ID NO: 24; The specific primer pairs are one or two of D253Y-F / R, N329F-F / R, V133A-F / R, N329T-F / R, N329V-F / R, N329S-F / R, N329Q-F / R, N329M-F / R, N329L-F / R and N329H-F / R; The nucleotide sequence of D253Y-F is GGTTCTGACCGGTGCGTATGTTGATTACGTTACC, The nucleotide sequence of D253Y-R is GGTAACGTAATCAACATACGCACCGGTCAGAACC; The nucleotide sequence of N329F-F is CCCACGGCTTCCTGTTCCTGACCCCGGTTA; The nucleotide sequence of N329F-R is TAACCGGGGTCAGGAACAGGAAGCCGTGGG; The nucleotide sequence of V133A-F is GGCGGCTTCGTTGCGGGCGGTATGGAT; The nucleotide sequence of V133A-R is ATCCATACCGCCCGCAACGAAGCCGCC; The nucleotide sequence of N329T-F is GACCCACGGCTTCCTGACCCTGACCCC; The nucleotide sequence of N329T-R is GGGGTCAGGGTCAGGAAGCCGTGGGTC; The nucleotide sequence of N329V-F is CCCACGGCTTCCTGGTCCTGACCCCGGTTA; The nucleotide sequence of N329V-R is TAACCGGGGTCAGGACCAGGAAGCCGTGGG; The nucleotide sequence of N329S-F is GACCCACGGCTTCCTGAGCCTGACCCC; The nucleotide sequence of N329S-R is GGGGTCAGGCTCAGGAAGCCGTGGGTC; The nucleotide sequence of N329Q-F is CCCACGGCTTCCTGTTCCTGACCCCGGTTA; The nucleotide sequence of N329Q-R is TAACCGGGGTCAGGAACAGGAAGCCGTGGG; The nucleotide sequence of N329M-F is CCACGGCTTCCTGATGCTGACCCCGGTTAG; The nucleotide sequence of N329M-R is CTAACCGGGGTCAGCATCAGGAAGCCGTGG; The nucleotide sequence of N329L-F is GACCCACGGCTTCCTGCTACTGACCCCGGTTAGCC; The nucleotide sequence of N329L-R is GGCTAACCGGGGTCAGTAGCAGGAAGCCGTGGGTC; The nucleotide sequence of N329H-F is CACGGCTTCCTGCACCTGACCCCGG; The nucleotide sequence of N329H-R is CCGGGGTCAGGTGCAGGAAGCCGTG.
5. A recombinant expression vector containing the coding gene according to claim 3 or 4, characterized in that: The recombinant expression vector is a plasmid, phage or virus vector containing a mutant encoding gene.
6. An engineered bacterium expressing the carboxylesterase mutant according to claim 1, characterized in that: The engineered bacteria are obtained by transforming the recombinant expression vector as described in claim 5 into host bacteria.
7. A method for preparing (S)-3-cyclohexene-1-carboxylic acid, characterized in that: 3-cyclohexene-1-carboxylic acid methyl ester is used as a substrate, and the carboxylesterase mutant according to claim 1 or 2 and a solvent are mixed to react to obtain (S)-3-cyclohexene-1-carboxylic acid methyl ester, and (S)-3-cyclohexene-1-carboxylic acid methyl ester is hydrolyzed to obtain (S)-3-cyclohexene-1-carboxylic acid.
8. A method for preparing (S)-3-cyclohexene-1-carboxylic acid according to claim 7, characterized in that: The carboxylesterase mutant is added in the form of wet bacteria after fermentation and culture of the engineered bacteria as claimed in claim 5, or in the form of crude enzyme liquid obtained by crushing the wet bacteria.
9. A method for preparing (S)-3-cyclohexene-1-carboxylic acid according to claim 7 or 8, characterized in that: The solvent is an aqueous solution containing Tris-HCl and ethanol, the concentration of Tris-HCl is 100 mM, and the volume percentage of ethanol is 5%.
10. The method for preparing (S)-3-cyclohexene-1-carboxylic acid according to claim 8, characterized in that: The amount of the carboxylesterase mutant added to the mixed solution is 30-40 g / L based on the wet bacteria, and the amount of 3-cyclohexene-1-carboxylic acid methyl ester added is 25-35 g / L.