Method for improving luminous intensity of plants by introducing exogenous caffeic acid synthesis pathway

Abstract

The invention relates to a method for improving luminous intensity of a plant by introducing an exogenous caffeic acid synthesis pathway. A TAL gene and a P450 gene are introduced into a plant body to obtain a remarkable effect of increasing the expression quantity of caffeic acid. Due to the fact that introduction of the TAL gene and the P450 gene promotes deamination of the L-DOPA, the accumulation amount of the L-DOPA is increased, and then the expression amount of caffeic acid in the plant is effectively increased. Based on the pathway, the synthesis of fluorescein in the plant is increased, so that the luminous intensity of the plant is enhanced.

Description

Technical Field

[0001] The invention belongs to the technical field of synthetic biology and relates to a method for introducing an exogenous caffeic acid synthesis pathway to improve the luminescence intensity of plants. Background Art

[0002] The process of catalyzing the formation of fluorescein using caffeic acid as substrate is as follows:

[0003] Step 1: Caffeic acid reacts with propionyl-CoA to form milk lysine

[0004] Catalytic enzyme: Hispidin Synthase (Hisps)

[0005] Reaction description: Caffeic acid combines with propionyl-CoA to generate hispidin under the catalysis of hispidin synthase.

[0006] Caffeic acid + 2-propionyl-CoA + 2ATP → milk echinopsine + 2CO 2 +H 2 O+2AMP

[0007] Step 2: Hydroxylation of galactose to form 3-hydroxygalactose

[0008] Catalytic enzyme: Hispidin Hydroxylase (H3H)

[0009] Reaction description: Milk tree hydroxylase reacts with milk tree hydroxylation to generate 3-hydroxy milk tree

[0010] Milk tree alkaloids + O 2 +NADPH+H + →3-Hydroxymilk echinopsin + H 2 O+NADP +

[0011] Step 3: Oxidation of 3-hydroxylactine to form caffeoylpyruvate

[0012] Catalytic enzyme: Luciferase (LUZ)

[0013] Reaction description: 3-Hydroxylactocin is oxidized to generate luciferin under the catalysis of luciferase, accompanied by luminescence.

[0014]

[0015] Through these three steps, caffeic acid and pyruvate are converted into caffeoylpyruvate through enzymatic reactions to achieve bioluminescence.

[0016] Step 4: Oxidation of 3-hydroxylactine to form caffeoylpyruvate

[0017] Catalytic enzyme: caffeoyl pyruvate hydrolase (CPH)

[0018] Reaction description: Caffeoylpyruvate generates caffeic acid under the catalysis of caffeoylpyruvate hydrolase, thereby realizing the regeneration of caffeic acid and achieving the purpose of cyclic luminescence.

[0019] Caffeoylpyruvate + H 2 O→caffeic acid + pyruvic acid.

[0020] This process has been applied in fungi and transgenic plants. Caffeic acid is an important substrate for catalyzing the production of luciferin. The sufficiency of caffeic acid supply is directly related to the luminescence intensity of luminescent plants. When the endogenous caffeic acid supply of plants is insufficient, the luminescence intensity is greatly reduced.

[0021] The biosynthetic pathway of caffeic acid can be divided into two modules (e.g. Figure 1 shown):

[0022] (1) L-tyrosine is synthesized from carbon sources through the glycolysis pathway, pentose phosphate pathway, and shikimate pathway ( Figure 1 Middle A);

[0023] (2) Caffeic acid is produced by the sequential deamination and hydroxylation of L-tyrosine. Figure 1 (middle B).

[0024] Since the endogenous caffeic acid content in plants is very low, and caffeic acid is the substrate for plant luminescence, the luminescence intensity is affected by the endogenous caffeic acid in the plant and the luminescence intensity is average. Summary of the invention

[0025] In view of this, the object of the present invention is to provide a method for introducing exogenous caffeic acid synthesis pathway to increase the luminescence intensity of plants.

[0026] In order to achieve the above object, the present invention provides the following technical solutions:

[0027] A method for introducing an exogenous caffeic acid synthesis pathway to improve the luminescence intensity of a plant, wherein a TAL gene (from Flavobacterium johnsoniae) and a P450 gene (from Beta vulgaris) are introduced into the plant, the nucleotide sequence of the TAL gene is shown in SEQ ID NO.1, and the nucleotide sequence of the P450 gene is shown in SEQ ID NO.2.

[0028] As one of the preferred technical solutions, the plant is Nicotiana benthamiana.

[0029] As one of the preferred technical solutions, the specific steps are as follows:

[0030] (1) Gene cloning and vector construction: Luz gene, H3H gene, CPH gene, HispS gene, TAL gene, and P450 gene were connected to the pCAMBIA2300 vector;

[0031] (2) Transformation and screening;

[0032] (3) Agrobacterium transformation;

[0033] (4) Plant transformation.

[0034] As one of the further preferred technical solutions, the specific method of step (1) is:

[0035] (1-1) Design primers and use high-fidelity polymerase to amplify the gene by PCR;

[0036] (1-2) Double restriction enzyme digestion, ligation reaction, and vector transformation into Escherichia coli.

[0037] As one of the further preferred technical solutions, in step (1-1), the primers are as follows:

[0038] Public-F: ACAGCTATGACCATGATTACGAATTC, as shown in SEQ ID NO. 3;

[0039] Public-R: AGTCACGACGTTGTAAAACGACGG, as shown in SEQ ID NO.4.

[0040] As one of the further preferred technical solutions, in step (1-1), the PCR amplification system and reaction conditions are shown in Table 1.

[0041] Table 1. Gene cloning reaction system

[0042]

[0043] After the PCR reaction, the DNA was excised and recovered according to the instructions of the Novagen gel recovery kit. The recovered product was sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing to determine the gene sequence. The primer sequences and detection sequences are shown in Table 2.

[0044] Table 2. Primer sequences and detection sequences

[0045]

[0046] As one of the further preferred technical solutions, in step (1-2), double enzyme digestion is performed using restriction endonucleases EcoRI and HindIII.

[0047] As one of the further preferred technical solutions, in step (1-2), the amplified gene is connected to the enzyme-cut vector using a seamless cloning kit, and each gene carries a 35S promoter and a CaMV poly (A) terminator.

[0048] As one of the further preferred technical solutions, in step (1-2), the ligation product is transformed into competent Escherichia coli DH5α by heat shock method, and positive clones are screened on LB plates containing 50 mg / L Kan.

[0049] As one of the further preferred technical solutions, the specific method of step (2) is:

[0050] (2-1) E. coli culture: Select positive clones and culture them in liquid culture using 10 ml of LB containing 50 mg / L kan;

[0051] (2-2) Plasmid extraction: Use a plasmid extraction kit to extract the recombinant plasmid;

[0052] (2-3) Plasmid storage: The plasmid was frozen and stored in a refrigerator at -20°C for future use.

[0053] As one of the further preferred technical solutions, the specific method of step (3) is:

[0054] (3-1) Transform the plasmid into Agrobacterium GV3101 competent cells;

[0055] (3-2) Screening of transformed Agrobacterium: The transformed Agrobacterium was screened on YEP plates containing antibiotics (50 mg / L Kan, 25 mg / L Rif, 50 mg / L Gen).

[0056] As one of the further preferred technical solutions, the specific method of step (4) is:

[0057] (4-1) Plant material preparation: Select tobacco leaves suitable for transformation and cut them into pieces of 0.5 cm*0.5 cm in size;

[0058] (4-2) Leaf disc transformation: Soak plant leaf discs in Agrobacterium suspension at 28°C for 30 min and then transfer to co-cultivation medium;

[0059] (4-3) Co-cultivation and screening: Culture in co-cultivation medium at 28°C in the dark for 2 days, then transfer to selection medium containing selective antibiotics;

[0060] (4-4) Regeneration and rooting: After about 2-3 weeks, resistant shoots are selected and induced to root in rooting medium;

[0061] (4-5) Transplantation and growth of tobacco: Transplant the rooted tobacco into the soil and manage it in a greenhouse with a light intensity of 6000 Lx and 16 h / day;

[0062] (4-6) Transgenic identification: The transplanted tobacco was sampled and DNA was extracted using the CTAB method and PCR positive identification was performed.

[0063] As one of the further preferred technical solutions, in step (4-6), the reaction system and reaction conditions for PCR positive identification are shown in Table 3.

[0064] Table 3. Transgenic identification

[0065]

[0066] The beneficial effects of the present invention are:

[0067] Since the endogenous caffeic acid content in plants is very low, and caffeic acid is the substrate for plant luminescence, the luminescence intensity is affected by the endogenous caffeic acid in plants. Introducing an exogenous caffeic acid synthesis pathway can enhance the synthesis of caffeic acid, thereby increasing the concentration of luminescent substrates and thus enhancing the luminescence intensity of plants.

[0068] In order to increase the expression of caffeic acid in plants to achieve better luminescence effect, the present invention introduces an additional caffeic acid synthesis pathway in addition to the caffeic acid synthesized by the plant itself, thereby increasing the content of caffeic acid, which is crucial in the synthesis of luciferin, and thus improving the luminescence intensity.

[0069] Specifically, the present invention introduces TAL genes and P450 genes. The applicant has found that, compared with the introduction of TAL genes or P450 genes alone, the simultaneous introduction of TAL genes and P450 genes into plants achieves a significant effect of increasing the expression of caffeic acid. This may be because the introduction of TAL genes and P450 genes promotes the deamination of L-DOPA, increases the accumulation of L-DOPA, and effectively increases the expression of caffeic acid in plants. Based on this pathway, the synthesis of luciferin in plants is increased to enhance the luminescence intensity of plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:

[0071] Figure 1The biosynthetic pathway of caffeic acid, wherein A: L-tyrosine is synthesized from carbon sources through glycolysis pathway, pentose phosphate pathway and shikimate pathway; B: Caffeic acid is generated by the continuous deamination and hydroxylation of L-tyrosine;

[0072] Figure 2 Caffeic acid content (A) and relative luminescence intensity (B) after different genes were introduced;

[0073] Figure 3 These are photos of luminescence of plants introduced with different genes, among which A is luminescence, B is luminescence + P450, C is luminescence + TAL, and D is luminescence + P450 + TAL.

[0074] Figure 4 is the gene structure, where A is FBP, B is FBP+P450, C is FBP+TAL, and D is FBP+TAL+P450.

[0075] Figure 5 This is the DNA map of the pCAMBIA2300 vector.

[0076] Figure 6 This is the T-DNA map of the constructed vector, where A is FBP, B is FBP+P450, C is FBP+TAL, and D is FBP+TAL+P450. DETAILED DESCRIPTION

[0077] The preferred pCAMBIA2300-FBP+P450 vector construction embodiment of the present invention will be described in detail below with reference to the accompanying drawings.

[0078] Example:

[0079] 1. Gene cloning and vector construction

[0080] Gene synthesis and acquisition: The sequences of Luz gene (SEQ ID NO.5), H3H gene (SEQ ID NO.6), CPH gene (SEQ ID NO.7), HispS gene (SEQ ID NO.8, SEQ ID NO.9 connected in sequence), TAL gene (SEQ ID NO.1), and P450 gene (SEQ ID NO.2) were obtained by gene synthesis (Beijing Qingke Biotechnology Co., Ltd.), and primers were designed to connect the genes to the pCAMBIA2300 vector (purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd., DNA map see Figure 5 ) above, 2× high-fidelity PCR mix was purchased from Nanjing Novozyme Biotechnology Co., Ltd. (Cat. No.: P520-01).

[0081] PCR amplification: Use high-fidelity polymerase to perform PCR amplification on the gene. See Table 1 for details, where seq1 is the FBP luminescence gene cluster + P450 gene + TAL gene.

[0082] After the PCR reaction, the DNA was excised and recovered according to the instructions of the Novagen gel recovery kit. The recovered product was sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing to determine the gene sequence. See Table 2 for details.

[0083] Double digestion: pCAMBIA2300 vector was double digested with restriction endonucleases EcoRI and HindIII (the endonucleases were purchased from New England Biolabs). (Table 4)

[0084] Table 4. pCAMBIA2300 vector double restriction enzyme digestion

[0085]

[0086]

[0087] Ligation reaction: A seamless cloning kit (purchased from Beijing Biomed Gene Technology Co., Ltd.) was used to connect the amplified gene with the restriction-digested vector. Each gene carries a 35S promoter and a CaMV poly(A) terminator.

[0088] Vector transformation of Escherichia coli: The ligation product was transformed into competent Escherichia coli DH5α (purchased from Beijing Bomade Gene Technology Co., Ltd.) using the heat shock method, and positive clones were screened on LB plates containing 50 mg / L.

[0089] The synthetic FBP+TAL+P450, the nucleotide sequence is SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21 connected in sequence, the gene structure is as follows Figure 4 As shown in D.

[0090] The constructed vector T-DNA sequence is SEQ ID NO.33, SEQ ID NO.34, SEQ ID NO.35, and SEQ ID NO.36 connected in sequence, as shown in the diagram Figure 6 As shown in D.

[0091] 2. Conversion and screening

[0092] E. coli culture: Select positive clones and culture them in liquid form using 10 ml of LB containing 50 mg / L kan.

[0093] Plasmid extraction: The recombinant plasmid was extracted using a plasmid extraction kit (the kit was purchased from Nanjing Novozyme Biotechnology Co., Ltd.).

[0094] Plasmid storage: Freeze the plasmid in a refrigerator at -20℃ for future use.

[0095] 3. Bacterial testing and Agrobacterium transformation

[0096] Transformation of Agrobacterium: The plasmid was transformed into Agrobacterium GV3101 competent cells (purchased from Beijing Bomade Gene Technology Co., Ltd.) according to the instruction manual.

[0097] Screening of transformed Agrobacterium: The transformed Agrobacterium was screened on YEP plates containing antibiotics (50 mg / L Kan + 50 mg / L Gen + 25 mg / L Rif) (Kan, kanamycin, Gen, gentamicin, Rif, rifampicin, all purchased from Beijing Coolbo Technology Co., Ltd.).

[0098] Agrobacterium culture and suspension preparation: Select positive Agrobacterium clones for liquid culture, and adjust the concentration of the suspension to OD 0. 600 =0.6-0.8.

[0099] 4. Plant transformation

[0100] Preparation of plant materials: Select tobacco leaves suitable for transformation and cut them into 0.5 cm*0.5 cm size.

[0101] Leaf disc transformation: Soak plant leaf discs in Agrobacterium suspension at 28°C for 30 min and then transfer to co-cultivation medium (MS + 1 mg / L 6-BA + 30 g / L sucrose + 6 g / L agar powder + 100 μM acetosyringone, pH 5.8).

[0102] Co-cultivation and screening: Culture in the dark at 28°C on co-cultivation medium for 2 days, and then transfer to selection medium (MS + 1 mg / L 6-BA + 30 g / L sucrose + 6 g / L agar powder + 100 mg / L Kan, pH 5.8) containing selective antibiotics.

[0103] Regeneration and rooting: After about 2-3 weeks, resistant shoots were screened and induced to root in rooting medium (MS + 0.1 mg / L NAA + 30 g / L sucrose + 6 g / L agar powder + 100 mg / L Kan, pH 5.8).

[0104] Transplantation and growth of tobacco: The rooted tobacco was transplanted into soil (peat soil: vermiculite: perlite = 5:3:1) and managed in a greenhouse with a light intensity of 6000Lx and 16h / day.

[0105] Transgenic identification: The transplanted tobacco was sampled and DNA was extracted using the CTAB method, and PCR positive identification was performed. (Table 3)

[0106] Comparative Example 1:

[0107] Gene synthesis and acquisition: The sequences of Luz gene, H3H gene, CPH gene and HispS gene were obtained by gene synthesis, and primers were designed to connect the genes to the pCAMBIA2300 vector (purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd.). 2× high-fidelity PCR mix was purchased from Nanjing Novogene Biotechnology Co., Ltd. (Cat. No.: P520-01).

[0108] During PCR amplification, in Table 1, seq1 is the FBP luminescent gene cluster.

[0109] The synthetic FBP has a nucleotide sequence of SEQ ID NO.10 and SEQ ID NO.11 connected in sequence, and a gene structure of Figure 4 As shown in A.

[0110] The constructed vector T-DNA sequence is SEQ ID NO.22, SEQ ID NO.23, and SEQ ID NO.24 connected in sequence, as shown in the diagram Figure 6 As shown in A.

[0111] The rest is the same as the embodiment.

[0112] Comparative Example 2:

[0113] Gene synthesis and acquisition: The sequences of Luz gene, H3H gene, CPH gene, HispS gene, and P450 gene were obtained by gene synthesis, and primers were designed to connect the genes to the pCAMBIA2300 vector (purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd.). 2× high-fidelity PCR mix was purchased from Nanjing Novogene Biotechnology Co., Ltd. (Cat. No.: P520-01).

[0114] During PCR amplification, in Table 1, seq1 is the FBP luminescent gene cluster + P450 gene.

[0115] The synthetic FBP+P450, the nucleotide sequence is SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14 connected in sequence, the gene structure is as follows Figure 4 As shown in B.

[0116] The constructed vector T-DNA sequence is SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, and SEQ ID NO.28 connected in sequence, as shown in the map. Figure 6 As shown in B.

[0117] The rest is the same as the embodiment.

[0118] Comparative Example 3:

[0119] Gene synthesis and acquisition: The sequences of Luz gene, H3H gene, CPH gene, HispS gene and TAL gene were obtained by gene synthesis, and primers were designed to connect the genes to the pCAMBIA2300 vector (purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd.). 2× high-fidelity PCR mix was purchased from Nanjing Novogene Biotechnology Co., Ltd. (Cat. No.: P520-01).

[0120] During PCR amplification, in Table 1, seq1 is the FBP luminescent gene cluster + TAL gene.

[0121] The synthetic FBP+TAL, the nucleotide sequence is SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17 connected in sequence, the gene structure is as follows Figure 4 As shown in C.

[0122] The constructed vector T-DNA sequence is SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, and SEQ ID NO.32 connected in sequence, as shown in the diagram Figure 6 As shown in C.

[0123] The rest is the same as the embodiment.

[0124] Experimental Results

[0125] 1. Caffeic acid content detection

[0126] Leaves of wild-type tobacco and transgenic plants were collected. Immediately after collection, the samples were frozen in liquid nitrogen, ground, and about 1 g of frozen tissue was placed in a 50 ml centrifuge tube for freeze drying, and the freeze-dried material was stored at -20°C. Each sample was prepared and analyzed three times.

[0127] About 50 mg of lyophilized powder was weighed, treated with 7 ml of 70% methanol aqueous solution in an ultrasonic bath for 30 minutes, and then centrifuged at 4,000 rpm for 10 minutes. The supernatant was collected, filtered with a Phenex GF / PVDF syringe filter (30 mm in diameter, 0.45 μm in pore size), and then analyzed on an LCMS instrument. The analysis was performed by a Shimadzu 8030 system consisting of HPLC coupled to a PDA and a triple quadrupole mass spectrometer (HPLC-DAD-ESI-TQ MS). Chromatographic separation was performed on a Discovery C18 column 4.6×150 mm, 5 μm in gradient mode with mobile phase components A (0.3% acetic acid aqueous solution) and B (acetonitrile). The gradient run was as follows: 0-4 minutes 10-40% B, 4-5 minutes 40-80%, 5-10.5 minutes, isocratic elution with 100% B, and then returned to the initial conditions. The column temperature was 40°C, the flow rate was 1 ml / min, and the injection volume was 20 μl.

[0128] Test results see Figure 2 In Figure A, the results show that adding TAL or P450 genes alone cannot increase the caffeic acid content in plants. Only when TAL and P450 genes exist together can the caffeic acid content in plants be significantly increased.

[0129] 2. Luminescence detection

[0130] The transgenic plants of Example and Comparative Examples 1 to 3 were cultured to maturity, and a LightScout full-spectrum photon meter (Shanghai Zequan Technology) was used to align the detection port with the tobacco leaves to be detected (close to the tobacco leaves) in a dark environment to detect the photon accumulation at different times. Experimental results ( Figure 2 Middle B, Figure 3 ) showed that transgenic plants with the introduction of exogenous caffeic acid synthesis pathway showed significantly enhanced luminescence intensity, which was at least 3 times higher than that of non-transgenic control plants (shooting conditions: Huawei P30 Pro, ISO 6400, time-lapse photography 2s, aperture 1.6mm).

[0131] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.

Claims

1. A method for introducing an exogenous caffeic acid synthesis pathway to increase the luminescence intensity of plants, characterized in that: The TAL gene and the P450 gene are introduced into the plant body, the nucleotide sequence of the TAL gene is shown as SEQ ID NO.1, and the nucleotide sequence of the P450 gene is shown as SEQ ID NO.

2.

2. The method according to claim 1, characterized in that The specific steps are as follows: (1) Gene cloning and vector construction: Luz gene, H3H gene, CPH gene, HispS gene, TAL gene, and P450 gene were connected to the pCAMBIA2300 vector; (2) Transformation and screening; (3) Agrobacterium transformation; (4) Plant transformation.

3. The method according to claim 2, characterized in that The specific method of step (1) is: (1-1) Design primers and use high-fidelity polymerase to amplify the gene by PCR; (1-2) Double restriction enzyme digestion, ligation reaction, and vector transformation into Escherichia coli.

4. The method according to claim 3, characterized in that In step (1-1), the primers are as follows: Public-F: ACAGCTATGACCATGATTACGAATTC, as shown in SEQ ID NO. 3; Public-R: AGTCACGACGTTGTAAAACGACGG, as shown in SEQ ID NO.

4.

5. The method according to claim 3, characterized in that: In step (1-2), double digestion is performed using restriction endonucleases EcoRI and HindIII.

6. The method according to claim 3, characterized in that In step (1-2), the amplified gene is ligated to the restriction-cut vector using a seamless cloning kit, and each gene carries a 35S promoter and a CaMV poly(A) terminator.

7. The method according to claim 3, characterized in that In step (1-2), the ligation product was transformed into competent Escherichia coli DH5α by heat shock method, and positive clones were screened on LB plates containing 50 mg / L kan.

8. The method according to claim 2, characterized in that: The specific method of step (2) is: (2-1) E. coli culture: Select positive clones and culture them in liquid culture using 10 ml of LB containing 50 mg / L kan; (2-2) Plasmid extraction: Use a plasmid extraction kit to extract the recombinant plasmid; (2-3) Plasmid storage: The plasmid was frozen and stored in a refrigerator at -20°C for future use.

9. The method according to claim 2, characterized in that: The specific method of step (3) is: (3-1) Transform the plasmid into Agrobacterium GV3101 competent cells; (3-2) Screening of transformed Agrobacterium: The transformed Agrobacterium was screened on YEP plates containing antibiotics.

10. The method according to claim 2, characterized in that The specific method of step (4) is: (4-1) Plant material preparation: Select tobacco leaves suitable for transformation and cut them into pieces of 0.5 cm*0.5 cm in size; (4-2) Leaf disc transformation: Soak plant leaf discs in Agrobacterium suspension at 28°C for 30 min before transferring to co-cultivation medium; (4-3) Co-cultivation and screening: Culture in the co-cultivation medium at 28°C in the dark for 2 days, then transfer to a selection medium containing selective antibiotics; (4-4) Regeneration and rooting: After about 2-3 weeks, resistant shoots are selected and induced to root in rooting medium; (4-5) Transplantation and growth of tobacco: Transplant the rooted tobacco into the soil and manage it in a greenhouse with a light intensity of 6000 Lx and 16 h / day; (4-6) Transgenic identification: The transplanted tobacco was sampled and DNA was extracted using the CTAB method and PCR positive identification was performed.

Images