Construction method and application of Car4 gene tracer animal model based on CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats / CRISPR / Cas9)

Abstract

The invention belongs to the technical field of biology, and particularly relates to a construction method and application of a Car4 gene tracing animal model based on CRISPR / Cas9. According to the invention, an EGFP-CreERT2 gene knock-in mouse controlled by a Car4 gene is constructed in a gene insertion manner. While expressing the CA4 protein, the mouse also expresses fusion protein of EGFP (Enhanced Green Fluorescent Protein), a ligand binding region mutant (ERT) of an estrogen receptor and Cre recombinase. When the gene is knocked into a mouse, the EGFP can well play a role in tracing the CA4 protein; the insertion of the EGFP and CreERT2 genes does not have obvious influence on the expression and function of CA4 in cardiac muscle tissues; when the gene is inserted into a mouse to realize CA4 protein tracing, a reliable Cre tool mouse is provided for realizing conditional knockout of a target gene in capillary endothelial cells in heart tissues.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a method for constructing a CRISPR / Cas9-based Car4 gene tracing animal model and an application thereof. Background Art

[0002] The information disclosed in the background of the invention is only intended to enhance the understanding of the overall background of the invention and should not be necessarily regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Carbonic anhydrase (CAs) is a zinc-containing metalloenzyme whose main function is to reversibly catalyze the hydration of carbon dioxide. Fifteen isoenzymes have been found in the human body, with different structures, properties and tissue distribution. CAs play an important role in regulating various physiological processes such as cell pH, carbon dioxide transport, electrolyte balance and cell homeostasis, and are essential for cell survival and proliferation. At present, many CAs have become potential targets for drug development, and CAs inhibitors have also been used to treat diseases such as hypertension, glaucoma, edema, obesity and epilepsy.

[0004] Carbonic anhydrase IV (CA4) is an isoenzyme of the carbonic anhydrase family that can efficiently catalyze the hydration of CO2 and HCO3 -dehydration reaction. Researchers have successively found the expression of CA4 in tissues such as the brain, heart, lung, kidney and muscle. However, the structure and expression regulation of CA4 are not the same in different tissues. Although CA4 from the lung and kidney have the same N-terminal amino acid sequence, CA4 from different sources can be degraded to varying degrees at the C-terminus, or modified to varying degrees by amidation or deamination. In a mouse model with thyroid hormone receptor α1 (TRα1) mutation, CA4 expression in the lung and brain was significantly reduced, while the expression of CA4 in the kidney was not affected by changes in TRα1 signal transduction. However, the expression of CA4 in the kidney is strongly inhibited by thyroid hormone. In kidney tissue, CA4 is mainly present on the luminal surface of epithelial cells in the proximal tubules and the thick ascending limb of the loop of Henle. Regardless of respiratory or metabolic acidosis, the expression and activity of CA4 in the proximal tubules will increase significantly, and acidify urine by promoting H+ secretion, accelerating the excretion of acidic metabolites and the reabsorption of HCO3-. However, when CA4 expression was inhibited, the pH value in urine was not affected. Therefore, when CA4 is inhibited in kidney tissue, other CAs may play a compensatory role. In lung tissue, CA4 is localized to the luminal side of the alveolar capillary endothelium, but is absent from the endothelium of larger pulmonary vessels. A biological analysis of lung adenocarcinoma and lung squamous cell carcinoma datasets downloaded from the Cancer Genome Atlas database showed that CA4 expression in tumor tissue was lower than that in normal tissue. In skeletal muscle, CA4 has been found to be localized on the plasma membrane and sarcoplasmic reticulum. Knocking out the CA4 gene alone did not have a significant effect on muscle function, but CA4 and CA14 double knockout mice showed reduced muscle function.

[0005] Studies have confirmed that CA4 is the main type of CA responsible for regulating brain interstitial pH. In addition, with the participation of GP70, CA4 can also enhance the transport activity of monocarboxylate transporter 2 in a non-catalytic manner and accelerate the absorption of lactate by neurons. However, researchers have different opinions on the cell types in which CA4 is expressed in brain tissue. Svichar et al. found that CA4 and CA14 in hippocampal neurons can play a role in regulating intracellular pH through Cl(-)-HCO3(-) exchange mediated by anion exchange protein 3. Svichar et al. confirmed that CA4 expressed on the surface of astrocytes can catalyze the buffering of brain extracellular fluid. Ghandour et al. found that CA4 is only expressed on the luminal surface of brain capillary endothelial cells. This result not only suggests that CA4 plays a role in CO2 and HCO3 in the brain. -In addition to playing a role in homeostasis, it also suggests the possibility of CA4 as a cell biomarker related to the blood-brain barrier. Coincidentally, although some studies have found that the mRNA level of CA4 in the myocardial tissue of patients with heart failure with myocardial hypertrophy is increased. The specific expression location of CA4 in cardiac tissue is still controversial. Scheibe et al. detected the expression of CA4 in the cardiomyocytes of adult mice using immunohistochemistry. Sender et al. used immunohistochemistry, immunoelectron microscopy and in situ hybridization techniques to confirm that CA4 is expressed in both endothelial cells and cardiomyocytes in rat and human heart tissues. Knüppel-Ruppert et al. used Western blot technology to confirm that in human heart tissue, CA4 is only expressed in endothelial cells, while another type of CA is expressed in cardiomyocytes. The reason for the expression of CA4 in the above tissues is whether it is the differential expression of CA4 in animals at different stages, or the lack of specificity of antibodies or probes? Therefore, the construction of a CA4 tracing animal model not only helps to clarify the spatiotemporal expression of CA4, but also helps to screen CA4-positive cells and study their functions. Summary of the invention

[0006] In view of the deficiencies of the above-mentioned prior art, the purpose of the present invention is to provide a method for constructing a CRISPR / Cas9-based Car4 gene tracing animal model and its application. Specifically, the present invention successfully constructs a CA4 tracing mouse by inserting a tracing gene through CRISPR / Cas9 technology. Based on the above research results, the present invention is completed.

[0007] Specifically, the technical solution of the present invention is as follows:

[0008] The first aspect of the present invention provides a method for constructing a CRISPR / Cas9-based Car4 gene tracing animal model, the construction method comprising:

[0009] Cas9 was used to perform site-directed cutting of the Car4 gene, and then the homology directed repair (HDR) method was used to integrate the exogenous genes encoding fluorescent protein and CreERT2 into the Car4 gene to obtain F0 generation chimeric mice, which were then hybridized with wild-type mice to obtain stable F1 generation mice, and the F1 generation mice were self-pollinated to obtain homozygous transgenic F2 generation mice.

[0010] Wherein, the fluorescent protein may be GFP, EGFP and tdTomato; among them, EGFP is preferred.

[0011] More specifically, the construction method includes:

[0012] A mixture of Cas9 mRNA, gRNA and donor DNA recombinant plasmid is introduced into the fertilized egg of a mouse to generate F0 generation chimeric mice; wherein the donor DNA recombinant plasmid contains at least the coding gene sequence of P2A-EGFP-T2A-CreERT2; in the present invention, eGFP and CreERT2 genes are knocked in front of the Car4 gene termination factor TAA to generate EGFP-CreERT2 gene knock-in mice controlled by the Car4 gene, the self-cleaving polypeptide P2A is selected to connect Car4 and EGFP, and T2A is used to connect EGFP and CreERT2. The cleavage efficiency of 2A peptide is high, and the use of 2A peptide as a connecting element can achieve equal expression of multiple proteins.

[0013] Furthermore, the WPRE element for enhancing gene expression and the polyA sequence that plays an important role in mRNA stability, translation efficiency, cell localization, diversity, and cell cycle regulation are added after CreERT2.

[0014] The target sequence of exon 8 of the Car4 gene is shown in SEQ ID NO.1, and the sequence of the gRNA is shown in SEQ ID NO.2-3. Thus, the above-mentioned exogenous gene can be inserted in front of the stop codon of the Car4 gene, located in the enhancer region of the gene. Further, a sequence of about 1.5 kb on the left side of gRNA1 (sequence as shown in SEQ ID NO.2) is selected to prepare a 5' homology arm, and a sequence of about 1.5 kb on the right side of gRNA2 (sequence as shown in SEQ ID NO.3) is selected to prepare a 3' homology arm.

[0015] The mice are C57BL / 6J mice.

[0016] Furthermore, the genes of F0 and F1 generation mice were identified, and mice with the correct sequence were selected for subsequent breeding.

[0017] Among them, the method for genetic identification of F0 generation mice includes: designing primers at the upstream and downstream of the 5' homologous arm and the 3' homologous arm, respectively, and using the PCR method to identify the genes of the F0 generation mice after gene recombination; 3' homologous arm identification: a 4.9kb fragment should be amplified in the homologous recombinant DNA, and an 8.8kb fragment can be amplified in the negative DNA; 5' homologous arm identification: a 4.3kb fragment should be amplified in the homologous recombinant DNA, and no fragment can be amplified in the negative DNA.

[0018] The method for genetic identification of F1 generation mice is the same as that of F0 generation, that is, primers are designed upstream and downstream of the 5' homologous arm and the 3' homologous arm, respectively, and the genes of the F1 generation mice after gene recombination are identified by PCR; 3' homologous arm identification: a 4.9kb fragment should be amplified in the homologous recombinant DNA, and an 8.8kb fragment can be amplified in the negative DNA; 5' homologous arm identification: a 4.3kb fragment should be amplified in the homologous recombinant DNA, and no fragment can be amplified in the negative DNA.

[0019] Furthermore, the screening method for homozygous transgenic F2 mice is as follows: primers are designed upstream and downstream of the eighth exon of the Car4 gene, and the Car4 gene and Car4+EGFP gene are used as templates respectively. The genotype of the F2 mice is identified by PCR amplification method. The mice whose DNA can only amplify a DNA fragment with a length of 385bp (P1P2=385bp) are wild-type mice, the mice whose DNA can simultaneously amplify two fragments with a length of 385bp (P1P2=385bp) and 484bp (P1P4=484bp) are Car4+ / - heterozygous mice; the mice whose DNA can only amplify a fragment with a length of 484bp (P1P4=484bp) are Car4- / - homozygous mice.

[0020] The second aspect of the present invention provides the application of the above construction method in any one or more of the following:

[0021] (a) CA4 protein expression profile study;

[0022] (b) Screening of CA4-positive cells in organs / tissues;

[0023] (c) Achieve conditional knockout of target genes in capillary endothelial cells within tissues.

[0024] Wherein, in (c), the tissue may be lung tissue, brain tissue and myocardial tissue.

[0025] More specifically, the application (c) is as follows: the present invention constructs a Car4 gene tracing animal mouse model and conditionally knocks out the target gene in the capillary endothelial cells in the above tissue by hybridizing with Flox mice.

[0026] Beneficial technical effects of one or more of the above technical solutions:

[0027] The above technical scheme constructs the EGFP-CreERT2 knock-in mouse controlled by the Car4 gene by gene insertion. While expressing CA4 protein, the mouse also expresses EGFP and the fusion protein of the ligand binding region mutant (ERT) of the estrogen receptor and the Cre recombinase. Under a fluorescence microscope, EGFP signals were detected in the brain, lungs, kidneys and skeletal muscles of Car4-EGFP-CreERT2 mice. Immunohistochemistry results showed that CA4 protein in mouse myocardial tissue was only expressed in the intermyocardial capillaries. Consistent with this result, obvious EGFP fluorescence signals were also detected in the intermyocardium of Car4-EGFP-CreERT2 mice. Western blot results showed that compared with wild-type mice, the expression of CA4 protein in the myocardial tissue of Car4-EGFP-CreERT2 / + and Car4-EGFP-CreERT2 mice did not change significantly. The results of flow cytometry showed that compared with Car4-EGFP-CreERT2 / + mice, there was no significant change in the proportion of endothelial cells and CA4+ endothelial cells in the myocardial tissue of Car4-EGFP-CreERT2 mice. In the above gene knock-in mice, EGFP can play a good role in CA4 protein tracing; EGFP and CreERT2 gene insertion did not have a significant effect on CA4 expression and function in myocardial tissue; while the above gene insertion mice achieve CA4 protein tracing, they also provide a reliable Cre tool mouse for conditional knockout of target genes in capillary endothelial cells in cardiac tissue, so they have good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0029] Figure 1 : Technical roadmap of the present invention.

[0030] Figure 2 : Car4 transcript and gene structure in the embodiments of the present invention.

[0031] Figure 3 : Schematic diagram of gene recombination in an embodiment of the present invention.

[0032] Figure 4 : Schematic diagram of the Car4-P2A-EGFP-T2A-CreERT2 sequence in an embodiment of the present invention.

[0033] Figure 5 : Car4-P2A-EGFP-Donor Vector plasmid in the embodiment of the present invention.

[0034] Figure 6 : Car4-P2A-EGFP-T2A-CreERT2-Donor Vector plasmid in the embodiment of the present invention.

[0035] Figure 7 : Principle of gene identification of F0 and F1 generation mice in the embodiment of the present invention. A, PCR detection result of 3' arm; B, PCR detection result of 5' arm.

[0036] Figure 8 : Gene identification results of F0 generation mice in the present invention. A, PCR detection results of 3' arm; B, PCR detection results of 5' arm.

[0037] Fig. 9 : The genotype identification results of F1 generation mice in the embodiment of the present invention.

[0038] Fig.10 : Principle of genotype identification of F2 generation mice in the embodiment of the present invention.

[0039] Fig.11 : The genotype identification results of F2 generation mice in the embodiment of the present invention.

[0040] Fig.12 : Expression of CA4 in the brain, lung, kidney and skeletal muscle of Car4-EGFP-CreERT2 mice in the examples of the present invention.

[0041] Fig.13 : Detection of CA4 expression in myocardial tissue of Car4-EGFP-CreERT2 mice in the present invention. A, Immunofluorescence staining shows the expression of CA4 in myocardial tissue of C57BL / 6J mice; B, Western blot detection shows the expression of CA4 in myocardial tissue of mice with different genotypes; C, EGFP fluorescence signal of myocardial tissue of Car4-EGFP-CreERT2 mice observed under a fluorescence microscope.

[0042] Fig.14 :Detection of endothelial cells and CA4 positive cells in myocardial tissue in the embodiments of the present invention. A, flow cytometric detection results of cells in myocardial tissue of mice with different genotypes; B, the proportion of CD31(+) cells i) and EGFP(+)CD31(+) cells ii) in CD31(+) cells in myocardial tissue of Car4-EGFP-CreERT2 / + and Car4-EGFP-CreERT2 mice. DETAILED DESCRIPTION

[0043] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0044] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0045] The present invention is now further described in conjunction with specific examples. Unless otherwise specified, the experimental methods and reagents in the following embodiments are conventional methods and commercially available reagents in the art and can be obtained from commercial channels.

[0046] Example

[0047] 1. Selection of insertion site

[0048] (1) Gene name: Ensembl Number: Car4 (ENSMUSG00000000805)

[0049] (2) There are 6 transcripts in the Car4 gene locus. This study was based on the analysis of the Car4-201 transcript: there are 8 exons in the transcript structure, and protein translation starts at exon 1 and ends at exon 8.

[0050] Car4 gene URL link:

[0051] http: / / www.ensembl.org / Mus_musculus / Transcript / Exons?db=core;g=ENSMUSG00000000805;t=ENSMUST00000103194.10

[0052] (3) Knock-in sequence: P2A-EGFP-T2A-CreERT2-WPRE-pA; Insertion site: before the Car4 gene termination factor TAA.

[0053] 2. Obtaining Cas9 mRNA

[0054] Cas9 mRNA was purchased from GenScript Biotech Co., Ltd.

[0055] 3. gRNA design and chemical synthesis

[0056] For Car4 gene Exon8, crispor.tefor.net was used to design the guideRNA sequence (Table 1).

[0057] Table 1. Designed sequences of gRNA

[0058]

[0059] 4. Obtaining the target fragment and constructing the plasmid

[0060] The target fragment Car4-P2A-EGFP-T2A-CreERT2 was connected to the pBR322 plasmid by PCR and Infusion methods to construct a new recombinant plasmid.

[0061] (1) Preparation of 5' and 3' homology arms

[0062] According to the previous scheme, the guideRNA sequence was designed for Exon8 of the Car4 gene using crispor.tefor.net (Table 1). The sequence of about 1.5 kb on the left side of gRNA1 was selected to make the 5' homology arm, and the sequence of about 1.5 kb on the right side of gRNA2 was selected to make the 3' homology arm. Then, primers were designed using primer-blast on NCBI and PCR amplification was performed to ensure that the PCR product covered the 5' arm and 3' arm.

[0063] (2) Obtaining the target fragment

[0064] The Car4-F1 and Car4-R1 primers were paired and the fragment containing 5arm+3arm was used as a template for PCR amplification to obtain the target fragment Car4-5arm; the Car4-F2 and Car4-XR2 primers were paired and the plasmid containing the P2A-CreERT2-T2A-EGFP-WPRE-pA element was used as a template for PCR amplification to obtain the target fragment P2A-EGFP.

[0065] After the construction of Car4-P2A-EGFP-Donor Vector plasmid was completed, Car4-F1 and Car4-R2 primers were paired, and the plasmid containing the 5arm-P2A-EGFP original was used as a template for PCR amplification to obtain the target fragment 5arm-P2A-EGFP; Car4-F3 and Car4-R4 primers were paired, and the plasmid containing the P2A-CreERT2-T2A-EGFP-WPRE-pA element was used as a template for PCR amplification to obtain the target fragment T2A-CreERT2; Car4-F4 and Car4-R4 primers were paired, and the fragment containing 5arm+3arm was used as a template for PCR amplification to obtain the target fragment Car4-3arm. The primer sequences used are shown in Table 2.

[0066] Table 2. Primers required to obtain target fragments

[0067]

[0068] Reaction system:

[0069]

[0070]

[0071] *PrimeStar Max Premix(2X)(TaKaRa, Cat#R045)

[0072] Reaction conditions:

[0073] step# Temperature(℃) time Number of reactions 1 98 3min - 2 98 10sec - 3 52-68 15sec - 4 72 30sec Repeat steps 2-4 for 35 cycles 5 72 1min - 6 12 - stop

[0074] (3) Vector construction

[0075] DNA Recombination Method Reference HD Cloning Kit Instructions (639649, Clontech, USA). The universal vector NRosa26-CAG plasmid was cut by BbvcI to produce sticky ends, and the target fragment P2A-EGFP-T2A-CreERT2-WPRE-pA was obtained by PCR amplification. The obtained target fragment and the vector after enzyme cutting were recombined by In-Fusion® HD Cloning Kit enzyme.

[0076] Car4-P2A-EGFP-Donor Vector Plasmid In-Fusion System Table

[0077]

[0078] Car4-P2A-EGFP-T2A-CreERT2-Donor Vector In-Fusion System Table

[0079]

[0080]

[0081] After mixing the above system, place it in a PCR instrument and react at 50°C for 15 minutes. The product is directly used for transformation.

[0082] (4) DNA recovery and concentration determination:

[0083] After the recombinant DNA was subjected to agarose gel electrophoresis, the gel without the target DNA band was cut out, the sol was shaken at 56°C, and then centrifuged and collected through a recovery column with a collection tube. The recovery method was based on the QIAquick Gel Extract Gel Extraction Kit (28704, QIAGEN, Germany) and the concentration was measured.

[0084] (5) Identification of plasmid after transformation

[0085] Single clones were picked from the Car4-P2A-EGFP-Donor Vector plates grown overnight after transformation for PCR identification. Plaques with a band of about 3.8 kb amplified using Car4-F1 and Car4-XR2 were preliminarily determined to be correct plaques. These plaques were sent for sequencing and streaked for preservation.

[0086] After transformation, the Car4-P2A-EGFP-T2A-CreERT2-Donor Vector plate grown overnight was selected for single clone PCR identification. The plaque with a band of about 5.9kb amplified by Car4-F3 and Car4-R4 was initially determined to be the correct plaque, and the plaque was sent for sequencing. The recombinant plasmid with completely correct sequencing can be used for the next experiment.

[0087] (6) Plasmid purification

[0088] The clone with the correct sequencing was inoculated into 400 ml LB, and the plasmid was extracted using NucleoBond Xtra MidiPlus EF kit, dissolved in Nuclease-Free Water, and stored at -30°C.

[0089] 5. Obtaining and Identifying F0 Generation Mice

[0090] The in vitro transcribed cas9 mRNA, gRNA and donor DNA recombinant plasmids were co-microinjected into C57BL / 6J mouse fertilized eggs, and the fertilized eggs were transplanted into pseudo-pregnant C57BL / 6J mice. After about 20 days, F0 generation mice were obtained; the genes of the obtained F0 generation mice were identified by PCR and sequencing.

[0091] 6. Obtaining and identifying the genes of F1 mice

[0092] Since the early cleavage rate of fertilized eggs is very fast, the obtained F0 generation mice are chimeras and may not have stable inheritance ability. Stable and heritable F1 generation mice must be obtained through positive F0 generation mice. Therefore, we breed the identified F0 generation mice with wild-type C57BL / 6J mice to obtain positive F1 generation heterozygous mice. The genotype of the obtained F1 generation mice was identified by PCR and sequencing.

[0093] 6.1 Identification of 5' homology arms

[0094] (1) Identify the primer sequence of the 5' homology arm:

[0095] Primers Sequence 5'-->3' Primer Type I AAGGCTCACATTCTTCCTTTCTTTG Forward II TTTTGGTGTACGGTCAGTAAATTGG Reverse

[0096] (2) Reaction system for identifying 5' homology arms:

[0097] Reaction system Reaction (μl) <![CDATA[ddH2O]]> 8.05 2xPCR Buffer 10 Primer I (20 pmol / μl) 0.3 Primer II (20 pmol / μl) 0.3 KOD-Multi&Epi-* 0.35 Genomic DNA 1 Total 20

[0098] *KOD-Multi&Epi-(TOYOBO, Code No: KME-101)

[0099] (3) PCR procedure for identifying the 5' homology arm:

[0100] step Temperature(℃) time Number of reactions 1 94 3 minutes - 2 98 20 seconds - 3 63 20 seconds - 4 68 4 minutes Repeat steps 2-4 for 35 cycles 5 68 5 minutes - 6 12 - stop

[0101] 6.2 Identification of 3' homology arms

[0102] (1) Identify the primer sequence of the 3' homology arm:

[0103] Primers Sequence 5'-->3' Primer Type III CTCAAGGCATTCTGATTGGAAAACT Forward IV TGCCTACCCTTTAACACCTTTTCTA Reverse

[0104] (2) Reaction system for identifying 3' homology arms:

[0105]

[0106]

[0107] *KOD-Multi&Epi-(TOYOBO, Code No: KME-101)

[0108] (3) PCR procedure for identifying the 3' homology arm:

[0109] step# Temperature(℃) time Number of reactions 1 94 3min - 2 98 20sec - 3 63 20sec - 4 68 4min Repeat steps 2-4 for 35 cycles 5 68 5min - 6 12 - hold

[0110] 7. Acquisition and identification of F2 generation mice

[0111] F2 mice were obtained by mutual hybridization of F1 mice, and the genotype of F2 mice was identified by PCR.

[0112] (1) Primer sequence

[0113] Primers Sequence 5'-->3' Primer Type P1 GCTGTCTGGTCTGAGGTCAC Forward P2 CACCACAGCCAGTTCCTCAT Reverse P4 CCGGTGGTGCAGATGAACTT Reverse

[0114] (2) Reaction system

[0115]

[0116]

[0117] (3) PCR procedure:

[0118]

[0119] 8. EGFP fluorescence signal detection

[0120] Fluorescence microscopy was used to observe and photograph the EGFP fluorescence signals in frozen sections of brain, lung, kidney, skeletal muscle and myocardial tissues of Car4-EGFP-CreERT2 mice, and the expression of CA4 protein in the above tissues was determined based on the EGFP signal distribution.

[0121] 9. Immunofluorescence Detection

[0122] Paraffin sections of C57BL / 6J mouse hearts were dewaxed, blocked, incubated with rabbit anti-mouse CA4 primary antibody (13931-AP, Wuhan Proteintech), Alexa488-labeled goat anti-rabbit secondary antibody and Dylight-594-labeled Lectin (DL-1177-1, Vector), and then sealed with DAPI mounting medium and observed and photographed under a fluorescence microscope.

[0123] Frozen sections of Car4-EGFP-CreERT2 mouse brain, lung, kidney, skeletal muscle and myocardial tissues were fixed and blocked, then incubated with rabbit anti-mouse CA4 primary antibody (13931-AP, Wuhan Proteintech), Alexa488-labeled goat anti-rabbit secondary antibody and Dylight-594-labeled Lectin (DL-1177-1, Vector), and then sealed with DAPI mounting medium and observed and photographed under a fluorescence microscope.

[0124] 10. Western blot detection:

[0125] The ventricular tissues of mice with different genotypes were lysed and the total proteins were extracted. The denatured proteins were subjected to SDS-PAGE gel electrophoresis, protein transfer, immunoblotting, and incubation with HRP-labeled anti-mouse CA4 antibody for qualitative detection to confirm the expression difference of CA4.

[0126] 11. HE staining

[0127] The frozen sections of the mouse brain, kidney, lung, skeletal muscle and myocardial tissues that completed the EGFP fluorescence observation were rinsed with running water, stained with hematoxylin-eosin (H&E), and then dehydrated and transparent. The transparent samples were sealed with neutral gum and observed and photographed under a microscope.

[0128] 12. Flow cytometry

[0129] Myocardial tissues of mice with different genotypes were treated with enzymes and filtered through a 70μm filter to form single-cell suspensions, which were then incubated with CD31-APC (APC-65058, Proteintech) antibodies and isotype control antibodies at room temperature for 20 minutes. After flow cytometry, the proportion of CD3(+) cells in total cells and the proportion of CD31(+)EGFP(+) cells in CD31(+) cells were calculated.

[0130] Research results

[0131] 1. This study generated F0 chimeric mice by microinjecting a mixture of Cas9mRNA, gRNA, and sequencing-verified donor vectors into fertilized eggs of C57BL / 6J mice. After PCR and sequencing identification, the F0 mice with correct sequencing were crossed with wild-type C57BL / 6J mice to produce stable F1 mice. After PCR and sequencing identification, the F1 mice with correct sequencing were self-fertilized to obtain F2 mice, and homozygous transgenic mice were obtained after identification ( Figure 1 ).

[0132] 2.Car4 transcript gene structure

[0133] There are 6 transcripts in the Car4 gene locus. This study is based on the information of the Car4-201 transcript: there are 8 exons in the transcript structure, and protein translation starts at exon 1 and ends at exon 8 ( Figure 2 ). This project intends to insert the target fragment before the stop codon of the Car4 gene, and the proposed insertion site is located in the enhancer region.

[0134] 3. Design of Gene Recombination Scheme

[0135] In this project, we knocked in eGFP and CreERT2 genes in front of the Car4 gene terminator TAA to produce EGFP-CreERT2 gene knock-in mice controlled by the Car4 gene. We selected the self-cleaving polypeptide P2A to connect Car4 and EGFP, used T2A to connect EGFP and CreERT2, and added the WPRE element to enhance gene expression and the polyA sequence that plays an important role in mRNA stability, translation efficiency, cell localization, diversity, and cell cycle regulation after CreERT2. The homology-directed repair (HDR) method is used to integrate the exogenous gene, thereby achieving the knock-in of the target gene at a specific site ( Figure 3 ).

[0136] 4. Synthesis of gRNA

[0137] According to the gRNA sequence: TAGCCAACTTCCTCCAGTAA, gRNA was generated by chemical synthesis. The full sequence after synthesis is as follows:

[0138] U*mA*mG*rCrCrArArCrUrUrCrCrUrCrArGrUrArArGrUrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArArGr UrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArCrUrUrGrArArArArGrUrGrGrCrArCrCrGrArGrUrC rGrGrUrGrCrU*mU*mU*mU

[0139] 5. Obtaining P2A-eGFP-T2A-CreERT2-WPRE-pA sequence and constructing recombinant plasmid

[0140] The Car4-P2A-EGFP-T2A-CreERT2 sequence, plasmid and recombinant plasmid obtained after PCR amplification ( Figure 4-6 ) sequences were confirmed by sequencing. Among them, the nucleotide sequence (14095bp) of the Car4-P2A-EGFP-T2A-CreERT2-Donor Vector plasmid is as follows:

[0141] TTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACG

[0142] TCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTTATTTTTCTAAATACATTCAAATATGTATC

[0143] CGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCC

[0144] GTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAA

[0145] AAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGA

[0146] GAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCG

[0147] TGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCA

[0148] GTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAA

[0149] CACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGG

[0150] GATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCA

[0151] CGATGCCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAA

[0152] CAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTT

[0153] TATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGC

[0154] CCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAG

[0155] ATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAAC

[0156] TTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTT

[0157] TTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAA

[0158] TCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCT

[0159] TTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCC

[0160] ACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGT

[0161] GGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAA

[0162] CGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGC

[0163] TATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAG

[0164] GAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTG

[0165] ACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTT

[0166] TTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACC

[0167] GTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGA

[0168] GGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCA

[0169] CTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCAT

[0170] GGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTAC

[0171] AGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGC

[0172] AGCTGCGGTAAAGCTCATCAGCGTGGTCGTGAAGCGATTCACAGATGTCTGCCTGTTCATCCGCGTCCAGCTCG

[0173] TTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTG

[0174] GTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGCT

[0175] CACGATACGGGTTACTGATGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGA

[0176] TGCGGCGGGACCAGAGAAAAATCACTCAGGGTCAATGCCAGCGCTTCGTTAATACAGATGTAGGTGTTCCACA

[0177] GGGTAGCCAGCAGCATCCTGCGATGCAGATCCGGAACATAATGGTGCAGGGCGCTGACTTCCGCGTTTCCAGA

[0178] CTTTACGAAACACGGAAACCGAAGACCATTCATGTTGTTGCTCAGGTCGCAGACGTTTTGCAGCAGCAGTCGC

[0179] TTCACGTTCGCTCGCGTATCGGTGATTCATTCTGCTAACCAGTAAGGCAACCCCGCCAGCCTAGCCGGGTCCTC

[0180] AACGACAGGAGCACGATCATGCGCACCCGTGGCCAGGACCCAACGCTGCCCGAGATGCGCCGCGTGCGGCTG

[0181] CTGGAGATGGCGGACGCGATGGATATGTTCTGCCAAGGGTTGGTTTGCGCATTCACAGTTCTCCGCAAGAATTG

[0182] ATTGGCTCCAATTCTTGGAGTGGTGAATCCGTTAGCGAGGTGCCGCCGGCTTCCATTCAGGTCGAGGTGGCCCG

[0183] GCTCCATGCACCGCGACGCAACGCGGGGAGGCAGACAAGGTATAGGGCGGCGCCTACAATCCATGCCAACCC

[0184] GTTCCATGTGCTCGCCGAGGCGGCATAAATCGCCGTGACGATCAGCGGTCCAGTGATCGAAGTTAGGCTGGTA

[0185] AGAGCCGCGAGCGATCCTTGAAGCTGTCCCTGATGGTCGTCATCTACCTGCCTGGACAGCATGGCCTGCAACG

[0186] CGGGCATCCCGATGCCGCCGGAAGCGAGAAGAATCATAATGGGGAAGGCCATCCAGCCTCGCGTCGCGAACGC

[0187] CAGCAAGACGTAGCCCAGCGCGTCGGCCGCCATGCCGGCGATAATGGCCTGCTTCTCGCCGAAACGTTTGGTG

[0188] GCGGGACCAGTGACGAAGGCTTGAGCGAGGGCGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGATCATC

[0189] GTCGCGCTCCAGCGAAAGCGGTCCTCGCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGTTGCA

[0190] TGATAAAGAAGACAGTCATAAGTGCGGCGACGATAGTCATGCCCCGCGCCCACCGGAAGGAGCTGACTGGGTT

[0191] GAAGGCTCTCAAGGGCATCGGTCGAGGAAACTCGGCCGTGGTGACCAATACAAAACAAAAGCGCTCCTCGTA

[0192] CCAGCGAAGAAGGGGCAGAGATGCCGTAGTCAGGTTTAGTTCGTCCGGCGGCGCCAGAAATCCGCGCGGTGG

[0193] TTTTTGGGGGTCGGGGGTGTTTGGCAGCCACAGACGCCCGGTGTTCGTGTCGCGCCAGTACATGCGGTCCATG

[0194] CCCAGGCCATCCAAAAACCATGGGTCTGTCTGCTCAGTCCAGTCGTGGACTGACCCCACGCAACGCCCAAAAT

[0195] AATAACCCCCACGAACCATAAACCATTCCCCATGGGGGACCCCGTCCCTAACCCACGGGGCCCGTGGCTATGGC

[0196] AGGGCCTGCCGCCCCGACGTTGGCTGCGAGCCCTGGGCCTTCACCCGAACTTGGGGGGTGGGGTGGGGAAAA

[0197] GGAAGAAACGCGGGCGTATTGGCCCCAATGGGGTCTCGGTGGGGTATCGACAGAGTGCCAGCCCTGGGACCG

[0198] AACCCCGCGTTTATGAACAAACGACCCAACACCCGTGCGTTTTATTCTGTCTTTTTATTGCCGTCATAGCGCGGG

[0199] TTCCTTCCGGTATTGTCTCCTTCCGTGTTCTGCTCGACTCTAGAGGATCggttacctcccacgggagcagcgttcagtgatgtgtgtgtgt

[0200] gtagaccatacggttatcccctgaagccttgtgacttagcagcctcacatgagacccccatgactctgggtctggcagatcttccattcctaccctctcttccccccccccccccatcca

[0201] gtcaaatgagagccacaggaagaagaccagcaagtgtgcaaaatgagagccacaatgggggaagtttattctcttaagaatcatctaaacatgcgggagagtatttttagcccatga

[0202] ctcctaccgggatgccaaacctaaacacagggaaggagaggtggccccttggggatagaagcagccactggaaatagggtgggaaaaggtacagcagaccccaccctgtccct

[0203] cagagtggcctatctgcctggatggttttgaatgaagagagttggctatggacgttgcagagtgaccctgggctgtggcccgagggtctgacaggtttcttgcctctgctgtattgcagct

[0204] tctttatccatgcaatggagaagaacctcactcgcaaaatggtagagcagcccatagtcagcacatagtaggctttcaataatgtgctttatagtctgtgctgagaaccttccagaaatg

[0205] ggccaatggacctcagaagagtctttgtgctttcccaggcttggcatctgcagggaagcacacatgtgcaagtgtgtgtgtgtgtgtgtgtgtgtgtgcatccaatgcaaccagct

[0206] aaggatgaataaagagaaaagtcaggatgggagggggcagacagactagacctcccttgtaataaagaacaattaattggtagcctattacccatggagagaactgcctta

[0207] tgaggcaggcagggctggtataaaagggcacttaggccaccttctccaggtggcggtcagcacagatccagtgagtttactctgaagaggaagctcttcagtgacacacactgacag

[0208] gaagaaatgtccctaaactctttgtgtggggccacagtcaagagagcaaactccccacctgtggaggccagccctgagtagctttgctaggagtgcctccaggacacacagagct

[0209] ggtctgaggcgtgcacaagcactacctgactctggcttccacttggtcattatgggaaacaaccctgtgccttccacctggggtggaaaagccagacctctctctggccacttgcag

[0210] agagctggaacttcctggtcagctgctacgttattctctgaagaccacatgaaggacaaggttacaggggagggaaatgggggtggggagtatgagggagagaaaggtgggaag

[0211] aggggggaagttgtccagtgcaggaacggctgtgctgacctcagagctcagactctggagaggaggcagctgagaacccctgcaggcctagtgggaactaaaggagaaggaat

[0212] gagcttggaccacacactgcacgccccaccccccaccccgctgttgccatggctacacaataccaacaccgccatcccagctgcatggtcattggtgaagctagaaggtacttatta

[0213] ttggtcacaaatagaaaagggtagttagaggagcggggaatggccatcttaccctaggctgattgggggagctggggtaatcaccccctccaactagtcacccccacagcaggatc

[0214] ttctaggcctcaagtgtcccagtgatttgtatcttcctctaggggacacgtacctcagctctagctagaaaagcctggctccagctctcctgtttgctcaaggcctgtgaccttatgggca

[0215] cttcttttgttgtggctcagaactccaacactgctatggatggtgaataccatctttccttctgtctacacacacacacacacacacacacagtctccctgctgttcctccactagagagac

[0216] atagtgggaggaggaagcctgattctcttcctgtcacaactcctgctgacctatgagcagatcctgcctgagacatgagcctagaaacctgggaactggttctgccctgccctcatctc

[0217] tgcaaccttttggaagagcgacatgctggccctgtgcgtgagatcactaagggatccggcatctacaatgttcacaaacggtccactcccacccctctgttcttccctccctcctcctct

[0218] ccatcctccctgatgcttcctgacaggagtcctccctccctccctgcctgagcactcatggcctccttcccttgcagatcctggccctgacagtgtgagacttttgtcaaagcactgggct

[0219] gagaacctcaggccgaggcatctctctagtttgtttgctcctgtaatctgcccagttttagggcaagctcaagaggtacttgagcaaatgggtgagtccattcctcactacacagtgcag

[0220] tgctccatctgaggggtgggcacccaggacctcaagtcagctccactctggctataatatgtagctttcagccagcctctattcttgggtctcattccacccccaccccctatccaccca

[0221] ccccgtaaaacaaagagcctggaagagaagccctccggctttctttgtgttggcgctccaaggtaccttcaacatctttctgaggttgggtgcgtgttgatagtattcacatacatgggta

[0222] gggtgattcatgcctggttggtagaaatctccaggctttaatgtccccaccctgtcatggaacagggcaattgcagagaattaccaaaaaacaaacaactaaaaacttgccaagggT

[0223] TTTTCTAAAAACATATCCATATTTTATTTCATTTAATTGGGGGGCTGGGGAGGAGGTCAGAGATCCACATGTCCC

[0224] TGTCACCCTCCCTCCACCCCCAAGGCTGGGATTAAAGGTGTGCACACCACAGCCAGTTCCTCATATTTTAATAG

[0225] TCCCCAAAGTTCAACCTGGAAAGATTAAGAAAGATAAGCCATGTCCTCTAAAGGCTGAGGTCAGAGGTCAGAT

[0226] ATCCAGAAGTGGGCCATTAGGCGCGCCAGTTTTCCAATCAGAATGCCTTGAGTCCCCAGCATGCCTGCTATTGT

[0227] CTTCCCAATCCTCCCCCTTGCTGTCCTGCCCCACCCCACCCCCCAGAATAGAATGACACCTACTCAGACAATGC

[0228] GATGCAATTTCCTCATTTTATTAGGAAAGGACAGTGGGAGTGGCACCTTCCAGGGTCAAGGAAGGCACGGGGG

[0229] AGGGGCAAACAACAGATGGCTGGCAACTAGAAGGCACAGTCGAGGCTGATCAGCGAGCTCTAGCATTTAGGT

[0230] GACACTATAGAATAGGGCCTGCGGGGAGGCGGCCCAAAGGGAGATCCGACTCGTCTGAGGGCGAAGGCGAAG

[0231] ACGCGGAAGAGGCCGCAGAGCCGGCAGCAGGCCGCGGGAAGGAAGGTCCGCTGGATTGAGGGCCGAAGGGA

[0232] CGTAGCAGAAGGACGTCCCGCGCAGAATCCAGGTGGCAACACAGGCGAGCAGCCAAGGAAAGGACGATGATT

[0233] TCCCCGACAACACCACGGAATTGTCAGTGCCCAACAGCCGAGCCCCTGTCCAGCAGCGGGCAAGGCAGGCGG

[0234] CGATGAGTTCCGCCGTGGCAATAGGGAGGGGAAAGCGAAAGTCCCGGAAAGGAGCTGACAGGTGGTGGCA

[0235] ATGCCCCAACCAGTGGGGGTTGCGTCAGCAAACACAGTGCACACCACGCCACGTTGCCTGACAACGGGCCAC

[0236] AACTCCTCATAAAGAGACAGCAACCAGGATTTATACAAGGAGGAGAAAATGAAAGCCATACGGGAAGCAATAG

[0237] CATGATACAAAGGCATTAAAGCAGCGTATCCACATAGCGTAAAGGAGCAACATAGTTAAGAATACCAGTCAAT

[0238] CTTTCACAAATTTTGTAATCCAGAGGTTGATCATCAAGCTGTGGCAGGGAAACCCTCTGCCTCCCCCCGTGATGT

[0239] AATACTTTTGCAAGGAATGCGATGAAGTAGACCGCCAGTGGCCAAGTGGCTTTGGTCCGTCTCTCCACGGA

[0240] TGCCCCTCCACGGCTAGTGGGCGCATGTAGGCGGTGGGCGTCCGCCGCCTCCAGCAGCAGGTCATAGAGGGGC

[0241] ACCACGTTCTTGCACTTCCATGCTGTACAGATGCTCCATGCCTTTGTTACTCATGTGCCTGATGTGGGAGAGGATG

[0242] AGGAGGAGCTGGGCCAGCCGCTGGTGCTGCTGCTGCAGGGTCAGGCCTGCCTTGGCCATCAGGTGGATCAAA

[0243] GTGTCTGTGATCTTGCCAGGACTCGGTGGATATGGTCCTTTCCTTCCAGAGACTTCAGGGTGCTGGACAGAAAA

[0244] TGTGTACACTCCAGAATTAAGCAAAATAATAGATTTGAGGCACACAAACTCCTCTCCCTGCAGATTCATCATGC

[0245] GGAACCGAGATGATGTAGCCAGCAGCATGTCGAAGATCTCCACCATGCCCTCTACACATTTTCCCTGGTTCCTG

[0246] TCCAAGAGCAAGTTAGGAGCAAACAGTAGCTTCACTGGGTGCTCCATGGAGCGCCAGACGAGACCAATCATC

[0247] AGGATCTCTAGCCAGGCACATTCTAGAAGGTGGACCTGATCATGGAGGGTCAAATCCACAAAGCCTGGCACCC

[0248] TCTTCGCCCAGTTGATCATGTGAACCAGCTCCCTGTCTGCCAGGTTGGTCAGTAAGCCCATCATCGAAGCTTCA

[0249] CTGAAGGGTCTGGTAGGATCATACTCGGAATAGAGTATGGGGGGCTCAGCATCCAACAAGGCACTGACCATCT

[0250] GGTCGGCCGTCAGGGACAAGGCCAGGCTGTTCTTCTTAGAGCGTTTGATCATGAGCGGGCTTGGCCAAAGGTT

[0251] GGCAGCTCTCATGTCTCCAGCAGATGGCTCGAGATCGCCATCTTCCAGCAGGCGCACCATTGCCCCTGTTTCAC

[0252] TATCCAGGTTACGGATATAGTTCATGACAATATTTACATTGGTCCAGCCACCAGCTTGCATGATCTCCGGTATTGA

[0253] AACTCCAGCGCGGGCCATATCTCGCGCGGCTCCGACACGGGCACTGTGTCCAGACCAGGCCAGGTATCTCTGA

[0254] CCAGAGTCATCCTTAGCGCCGTAAATCAATCGATGAGTTGCTTCAAAAATCCCTTCCAGGGCGCGAGTTGATAG

[0255] CTGGCTGGTGGCAGATGGCGCGGCAACACCATTTTTTCTGACCCGGCAAAACAGGTAGTTATTCGGATCATCAG

[0256] CTACACCAGAGACGGAAATCCATCGCTCGACCAGTTTAGTTACCCCCAGGCTAAGTGCCTTCTCTACACCTGCG

[0257] GTGCTAACCAGCGTTTTCGTTCTGCCAATATGGATTAACATTCTCCCACCGTCAGTACGTGAGATATCTTTAACC

[0258] CTGATCCTGGCAATTTCGGCTATACGTAACAGGGTGTTATAAGCAATCCCCAGAAATGCCAGATTACGTATATCC

[0259] TGGCAGCGATCGCTATTTTCCATGAGTGAACGAACCTGGTCGAAATCAGTGCGTTCGAACGCTAGAGCCTGTTT

[0260] TGCACGTTCACCGGCATCAACGTTTTCTTTTCGGATCCGCCGCATAACCAGTGAAACAGCATTGCTGTCACTTG

[0261] GTCGTGGCAGCCCGGACCGACGATGAAGCATGTTTAGCTGGCCCAAATGTTGCTGGATAGTTTTTACTGCCAGA

[0262] CCGCGCGCCTGAAGATATAGAAGATAATCGCGAACATCTTCAGGTTCTGCGGGAAACCATTTCCGGTTATTCAA

[0263] CTTGCACCATGCCGCCCACGACCGGCAAACGGACAGAAGCATTTTCCAGGTATGCTCAGAAAACGCCTGGCGA

[0264] TCCCTGAACATGTCCATCAGGTTCTTGCGAACCTCATCACTCGTTGCATCGACCGGTAATGCAGGCAAATTTTG

[0265] GTGTACGGTCAGTAAATTGGAGCCCATtggaccagggttttcttcaacatcaccacaagtgaggagagaacctctaccttctccgcttccCTTGTACA

[0266] GCTCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAACTCCAGCAGGACCATGTGATCGCGCTTCTCGTT

[0267] GGGGTCTTTGCTCAGGGCGGACTGGGTGCTCAGGTAGTGGTTGTCGGGCAGCAGCACGGGGCCGTCGCCGAT

[0268] GGGGGTGTTCTGCTGGTAGTGGTCGGCGAGCTGCACGCTGCCGTCCTCGATGTTGTGGCGGATCTTGAAGTTC

[0269] ACCTTGATGCCGTTCTTCTGCTTGTCGGCCATGATATAGACGTTGTGGCTGTTGTAGTTGTACTCCAGCTTGTGC

[0270] CCCAGGATGTTGCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCCTCGAA

[0271] CTTCACCTCGGCGCGGGTCTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCGG

[0272] GCATGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGT

[0273] CAGGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCTT

[0274] GCCGTAGGTGGCATCGCCCTCGCCCTCGCCGGACACGCTGAACTTGTGGCCGTTTACGTCGCCGTCCAGCTCG

[0275] ACCAGGATGGGCACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACCATAGGACCAGGGTTCTCCTCCACGT

[0276] CGCCAGCCTGCTTCAGCAGGCTGAAGTTAGTAGCTCCGCTtCCCTGGAGGAAGTTGGCTACCAGGCAGGTGAG

[0277] TGTGGGGACCAACAGAGTGGGCAGGGGCAAAGACAGCAGCTGTCCTGGGGCATGGGACTTGAACACCTGGC

[0278] GTTTTCCCAGCGGCTGCAGGGGCCTCACATTGTCCTTCATGTTCAACTTCTGATCTTCGTCATAGTACAGATTTT

[0279] TTGAGAATTCCAGGAActgtgaaagagactgggctcagcaggtggagctatgaatgctctttgccaggtgacctcagaccagacagctcatatcggcaaggaagag

[0280] aggagctcagaatgattaccaagagtgtcaagtgtggcatttgtgggaagctgagcgccactgtctctccctgtcctccacaggtactttttcaagcctattaccatcattcttggaggtt

[0281] ggcatcctttagtatcagctgaaggagctcaccaggtgcctggatcctggccccaggatatctgattcgatagagtgagcccatgaatggtcattcctaaagcattctcactggtgatg

[0282] atggtgacaccacactgagactcgctgctataagcccaagggagtttggtcctctgggtttcctgctgtcttcccagaggctattgtaaactcaagtgttgtttgctgagcaacttcccaa

[0283] cagcactaaggaagtccaacctcaggtccccacatgaaccagccagctctctcccacttttctggaagcccattccaagcatcctccaggatgtctcactgggccctctattcaggaa

[0284] agtggtactcagagctttctttcttgtctgtgtccaccagtagaaaccaaaagtctaactcaatgaatcttatcttcccaccccagggacctgtggagcaaatagatagggctttaaggaa

[0285] ctagactccctatgggagagtgcaccttgcccaagcctgggtacCTGGTTTTTGTGGATCTTGATGGGTTGTTTGTACACAGTCCAGATGA

[0286] CAGTCTCATCACAGTTTGGTGTGGTTAGTGAGCCATTGTAACGGAAGTAGGTATACATTTTGGTGCTCGGGGGA

[0287] AGCATGTCCTGCAAACTGCTCTCCCTCACTGTAGAGGTTGAATctggggtgagagacaaaaccttatatatggctctctttaaagcagctgtcc

[0288] tagagcctctagccctctcatcatggaaaaaaagccatcccctcccccaacctgactcacGGGGTTTGGAGATACTGGGCAGTGCTTCCACCAGGG

[0289] GCTGGAAGCCCTTGTTCACCTTGTCTCCTACctggaacaggagagaaagaaacatgatatgggttctttgggagctgctgtggccaagcagctccttctg

[0290] gaggatgggtgacccccaggatgggggggggggctacCTCAATCATAAATGCCAGCACTGCAAACTTGTCCTTCGAGTCCTCCTTG

[0291] CTAGATGTCAACTTCTTGTGCACGATGTGCATctagaaggcacatgcagatggaggacttaggcaagctggaccacctatcctccccaaggtgggtac

[0292] acacctggaatccagcccaggacccagctccatggcttcttacCTCCATGGCAAAGTGTCTCCCATCAATACTGTGCTCTGAACCGTTGT

[0293] CATTCCCATTTGACCAGTGCAGGTGCAACTGTACAGCCTCGTACCGGGCGGGCAGGTCTCCTCCGATAATGCAC

[0294] GCACCTCCCCCCAGCGTCATCTCCActgggagataccagagtgggcagagtccttactccggcctaccattagccctctcagttcccaccctaggtttttcctct

[0295] cacctttgctgtttgaggcctgggcactgagggatgggaggtgagtggtagccagccggcactctgcctacctgctcattgcttccccccccccaccaccacctctcatatacctatcc

[0296] caaaatgtagccctgtcctgggcctgatgggttctgactcccacccgtggtatcctggtatccccacaataatgtctaaactccttagccctggtgacctgctctggaccttggtcagctc

[0297] ctcctagtttccctctatggcctccatccacactcagctgctcctactcacggttcaacaaacacctaagcagtttcacacctcttagttttcaaagaggtttttccctccttccgggaaggtt

[0298] ccttccctttgcccctactgttctgatgaaatgactgaaaacccaactagctacagtatcctctcctctacaagtttctctggtggcttctcccatctccaggcttgagggactcatcatccct

[0299] gaacaattagcccaacccacaagggacccacCTGTGTGTTGATTGTTCTTAATTGGCCACTGTTGCTTTTGGTCATAGCCGACGA

[0300] GGATGAAGGGTGTCAGTCTGGGGTTCACCTTTGTCCTAGCAGTGACAATGTTGATGGGGGACTGCTGATTCTCC

[0301] TTACAGGCTCCAGGCCACTTCTCAGGCCctgacggggggtgggggtggggtggggggggtggagagagaagtctgagagtccagagcacattgacc

[0302] cattgttgtggattaagaccctagaatgctggtgaggtctcacttcggggaatgaatctcagaatcctgccctggccttcctcttcttcctcccacatgatgacatgatataggcaggcta

[0303] gtgggtctctgatgtggctgagggttgaggggttgtggagagagaggtggagggagaaaaaggcttgccattgatggctaagagctctgggattggaataacttcatgatgctgagc

[0304] tctggctttctcagggggaatctgggcatgaataaaggagcttccagggcgtgctggtaagtttccaagctgctgagtggggagatggcttctcagctttggacattgtagaggaggtcc

[0305] ttgtggaagagatgttatggaaagaccctggacctgacaaggcaatctctaaggagtggggatagggtggggaggaagagccaggcaggcaactccaacatccagctaggAG

[0306] CTTGTCGACCGCGGCCTTTTGCGGCCGCAGCTTATCGATGATAAGCTGTCAAACATGAGAA

[0307] 6. Genetic identification results of F0 generation mice

[0308] Primers were designed upstream and downstream of the 5' homology arm and the 3' homology arm, and the genes of the F0 generation mice after gene recombination were identified by PCR amplification; 3' homology arm identification: a 4.9kb fragment should be amplified in the homologous recombinant DNA, and an 8.8kb fragment can be amplified in the negative DNA; 5' homology arm identification: a 4.3kb fragment should be amplified in the homologous recombinant DNA, and no fragment can be amplified in the negative DNA ( Figure 7 ). The results of the 3' homology arm identification of F0 mice showed that 4.9kb fragments and 8.8kb fragments were amplified simultaneously in the DNA of 10 mice out of the 25 selected F0 mice, while only the 8.8kb fragment was amplified in the DNA of the remaining mice and wild control mice ( Figure 8 A); The mice that could amplify the 4.9kb fragment were selected and tested for 5' homology arms. The results showed that the selected mouse DNAs all amplified the 4.3kb fragment, while no fragment was amplified in the wild control mouse DNA ( Figure 8 B). This indicates that the target gene of the 10 selected F0 mice was successfully recombined. The amplified fragments of the 10 F0 mice were sequenced and compared, and mice with the correct sequence were selected for subsequent breeding.

[0309] 7. Genotyping results of F1 mice

[0310] The identification principle and method of F1 generation mice are the same as those of F0 generation. The identification results of the 3' arm showed that among the 5 selected F1 generation mice, 4 mice had 4.9kb and 8.8kb fragments amplified simultaneously in their DNA, and only 8.8kb fragment was amplified in the DNA of the remaining 1 mouse and wild control mice; the identification results of the 5' arm showed that in the above 3' arm detection process, 4.9 and 8.8kb fragments were amplified in the DNA of the 4 mice, and 4.3kb fragment was amplified in the DNA of the mice that only amplified 8.8kb and wild mice. ( Fig. 9 ). This indicates that there are 4 heterozygous mice among the 5 F1 mice. After sequencing and comparison of the amplified sequences of mice in good condition (No. 1, 3, and 6), mice with the correct sequences were selected and used to breed F2 mice.

[0311] 8. Genotyping results of F2 mice

[0312] Primers were designed upstream and downstream of the eighth exon of the Car4 gene, and the genotype of the F2 generation mice was identified by PCR amplification using the Car4 gene and the Car4+EGFP gene as templates. Fig.10 ), the mice whose DNA could only amplify a DNA fragment of 385bp (P1P2 = 385bp) were wild-type mice, the mice whose DNA could simultaneously amplify two fragments of 385bp (P1P2 = 385bp) and 484bp (P1P4 = 484bp) were heterozygous mice with exogenous gene knock-in; the mice whose DNA could only amplify a fragment of 484bp (P1P4 = 484bp) were homozygous mice with exogenous gene knock-in ( Fig.11 ).

[0313] 9. Detection of EGFP signal in mouse brain, lung, kidney and skeletal muscle tissue

[0314] We detected obvious EGFP fluorescence signals in the choroid plexus of the lateral ventricle, alveoli, renal tubules and skeletal muscles of Car4-EGFP-CreERT2 mice, indicating that CA4 protein is expressed in the above-mentioned tissues of mice.

[0315] 10. Detection of CA4 expression in mouse myocardial tissue

[0316] The results of immunofluorescence detection showed that CA4 was highly expressed in the myocardial tissue of C57BL / 6J mice, and its expression site was limited to the capillaries between the myocardium ( Fig.13A); Western blot results showed that compared with wild-type C57BL / 6J mice, the CA4 content in the myocardial tissue of Car4-EGFP-CreERT2 / + and Car4-EGFP-CreERT2 mice tended to decrease, but the magnitude of the decrease did not reach statistical significance ( Fig.13 B), indicating that the insertion of EGFP and CreERT2 genes had no significant effect on the protein expression of CA4; the results of frozen sections of the heart of Car4-EGFP-CreERT2 mice showed that there was a clear EGFP signal between myocardial cells ( Fig.13 C).

[0317] 11. CA4 positive cell tracing detection

[0318] The results of flow cytometry showed that compared with Car4-EGFP-CreERT2 / + mice, there was no significant change in the proportion of CD31(+) cells in the single cell suspension isolated from the myocardial tissue of Car4-EGFP-CreERT2 mice and the proportion of CD31(+) and EGFP(+) positive cells to the total number of CD31(+) cells ( Fig.14 AB).

[0319] In this project, we successfully constructed Car4 em1(P2A-EGFP-T2A-CreERT2-WPRE-pA)Smoc(BG:C57BL / 6J), a Car4 knock-in mouse with a C57BL / 6J genetic background, using the CRISPR / Cas9 system. During the mouse construction process, we inserted the EGFP and CreERT2 genes in front of the Car4 gene terminator TAA, generating EGFP-CreERT2 knock-in mice controlled by the Car4 gene. We selected the self-cleaving peptide P2A to connect Car4 and EGFP, used T2A to connect EGFP and CreERT2, and added the WPRE element to enhance gene expression and the polyA sequence that plays an important role in mRNA stability, translation efficiency, cell localization, diversity, and cell cycle regulation after CreERT2. The exogenous gene was integrated using the homology-directed repair method to achieve the knock-in of the target gene at a specific site.

[0320] The mouse Car4 gene has a total of 6 transcripts. Through a comprehensive evaluation of the structure and site of the Car4 gene, we selected the Car4-201 transcript for analysis. This transcript has a total of 8 exons, and protein translation starts at the first exon and ends at the eighth exon. In this project, we use EGFP as the preferred protein for tracing CA4. In order to avoid the impact of the inserted gene on the amino acid sequence of the CA4 protein, we inserted the EGFP gene between the last exon of the Car4 gene and the gene termination factor (this site is applicable to all coding transcripts). As a key factor that directly affects the synthesis of gene transcripts, the promoter is crucial for achieving efficient expression of chromosomal integrated proteins. Therefore, the expression of exogenous EGFP depends to a large extent on the ability of the Car4 gene promoter to promote the EGFP gene. Although as a mutant line of GFP, the fluorescence intensity emitted by EGFP is more than 6 times that of GFP, when the Car4 promoter is insufficient to promote its gene, the intuitiveness of EGFP tracing will be greatly reduced. The tandem dimer Tomato is the brightest fluorescent protein among all spectral types. When other fluorescent proteins have poor signals, this protein can still achieve good tracking of the target protein due to its super strong fluorescence signal. However, due to the large size of tdTomato molecules, it may interfere with the folding of the target protein in some cases. Therefore, it is not suitable to directly insert its gene into the Car4 gene to form a fusion gene in this project. Due to the lack of in-depth understanding of the initiation ability of the car4 gene promoter and the long period of obtaining transgenic mice, in order to avoid the risk of weak or unobservable EGFP fluorescence caused by the insufficient initiation ability of the Car4 gene promoter to exogenous EGFP, we introduced the CreERT2 element into it and knocked it in front of the Car4 gene termination factor TAA to produce EGFP-CreERT2 gene knock-in mice controlled by the Car4 gene promoter. Cre-ERT2 is a fusion protein expressing the ligand binding region mutant (ERT) of the estrogen receptor (ER) and the Cre recombinase. Cre-ERT2 is inactive in the cytoplasm without tamoxifen induction; when induced by the inducer tamoxifen, the metabolite of tamoxifen, 4-OHT (estrogen analogue), binds to ERT, allowing Cre-ERT2 to enter the nucleus and exert Cre recombinase activity. In this way, even in the case of poor EGFP expression signal, [Cre+(car4-eGFP-ERT2Cre[KI / +]; Rosa26-LSL-tdTomato[KI / +] heterozygous mice can be generated by crossing the above mice with Rosa26-LSL-tdTomato(loxP-Stop-loxP,LSL) mice.Then, by hybridizing heterozygous mice, Cre+(car4-eGFP-ERT2Cre[KI / +]; Rosa26-LSL-tdTomato[KI / KI]) or Cre+(car4-eGFP-ERT2Cre[KI / KI]; Rosa26-LSL-tdTomato[KI / KI]) mice were finally generated. Under the induction of tamoxifen, TdTomato tracing mice with stronger fluorescence signals were generated, which can achieve conditional tracing of CA4 protein in mice. The labeling of CA4 by Tomato through hybridization can avoid the risk of weak EGFP fluorescence or no fluorescence due to insufficient activation ability of Car4 promoter on exogenous EGFP. On the other hand, when the EGFP signal is good, the expression of CA4 protein can be mutually confirmed by two different fluorescent proteins.

[0321] Fortunately, we observed obvious EGFP fluorescence signals in the brain, heart, lung, kidney and muscle tissues of Car4-P2A-EGFP-T2A-CreERT2 mice. The above results confirmed the successful construction of Car4 tracer mice on the one hand, and reconfirmed the expression of CA4 in the above tissues on the other hand. Since the tracer gene insertion site is located in the enhancer region of the Car4 gene, in order to clarify the effect of tracer gene insertion on the transcriptional regulation of the Car4 gene, we used real-time quantitative PCR and Western-blot to detect the expression of Car4 mRNA and CA4 protein in mouse heart tissue. The results showed that compared with the wild type, there was no significant change in car4 gene mRNA and CA4 protein, indicating that the insertion of the exogenous gene did not affect the expression of the Car4 gene. In order to clarify the effect of CA4 expression changes on the content of endothelial cells in myocardial tissue and the tracing effect of EGFP on CA4-positive cells, we used flow cytometry to detect cells in myocardial tissue. The results showed that compared with heterozygotes, the content of CD31-positive cells in myocardial tissue of Car4-EGFP-CreERT2 homozygous mice and the proportion of EGFP / CD31 double positive cells in CD31-positive cells did not change. This result suggests that gene insertion has no effect on the content of endothelial cells in myocardial tissue; on the other hand, although the content of EGFP in Car4-EGFP-CreERT2 / + is only half of that in Car4-EGFP-CreERT2 mice, it has the same tracing effect on CA4-positive cells in the myocardial tissue of the above two genotypes of mice.

[0322] In this project, we used P2A and T2A peptides to connect Car4 to eGFP, eGFP and CreERT2, respectively. The cleavage efficiency of 2A peptide is high. Using 2A peptide as a connecting element can achieve equal expression of multiple proteins, but 2A peptide also has certain disadvantages. Since the break occurs between glycine (G) and proline (P) at the C-terminus of the 2A polypeptide, the upstream protein will have an additional polypeptide tail of more than 20 amino acids, and the downstream protein will have an additional proline at the N-terminus. This additional 2A peptide structure may have a certain effect on the function of the target protein. As to whether the insertion of the above gene has an effect on the function of the CA4 protein, we will continue to explore in subsequent studies.

[0323] Interestingly, Fleming et al. found that in lung tissue, CA4 is only expressed on the luminal side of the alveolar capillary endothelium, but not in the endothelium of larger pulmonary vessels. Ghandour et al. found that in brain tissue, CA4 is also only expressed on the luminal surface of capillary endothelial cells. In our previous study, we found that in mouse heart tissue, CA4 is also only expressed in capillary endothelial cells. The EGFP signal on the frozen sections of this Car4 gene-traced mouse also confirms this point, suggesting that CA4 can also be used as a specific marker for capillary endothelial cells in the above tissues. Therefore, the eGFP-CreERT2 gene knock-in mouse controlled by the Car4 gene can achieve CA4 tracing while carrying the CreERT2 element, and can be hybridized with Flox mice to conditionally knock out the target gene in the capillary endothelial cells in the above tissues.

[0324] In summary, in the process of constructing the Car4-P2A-EGFP-T2A-CreERT2 mouse, we systematically considered the possible risks in the construction of CA4 tracer mice and took corresponding measures to avoid such risks, which provided a reference for the construction of other protein tracer mice. The successful construction of this mouse, on the one hand, provides a good animal model for observing and studying the CA4 protein expression spectrum and screening CA4 positive cells in tissues; on the other hand, it also provides a reliable Cre tool mouse for conditional knockout of target genes in capillary endothelial cells in tissues such as the heart.

[0325] The above embodiments are only for illustrating the technical concept and features of the present invention, and their purpose is to enable people familiar with the technology to understand the content of the present invention and implement it accordingly, and they cannot be used to limit the protection scope of the present invention. Any equivalent changes or modifications made according to the spirit of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for constructing a CRISPR / Cas9-based Car4 gene tracing animal model, the method comprising: Cas9 was used to perform site-directed cutting of the Car4 gene, and then the exogenous genes encoding fluorescent protein and CreERT2 were integrated into the Car4 gene using the homology-directed repair method to obtain F0 chimeric mice, which were then hybridized with wild-type mice to obtain stable F1 mice, and the F1 mice were self-pollinated to obtain homozygous transgenic F2 mice.

2. The construction method according to claim 1, characterized in that: The fluorescent protein is GFP, EGFP and tdTomato; further is EGFP.

3. The construction method according to claim 1, characterized in that: The construction method comprises: A mixture of Cas9 mRNA, gRNA and donor DNA recombinant plasmid is introduced into the fertilized eggs of mice to generate F0 generation chimeric mice; wherein the donor DNA recombinant plasmid contains at least the coding gene sequence of P2A-EGFP-T2A-CreERT2; further, the eGFP and CreERT2 genes are inserted in front of the Car4 gene termination factor TAA.

4. The construction method according to claim 1, characterized in that: Add the WPRE element and polyA sequence after CreERT2.

5. The construction method according to claim 1, characterized in that: The target sequence of exon 8 of the Car4 gene is shown as SEQ ID NO.1, and the sequence of the gRNA is shown as SEQ ID NO.2-3.

6. The construction method according to claim 1, characterized in that: The mice are C57BL / 6J mice.

7. The construction method according to claim 1, characterized in that: Perform genetic identification on F0 and F1 generation mice, and select mice with the correct sequence for subsequent breeding; The method for gene identification of F0 generation mice includes: designing primers at the upstream and downstream of the 5' homology arm and the 3' homology arm respectively, and using the PCR method to identify the genes of the F0 generation mice after gene recombination; 3' homology arm identification: a 4.9kb fragment should be amplified in the homologous recombinant DNA, and an 8.8kb fragment can be amplified in the negative DNA; 5' homology arm identification: a 4.3kb fragment should be amplified in the homologous recombinant DNA, and no fragment can be amplified in the negative DNA; The method for genetic identification of F1 generation mice includes: designing primers at the upstream and downstream of the 5' homologous arm and the 3' homologous arm, respectively, and using the PCR method to identify the genes of the F1 generation mice after gene recombination; 3' homologous arm identification: a 4.9kb fragment should be amplified in the homologous recombinant DNA, and an 8.8kb fragment should be amplified in the negative DNA; 5' homologous arm identification: a 4.3kb fragment should be amplified in the homologous recombinant DNA, and no fragment can be amplified in the negative DNA.

8. The construction method according to claim 1, characterized in that: The screening method for homozygous transgenic F2 mice is as follows: primers are designed upstream and downstream of the eighth exon of the Car4 gene, and the Car4 gene and the Car4+EGFP gene are used as templates respectively. The genotype of the F2 mice is identified by PCR amplification method. The mice whose DNA can only amplify a DNA fragment with a length of 385bp (P1P2=385bp) are wild-type mice, the mice whose DNA can simultaneously amplify two fragments with a length of 385bp (P1P2=385bp) and 484bp (P1P4=484bp) are Car4+ / - heterozygous mice; the mice whose DNA can only amplify a fragment with a length of 484bp (P1P4=484bp) are Car4- / - homozygous mice.

9. Application of the construction method according to any one of claims 1 to 8 in any one or more of the following: (a) CA4 protein expression profile study; (b) Screening of CA4-positive cells in organs / tissues; (c) Achieve conditional knockout of target genes in capillary endothelial cells within tissues.

10. The use according to claim 9, wherein in (c), the tissue is lung tissue, brain tissue or myocardial tissue; Furthermore, the application (c) is: the Car4 gene tracing animal mouse model obtained by the construction method is hybridized with Flox mice to perform conditional knockout of the target gene in the capillary endothelial cells in the tissue.

Images