Kit for predicting papillary thyroid carcinoma susceptibility

Abstract

The invention discloses a kit for predicting papillary thyroid carcinoma susceptibility, and belongs to the technical field of medical biotechnology and medical detection. According to the invention, genomic DNA of a subject is extracted, and the genotype of the exon region 45867709 position of the ERCC2 gene of the subject is determined, so that the susceptibility of the subject to papillary thyroid carcinoma is predicted. The invention has the following advantages: the correlation between the variation of the site 45867709 of the exon region of the ERCC2 gene and papillary thyroid carcinoma is elaborated for the first time, and a method for evaluating the risk of a subject suffering from papillary thyroid carcinoma is provided. The method can be used for risk assessment, screening and early diagnosis of papillary thyroid carcinoma, and has the advantages of noninvasive property, rapidness and high accuracy.

Description

Technical Field

[0001] The invention relates to a kit for predicting susceptibility of thyroid papillary carcinoma, belonging to the technical fields of medical biotechnology and medical detection. Background Art

[0002] Papillary thyroid carcinoma (PTC) is the most common thyroid endocrine tumor, accounting for approximately 90% of all thyroid cancers. This cancer usually grows slowly and has a good prognosis when effectively treated in the early stages. Despite this, current diagnostic methods are mainly based on histological examination and pathological analysis, which not only require surgical removal of tissue, but also have disadvantages such as invasiveness and high cost. Therefore, it is of great clinical significance to develop a non-invasive detection method to assess the susceptibility of PTC and achieve its early detection and treatment.

[0003] The main methods currently used to detect papillary thyroid cancer include ultrasound, radionuclide scanning, needle biopsy, and fine needle aspiration cytology. Among them, ultrasound and radionuclide scanning are non-invasive detection methods and are widely used in clinical practice, especially in the initial screening stage. Although these methods are less invasive, they have low accuracy in detecting lesions smaller than 1 cm and it is difficult to provide enough information to clearly distinguish whether the lesions are benign or malignant. This deficiency often requires further pathological confirmation of the diagnosis. In contrast, needle biopsy and fine needle aspiration cytology provide more direct tissue diagnostic information, but these methods also have problems such as high invasiveness, high cost, and potential patient discomfort.

[0004] Although these traditional methods can effectively detect already formed tumors, they are still insufficient in predicting the risk and development of thyroid cancer at an early stage. In order to improve this situation, scientists have begun to explore the detection of genetic susceptibility loci, aiming to identify cancer risks in advance through genetic markers. Existing technologies in this field, such as Sanger sequencing, whole exome sequencing, flight mass spectrometry, and high-resolution melting curve analysis (HRM), have their own characteristics, but they all have certain limitations. For example, Sanger sequencing performs well in terms of accuracy, but it is slow and costly, and is not suitable for large-scale screening. Whole exome sequencing provides a comprehensive genetic variation detection platform, but its data processing is complex and costly. Although flight mass spectrometry technology and HRM can quickly identify different types of genetic variations, they have high requirements for equipment, are relatively expensive, and are highly dependent on sample quality, and are prone to false positive and false negative results.

[0005] Therefore, there is currently no non-invasive detection product and patent that can effectively assess the susceptibility risk of papillary thyroid cancer, early detection and treatment of papillary thyroid cancer. In view of these limitations of the prior art, this patent proposes a new detection method based on allele-specific PCR (Amplification Refractory Mutation System, ARMS) technology. This method can specifically detect gene mutations associated with a high risk of papillary thyroid cancer. Compared with traditional technologies, ARMS technology has the advantages of simple operation, fast reaction speed, and low cost, and is particularly suitable as a routine clinical screening tool. This new kit can effectively identify high-risk papillary thyroid cancer susceptibility sites without the need for complex equipment and high costs, thereby providing a powerful tool for early diagnosis and treatment in the clinic, increasing the success rate of treatment, and reducing the economic burden and physical trauma of patients. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a non-invasive detection kit and detection method for early assessment of the risk of papillary thyroid cancer.

[0007] The core content of the present invention is based on the following research results of the inventors.

[0008] The present invention is the first to study and discover a mutation site with a high carrier rate in patients with papillary thyroid carcinoma and to explain that the mutation site is associated with an increased risk of papillary thyroid carcinoma. The present invention first found that the mutation site was enriched in 18 patients in the exon sequencing of 1009 patients with papillary thyroid carcinoma. The mutation showed a population-specific low carrier frequency (0.6%) in the Chinese non-cancer control group (ChinaMAP). Studies have shown that individuals who carry the mutation have a 3.14-fold increased risk of developing papillary thyroid carcinoma compared with non-carriers (95% CI, 1.85-5.32; P<0.0001). Therefore, the present invention provides a method for predicting the susceptibility of sporadic papillary thyroid carcinoma, which can be used for early assessment of the risk of papillary thyroid carcinoma and auxiliary diagnosis of malignant transformation of high-risk thyroid nodules.

[0009] The kit of the present invention can be used to screen high-risk populations so as to detect PTC at an early stage and carry out effective treatment. The kit has the advantages of simple operation, high accuracy, rapidity, low cost, etc., and is suitable for use in clinics, medical institutions and families.

[0010] A kit for predicting susceptibility to papillary thyroid cancer comprises primers and / or reagents for detecting variant sites in the exon region of ERCC2.

[0011] The mutation site is ERCC2, chr19:45867709 (GRCh37) G / A. Figure 1 It is a schematic diagram of the ERCC2 gene structure and its susceptible mutation sites. The figure includes multiple exons, and 45867709 is marked at the corresponding position of the exon region of the ERCC2 gene.

[0012] A nucleotide fragment comprising ERCC2, chr19:45867709 (GRCh37) G / A, wherein position 416 is a mutation site, the wild type is G, and the mutant type is A.

[0013] GGTGCCCATACTTCCTTGCTCGATACTCAGTGAGGAGGCTGGTGGGATGGGCAGAGGGGC

[0014] GAGTGTGAGGGTGTGGGCTGCCCGCCCGTCTCCTGTCTGCCCATGTCTGTCTGTTGCTTGC

[0015] TGTGAGTCTGCCTGTCTGCATCTCCCTGTTGGTGGGTGCCCGTATCTGTTGGTCTGTCTCTA

[0016] TCCATCTGCTCATACTTCTGCCTGGCCTGTGTCTGCCTGTGCAGGCCTGTGTGGGAGTGAC

[0017] GGGCCAGTGTGGCCAGGGGTAGGGGTAGGGGTTGGGGTGGCAGGGCCCTGGTAACCCTG

[0018] CTCCCCGGCCCCCCAGATCCTGCATGCCAATGGTGGTGGTTTATAGCTACCACTACCTCCTGGACCCCAAGATTGCAGACCTGGTGTCCAAGGAACTGGCCCGCAAGGCCGTC[G>A]TGGTCT TCGACGAGGCCCACAACATTGGTGAGGGGGGCCAGGGGCCAAAGGGATGCCAGCCCCTCTGAGTGAGGCCCCTGCAGGCCTGCCTGAGCCGGCTCTCCCCTCTCCAGACAACGTCTGCATCGACTC CATGAGCGTCAACCTCACCCGCCGGACCCTTGACCGGTGCCAGGGCAACCTGGAGACCCTGCAGAAGACGGTGCTCAGGTGGGGCCGGGGACGTCTGGCGGTGGTGCCCGCCCTGCCCCTGGGACCCTGGCC

[0019] The nucleotide sequence where the mutation site is located has the nucleotide sequence shown in the sequence list SEQ ID No. 2. The wild-type nucleotide sequence without the mutation site has the nucleotide sequence shown in the sequence list SEQ ID No. 1.

[0020] The primers have nucleotide sequences shown in SEQ ID No. 3 to SEQ ID No. 6 in the sequence listing.

[0021] The kit also contains other diagnostic reagents, wherein the PCR reaction reagents are composed of the following reagents:

[0022] (1) 10 μL of a mixture of 2× PCR Taq enzyme and buffer;

[0023] (2) 8.4 μL pure water

[0024] (3) 0.15 μL of the F1 primer for detecting the wild-type site, which has the nucleotide sequence shown in SEQ ID NO. 3 and a concentration of 20 pmol / μL;

[0025] (4) 0.15 μL of R1 primer for detecting the wild-type site, which has the nucleotide sequence shown in SEQ ID NO. 4 and a concentration of 20 pmol / μL;

[0026] (5) 0.15 μL of F2 primer for detecting mutant sites, which has the nucleotide sequence shown in SEQ ID NO.5 and a concentration of 20 pmol / μL;

[0027] (6) 0.15 μL of R2 primer for detecting mutant sites, having the nucleotide sequence shown in SEQ ID NO.6 and a concentration of 20 pmol / μL.

[0028] Directions:

[0029] (1) Collecting genomic DNA from the subject. This kit uses a sterile cotton swab to wipe the inner wall of the subject's oral cavity to collect the subject's oral mucosal exfoliated cells. Subsequently, the genomic DNA of the mucosal exfoliated cells is extracted and ultrapure water is added to adjust its concentration to 50 ng / μL.

[0030] (2) Preparation of PCR amplification system:

[0031] The wild-type and mutant fragments were amplified by allele-specific PCR.

[0032] The wild-type reaction system prepared a mixed solution: 10 μL of a mixture of 2×PCR Taq enzyme and buffer; 0.15 μL of F1 primer for detecting the wild-type site, which is the nucleotide sequence shown in SEQ ID NO.2, and the concentration is 20 pmol / μL; 0.15 μL of R1 primer for detecting the wild-type site, which is the nucleotide sequence shown in SEQ ID NO.3, and the concentration is 20 pmol / μL; 1 μL of 50 ng / μL genomic DNA, and 8.4 μL of pure water.

[0033] Preparation of mixed solution for mutant reaction system: 10 μL of 2×PCR Taq enzyme and buffer solution; 0.15 μL of F2 primer for detecting mutant sites, which is the nucleotide sequence shown in SEQ ID NO.4, with a concentration of 20 pmol / μL; 0.15 μL of R2 primer for detecting mutant sites, which is the nucleotide sequence shown in SEQ ID NO.5, with a concentration of 20 pmol / μL;

[0034] 1 μL of 50 ng / μL genomic DNA, 8.4 μL of pure water.

[0035] (3) PCR amplification and agarose gel electrophoresis

[0036] The PCR reaction conditions were 95°C pre-denaturation for 3 min, 95°C denaturation for 20 s, 69°C annealing for 25 s, 72°C extension for 15 s, a total of 47 cycles, and a total extension of 2 min at 72°C. The PCR products were added to the agarose gel wells for electrophoresis separation, and the band pattern of the PCR products was used to determine whether the mutant allele was present in the sample.

[0037] Currently, there is no effective non-invasive method for early assessment of the risk of papillary thyroid cancer at home and abroad.

[0038] The advantages of the present invention are as follows: Based on the creative invention of the inventor, a kit for predicting susceptibility to papillary thyroid carcinoma is developed, which uses non-invasive collection of oral mucosal exfoliated cells from subjects to extract genomic DNA. By detecting the genotype of the pathogenic site of papillary thyroid carcinoma, the risk of the subject suffering from papillary thyroid carcinoma is assessed. The detection kit can be used for risk assessment, screening, and early diagnosis of the disease, and is non-invasive, rapid, and highly accurate. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] The specific implementation modes of the present invention will be further described in detail below in conjunction with the accompanying drawings.

[0040] Figure 1 Schematic diagram of the ERCC2 gene structure and susceptible mutation sites

[0041] Figure 2 Figure 2 shows the genotyping of ERCC2 gene variant sites by allele-specific PCR method

[0042] Figure 3 Sanger sequencing diagram showing the G / A mutant of chr19:45867709 (GRCh37) DETAILED DESCRIPTION

[0043] Example 1: Extraction of genomic DNA from patients with papillary thyroid carcinoma and screening of its susceptibility genes

[0044] 1. Case selection

[0045] A total of 1009 unrelated patients with papillary thyroid cancer in Beijing were selected. All subjects signed written informed consent. This study was approved by the Ethics Review Committee of Beijing Hospital and complied with the World Medical Association Declaration of Helsinki and the ethical principles of human medical research.

[0046] 2. Genomic DNA Extraction

[0047] The main methods for genomic DNA extraction in this protocol are as follows.

[0048] (1) The collection of oral mucosal exfoliated cells from subjects and the extraction of genomic DNA from oral mucosal exfoliated cells were as follows: 30 minutes before the collection of oral mucosal exfoliated cells, the subjects rinsed their mouths with clean water three times for 10 seconds each time, and stopped eating and drinking until the collection was completed. The inner wall of the subject's oral cavity was wiped with a sterile cotton swab 30 times, and the cotton swab head was mixed with 600 μl of cell lysis buffer and digested at 60 degrees for 6 hours. Thereafter, 600 μl of phenol-chloroform was added, and the tube was inverted at room temperature for 5 minutes. Centrifuged at 12000 rpm at room temperature for 5 minutes, and the upper transparent liquid was aspirated into a new 1.5 ml sterile centrifuge tube. An equal volume of isopropanol was added, and the tube was inverted to mix. The tube was centrifuged at 12000 rpm at room temperature for 15 minutes. The liquid was aspirated, 1 ml of 75% ethanol was added, the tube was inverted 10 times, and centrifuged at 12000 rpm at room temperature for 1 minute. The liquid was aspirated, and 60 μl of sterile TE (pH 8.0) solution was added to dissolve the genomic DNA of oral mucosal exfoliated cells at 4 degrees overnight.

[0049] Cell lysis buffer formula: 20mmol / L Tris-Cl (pH8.0), 0.1mol / L EDTA (pH8.0), 1mol / LNaCl, 0.5% SDS, 0.4mg / mL proteinase K.

[0050] Phenol-chloroform solution: a 1:1 volume mixture of Tris-saturated phenol and chloroform.

[0051] The oral mucosal cells of the subjects were collected in June 2023. The collector was Wei Tian, ​​whose contact number is 18515100109, and the address is Beijing Hospital, No. 1 Dongdan Dahua Road, Dongcheng District, Beijing.

[0052] 3. Whole Exome Sequencing

[0053] Whole exome sequencing was performed by Mingcode Biotechnology Co., Ltd. (Shanghai, China), and 1 μg of genomic DNA from each sample was sequenced on an Illumina Novasek S6000 using the SureSelect Human All E×on V6 kit (60 MB). High-quality reads were aligned to the human reference genome (NCBI Build 37) using the Burrows-Wheeler Alignment (BWA) tool version 0.7.15-r1140 with default parameters. We used Sentieon (ver201808) to remove duplicate reads, recalibrate quality scores, improve alignment accuracy, and call germline variants. Subsequently, single nucleotide variants (SNVs) and small insertions and deletions (Indels) were annotated using ANNOVAR.

[0054] IV. Experimental Results

[0055] We found that 18 of 1009 patients with papillary thyroid cancer carried the ERCC2, chr19:45867709 (GRCh37) G / A variant site. This variant showed a low carrier frequency (0.006) in the Chinese non-cancer control group. The study showed that individuals carrying the variant had a 3.14-fold increased risk of developing papillary thyroid cancer compared with non-carriers (95% CI, 1.85-5.32; P = 0.0001) (Table 1).

[0056] Table 1. Carrier frequency of ERCC2 Chr19:45867709 (GRCh37) G>A mutation in Chinese patients with papillary thyroid cancer and Chinese non-tumor individuals

[0057]

[0058] Example 2: A kit for predicting susceptibility to papillary thyroid carcinoma

[0059] The present invention adopts allele-specific PCR (ARMS-PCR) analysis method and PCR sequencing technology to simultaneously detect the genotype of position 45867709 (whose allele site is G / A) in the exon region of the ERCC2 gene.

[0060] A total of 470 patients with papillary thyroid cancer and 2636 Chinese subjects without tumors were selected from Beijing Hospital. Peripheral blood DNA was extracted for genotyping.

[0061] 1. Kit Composition

[0062] The kit contains a primer pair for determining the genotype of the ERCC2 gene 45867709 position, and other ARMS-PCR corresponding reagents. The kit of the present invention is used for 10 people to detect, and is stored at -20°C in the dark. Its components, contents and sources include:

[0063] (1) 10 μL of a mixture of 2× PCR Taq enzyme and buffer;

[0064] (2) 8.4 μL pure water

[0065] (3) 0.15 μL of the F1 primer for detecting the wild-type site, which has the nucleotide sequence shown in SEQ ID NO. 3 and a concentration of 20 pmol / μL;

[0066] (4) 0.15 μL of R1 primer for detecting the wild-type site, which has the nucleotide sequence shown in SEQ ID NO. 4 and a concentration of 20 pmol / μL;

[0067] (5) 0.15 μL of F2 primer for detecting mutant sites, which has the nucleotide sequence shown in SEQ ID NO.5 and a concentration of 20 pmol / μL;

[0068] (6) 0.15 μL of R2 primer for detecting mutant sites, having the nucleotide sequence shown in SEQ ID NO.6 and a concentration of 20 pmol / μL.

[0069] 2. How to use the kit

[0070] (1) Preparation of PCR amplification system:

[0071] The wild-type and mutant partial fragments were amplified by allele-specific PCR. The wild-type reaction system prepared a mixed solution: 10 μL of a mixture of 2×PCR Taq enzyme and buffer; 0.15 μL of the F1 primer used to detect the wild-type site, which was the nucleotide sequence shown in SEQ ID NO.2, with a concentration of 20 pmol / μL; 0.15 μL of the R1 primer used to detect the wild-type site, which was the nucleotide sequence shown in SEQ ID NO.3, with a concentration of 20 pmol / μL; 1 μL of 50 ng / μL genomic DNA, and 8.4 μL of pure water. The mutant reaction system prepared a mixed solution: 10 μL of a mixture of 2×PCR Taq enzyme and buffer; 0.15 μL of F2 primer for detecting mutant sites, which has a nucleotide sequence shown in SEQ ID NO.4 and a concentration of 20 pmol / μL; 0.15 μL of R2 primer for detecting mutant sites, which has a nucleotide sequence shown in SEQ ID NO.5 and a concentration of 20 pmol / μL; 1 μL of 50 ng / μL genomic DNA, and 8.4 μL of pure water.

[0072] (2) ARMS-PCR genotyping

[0073] The ARMS-PCR reaction conditions were 95°C pre-denaturation for 3 min, 95°C denaturation for 20 s, 69°C annealing for 25 s, 72°C extension for 15 s, a total of 47 cycles, and a total extension of 2 min at 72°C. The PCR products were added to the agarose gel wells for electrophoresis separation, and the presence or absence of the 114 bp PCR product fragment in the agarose gel was used to determine whether the sample carried the mutant allele. Figure 2 This is the electrophoresis genotyping diagram of the ERCC2 gene mutation site by ARMS-PCR method

[0074] 3. Sanger sequencing to verify genotype

[0075] The subject's genomic DNA was sequenced and verified, and the Sanger sequencing of the ERCC2, chr19:45867709 (GRCh37) G / A site was detected: the target fragment amplified by the primers was 632 bp in length, and the primer sequences were as follows:

[0076] F3: 5'-GGTGCCCATACTTCCTTGCTCGATACT-3' (SEQ ID No. 7)

[0077] R3: 5'-GCACCGTCTTCTGCAGGGTCTCCA-3' (SEQ ID No. 8)

[0078] Amplify the fragment containing the mutation site by PCR. Prepare the reaction system with a mixed solution: 10 μL of a mixture of 2×PCR Taq enzyme and buffer; 0.15 μL of F3 primer for amplifying the fragment containing the mutation site, which is the nucleotide sequence shown in SEQ ID NO.6, with a concentration of 20 pmol / μL; 0.15 μL of R3 primer for detecting the fragment containing the mutation site, which is the nucleotide sequence shown in SEQ ID NO.7, with a concentration of 20 pmol / μL; 1 μL of 50 ng / μL genomic DNA, and 8.7 μL of pure water.

[0079] The PCR reaction conditions were 95°C pre-denaturation for 3 min, 95°C denaturation for 20 s, 62°C annealing for 25 s, 72°C extension for 15 s, a total of 35 cycles, and 72°C total extension for 2 min. Electrophoresis. The PCR products were sent to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. for Sanger sequencing to determine the genotype.

[0080] IV. Experimental Results

[0081] Figure 2 This is the electrophoresis genotyping diagram of the ERCC2 gene mutation site by the ARMS-PCR method. The ERCC2, chr19:45867709 (GRCh37) G / A site mutation carriers showed a 114 bp wild-type PCR amplification band and a 114 bp mutant PCR amplification band, while the ERCC2, chr19:45867709 (GRCh37) G / A site mutation non-carriers showed a 114 bp wild-type PCR amplification band.

[0082] The ARMS-PCR method was used to genotype the peripheral blood genomic DNA of 470 Chinese patients with papillary thyroid carcinoma and 2636 Chinese controls without tumors. The results showed that 7 of the 470 patients with papillary thyroid carcinoma amplified two bands, indicating that they carried the ERCC2, chr19: 45867709 (GRCh37) G / A site variation, and 10 of the 2636 Chinese controls without tumors amplified two bands, indicating that they carried the ERCC2, chr19: 45867709 (GRCh37) G / A site variation. The remaining individuals only amplified one wild-type band, indicating that they did not carry the ERCC2, chr19: 45867709 (GRCh37) G / A variation site.

[0083] Table 2. Carrier frequency of ERCC2 Chr19:45867709 (GRCh37) G>A mutation in papillary thyroid carcinoma patients and Chinese non-tumor individuals

[0084]

[0085] Figure 3 It is the sequencing map of the ERCC2 gene mutation site. All patients carrying this mutation have double peaks. The test results are consistent with ARMS-PCR. The above experiments prove that the "kit for predicting susceptibility to papillary thyroid cancer" we invented can accurately detect ERCC2, chr19:45867709 (GRCh37) G / A mutation. In addition, according to the experiments in the examples, we found that carrying this mutation can increase the risk of papillary thyroid cancer by 3.97 times (95% CI, 1.50-10.48; P=0.01). Therefore, the "kit for predicting susceptibility to papillary thyroid cancer" of the present invention can be used to predict susceptibility to thyroid cancer.

[0086] The series of detailed descriptions listed above are only specific descriptions of feasible implementation methods of the present invention. They are not intended to limit the scope of protection of the present invention. Those skilled in the art can design many other modifications and implementation methods, which will fall within the scope and spirit of the principles disclosed in this application. More specifically, within the scope of the disclosure, drawings and claims of this application, various modifications and improvements can be made to the components and / or layout of the subject combination layout. In addition to the modifications and improvements made to the components and / or layout, other uses will also be obvious to those skilled in the art.

Claims

1. A kit for predicting susceptibility to papillary thyroid carcinoma, characterized in that: Contains specific primers and PCR reaction reagents for detecting mutation sites in the exon region of the thyroid papillary carcinoma susceptibility gene.

2. A kit for predicting susceptibility to papillary thyroid carcinoma according to claim 1, characterized in that: The mutation site is: ERCC2, chr19:45867709 (GRCh37) G / A site.

3. A kit for predicting susceptibility to papillary thyroid carcinoma according to claim 2, characterized in that: The nucleotide sequence where the variation site is located has the nucleotide sequence shown in the sequence table SEQ ID No.

1.

4. A kit for predicting susceptibility to papillary thyroid carcinoma according to claim 1, characterized in that: The primers have nucleotide sequences shown in SEQ ID No. 2 to SEQ ID No. 5 in the sequence listing.

5. The kit for predicting susceptibility to papillary thyroid carcinoma according to claim 1, characterized in that: The PCR reaction reagents are composed of the following reagents: (1) 10 μL of a mixture of 2× PCR Taq enzyme and buffer; (2) 8.4 μL pure water (3) 0.15 μL of the F1 primer for detecting the wild-type site, which has the nucleotide sequence shown in SEQ ID NO. 2 and a concentration of 20 pmol / μL; (4) 0.15 μL of R1 primer for detecting the wild-type site, which has the nucleotide sequence shown in SEQ ID NO. 3 and a concentration of 20 pmol / μL; (5) 0.15 μL of F2 primer for detecting mutant sites, which has the nucleotide sequence shown in SEQ ID NO. 4 and a concentration of 20 pmol / μL; (6) 0.15 μL of R2 primer for detecting mutant sites, having the nucleotide sequence shown in SEQ ID NO.5 and a concentration of 20 pmol / μL.

Images